Novel therapeutic agent for parkinson's disease

Abstract

The present application relates to a novel therapeutic agent for Parkinson's disease and a method for treating Parkinson's disease by using same.

Description

Novel Parkinson's disease treatment

[0001] Some embodiments of the present application relate to compositions for treating Parkinson's disease.

[0002] Some embodiments of the present application relate to methods for treating Parkinson's disease.

[0003]

[0004] Parkinson's disease is a brain disorder that causes involuntary or uncontrollable movements, such as tremors, rigidity, and difficulties with balance and coordination. Parkinson's disease is classified as a neurodegenerative disease. Damage or degeneration (death or loss of function of dopaminergic neurons) of the substantia nigra is known to play a major role in the onset or progression of Parkinson's disease. Parkinson's disease is known to affect both the motor and non-motor systems. Movement disorders characterized by classic parkinsonian motor symptoms are known to be caused by dopamine deficiency in the basal ganglia, and damage to dopaminergic neurons in the substantia nigra is known to result in dopamine deficiency in the basal ganglia.

[0005] Meanwhile, NDST3, also known as N-Deacetylase and N-sulfotransferase 3, is a protein known to catalyze the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate (HS) and heparin. In humans, the human NDST3 protein is encoded by the human NDST3 gene, which is known to be located at the chromosome location of 4q26. The therapeutic effect of the NDST3 protein or the nucleic acid encoding it on Parkinson's disease is not yet known.

[0006]

[0007] The need to discover substances with therapeutic effects on Parkinson's disease has persisted in the field since the disease was discovered, and continues to exist today. The present application provides a novel Parkinson's disease treatment and a method for treating Parkinson's disease using the same.

[0008]

[0009] Some embodiments of the present application provide novel therapeutic agents for Parkinson's disease.

[0010] Some embodiments of the present application provide a pharmaceutical composition for treating Parkinson's disease, comprising an NDST3 protein or a nucleic acid encoding the same.

[0011] Some embodiments of the present application provide a pharmaceutical composition for treating Parkinson's disease, comprising a vector comprising a nucleic acid encoding an NDST3 protein.

[0012] Some embodiments of the present application provide a method for treating Parkinson's disease in a subject, comprising: administering to the subject a pharmaceutical composition for treating Parkinson's disease according to some embodiments of the present application.

[0013]

[0014] The composition for treating Parkinson's disease of the present application has the effect of treating Parkinson's disease. The method for treating Parkinson's disease of the present application can treat Parkinson's disease in a subject.

[0015]

[0016] Figure 01 shows a schematic diagram of a carrier plasmid having a sequence encoding human NDST3 protein.

[0017] Figure 02 shows a schematic diagram of the nucleic acid contained in an AAV vector encoding Ndst3.

[0018] Figure 03 shows a schematic representation of the nucleic acid contained in an AAV vector encoding Ndst3 for administration to humans.

[0019] Figure 04 is a schematic diagram of a nucleic acid contained in an AAV vector encoding Ndst3. The nucleic acid depicted in the schematic diagram in Figure 04 includes an NG2 promoter.

[0020] Figure 05 depicts a schematic representation of a nucleic acid sequence contained in an AAV vector encoding Ndst3 for human administration. The nucleic acid sequence depicted in the schematic representation in Figure 05 includes an NG2 promoter.

[0021] Figure 06 shows the in vitro results of immunofluorescence staining of neuronal markers (TUJ1, MAP2) in the control group, 6-OHDA treatment group, and Ndst3 treatment group.

[0022] Figure 07 shows a graph that numerically shows the results of immunofluorescence staining of neuronal markers (TUJ1, MAP2) in the control group, 6-OHDA treatment group, and Ndst3 treatment group (** p<0.01).

[0023] Figure 8 shows the in vitro results confirming the dopaminergic neuron marker (TH) of the control group, the 6-OHDA treatment group, and the Ndst3 treatment group. Figure 8A shows the results of confirming the expression of the neuron marker (TH) of the control group, the 6-OHDA treatment group, and the Ndst3 treatment group through Western blotting, and Figure 8B is a graph that numerically expresses the results of Figure 8A.

[0024] Figure 09 shows the results of analyzing the action potential (AP) of the control group, 6-OHDA treatment group, and Ndst3 treatment group.

[0025] Figure 10 shows the results of analyzing the action potential firing rate (AP firing rate) of the control group, 6-OHDA treatment group, and Ndst3 treatment group (* p<0.05, ** p<0.01).

[0026] Figure 11 shows the results of analyzing the resting membrane potential of the control group, 6-OHDA treatment group, and Ndst3 treatment group (* p<0.05, ** p<0.01).

[0027] Figure 12 shows the results of confirming the expression of a dopaminergic neuron marker (TH) by immunofluorescence staining after treating a 6-OHDA-induced Parkinson's disease mouse model with Ndst3.

[0028] Figure 13 is a graph that numerically shows the results of confirming the expression of dopaminergic neuron marker (TH) related to Figure 12 (** p<0.01).

[0029] Figure 14 shows the results of confirming the expression of dopaminergic neuron markers (TH) in the substantia nigra (SN) and striatum (ST) by immunostaining (DAB staining) after treating a 6-OHDA-induced Parkinson's disease mouse model with Ndst3.

[0030] Figure 15 is a graph that numerically shows the results of confirming the expression of dopaminergic neuron marker (TH) related to Figure 14 (** p<0.01).

[0031] Figure 16 shows the results of confirming the expression of dopaminergic neuron markers (TH) in the lateral substantia nigra (SNL), substantia nigra pars compacta (SNc), and ventral tegmental area (VTA) by immunostaining (DAB staining) after treating a 6-OHDA-induced Parkinson's mouse model with Ndst3.

[0032] Figure 17 is a graph that numerically shows the results of confirming the expression of dopaminergic neuron marker (TH) related to Figure 16 (* p<0.05, ** p<0.01).

[0033] Figure 18 shows the results of confirming the expression of a dopaminergic neuron marker (DAT) in the substantia nigra (SN) by immunostaining (DAB staining) after treating a 6-OHDA-induced Parkinson's mouse model with Ndst3.

[0034] Figure 19 is a graph that numerically shows the results of confirming the expression of a dopaminergic neuron marker (DAT) related to Figure 18 (** p<0.01).

[0035] Figure 20 shows the results of confirming the expression of Ndst3 through qRT-PCR after treating Ndst3 in a 6-OHDA-induced Parkinson's mouse model (** p<0.01).

[0036] Figure 21 shows the results of confirming the expression of dopaminergic neuron markers (TH) in the striatum (ST) and substantia nigra (SN) by immunostaining (DAB staining) after treating Ndst3 in a Parkinson's mouse model induced by MPTP.

[0037] Figure 22 is a graph that quantifies the results related to Figure 21 (** p<0.01).

[0038] Figure 23 shows the results of confirming the expression of a dopaminergic neuron marker (DAT) in the substantia nigra (SN) by immunostaining (DAB staining) after treating a Parkinson's mouse model induced by MPTP with Ndst3.

[0039] Figure 24 is a graph that quantifies the results related to Figure 23 (** p<0.01).

[0040] Figure 25 shows the results of the rotational test of mice in each group (6-OHDA treatment group, Ndst3 treatment group, etc.). Figure 25A is a photograph of mice in each group undergoing the rotational test. Figure 25B is a graph quantifying the results of the rotational test (* p<0.05).

[0041] Figure 26 shows the results of the tail suspension test of mice in each group (6-OHDA treatment group, Ndst3 treatment group, etc.). Figure 26A is a photograph of the tail suspension test performed on mice in each group. Figure 26B is a graph quantifying the results of the tail suspension test (* p<0.05).

[0042] Figure 27 shows the results of the cylinder test in mice following intrathecal injection (ICM injection) of Ndst3. Specifically, Figure 27 shows the results of the mouse cylinder test for each group (6-OHDA treatment group, Ndst3 treatment group, etc.). Figure 27A is a graph quantifying the number of times each group used the ipsilateral forelimb. Figure 27B is a graph quantifying the number of times each group used the contralateral forelimb.

[0043]

[0044] Some embodiments of the present application provide a pharmaceutical composition for treating Parkinson's disease, comprising a vector comprising a nucleic acid encoding an NDST3 protein.

[0045] In some embodiments, the vector may be a viral vector.

[0046] In a particular embodiment, the viral vector may be any one of a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus, a vaccinia virus, a poxvirus, a human immunodeficiency virus (HIV), a murineleukemia virus (MLV), an avian sarcoma / leukosis virus (ASLV), a spleen necrosis virus (SNV), a rou sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a herpes simplex virus, an epizomal virus, and a herpes simplex virus.

[0047] In certain embodiments, the viral vector may be an adeno-associated virus (AAV) vector.

[0048] In a particular embodiment, the AAV can be any one selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0049] In certain embodiments, the AAV may be AAV9.

[0050] In some embodiments, the vector may be a non-viral vector.

[0051] In certain embodiments, the non-viral vector may be any one selected from a plasmid, a phage, naked DNA, a DNA-RNA lipid complex, a liposome, a nanoparticle, a DNA-polymer complex, mRNA, an artificial chromosome, and a cosmid.

[0052] In some embodiments, the pharmaceutical composition may further comprise one or more pharmaceutically acceptable additional components.

[0053] In certain embodiments, the pharmaceutically acceptable additional components may each independently be any one selected from a carrier, an excipient, a diluent, and a preservative.

[0054] In some embodiments, the NDST3 protein may be a human NDST3 protein.

[0055] In some embodiments, the human NDST3 protein can be a wild-type human NDST3 protein or a variant thereof.

[0056] In a specific embodiment, the human NDST3 protein may have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% and less than 100% sequence identity thereto.

[0057] In a specific embodiment, the human NDST3 protein may have the amino acid sequence of SEQ ID NO: 01.

[0058] In certain embodiments, the human NDST3 protein can be a wild-type human NDST3 protein or a functional equivalent thereof.

[0059] In a particular embodiment, the human NDST3 protein can be a variant of a wild-type human NDST3 protein, wherein the variant of the wild-type NDST3 protein can comprise a conservative substitution of one or more amino acid residues from the wild-type human NDST3 protein having the amino acid sequence of SEQ ID NO: 01, such that the human NDST3 protein can have an amino acid sequence having at least 80% and less than 100% sequence identity with the amino acid sequence of the wild-type human NDST3 protein.

[0060] In some embodiments, the nucleic acid encoding the NDST3 protein may comprise an NDST3 protein coding region, wherein the NDST3 protein coding region may have a nucleic acid sequence encoding the NDST3 protein.

[0061] In certain embodiments, the nucleic acid sequence encoding the NDST3 protein may be a DNA sequence, an RNA sequence, or a DNA / RNA hybrid sequence.

[0062] In a specific embodiment, the nucleic acid sequence encoding the NDST3 protein may be a full-length sequence of the NDST3 gene, an ORF (open reading frame) sequence of the NDST3 gene, a CDS (coding sequence) of the NDST3 gene, or a cDNA sequence of the NDST3 gene.

[0063] In a specific embodiment, the nucleic acid sequence encoding the NDST3 protein may be a full-length sequence of a wild-type human NDST3 gene, an ORF sequence of a wild-type human NDST3 gene, a CDS of a wild-type human NDST3 gene, or a cDNA sequence of a wild-type human NDST3 gene.

[0064] In a specific embodiment, the nucleic acid sequence encoding the NDST3 protein may be a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having at least 80% and less than 100% sequence identity thereto.

[0065] In a specific embodiment, the nucleic acid sequence encoding the NDST3 protein may be the nucleic acid sequence of SEQ ID NO: 07.

[0066] In certain embodiments, the nucleic acid encoding the NDST3 protein may further comprise one or more additional elements.

[0067] In certain embodiments, each of the one or more additional elements can independently be any one selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), a nuclear localization signal coding sequence, and 2A self-cleaving peptides.

[0068] In a particular embodiment, the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

[0069] In a specific embodiment, the promoter may be an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

[0070]

[0071] Some embodiments of the present application provide a pharmaceutical composition for treating Parkinson's disease, comprising:

[0072] Viral vector encoding NDST3 protein,

[0073] At this time, the viral vector encoding the NDST3 protein contains a nucleic acid encoding the NDST3 protein.

[0074] In some embodiments, the NDST3 protein may have an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% and less than 100% sequence identity thereto.

[0075] In some embodiments, the nucleic acid encoding the NDST3 protein comprises an NDST3 protein coding region, wherein the NDST3 protein coding region may have a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having at least 80% and less than 100% sequence identity thereto.

[0076] In a particular embodiment, the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

[0077] In a specific embodiment, the promoter may be an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

[0078] In some embodiments, the viral vector may be an AAV vector.

[0079] In some embodiments, the viral vector may be an AAV9 vector.

[0080]

[0081] Some embodiments of the present application provide a method for treating Parkinson's disease in a subject comprising:

[0082] Administering to a subject a pharmaceutical composition for treating Parkinson's disease according to some embodiments of the present application.

[0083] In some embodiments, the subject may be a subject having Parkinson's disease.

[0084] In some embodiments, the pharmaceutical composition may be administered to the subject via a parenteral route.

[0085] In some embodiments, the pharmaceutical composition may be administered intravenously, subcutaneously, intramuscularly, intradermally, intraperitoneally, intraarterially, intramucosally, spinally, intrathecally, nasally, or intracerebral.

[0086]

[0087] Below, the invention disclosed in this application is described in more detail through embodiments and examples. The invention disclosed in this application can be implemented in various ways and is not limited to the specific embodiments described herein.

[0088] Those skilled in the art will readily recognize various modifications and alternative embodiments of the invention disclosed herein. Therefore, it should be understood that the invention disclosed herein is not limited to the specific embodiments or examples described herein, and that modifications and alternative embodiments are also encompassed within the scope of the invention disclosed herein.

[0089]

[0090] Explanation of Terms

[0091] Unless otherwise stated, all technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which this application pertains. All publications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0092] The term "about" as used herein means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% relative to a reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0093] The term "treatment" as used herein means alleviating, alleviating, and / or inhibiting the progression of a disease, condition, and / or symptom. The term "treatment" as used herein encompasses alleviating and alleviating a disease, condition, and / or symptom. For example, treatment may mean partial or complete recovery of a disease, condition, and / or symptom to a normal state. For example, the treatment may mean any action that causes a change in a condition in which symptoms are improved or beneficially altered by the composition of the present application, or any action that causes symptoms to be improved or altered. In some cases, treatment may be interpreted to include an aspect of prevention.

[0094] The terms "protein," "peptide," and "polypeptide," as used herein, are used interchangeably and encompass naturally occurring proteins and non-naturally occurring proteins. Non-naturally occurring proteins may be, for example, recombinant proteins or synthetic proteins. For example, a protein, peptide, or polypeptide may be naturally occurring, recombinant, synthetic, or any combination thereof. For example, a protein, peptide, or polypeptide may be naturally occurring. For example, a protein, peptide, or polypeptide may be recombinant or synthetic, or a combination of recombinant, synthetic, and naturally occurring.

[0095] The term "nucleic acid" as used herein encompasses both naturally occurring and non-naturally occurring nucleic acids. Non-naturally occurring nucleic acids may be, for example, recombinant nucleic acids or synthetic nucleic acids. For example, a nucleic acid may be naturally occurring, recombinant, synthetic, or any combination thereof. For example, a nucleic acid may be naturally occurring. For example, a nucleic acid may be recombinant, synthetic, or a combination of recombinant, synthetic, and naturally occurring.

[0096] The term "amino acid" as used herein may refer to both an amino acid that is not bonded to another amino acid and an amino acid residue bonded to another amino acid contained in a protein, polypeptide, or peptide, and may be appropriately interpreted depending on the content or context of the paragraph in which the term "amino acid" is used. The term "amino acid" as used herein may be used to mean both natural amino acids and unnatural amino acids. As used herein, natural amino acids collectively refer to the 20 amino acids synthesized through the transcription and translation processes of genes in the human body. Specifically, the natural amino acids are alanine (Ala, A), arginine (Arg, R), asparagine (Asn, N), aspartic acid (Asp, D), cysteine ​​(Cysteine, C), glutamic acid (Glu, E), glutamine (Gln, Q), glycine (Gly, G), histidine (His, H), isoleucine (Ile, I), leucine (Leu, L), lysine (Lys, K), methionine (Met, M), phenylalanine (Phe, F), proline (Pro, P), serine (Serine, S), threonine (Thr, T), Includes tryptophan (Trp, W), tyrosine (Tyr, Y), and valine (Val, V). As used herein, an unnatural amino acid refers to an amino acid that is not synthesized through the transcription and translation process of genes in the human body, but is synthesized through a process other than transcription and translation, is synthesized artificially, or can be synthesized in an organism other than a human.As described above, the term "amino acid" as used herein can be used to refer to both an amino acid that is not bonded to another amino acid and an amino acid residue that is bonded to another amino acid contained in a protein or peptide. The term "amino acid residue" as used herein refers to a structure derived from an amino acid contained in a compound, peptide, and / or protein, which is covalently linked to another portion of the compound, peptide, and / or protein. For example, when alanine, arginine, and glutamic acid are linked via amide bonds to form a peptide having an ARE sequence, the peptide includes three amino acid residues, wherein A may be referred to as an alanine residue, R as an arginine residue, and E as a glutamic acid residue. Furthermore, as described above, in a peptide having an ARE sequence, the peptide may include three amino acids, wherein A may be referred to as alanine, R as arginine, and E as glutamic acid. As another example, when aspartic acid, phenylalanine, and lysine are linked via amide bonds to form a peptide having a DFK sequence, the peptide comprises three amino acid residues, wherein D may be referred to as an aspartic acid residue, F may be referred to as a phenylalanine residue, and K may be referred to as a lysine residue. Furthermore, as described above, in a peptide having a DFK sequence, the peptide may comprise three amino acids, wherein D may be referred to as aspartic acid, F may be referred to as phenylalanine, and K may be referred to as lysine.

[0097] Unless otherwise stated, when describing amino acid sequences in this specification, amino acid single-letter notation or three-letter notation is used, and is written in the N-terminal to C-terminal direction. For example, when written as RNVP, it means a peptide in which arginine, asparagine, valine, and proline are sequentially connected from the N-terminal to the C-terminal. Another example, when written as Thr-Leu-Lys, it means a peptide in which threonine, leucine, and lysine are sequentially connected from the N-terminal to the C-terminal. In the case of amino acids that cannot be expressed in the single-letter notation, other letters are used and additional explanations are provided.

[0098] Unless otherwise stated, the nucleic acid sequences (e.g., DNA sequences, RNA sequences, DNA / RNA hybrid sequences) disclosed herein should be understood as being described in the 5' to 3' direction. In the case of DNA, which is a type of nucleic acid, it is well known that two strands (e.g., a first strand and a second strand) can form a double helix structure (e.g., in the case of human genomic DNA). Therefore, when a certain nucleic acid sequence (e.g., a DNA sequence) is disclosed, it is preferable that a sequence complementary to said certain nucleic acid sequence is also disclosed in the present specification, unless otherwise specified. Furthermore, unless otherwise specified, when a certain DNA sequence is disclosed, it is preferable that an RNA sequence corresponding to said certain DNA sequence (e.g., a sequence in which all Ts of said certain DNA sequence are changed to U) and an RNA sequence transcribed from said certain DNA sequence are also disclosed in the present specification.

[0099] The term "sequence identity" as used herein refers to the degree of similarity between two or more sequences. For example, the term "sequence identity" is used with terms referring to a reference sequence and terms indicating a ratio (e.g., a percentage). For example, the term "sequence identity" can be used to describe a sequence that is similar or substantially identical to a reference nucleic acid sequence. When described as "a sequence having at least 90% sequence identity to sequence A," the reference sequence is sequence A. For example, the percentage of sequence identity can be calculated by aligning a reference sequence with a sequence being the subject of the percent sequence identity measurement, and the percentage of sequence identity can be calculated including mismatches, deletions, and insertions for one or more nucleotides. The method for calculating and / or determining the percentage of sequence identity is not otherwise limited and may be calculated and / or determined through any appropriate method or algorithm available to a person skilled in the art.

[0100] In the present specification, when it is expressed as “A comprises B”, the expression “A comprises B” should be interpreted as not excluding a possibility that A comprises an additional element in addition to B. Furthermore, the expression “A comprises B” can be modified and rewritten as “A is B”, “A consists of B”, or “A is expressed by B”.

[0101]

[0102] Parkinson's disease

[0103] This section on Parkinson's disease is provided to assist in understanding Parkinson's disease and is not intended to limit the scope of this application. Parkinson's disease is a brain disorder that causes involuntary or uncontrollable movements, such as tremors, rigidity, and difficulties with balance and coordination. Parkinson's disease is classified as a neurodegenerative disease. Damage or degeneration (death or loss of function of dopaminergic neurons) of the substantia nigra is known to play a major role in the onset or progression of Parkinson's disease. Parkinson's disease is known to affect both the motor and non-motor systems. Movement disorders characterized by classic parkinsonian motor symptoms are known to be caused by dopamine deficiency in the basal ganglia, and damage to dopaminergic neurons in the substantia nigra is known to cause dopamine deficiency in the basal ganglia. Symptoms of Parkinson's disease are known to include motor and non-motor symptoms, and symptoms may vary somewhat depending on the individual Parkinson's patient. Motor symptoms include tremor, slowness of movement (bradykinesia), rigidity, and postural instability such as problems with gait and balance.Examples of non-motor symptoms include depression, anxiety, apathy, hallucinations, constipation, orthostatic hypotension, sleep disorders, loss of sense of smell, and a variety of cognitive impairments.

[0104] Parkinson's disease is usually divided into three stages: early stage, mid stage, and advanced stage, or into five stages: stage 1, stage 2, stage 3, stage 4, and stage 5.

[0105] These Parkinson's disease-related matters are well known in the art and are described in detail in the following references: Greenamyre, JT, & Hastings, TG (2004). Parkinson's--divergent causes, convergent mechanisms. Science, 304(5674), 1120-1122.; Ziemssen, T., & Reichmann, H. (2007). Non-motor dysfunction in Parkinson's disease. Parkinsonism & related disorders, 13(6), 323-332.; and Bose, A., & Beal, MF (2016). Mitochondrial dysfunction in Parkinson's disease. Journal of neurochemistry, 139, 216-231.], each of which is incorporated herein by reference in its entirety.

[0106] The need for developing novel treatments for Parkinson's disease has existed in the field since the disease was discovered, and still exists today.

[0107]

[0108] NDST3

[0109] This section on NDST3 is provided to aid in understanding NDST3, and the scope of the present application is not limited by the contents of NDST3 described in this section. NDST3, also referred to as N-Deacetylase and N-sulfotransferase 3, is a protein known to catalyze N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate (HS) and heparin. In humans, the human NDST3 protein is encoded by the human NDST3 gene, and the human NDST3 gene is known to be located at the chromosome location of 4q26. Information about the human NDST3 gene, which encodes the NDST3 protein and is located on chromosome 4, is available through the National Center for Biotechnology Information (NCBI), and the Gene ID of the human NDST3 gene is 9348. The amino acid sequence and NCBI accession of the known wild type human NDST3 protein are disclosed in Table 01 below.

[0110] Table 01. Amino acid sequence information of wild-type human NDST3 protein

[0111]

[0112]

[0113] It is known that there are isoforms of the wild-type human NDST3 protein, the amino acid sequences of which and NCBI Accession are disclosed in Table 02 below.

[0114] Table 02. Amino acid sequence information of wild-type human NDST3 protein isoforms

[0115]

[0116]

[0117]

[0118] Meanwhile, as mentioned above, the therapeutic effect of NDST3 (NDST3 protein or nucleic acid encoding it) on Parkinson's disease was not known prior to the filing date of the present application.

[0119]

[0120] The therapeutic agent for Parkinson's disease provided by some embodiments of the present application is NDST3. The novel therapeutic agent for Parkinson's disease provided by some embodiments of the present application is the NDST3 protein or a nucleic acid encoding the NDST3 protein. Some embodiments of the present application provide a composition for treating Parkinson's disease comprising NDST3 (or the NDST3 protein or a nucleic acid encoding it).

[0121] Below, a composition for treating Parkinson's disease is described in detail.

[0122]

[0123] Composition for treating Parkinson's disease

[0124] Overview of Compositions for Treating Parkinson's Disease

[0125] Some embodiments of the present application provide a composition for treating Parkinson's disease (or a composition for treating Parkinson's disease). The composition for treating Parkinson's disease of the present application can be used to treat Parkinson's disease in a subject. For example, the composition for treating Parkinson's disease of the present application can be used to treat Parkinson's disease in a subject. For example, the composition of the present application can be used to treat a human with Parkinson's disease or diagnosed with Parkinson's disease. For example, the composition of the present application can be used to treat symptoms of Parkinson's disease in a subject.

[0126] The names used to refer to the composition for treating Parkinson's disease of the present application are not limited. For example, the composition for treating Parkinson's disease may be referred to by other names, such as a composition, a composition comprising NDST3, a composition comprising the NDST3 protein or a nucleic acid encoding it, and a composition comprising a Parkinson's disease therapeutic agent.

[0127] In some embodiments, the composition for treating Parkinson's disease of the present application comprises an NDST3 protein or a nucleic acid encoding an NDST3 protein.

[0128] In some embodiments, a composition for treating Parkinson's disease may comprise an NDST3 protein or a nucleic acid encoding an NDST3 protein as the active substance (active ingredient or active pharmaceutical ingredient). In some embodiments, a composition for treating Parkinson's disease may comprise an NDST3 protein as the active substance. In some embodiments, a composition for treating Parkinson's disease may comprise a nucleic acid encoding an NDST3 protein as the active substance. In some embodiments, a composition for treating Parkinson's disease may comprise a vector comprising a nucleic acid encoding an NDST3 protein or a vector encoding an NDST3 protein as the active substance. In some embodiments, a composition for treating Parkinson's disease may comprise a therapeutically effective amount of the active substance. As used herein, the term "effective amount" may refer to an amount of a biologically active agent sufficient to elicit a desired biological response.

[0129]

[0130] Below, the NDST3 protein or the nucleic acid encoding it is described in detail.

[0131]

[0132] NDST3 protein or a nucleic acid encoding it

[0133] In some embodiments, the composition for treating Parkinson's disease of the present application comprises an NDST3 protein or a nucleic acid encoding the same. In some embodiments, the composition for treating Parkinson's disease may comprise an NDST3 protein or a nucleic acid encoding the same as an active agent. In some embodiments, the composition for treating Parkinson's disease may comprise an effective amount (or a pharmaceutically effective amount or a therapeutically effective amount) of an NDST3 protein or an effective amount (or a pharmaceutically effective amount or a therapeutically effective amount) of a nucleic acid encoding the NDST3 protein.

[0134] In some embodiments, a composition for treating Parkinson's disease comprises an NDST3 protein. For example, the NDST3 protein may be incorporated into, linked to, or attached to a carrier for protein delivery (e.g., a liposome, nanoparticle, or protein for delivery). In some embodiments, a composition for treating Parkinson's disease comprises a nucleic acid encoding the NDST3 protein. For example, the nucleic acid encoding the NDST3 protein may be packaged in a vector (e.g., a plasmid, a viral vector such as an AAV vector, or a cosmid). That is, a composition for treating Parkinson's disease may comprise a vector comprising a nucleic acid encoding the NDST3 protein.

[0135] The NDST3 protein and the nucleic acid encoding the NDST3 protein are described in detail below.

[0136]

[0137] NDST3 protein

[0138] In some embodiments, the composition for treating Parkinson's disease of the present application may comprise a nucleic acid encoding the NDST3 protein. In some embodiments, the composition for treating Parkinson's disease of the present application may comprise the NDST3 protein. In some embodiments, the composition for treating Parkinson's disease may comprise the NDST3 protein as an active ingredient.

[0139] In some embodiments, the NDST3 protein may be naturally occurring, recombinant, synthetic, or a combination thereof. In some embodiments, the NDST3 protein may be naturally occurring. In some embodiments, the NDST3 protein may be a recombinant NDST3 protein. In some embodiments, the NDST3 protein may be synthetic.

[0140] In some embodiments, the NDST3 protein can be a human NDST3 protein (e.g., of human origin). In some embodiments, the NDST3 protein can be a wild-type human NDST3 protein or a variant thereof. In some embodiments, the NDST3 protein can be any one selected from a canine NDST3 protein (e.g., of canine origin), an equine NDST3 protein (e.g., of equine origin), a feline NDST3 protein (e.g., of feline origin), a camel NDST3 protein (e.g., of camel origin), a mouse NDST3 protein (e.g., of mouse origin), a rat NDST3 protein (e.g., of rat origin), a porcine NDST3 protein (e.g., of porcine origin), a rabbit NDST3 protein (e.g., of rabbit origin), an ovine NDST3 protein (e.g., of ovine origin), a monkey NDST3 protein (e.g., of monkey origin), a chimpanzee NDST3 protein (e.g., of chimpanzee origin), and a bovine NDST3 protein (e.g., of bovine origin). In some embodiments, the NDST3 protein can be any one selected from a wild-type canine NDST3 protein or a variant thereof, a wild-type equine NDST3 protein or a variant thereof, a wild-type feline NDST3 protein or a variant thereof, a wild-type camel NDST3 protein or a variant thereof, a wild-type mouse NDST3 protein or a variant thereof, a wild-type rat NDST3 protein or a variant thereof, a wild-type porcine NDST3 protein or a variant thereof, a wild-type rabbit NDST3 protein or a variant thereof, a wild-type sheep NDST3 protein or a variant thereof, a wild-type monkey NDST3 protein or a variant thereof, a wild-type chimpanzee NDST3 protein or a variant thereof, and a wild-type bovine NDST3 protein or a variant thereof. In some embodiments, the NDST3 protein can be of human origin.

[0141] In some embodiments, the NDST3 protein may be modified with modifications commonly performed in the art. In some embodiments, the NDST3 protein may further comprise modifications and / or comprise additional elements. Here, the modifications may be, for example, addition of polyethylene glycol (e.g., pegylation), addition of a linker (e.g., a peptide linker), modifications for functionalization, conjugation, addition of a hydrophilic moiety, addition of a hydrophobic moiety, addition of a PEG moiety (e.g., pegylation), addition of an amide group (e.g., amidation of the C-terminus), addition of a carbohydrate group, addition of a hydroxyl group, addition of a phosphate group, addition of a prenyl group (e.g., prenylation), and / or addition of a farnesyl group (e.g., farnesylation), etc. In some embodiments, the modifications performed on the NDST3 protein may be modifications commonly performed on proteins in the art. In some embodiments, the modification made to the NDST3 protein may be at a level that does not impair the inherent function of the NDST3 protein.

[0142] As described above, the NDST3 protein may be a human NDST3 protein. In some embodiments, the NDST3 protein may have or comprise the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% sequence identity thereto. In some embodiments, the NDST3 protein may have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% but less than 100% sequence identity thereto. Here, the amino acid sequence of SEQ ID NO: 01 may be the amino acid sequence of a wild-type human NDST3 protein.

[0143] Below, the aspects of the NDST3 protein are described in detail.

[0144]

[0145] In some embodiments, the NDST3 protein may have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% but less than 100% sequence identity thereto. In some embodiments, the NDST3 protein may be a protein having the amino acid sequence of SEQ ID NO: 01 or a protein having an amino acid sequence having at least 80% but less than 100% (e.g., 99.9% or less) sequence identity thereto. In some embodiments, the NDST3 protein can have an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% but less than 100%, at least 82% but less than 100%, at least 84% but less than 100%, at least 86% but less than 100%, at least 88% but less than 100%, at least 90% but less than 100%, at least 92% but less than 100%, at least 94% but less than 100%, at least 95% but less than 100%, at least 96% but less than 100%, at least 97% but less than 100%, at least 97.5% but less than 100%, at least 98% but less than 100%, at least 98.5% but less than 100%, at least 99% but less than 100%, or at least 99.5% but less than 100% sequence identity thereto. In certain embodiments, the NDST3 protein may have an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 90% but less than 100%, at least 92% but less than 100%, at least 94% but less than 100%, at least 95% but less than 100%, at least 96% but less than 100%, at least 97% but less than 100%, at least 97.5% but less than 100%, at least 98% but less than 100%, at least 98.5% but less than 100%, at least 99% but less than 100%, or at least 99.5% but less than 100% sequence identity thereto. In a specific embodiment, the NDST3 protein has the amino acid sequence of SEQ ID NO: 01 or is at least 95% but less than 100%, at least 96% but less than 100%, at least 97% but less than 100%, at least 97.5% but less than 100%, at least 98% but less than 100%, at least 98.5% but less than 100%, at least 99% but less than 100%, or at least 99.It may have an amino acid sequence having a sequence identity of 5% or more and less than 100%. In some embodiments, the NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or is about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or It can have an amino acid sequence with 99.9% sequence identity. In particular embodiments, the NDST3 protein can have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence with about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity thereto. In certain embodiments, the NDST3 protein can have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having about 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity thereto. In certain embodiments, the NDST3 protein can have the amino acid sequence of SEQ ID NO: 01.

[0146]

[0147] In some embodiments, the NDST3 protein may be a human NDST3 protein. In some embodiments, the human NDST3 protein may be a wild-type human NDST3 protein or a variant of a human NDST3 protein (e.g., a variant of a wild-type human NDST3 protein).

[0148] In some embodiments, the wild-type human NDST3 protein can have the amino acid sequence of SEQ ID NO: 01.

[0149] In some embodiments, the variant of the human NDST3 protein can be created or derived by insertion of one or more amino acid residues from a wild-type human NDST3 protein, deletion of one or more amino acid residues from a wild-type human NDST3 protein, and / or substitution of one or more amino acid residues from a wild-type human NDST3 protein (i.e., substitution with a different amino acid residue). In some embodiments, there can be a difference of at least one amino acid residue between the amino acid sequence of the variant of the human NDST3 protein and the amino acid sequence of the wild-type human NDST3 protein. In some embodiments, there can be a difference of 1 to 200, 1 to 100, 1 to 50, 1 to 30, 1 to 20, or 1 to 10 amino acid residues between the amino acid sequence of the variant of the human NDST3 protein and the amino acid sequence of the wild-type human NDST3 protein. In some embodiments, there may be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues different between the variant human NDST3 protein and the wild-type human NDST3 protein. The differences in amino acid residues may encompass differences resulting from insertions, deletions, and substitutions.For example, a variant of a human NDST3 protein may have about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues substituted (or mutated) with other amino acid residues from the wild-type human NDST3 protein. The substitution of each amino acid residue with another amino acid residue may be independent.

[0150] For example, a variant of a human NDST3 protein can have an amino acid sequence that has greater than or equal to 80% but less than 100% sequence identity with the amino acid sequence of a wild-type human NDST3 protein (e.g., the amino acid sequence of SEQ ID NO: 01). For example, a variant of a human NDST3 protein can have an amino acid sequence that has greater than or equal to 90% but less than 100% sequence identity with the amino acid sequence of a wild-type human NDST3 protein. For example, a variant of a human NDST3 protein can have an amino acid sequence that has greater than or equal to 95% but less than 100% sequence identity with the amino acid sequence of a wild-type human NDST3 protein.

[0151]

[0152] In some embodiments, one or more amino acid sequence differences between the wild-type human NDST3 protein and the human NDST3 protein variant may be due to conservative amino acid substitutions. For example, the human NDST3 protein variant may comprise one or more substitutions from the amino acid sequence of the wild-type human NDST3 protein, wherein the one or more substitutions may be conservative amino acid substitutions. For example, the NDST3 protein has an amino acid sequence having 80% to less than 100% sequence identity with the amino acid sequence of SEQ ID NO: 01, wherein all or part of the differences in the amino acid sequence having 80% to less than 100% sequence identity with the amino acid sequence of SEQ ID NO: 1 may be due to conservative amino acid substitutions.

[0153] A conservative amino acid substitution refers to the replacement of a specific amino acid in a protein with another amino acid having similar properties. Examples of conservative substitutions are disclosed in Table 03, and useful conservative substitutions are disclosed in the "Preferred Substitutions" section of Table 03. Variants of an NDST3 protein (e.g., variants of a human NDST3 protein) that include conservative substitutions are included within the scope of the NDST3 proteins disclosed herein. In some embodiments, variants of an NDST3 protein that include conservative substitutions may not substantially alter the biological activity of a wild-type NDST3 protein (e.g., wild-type human NDST3 protein), and variants that do not substantially alter such biological activity are included within the scope of the NDST3 proteins disclosed herein.

[0154] Table 03. Examples of conservative substitutions

[0155]

[0156] (See document [US 8980821 B2, Application No. US 13 / 088233], the entire contents of which are incorporated herein by reference.)

[0157]

[0158] For example, if a variant of a human NDST3 protein comprises a substitution of DXXE (wherein XX represents a specific number) from a wild-type human NDST3 protein, then the difference between the variant of the human NDST3 protein and the wild-type human NDST3 protein may be due to a conservative substitution.

[0159] In some embodiments, the variant of the human NDST3 protein can have 1 to 100 amino acid residues substituted for another amino acid residue of the wild-type human NDST3 protein, wherein the substitution of the 1 to 100 amino acid residues for another amino acid residue can be a conservative substitution. In some embodiments, the variant of the human NDST3 protein can comprise a conservative substitution of 1 to 100, 1 to 50, 1 to 30, 1 to 20, or 1 to 10 amino acid residues. For example, the variant of the human NDST3 protein can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conservative substitutions. In some embodiments, the NDST3 protein (e.g., the variant of the human NDST3 protein) can further comprise one or more non-conservative substitutions in addition to the conservative substitutions. In some embodiments, the NDST3 protein (e.g., a variant of the human NDST3 protein) may comprise one or more unnatural amino acids. The unnatural amino acids may be introduced, for example, to conjugate the NDST3 protein to other elements.

[0160]

[0161] In some embodiments, a variant of a human NDST3 protein may be a functional equivalent of a wild-type human NDST3 protein. As used herein, the term "functional equivalent" refers to a second molecule or conceivable element that is functionally, but not necessarily structurally, equivalent to a first molecule or conceivable element. For example, a functional equivalent of an NDST3 protein may refer to a protein that has substantially the same or similar function (e.g., biological activity) as the NDST3 protein, but does not necessarily have the same amino acid sequence. In some embodiments, a variant of an NDST3 protein (e.g., a variant of a human NDST3 protein) may be a functional equivalent of a wild-type NDST3 protein (e.g., a wild-type human NDST3 protein). For example, a protein having an amino acid sequence that has at least 80% but less than 100% sequence identity to the amino acid sequence of a wild-type human NDST3 protein may be a functional equivalent of the wild-type human NDST3 protein. In some embodiments, functional equivalents may arise by, but are not limited to, conservative substitutions of one or more amino acids within a reference protein (e.g., wild-type human NDST3 protein).

[0162]

[0163] In some embodiments, the NDST3 protein of the present application may comprise substitutions at one or more amino acid residues comprising a substituent; fusions or conjugations with other compounds (e.g., fusions with other compounds or proteins may be intended to increase the stability and / or solubility of the NDST3 protein); and / or fusions or conjugations with other proteins, such as serum albumin, an IgG Fc protein, an antibody, a leader sequence, a secretory sequence, a sequence that facilitates purification, or a nuclear localization sequence. Illustratively, the present application provides antibody-NDST3 protein conjugates in which an antibody and an NDST3 protein are covalently linked (e.g., via a linker), or albumin-NDST3 proteins in which an albumin (e.g., human serum albumin) and an NDST3 protein are covalently linked (e.g., via a linker). Such mutations, fusions, or conjugations are recognized as being within the scope of one of ordinary skill in the art based on the teachings herein.

[0164]

[0165] The NDST3 protein described above (e.g., wild-type human NDST3 protein or a variant thereof) or a modified form of the NDST3 protein can be produced using methods known in the art for producing proteins (e.g., recombinant proteins). Methods for protein expression and purification are well known. For example, those skilled in the art can refer to the reference [Green, Michael R., and Joseph Sambrook. "Molecular cloning." A Laboratory Manual 4th (2012).] for protein production, synthesis, or production, the entire contents of which are incorporated herein by reference.

[0166]

[0167] Nucleic acid encoding NDST3 protein

[0168] Overview of the nucleic acid encoding the NDST3 protein

[0169] In some embodiments, a composition for treating Parkinson's disease may comprise a nucleic acid encoding the NDST3 protein. In some embodiments, a composition for treating Parkinson's disease may comprise a nucleic acid encoding the NDST3 protein as an active ingredient. In some embodiments, the nucleic acid encoding the NDST3 protein may be referred to as a nucleic acid for the expression of the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein may be referred to as a nucleic acid comprising a region encoding the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein may be referred to by various names, such as, but not limited to, a nucleic acid, a nucleic acid construct, a nucleic acid for expressing NDST3 (protein), an expression nucleic acid, an expression construct, a nucleic acid for delivering NDST3 (protein), and the like.

[0170] For example, a nucleic acid encoding an NDST3 protein can be used to express the NDST3 protein at a specific location (e.g., a cell or the nucleus of a cell). For example, but not limited to, a nucleic acid encoding an NDST3 protein can be used to express the NDST3 protein at a desired location (e.g., a cell of interest, a host cell, etc.). In some embodiments, the desired cell (or target cell) can be a central nervous system cell. In some embodiments, a nucleic acid encoding an NDST3 protein can be used to express the NDST3 protein in a cell (e.g., a central nervous system cell of a subject), but not limited to, a central nervous system cell. In some embodiments, the central nervous system cell can be a central nervous system neuron, an astrocyte, or a glia cell. In some embodiments, the cell can be a neuron, astrocyte, or a glial cell that is damaged or has lost function. For example, the central nervous system cell can be a cell of the substantia nigra. For example, the neuron may be, but is not limited to, one or more selected from the group consisting of a dopaminergic neuron (or a damaged or dysfunctional dopaminergic neuron), a cholinergic neuron, an adrenergic neuron, a GABAergic neuron, a glutamatergic neuron, a serotonergic neuron, a purinergic neuron, and a histaminergic neuron.

[0171] In some embodiments, the nucleic acid encoding the NDST3 protein may have a nucleic acid sequence encoding the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein may include a region (e.g., a coding region) encoding the NDST3 protein. Wherein the region encoding the NDST3 protein may have a nucleic acid sequence encoding the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein may include a nucleic acid sequence encoding the NDST3 protein.

[0172] The NDST3 protein is described in detail in the previous description, including the section "NDST3 Protein" of the present application. For example, the NDST3 protein may be a human NDST3 protein. For example, the NDST3 protein may be a wild-type human NDST3 protein or a variant thereof. For example, the NDST3 protein may have the amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having at least 80% but less than 100% sequence identity thereto.

[0173] In some embodiments, the nucleic acid encoding the NDST3 protein can be a DNA molecule, an RNA molecule, a DNA / RNA hybrid molecule, or a portion (e.g., a region) of a DNA molecule, a portion (e.g., a region) of an RNA molecule, or a portion (e.g., a region) of a DNA / RNA hybrid molecule. In some embodiments, the nucleic acid encoding the NDST3 protein can be in the form of a single strand (e.g., single-stranded DNA) or a double strand (e.g., double-stranded DNA). In some embodiments, the nucleic acid encoding the NDST3 protein can be a nucleic acid construct or a portion of a nucleic acid construct. For example, the nucleic acid encoding the NDST3 protein can be a DNA construct, an RNA construct, a DNA / RNA hybrid construct, or a portion (e.g., a region) of a DNA construct, a portion (e.g., a region) of an RNA construct, or a portion (e.g., a region) of a DNA / RNA hybrid construct.

[0174] In some embodiments, the nucleic acid encoding the NDST3 protein may be a recombinant nucleic acid.

[0175] In some embodiments, the length of the nucleic acid encoding the NDST3 protein is about any one selected from among 500 nt (or 500 bases), 1,000 nt, 2,000 nt, 3,000 nt, 4,000 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, 10,000 nt, 20,000 nt, 30,000 nt, 40,000 nt, 50,000 nt, 60,000 nt, 70,000 nt, 80,000 nt, 90,000 nt, 100,000 nt, 500,000 nt, 1,000,000 nt, and 2,000,000 nt or two values ​​selected from among the aforementioned values. The length of the nucleic acid encoding the NDST3 protein may be, but is not limited to, 1,000 nt to 10,000 nt, 2,000 nt to 6,000 nt, or 2,000 nt to 5,000 nt.

[0176]

[0177] Nucleic acid sequence encoding NDST3 protein

[0178] As described above, the nucleic acid encoding the NDST3 protein may comprise a nucleic acid sequence encoding the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein comprises a coding region (e.g., an NDST3 protein coding region), wherein the coding region may have a nucleic acid sequence encoding the NDST3 protein.

[0179] In some embodiments, the nucleic acid sequence encoding the NDST3 protein encompasses the nucleic acid sequence of a wild-type or mutant protein. In some embodiments, information on the nucleic acid sequence encoding the wild-type NDST3 protein can be obtained from a known database.

[0180] In some embodiments, the nucleic acid sequence encoding the NDST3 protein can comprise the full-length sequence of the NDST3 gene (e.g., the full-length sequence of the human NDST3 gene). In some embodiments, the nucleic acid sequence encoding the NDST3 protein can be the full-length sequence of the NDST3 gene, including introns and exons. In some embodiments, the sequence encoding the NDST3 protein can comprise the full-length sequence or a portion thereof of a human NDST3 gene, a canine NDST3 gene, an equine NDST3 gene, a feline NDST3 gene, a camel NDST3 gene, a mouse NDST3 gene, a rat NDST3 gene, a pig NDST3 gene, a rabbit NDST3 gene, an ovine NDST3 gene, a monkey NDST3 gene, a chimpanzee NDST3 gene, or a bovine NDST3 gene.

[0181] In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise one or more introns and one or more exons of an NDST3 gene (e.g., a human NDST3 gene). In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise one or more exons of the NDST3 gene, but may not comprise an intron of the NDST3 gene. In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise only exons of the NDST3 gene. For example, the human NDST3 gene is known to have 14 exons. In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise all exons of the human NDST3 gene. In some embodiments, the nucleic acid sequence encoding the NDST3 protein can comprise one or more selected from exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, and exon 14 of a human NDST3 gene.

[0182] In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise a cDNA sequence of an NDST3 gene (or NDST3) or a sequence complementary thereto. In some embodiments, the sequence encoding the NDST3 protein may comprise a cDNA sequence of a human NDST3 gene, a canine NDST3 gene, an equine NDST3 gene, a cat NDST3 gene, a camel NDST3 gene, a mouse NDST3 gene, a rat NDST3 gene, a pig NDST3 gene, a rabbit NDST3 gene, an ovine NDST3 gene, a monkey NDST3 gene, a chimpanzee NDST3 gene, or a bovine NDST3 gene or a sequence complementary thereto. In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise a cDNA sequence of a human NDST3 gene.

[0183] In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise a coding sequence (CDS) of an NDST3 gene (or NDST3) or a sequence complementary thereto. In some embodiments, the sequence encoding the NDST3 protein may comprise a CDS of a human NDST3 gene, a canine NDST3 gene, an equine NDST3 gene, a cat NDST3 gene, a camel NDST3 gene, a mouse NDST3 gene, a rat NDST3 gene, a pig NDST3 gene, a rabbit NDST3 gene, an ovine NDST3 gene, a monkey NDST3 gene, a chimpanzee NDST3 gene, or a bovine NDST3 gene or a sequence complementary thereto. In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise a CDS of a human NDST3 gene.

[0184] In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise an open reading frame (ORF) sequence of an NDST3 gene. In some embodiments, the sequence encoding the NDST3 protein may comprise an ORF sequence of a human NDST3 gene, a canine NDST3 gene, an equine NDST3 gene, a cat NDST3 gene, a camel NDST3 gene, a mouse NDST3 gene, a rat NDST3 gene, a pig NDST3 gene, a rabbit NDST3 gene, an ovine NDST3 gene, a monkey NDST3 gene, a chimpanzee NDST3 gene, or a bovine NDST3 gene. In some embodiments, the nucleic acid sequence encoding the NDST3 protein may comprise an ORF sequence of a human NDST3 gene.

[0185] In some embodiments, the nucleic acid sequence encoding the NDST3 protein can comprise a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having at least 70% but less than 100% (e.g., 99.9% or less) sequence identity thereto, or a sequence complementary thereto.

[0186] [Sequence number 07]

[0187]

[0188]

[0189]

[0190] The sequence of SEQ ID NO: 07 may be the CDS sequence of the human NDST3 gene. The sequence of SEQ ID NO: 07 encodes the wild-type human NDST3 protein. In SEQ ID NO: 07, the underlining of the terminal tag indicates that the tag is a stop codon.

[0191] In some embodiments, the nucleic acid sequence encoding the NDST3 protein (e.g., the nucleic acid sequence encoding the human NDST3 protein) comprises or is at least 70% but less than 100%, at least 72% but less than 100%, at least 74% but less than 100%, at least 76% but less than 100%, at least 78% but less than 100%, at least 80% but less than 100%, at least 82% but less than 100%, at least 84% but less than 100%, at least 86% but less than 100%, at least 88% but less than 100%, at least 90% but less than 100%, at least 92% but less than 100%, at least 94% but less than 100%, at least 95% but less than 100%, at least 96% but less than 100%, at least 97% but less than 100%, at least 97.5% A nucleic acid sequence having less than 100% sequence identity, greater than or equal to 98% but less than 100%, greater than or equal to 98.5% but less than 100%, greater than or equal to 99% but less than 100%, or greater than or equal to 99.5% but less than 100%. In a particular embodiment, the nucleic acid sequence encoding the human NDST3 protein comprises the nucleic acid sequence of SEQ ID NO: 07 or comprises a nucleic acid sequence having greater than or equal to 90% but less than 100%, greater than or equal to 92% but less than 100%, greater than or equal to 94% but less than 100%, greater than or equal to 95% but less than 100%, greater than or equal to 96% but less than 100%, greater than or equal to 97% but less than 100%, greater than or equal to 97.5% but less than 100%, greater than or equal to 98% but less than 100%, greater than or equal to 98.5% but less than 100%, greater than or equal to 99% but less than 100%, or greater than or equal to 99.5% but less than 100% sequence identity thereto. In a particular embodiment, the nucleic acid sequence encoding the human NDST3 protein can comprise the nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having at least 95% but less than 100%, at least 96% but less than 100%, at least 97% but less than 100%, at least 97.5% but less than 100%, at least 98% but less than 100%, at least 98.5% but less than 100%, at least 99% but less than 100%, or at least 99.5% but less than 100% sequence identity thereto.In some embodiments, the nucleic acid sequence encoding the human NDST3 protein comprises or is about 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, It may comprise a nucleic acid sequence having a sequence identity of 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9%. In certain embodiments, the nucleic acid sequence encoding the human NDST3 protein can comprise the nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity thereto. In certain embodiments, the nucleic acid sequence encoding the human NDST3 protein can comprise the nucleic acid sequence of SEQ ID NO: 07 or can comprise a nucleic acid sequence having about 95%, 96%, 97%, 97.2%, 97.4%, 97.6%, 97.8%, 98%, 98.2%, 98.4%, 98.6%, 98.6%, 98.8%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity thereto. In certain embodiments, the nucleic acid sequence encoding the human NDST3 protein can be the nucleic acid sequence of SEQ ID NO: 07.

[0192] In some embodiments, the differences (e.g., all or one or more of the differences) between the nucleic acid sequence of SEQ ID NO: 07 and the nucleic acid sequence having greater than or equal to 70% and less than 100% sequence identity with the nucleic acid sequence of SEQ ID NO: 07 can be due to codon degeneracy.

[0193] In some embodiments, the length of the nucleic acid sequence encoding the NDST3 protein can be, but is not limited to, within a range of any one selected from about 500 nt (or 500 bases), 1,000 nt, 2,000 nt, 3,000 nt, 4,000 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, 10,000 nt, 20,000 nt, 30,000 nt, 40,000 nt, 50,000 nt, 60,000 nt, 70,000 nt, 80,000 nt, 90,000 nt, 100,000 nt, 500,000 nt, and 1,000,000 nt. For example, the length of the nucleic acid sequence encoding the NDST3 protein may be 500 nt to 10,000 nt, 1,000 nt to 6,000 nt, or 2,000 nt to 3,000 nt.

[0194]

[0195] Additional elements optionally included in the nucleic acid encoding the NDST3 protein

[0196] As described above, the nucleic acid encoding the NDST3 protein may comprise a nucleic acid sequence encoding the NDST3 protein. For example, the nucleic acid encoding the NDST3 protein may comprise a coding region, wherein the coding region may have a nucleic acid sequence encoding the NDST3 protein.

[0197] In some embodiments, a nucleic acid encoding an NDST3 protein may further comprise one or more additional elements in addition to the coding region. In some embodiments, the additional elements may each independently be any one selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), and 2A self-cleaving peptides. In some embodiments, the additional elements may be control elements (or control sequences). A control element may be used herein to refer to an element, region, or DNA sequence that is operably linked to a coding region (e.g., a nucleic acid sequence encoding an NDST3 protein) to enable expression of the coding region (e.g., expression of the NDST3 protein) in a target organism or host organism. Examples of control elements in prokaryotic cells may include promoters, operator sequences, and ribosome binding sites. Examples of control elements in eukaryotic cells may include promoters, polyadenylation sequences, and enhancers.

[0198] In some embodiments, the nucleic acid encoding the NDST3 protein can further comprise a promoter. In some embodiments, the promoter can be an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter. In some embodiments, the promoter can be, but is not limited to, a human, mouse, canine, equine, feline, rat, porcine, rabbit, ovine, monkey, chimpanzee, bovine, equine, or viral promoter.

[0199] In some embodiments, one or more additional elements may be operably linked to the coding region. For example, one or more of a promoter and an enhancer may be operably linked to the coding region. For example, in a nucleic acid encoding the NDST3 protein, a promoter may be operably linked to the coding region (e.g., a nucleic acid sequence encoding the NDST3 protein). The operably linked elements or nucleic acids may be linked to the coding region contiguously or via a linker (e.g., an oligonucleotide linker, etc.). The promoter and / or enhancer may be operably linked to the coding region to affect the transcription of the coding region. In some embodiments, the promoter may be linked to the 5' end or the 3' end of the coding region (e.g., a nucleic acid sequence encoding the NDST3 protein). Preferably, the promoter may be linked to the 5' end of the coding region, wherein the promoter is operably linked to the coding region.

[0200]

[0201] Methods for designing and / or preparing nucleic acids (e.g., nucleic acids having a nucleic acid sequence encoding the NDST3 protein) are well known to those skilled in the art. For example, those skilled in the art may refer to Green, Michael R., and Joseph Sambrook. "Molecular cloning." A Laboratory Manual 4th (2012). for designing and / or preparing nucleic acids (e.g., recombinant nucleic acids), the entire contents of which are incorporated herein by reference.

[0202]

[0203] The NDST3 protein or the nucleic acid encoding it described above can be incorporated into or attached to a carrier for delivery to or use in a desired site, organ, tissue, or organism (e.g., cell). For example, the NDST3 protein or the nucleic acid encoding it can be incorporated into or attached to a carrier for delivery to or use in a desired site, organ, tissue, or cell. For example, the nucleic acid encoding the NDST3 protein can be incorporated into or provided in the form of a vector for delivery to or use in a desired site, organ, tissue, or cell. The carrier and vector are described in detail below.

[0204]

[0205] vehicle

[0206] In some embodiments, the NDST3 protein or nucleic acid encoding it can be attached to or incorporated into a transporter (e.g., a drug transporter or drug carrier) for transport.

[0207] In some embodiments, the NDST3 protein or a nucleic acid encoding it may be attached to or incorporated into a vehicle for delivery or use to a desired site, organ, tissue, or cell. Here, attachment encompasses both covalent attachment (attachment via a covalent bond) and non-covalent attachment (attachment via a non-covalent bond). As used herein, the term "vehicle" may refer to an element for transporting and / or delivering an element or substance for delivery or use. For example, a vehicle may be referred to as a cargo.

[0208] In some embodiments, a composition for treating Parkinson's disease may comprise a transporter comprising the NDST3 protein or a nucleic acid encoding the NDST3 protein. In some embodiments, a composition for treating Parkinson's disease may comprise, as an active agent, the NDST3 protein or a transporter comprising the nucleic acid encoding the NDST3 protein.

[0209] In some embodiments, the transporter can be, but is not limited to, a nanoparticle (e.g., a metal nanoparticle such as silica nanoparticles, gold nanoparticles, and silver nanoparticles, or a protein nanoparticle such as albumin nanoparticles), a liposome, a lipid nanoparticle, a carbon nanotube, chitosan, a protein such as an antibody or albumin, a peptide, DNA, a DNA-RNA lipid complex, a polymer, a DNA-polymer complex, an artificial chromosome, a cosmid, a vector (e.g., a viral vector). For example, the NDST3 protein or a nucleic acid encoding it can be attached to or contained in the transporter. In some embodiments, the transporter can be a transporter for targeted drug delivery. That is, the transporter can be a transporter for active targeting. In some embodiments, the transporter can be a transporter for passive targeting. Transporters for transport of proteins or peptides are described in detail in the reference [Jain, A., Jain, A., Gulbake, A., Shilpi, S., Hurkat, P., & Jain, SK (2013). Peptide and protein delivery using new drug delivery systems. Critical Reviews™ in Therapeutic Drug Carrier Systems, 30(4).], which is incorporated herein by reference in its entirety.

[0210] Below, vectors used for transport, loading, and / or delivery of nucleic acids encoding the NDST3 protein are described in detail.

[0211]

[0212] vector

[0213] Vector Overview

[0214] The term "vector" is used herein to refer to a vehicle, particle, or element used to transport, load, carry, and / or deliver a nucleic acid (e.g., an exogenous nucleic acid or an exogenous gene). A vector may comprise a nucleic acid, wherein the nucleic acid contained in the vector may be a recombinant nucleic acid. For example, a vector may comprise exogenous DNA and recombinant DNA. A vector may be used to transport or deliver the contained nucleic acid to a desired site, organ, tissue, or cell. A vector may be designed, for example, to express an exogenous nucleic acid contained in the vector in another cell. In this case, an exogenous nucleic acid (e.g., an exogenous gene) introduced into another cell via the vector may be transcribed via an endogenous promoter of the other cell or an exogenous promoter introduced together with the exogenous nucleic acid.

[0215] In some embodiments, the nucleic acid encoding the NDST3 protein may be included in a vector. In some embodiments, the nucleic acid encoding the NDST3 protein may be provided in the form of a vector. In some embodiments, the nucleic acid encoding the NDST3 protein may be packaged in a vector.

[0216] Some embodiments of the present application provide a vector comprising a nucleic acid encoding the NDST3 protein. The vector comprising the nucleic acid encoding the NDST3 protein may be used for the treatment of Parkinson's disease.

[0217] In some embodiments, the composition for treating Parkinson's disease of the present application may comprise a vector comprising a nucleic acid encoding the NDST3 protein. In some embodiments, the composition for treating Parkinson's disease of the present application may comprise, as an active ingredient, a vector comprising a nucleic acid encoding the NDST3 protein. In this case, the vector comprising the nucleic acid encoding the NDST3 protein may be referred to as a vector encoding the NDST3 protein. The vector comprising the nucleic acid encoding the NDST3 protein may be referred to as an NDST3 (protein or gene) delivery vector, an NDST3 (protein or gene) expression vector, an expression vector, a vector for treating Parkinson's disease, and the like, without limitation.

[0218] Vectors are generally divided into viral vectors and non-viral vectors. Below, viral vectors are described in detail.

[0219]

[0220] viral vector

[0221] Viral vectors are a common and useful tool in molecular biology for transporting or delivering exogenous nucleic acids (e.g., exogenous genes). Viral vectors are described in detail in the literature [Bulcha, JT, Wang, Y., Ma, H., Tai, PW, & Gao, G. (2021). Viral vector platforms within the gene therapy landscape. Signal transduction and targeted therapy, 6(1), 53.; and Lundstrom, K. (2018). Viral vectors in gene therapy. Diseases, 6(2), 42.], the entire contents of each of which are incorporated herein by reference.

[0222] In some embodiments, the vector may be a viral vector. In some embodiments, a nucleic acid encoding the NDST3 protein may be included in the viral vector. In some embodiments, a viral vector comprising a nucleic acid encoding the NDST3 protein (e.g., a viral vector encoding the NDST3 protein) may be provided. In some embodiments, a composition comprising a viral vector comprising a nucleic acid encoding the NDST3 protein (e.g., a composition for treating Parkinson's disease) may be provided. The viral vector may be recombinant and is not otherwise limited.

[0223] In some embodiments, the viral vector may be derived from any one or more of a retrovirus, a lentivirus, an adenovirus, an adeno-associated virus (AAV), a vaccinia virus, a poxvirus, a human immunodeficiency virus (HIV), a murine leukemia virus (MLV), an avian sarcoma / leukosis virus (ASLV), a spleen necrosis virus (SNV), a rou sarcoma virus (RSV), a mouse mammary tumor virus (MMTV), a herpes simplex virus, an epizomal virus, and a herpes simplex virus.

[0224] In some embodiments, the viral vector can be selected from any one or more of a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated virus vector, a vaccinia virus vector, a poxvirus vector, a human immunodeficiency virus (HIV) vector, a murineleukemia virus (MLV) vector, an avian sarcoma / leukosis (ASLV) vector, a spleen necrosis virus (SNV) vector, a rou sarcoma virus (RSV) vector, a mouse mammary tumor virus (MMTV) vector, a herpes simplex virus vector, an episomal vector, a herpes simplex virus vector, and a hybrid vector (e.g., an adeno / AAV hybrid vector).

[0225] In some embodiments, a nucleic acid encoding the NDST3 protein (or the NDST3 protein coding region) can be integrated or inserted into the genome of a cell. In some embodiments, a nucleic acid encoding the NDST3 protein can be integrated or inserted into a desired location (target site) in the genome of a cell. For example, a nucleic acid encoding the NDST3 protein can be integrated or inserted into the AAVS1 gene (located on human chromosome 19).

[0226] In some embodiments, a vector or vector system may be designed to insert or integrate a nucleic acid encoding the NDST3 protein into a specific site (e.g., within the AAVS1 gene). Such a vector or vector system may be referred to as a vector or vector system for insertion into AAVS1.

[0227] In some embodiments, Rep (replicase / integrase protein) may be used for insertion into AAVS1. For example, a vector encoding Rep (e.g., an AAV vector encoding Rep) may be used in addition to a vector encoding NDST3 protein. In another example, Rep may be used in addition to a vector encoding NDST3 protein. In another example, a vector comprising a nucleic acid encoding Rep in addition to a nucleic acid encoding NDST3 protein may be used. In this case, the nucleic acid encoding Rep may be included in a single nucleic acid construct together with the nucleic acid sequence encoding NDST3 protein, or may be included in a separate nucleic acid construct from the nucleic acid encoding NDST3 protein. The Rep used for insertion or integration into the AAVS1 gene may be, but is not limited to, Rep78 and / or Rep68. Rep78 / Rep68 are known to induce insertion or integration into AAVS1 together with the ITR. In some embodiments, the vector for insertion into AAVS1 may be, but is not limited to, an AAV vector or a hybrid vector (e.g., an Adeno / AAV hybrid vector).

[0228] In some embodiments, the viral vector may be an adeno-associated virus (AAV) vector. AAV vectors are described in detail below.

[0229]

[0230] AAV vector

[0231] In some embodiments, the viral vector may be an adeno-associated virus (AAV) vector. The use or application of AAV vectors is well known in the art, and detailed descriptions of AAV vectors can be found in references [Asokan, A., Schaffer, DV, & Samulski, RJ (2012). The AAV vector toolkit: poised at the clinical crossroads. Molecular Therapy, 20(4), 699-708.; and Li, C., & Samulski, RJ (2020). Engineering adeno-associated virus vectors for gene therapy. Nature Reviews Genetics, 21(4), 255-272.], the entire contents of which are incorporated herein by reference. Examples of well-known serotypes of AAV vectors include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12.

[0232] In some embodiments, the AAV vector (e.g., a recombinant AAV vector) can be naturally derived, engineered, chimeric, or variant.

[0233] In some embodiments, the AAV vector can be any one of the AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S vectors.

[0234] In some embodiments, the AAV vector may be an AAV9 vector.

[0235]

[0236] In some embodiments, an AAV vector comprising a nucleic acid encoding the NDST3 protein may be provided. For example, the nucleic acid encoding the NDST3 protein may be referred to as, but is not limited to, a transgene cassette. For example, an AAV vector comprising a nucleic acid encoding the NDST3 protein may be referred to as, but is not limited to, an AAV cassette.

[0237] In some embodiments, an AAV vector (e.g., an AAV9 vector) may comprise: a capsid, and a nucleic acid encoding the NDST3 protein, wherein the capsid structurally encloses (encloses) the nucleic acid encoding the NDST3 protein.

[0238] Nucleic acids encoding the NDST3 protein are described in detail in the preceding descriptions, including the section "Nucleic Acids Encoding the NDST3 Protein" of the present application. In some embodiments, the nucleic acid encoding the NDST3 protein may comprise a coding region having a nucleic acid sequence encoding the NDST3 protein. In some embodiments, the nucleic acid encoding the NDST3 protein may further comprise one or more additional elements. In some embodiments, one of the one or more additional elements may be a promoter. In some embodiments, the nucleic acid encoding the NDST3 protein may comprise a coding region and a promoter, wherein the promoter may be operably linked to the coding region. The promoter may be operably linked 5' or 3' to the coding region. In some embodiments, the nucleic acid encoding the NDST3 protein may further comprise one or more ITRs (e.g., one or two). For example, the nucleic acid encoding the NDST3 protein may comprise a coding region having a nucleic acid sequence encoding the NDST3 protein. For example, a nucleic acid encoding an NDST3 protein may include a coding region and a promoter. For example, a nucleic acid encoding an NDST3 protein may include a coding region, a promoter, and one or more ITRs. For example, a nucleic acid encoding an NDST3 protein may include a coding region and one or more ITRs.

[0239]

[0240] For example, a viral vector containing a nucleic acid encoding the NDST3 protein can be produced using methods well known in the art. For example, a researcher can purchase materials (or a kit) for producing a viral vector from a viral vector supplier and produce a viral vector containing a nucleic acid encoding the NDST3 protein according to the manufacturer's protocol.

[0241]

[0242] Below, examples of methods for producing AAV vectors are described, but the scope of the present application is not limited thereto.

[0243] For example, AAV vectors can be produced using methods known in the art. Methods for producing AAV vectors can typically be performed using two or three or more plasmids.

[0244] As an example, a method for manufacturing an AAV vector includes:

[0245] A first plasmid (e.g., which may be referred to as a transfer plasmid) comprising a sequence for delivery or expression (e.g., a nucleic acid sequence encoding an NDST3 protein), wherein the transfer plasmid may further comprise an ITR and a promoter in addition to the sequence for delivery or expression;

[0246] a second plasmid comprising a nucleic acid sequence encoding a replication protein or / and a capsid protein (e.g., which may be referred to as a Rep-Cap plasmid); and

[0247] A third plasmid containing a sequence encoding a helper gene (e.g., this may be referred to as a helper plasmid)

[0248] introducing into the host cell; and

[0249] Extracting AAV particles (e.g., AAV vectors) from the host cell may be included.

[0250] At this time, the AAV particle may be an AAV2 particle or an AAV9 particle.

[0251] Here, the host cell into which the three types of plasmids or two types of plasmids (e.g., carrier plasmid and Rep-Cap plasmid) are introduced may be, for example, HEK293, HEK293T, Huh-7, HeLa, HepG2, Hep1A, SV40, CHO, COS, MeWo, NIH3T3, A549, PERC6, HT1180, 293 AAV cell, monocyte, or dendritic cell.

[0252] After introducing the three or two types of plasmids described above into a host cell, the researcher can culture the host cell using an appropriate method (e.g., according to the protocol provided by the host cell manufacturer) to obtain an AAV vector from the host cell. After culturing, an AAV vector containing the desired sequence can be obtained from the host cell.

[0253] Introduction of the plasmid into a host cell can be performed by appropriately selecting a method known in the art.

[0254] For example, electroporation, gene gun, sonoporation, magnetofection, microinjection, transient cell compression or squeezing, cationic liposome, lithium acetate-DMSO, lipid-mediated transfection, calcium phosphate precipitation, lipofection, PEI (Polyethyleneimine)-mediated transfection, DEAE-dextran-mediated transfection, etc. can be used, but are not limited thereto.

[0255] At this time, the order in which the plasmid is introduced into the host cell is not particularly restricted.

[0256] The above AAV particles may be prepared in the form of exosomes or microparticles, but are not limited thereto. A method for extracting AAV particles may be performed using a method known in the art.

[0257] For example, methods for extracting AAV particles can include centrifugation, precipitation, immunoprecipitation, affinity chromatography, filtration, magnetic beads coated with specific antibodies or actamers, freeze / thaw, sonication, and commercial kits.

[0258] AAV particles can optionally be concentrated using methods known in the art. For example, the concentration can be achieved using, but is not limited to, immunomagnetic capture, organic flocculation, and polyethylene glycol (PEG) precipitation.

[0259] Additionally, optionally, additional quality tests may be performed. For example, the quality tests may include, but are not limited to, titer measurements, sterility tests for bacteria and fungi, and mycoplasma detection tests.

[0260] The manufactured AAV vector comprises a capsid and an AAV vector nucleic acid, wherein the AAV vector nucleic acid is known to be located within the capsid. The AAV vector nucleic acid has a desired sequence. The AAV vector nucleic acid optionally further comprises a promoter and / or ITR.

[0261] Methods for producing viral vectors (e.g., AAV vectors) for delivering or administering designed sequences to a target are well known in the art. For example, a researcher can purchase host cells for producing viral vectors, such as AAV vectors, from a host cell manufacturer and produce or obtain AAV vectors comprising designed sequences according to the manufacturer's protocol. Alternatively, a researcher can purchase a kit for producing AAV vectors from the manufacturer of the kit and produce or obtain AAV vectors comprising designed sequences according to the manufacturer's protocol. Alternatively, a researcher can design a sequence to be delivered or administered to a target and produce or obtain a viral vector (e.g., AAV vector) comprising the designed sequences according to the literature [Green, Michael R., and Joseph Sambrook. "Molecular cloning." A Laboratory Manual 4th (2012).], which is incorporated herein by reference.

[0262]

[0263] nonviral vector

[0264] In some embodiments, the vector may be a non-viral vector. In some embodiments, the nucleic acid encoding the NDST3 protein may be contained or packaged in a non-viral vector.

[0265] In some embodiments, the nonviral vector can be any one selected from a plasmid, a phage, naked DNA, a DNA-RNA lipid complex, a liposome, a nanoparticle, a DNA-polymer complex, mRNA, an artificial chromosome, and a cosmid.

[0266]

[0267] Additional elements that may be included in the composition

[0268] In some embodiments, the composition (e.g., a composition for treating Parkinson's disease) may further comprise one or more additional components in addition to the active agent.

[0269] In some embodiments, the additional component may be a pharmaceutically acceptable additional component. The term "pharmaceutically acceptable" as used herein refers to materials, compositions, and / or dosage forms that are suitable, within the scope of sound medical judgment, for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0270] In some embodiments, the additional component may be physiologically acceptable, related to or affecting the stabilization, dissolution, absorption, or introduction efficiency of the active substance of the present application. For example, the additional component may be, but is not limited to, a carrier, an excipient, a diluent, a preservative, or the like. For example, each additional component (carrier, excipient, or diluent) may be independently selected from lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, distilled water, saline, glycerol, ethanol, and HSA (human serum albumin). For example, the preservative may be, but is not limited to, benzoic acid, sodium benzoate, sorbic acid, parahydroxybenzoic acid, or chlorobutanol.

[0271] The composition may further include, but is not limited to, fillers, bulking agents, binders, and / or wetting agents for formulation purposes.

[0272]

[0273] Use of the composition for treating Parkinson's disease

[0274] pharmaceutical composition

[0275] In some embodiments, the composition for treating Parkinson's disease of the present application can be used to treat Parkinson's disease in a subject (e.g., a human) with Parkinson's disease. In some embodiments, the composition for treating Parkinson's disease can be used to treat symptoms of Parkinson's disease in a subject. In some embodiments, the composition for treating Parkinson's disease can be used to treat an individual in need of treatment for Parkinson's disease. In some embodiments, the Parkinson's disease can be early stage, intermediate stage, or advanced stage Parkinson's disease. In some embodiments, the Parkinson's disease can be stage 1, stage 2, stage 3, stage 4, or stage 5 Parkinson's disease.

[0276] In some embodiments, the subject with Parkinson's disease may be a subject medically or clinically diagnosed with Parkinson's disease. In some embodiments, the subject may be a subject suspected of having Parkinson's disease.

[0277] In some embodiments, the subject of treatment for Parkinson's disease using the composition of the present application may be a human. In some embodiments, the subject of treatment for Parkinson's disease using the composition of the present application may be an animal other than a human (e.g., a non-human vertebrate). For example, the subject may be a dog, horse, cat, camel, mouse, rat, pig, rabbit, sheep, monkey, chimpanzee, or cow. Preferably, the subject of treatment for Parkinson's disease using the composition of the present application may be a human.

[0278] The composition for treating Parkinson's disease can be used for pharmaceutical purposes.

[0279] In some embodiments, the composition for treating Parkinson's disease of the present application may be a pharmaceutical composition for treating Parkinson's disease. For example, the pharmaceutical composition for treating Parkinson's disease may comprise, as an active substance, an active agent of the composition for treating Parkinson's disease described in detail in the preceding descriptions (e.g., NDST3 protein or a nucleic acid encoding it, a transporter comprising NDST3 protein or a nucleic acid encoding it, or a vector comprising a nucleic acid encoding NDST3 protein, etc.). In some embodiments, the pharmaceutical composition for treating Parkinson's disease may comprise the active agent in a therapeutically effective amount.

[0280] In some embodiments, the pharmaceutical composition may be formulated for oral or parenteral use. For example, when formulated for oral use, the composition may be formulated in solid, liquid, suspension, granule, capsule, or semi-solid forms. For example, when formulated for parenteral use, the composition may be formulated in the form of an injection, sustained-release formulation, or aerosol. Preferably, the composition may be formulated as an injection.

[0281] For injectable formulations, methods known in the art may be additionally employed to delay drug absorption and prolong the drug's effect, if necessary. For example, injectable depot forms can be prepared by encapsulating the active ingredient in a biodegradable polymer. Alternatively, injectable depot forms can be prepared by entrapping the active ingredient in liposomes or microemulsions.

[0282]

[0283] Kit

[0284] Some embodiments of the present application provide a kit comprising a composition for treating Parkinson's disease. A kit comprising a composition for treating Parkinson's disease may be referred to as a "Parkinson's disease treatment kit."

[0285] A kit for treating Parkinson's disease may include instructions for use according to methods known in the art. Typically, the instructions for use include instructions for administering the pharmaceutical composition for the treatment, diagnosis, and / or prevention of a disease (e.g., Parkinson's disease). In some embodiments, the instructions for use may include information on one or more of the following: dosage, administration schedule, and administration route for the intended treatment. For example, the instructions for use may include information on the dosage, administration schedule, and administration route for treating Parkinson's disease using the composition for treating Parkinson's disease of the present application.

[0286] In some embodiments, a kit for treating Parkinson's disease may include one or more containers. The containers may be, but are not limited to, vials or bottles, and may be appropriately selected based on the intended use or the ingredients contained therein. In some embodiments, the containers may contain a composition for treating Parkinson's disease. The type of container may be appropriately selected based on the form of the composition for treating Parkinson's disease.

[0287]

[0288] How to treat Parkinson's disease

[0289] Some embodiments of the present application provide a method for treating Parkinson's disease in a subject. Some embodiments of the present application provide a method for treating symptoms of Parkinson's disease in a subject. In some embodiments, the method for treating Parkinson's disease (or a symptom of Parkinson's disease) may comprise administering to the subject an NDST3 protein or a nucleic acid encoding it. For example, a therapeutically effective amount of the NDST3 protein or a nucleic acid encoding it may be administered to the subject. In some embodiments, the method for treating Parkinson's disease may comprise administering to the subject a composition (or pharmaceutical composition) for treating Parkinson's disease of the present application. For example, a therapeutically effective amount of the composition for treating Parkinson's disease may be administered to the subject. Compositions for treating Parkinson's disease are described in detail in the preceding descriptions, including the section "Compositions for Treating Parkinson's Disease" of the present application. For example, a composition for treating Parkinson's disease may comprise an NDST3 protein or a nucleic acid encoding it. For example, a composition for treating Parkinson's disease may include, but is not limited to, a vector encoding the NDST3 protein (e.g., an AAV vector). The composition for treating Parkinson's disease administered to a subject in the treatment method of the present application may be referred to as a Parkinson's disease therapeutic agent, and is not otherwise limited.

[0290]

[0291] In some embodiments, the subject of the treatment method of the present application may be an individual in need of treatment or prevention of Parkinson's disease. In some embodiments, the subject may have Parkinson's disease. In some embodiments, the subject may have been diagnosed with Parkinson's disease. In some embodiments, the Parkinson's disease may be early-stage, intermediate-stage, or advanced-stage Parkinson's disease. In some embodiments, the Parkinson's disease may be stage 1, stage 2, stage 3, stage 4, or stage 5 Parkinson's disease.

[0292] In some embodiments, the subject may be a human. That is, the subject may be a human having Parkinson's disease or diagnosed with Parkinson's disease. For example, the subject may be a human having early stage, intermediate stage, or advanced stage Parkinson's disease or diagnosed with early stage, intermediate stage, or advanced stage Parkinson's disease. In some embodiments, the Parkinson's disease may be a human having stage 1, stage 2, stage 3, stage 4, or stage 5 Parkinson's disease or diagnosed with stage 1, stage 2, stage 3, stage 4, or stage 5 Parkinson's disease. In some embodiments, the subject may be an animal other than a human (e.g., a non-human vertebrate). For example, the subject may be a dog, a horse, a cat, a camel, a mouse, a rat, a pig, a rabbit, a sheep, a monkey, a chimpanzee, or a cow.

[0293]

[0294] The Parkinson's disease treatment of the present application (e.g., a composition for treating Parkinson's disease) can be administered to a subject via various routes depending on clinical needs.

[0295] In some embodiments, the composition for treating Parkinson's disease may be administered orally or parenterally. For example, the composition for treating Parkinson's disease may be injected into a subject via parenteral administration.

[0296] In some embodiments, the composition for treating Parkinson's disease can be administered orally, intravenously, subcutaneously, intramuscularly, intradermally, intraperitoneally, intraarterially, mucosally, spinally, intrathecally, intranasally, into the central nervous system (e.g., brain), or into the cerebrospinal fluid.

[0297] In some embodiments, the composition for treating Parkinson's disease may be administered into the cerebral ventricle. For example, the composition for treating Parkinson's disease may be administered to a subject via intracerebroventricular injection (ICV injection).

[0298] In some embodiments, the composition for treating Parkinson's disease may be administered into the substantia nigra. For example, the composition for treating Parkinson's disease may be administered to a subject via intra-nigranular injection.

[0299] In some embodiments, the composition for treating Parkinson's disease can be administered to a subject via intrathecal injection (IT injection). For example, the composition for treating Parkinson's disease can be injected into the cisterna magna or cerebrospinal fluid via IT injection. For example, the composition for treating Parkinson's disease can be administered to a subject via intra-cisterna magna injection (ICM injection), direct injection of substances into cerebrospinal fluid, or injection via lumbar puncture.

[0300] In some embodiments, the composition for treating Parkinson's disease can be administered to a subject by intraparenchymal injection into the brain.

[0301] In some embodiments, the composition for treating Parkinson's disease may be administered intrathecally. In some embodiments, the composition for treating Parkinson's disease may be administered into the brain (e.g., into the substantia nigra of the brain).

[0302]

[0303] The dosage of the composition for treating Parkinson's disease of the present application may be determined by considering, but is not limited to, one or more of the following factors: disease type, administration site, body weight, age, and disease progression. Furthermore, the dosage may be appropriately determined within the scope of medical judgment, commensurate with a reasonable benefit / risk ratio, and without excessive toxicity, irritation, allergic reactions, or other problems.

[0304] As an example, if the composition for treating Parkinson's disease comprises an AAV vector, the composition for treating Parkinson's disease may be administered at the following dosages.

[0305] For example, about 1x10 5 GC(genome copy) / kg, 1x10 6 GC / kg, 1x10 7 GC / kg, 1x10 8 GC / kg, 1x10 9 GC / kg, 1x10 10 GC / kg, 1x10 11 GC / kg, 1x10 12 GC / kg, 1x10 13 GC / kg, 1x10 14 GC / kg, 1x10 15 GC / kg, 1x10 16 GC / kg, 1x10 17 GC / kg, 1x10 18 GC / kg, 1x10 19 GC / kg, and 1x10 20 AAV vectors may be administered at a concentration of one or more of the above-mentioned values, or within a range of two or more of the above-mentioned values. For example, about 1x105 GC(genome copy) / head, 1x10 6 GC / head, 1x10 7 GC / head, 1x10 8 GC / head, 1x10 9 GC / head, 1x10 10 GC / head, 1x10 11 GC / head, 1x10 12 GC / head, 1x10 13 GC / head, 1x10 14 GC / head, 1x10 15 GC / head, 1x10 16 GC / head, 1x10 17 GC / head, 1x10 18 GC / head, 1x10 19 GC / head, and 1x10 20 An AAV vector within a range of one of the GC / head or two of the values ​​described above may be administered.

[0306] In some embodiments, the volume of the composition for treating Parkinson's disease to be administered may be, but is not limited to, 1 ul to 10 ml. For example, the volume of the composition for treating Parkinson's disease to be administered may be any one selected from 1 ul, 2 ul, 3 ul, 4 ul, 5 ul, 6 ul, 7 ul, 8 ul, 9 ul, 10 ul, 20 ul, 30 ul, 40 ul, 50 ul, 60 ul, 70 ul, 80 ul, 90 ul, 100 ul, 200 ul, 300 ul, 400 ul, 500 ul, 600 ul, 700 ul, 800 ul, 900 ul, 1 ml, 5 ml, and 10 ml, or may be within a range of any two values ​​selected from the foregoing values.

[0307] In some embodiments, the composition for treating Parkinson's disease may be administered as a single or multiple dose. In some embodiments, for multiple doses, the single dose may be determined by the aforementioned dosage. The dosage may be the same or different for each administration, but is not limited thereto. In some embodiments, for multiple doses, administration may be performed at predetermined, regular time intervals. In some embodiments, the intervals between doses may not be fixed.

[0308] For example, the dosage may be determined based on data obtained from cell studies, animal studies, and / or human clinical trials. At this time, the dosage range for humans can be determined based on the dosage obtained from animal studies or preclinical trials using methods known in the art. For example, the following formula may be referenced when determining the dosage for humans:

[0309] HED (Human Equivalent Dose) = animal NOAEL x (W animal / W human ) (1-b)

[0310] Here, the NOAEL (No Observed Adverse Effect Level) refers to the no-observed-adverse-effect level. For example, b may be 0.67. To determine an appropriate dose, researchers may refer to, but are not limited to, the literature [Nair, AB, & Jacob, S. (2016). A simple practice guide for dose conversion between animals and humans. Journal of basic and clinical pharmacy, 7(2), 27.].

[0311]

[0312] In some embodiments, the composition for treating Parkinson's disease may be administered in combination with other components or substances. For example, the substance administered in combination with the composition for treating Parkinson's disease may be a substance known to treat neurological diseases such as Parkinson's disease, and such a substance known to treat neurological diseases may produce a synergistic effect with the composition for treating Parkinson's disease of the present application. For example, a substance that can enhance the therapeutic effect of the composition for treating Parkinson's disease of the present application may be administered in combination. For example, a substance that alleviates the toxicity of the composition for treating Parkinson's disease may be administered in combination. For example, the composition for treating Parkinson's disease may be used in combination with, but is not limited to, levodopa, carbidopa, and / or pramipexole.

[0313] The other components or substances described above may be administered simultaneously with the composition for treating Parkinson's disease, on the same day, or at a different time. If administered at a different time, the other substances may be administered once or multiple times, at regular or irregular intervals from the composition for treating Parkinson's disease, but are not limited thereto.

[0314] The dosage concentration, dose, and administration cycle used in the aforementioned Parkinson's disease treatment methods can be appropriately determined as needed. For example, researchers, physicians, or veterinarians can appropriately determine or prescribe these factors as needed. For example, physicians or veterinarians can gradually increase or decrease the dosage until the desired therapeutic effect is achieved. Furthermore, physicians or veterinarians can determine the dosage and administration period, etc., based on the condition of the subject (patient).

[0315]

[0316] In some embodiments, the method for treating Parkinson's disease may further comprise determining the prognosis of the subject. For example, the treatment progress or treatment effect of Parkinson's disease may be determined using clinical or medical methods known in the art, including but not limited to. For example, the treatment progress of Parkinson's disease may be determined using, but is not limited to, F-18-DOPA PET scanning, dopamine transporter scanning, and other methods known in the art. In some embodiments, the method for treating Parkinson's disease may further comprise a step of adjuvant treatment. Adjuvant treatment may include, but is not limited to, physical therapy, rehabilitation therapy, administration of anticonvulsants, and / or antidepressants.

[0317]

[0318] Exemplary embodiments

[0319] Below, exemplary embodiments of the invention provided according to some embodiments of the present application are provided. The invention provided by the present application is not limited to the examples below.

[0320]

[0321] Exemplary embodiments of a composition for treating Parkinson's disease comprising NDST3 protein or a nucleic acid encoding the same

[0322] A01. A pharmaceutical composition for treating Parkinson's disease comprising NDST3 protein or a nucleic acid encoding the same.

[0323]

[0324] A02. In A01,

[0325] A pharmaceutical composition wherein the above NDST3 protein is a human NDST3 protein.

[0326]

[0327] A03. In A02,

[0328] A pharmaceutical composition wherein the above NDST3 protein is a wild-type human NDST3 protein or a mutant thereof.

[0329]

[0330] A04. In A02,

[0331] A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having 80% or more and less than 100% sequence identity thereto.

[0332]

[0333] A05. In A02,

[0334] A pharmaceutical composition, wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO: 01.

[0335]

[0336] A06. In A02,

[0337] A pharmaceutical composition wherein the human NDST3 protein is a wild-type human NDST3 protein or a functional equivalent thereof.

[0338]

[0339] A07. In A02,

[0340] The above NDST3 protein is a variant of a wild-type human NDST3 protein, wherein the variant of the wild-type human NDST3 protein comprises a conservative substitution of one or more amino acid residues from the wild-type human NDST3 protein having the amino acid sequence of SEQ ID NO: 01,

[0341] A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence having a sequence identity of 80% or more and less than 100% with the amino acid sequence of the wild-type human NDST3 protein.

[0342]

[0343] A08. In A01,

[0344] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein comprises an NDST3 protein coding region, wherein the NDST3 protein coding region has a nucleic acid sequence encoding the NDST3 protein.

[0345]

[0346] A09. In A08,

[0347] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a DNA sequence, an RNA sequence, or a DNA / RNA hybrid sequence.

[0348]

[0349] A10. In any one of A08 to A09,

[0350] A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the NDST3 gene, the ORF (open reading frame) sequence of the NDST3 gene, the CDS (coding sequence) of the NDST3 gene, or the cDNA sequence of the NDST3 gene.

[0351]

[0352] A11. In any one of A08 to A10,

[0353] A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the wild-type human NDST3 gene, the ORF sequence of the wild-type human NDST3 gene, the CDS of the wild-type human NDST3 gene, or the cDNA sequence of the wild-type human NDST3 gene.

[0354]

[0355] A12. In any one of A08 to A10,

[0356] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having a sequence identity of 80% or more and less than 100% thereto.

[0357]

[0358] A13. In any one of A08 to A10,

[0359] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is the nucleic acid sequence of SEQ ID NO: 07.

[0360]

[0361] A14. In any one of A08 to A13,

[0362] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises one or more additional elements.

[0363]

[0364] A15. In A14,

[0365] A pharmaceutical composition, wherein each of the one or more additional elements is independently selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), a nuclear localization signal coding sequence, and 2A self-cleaving peptides.

[0366]

[0367] A16. In any one of A14 to A15,

[0368] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

[0369]

[0370] A17. In A16,

[0371] A pharmaceutical composition, wherein the promoter is an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

[0372]

[0373] A18. In any one of A01 to A17,

[0374] A pharmaceutical composition wherein the NDST3 protein or a nucleic acid encoding the same is attached to or included in a transporter.

[0375]

[0376] A19. In A18,

[0377] A pharmaceutical composition wherein the transporter is a nanoparticle, a liposome, a lipid nanoparticle, a carbon nanotube, chitosan, a protein, a peptide, DNA, a DNA-RNA lipid complex, a polymer, a DNA-polymer complex, an artificial chromosome, a cosmid, or a vector.

[0378]

[0379] A20. In any one of A01 to A17,

[0380] A pharmaceutical composition comprising a nucleic acid encoding the above NDST3 protein contained in a vector.

[0381]

[0382] A21. In A20,

[0383] A pharmaceutical composition wherein the above vector is a viral vector.

[0384]

[0385] A22. In A21,

[0386] A pharmaceutical composition wherein the viral vector is any one of retrovirus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, poxvirus, human immunodeficiency virus (HIV), murineleukemia virus (MLV), avian sarcoma / leukosis (ASLV), spleen necrosis virus (SNV), rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, epizomal, and herpes simplex virus.

[0387]

[0388] A23. In any one of A21 to A22,

[0389] A pharmaceutical composition wherein the viral vector is an adeno-associated virus (AAV) vector.

[0390]

[0391] A24. In A23,

[0392] A pharmaceutical composition wherein the AAV is any one selected from among AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0393]

[0394] A25. In any one of A23 to A24,

[0395] A pharmaceutical composition wherein the above AAV is AAV9.

[0396]

[0397] A26. In A20,

[0398] A pharmaceutical composition wherein the above vector is a non-viral vector.

[0399]

[0400] A27. In A26,

[0401] A pharmaceutical composition wherein the non-viral vector is any one selected from the group consisting of a plasmid, a phage, naked DNA, a DNA-RNA lipid complex, a liposome, a nanoparticle, a DNA-polymer complex, mRNA, an artificial chromosome, and a cosmid.

[0402]

[0403] A28. In any one of A01 to A27,

[0404] A pharmaceutical composition, characterized in that the pharmaceutical composition further comprises one or more pharmaceutically acceptable additional components.

[0405]

[0406] A29. In A28,

[0407] A pharmaceutical composition wherein each of the above pharmaceutically acceptable additional components is independently selected from a carrier, an excipient, a diluent, and a preservative.

[0408]

[0409] Exemplary embodiment of a composition for treating Parkinson's disease comprising a vector encoding NDST3 protein

[0410] B01. Pharmaceutical composition for treating Parkinson's disease comprising:

[0411] A vector comprising a nucleic acid encoding NDST3 protein.

[0412]

[0413] B02. In B01,

[0414] A pharmaceutical composition wherein the above vector is a viral vector.

[0415]

[0416] B03. In B02,

[0417] A pharmaceutical composition wherein the viral vector is any one of retrovirus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, poxvirus, human immunodeficiency virus (HIV), murineleukemia virus (MLV), avian sarcoma / leukosis (ASLV), spleen necrosis virus (SNV), rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, epizomal, and herpes simplex virus.

[0418]

[0419] B04. In any one of B02 to B03,

[0420] A pharmaceutical composition wherein the viral vector is an adeno-associated virus (AAV) vector.

[0421]

[0422] B05. In B04,

[0423] A pharmaceutical composition wherein the AAV is any one selected from among AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

[0424]

[0425] B06. In any one of B04 to B05,

[0426] A pharmaceutical composition wherein the above AAV is AAV9.

[0427]

[0428] B07. In B01,

[0429] A pharmaceutical composition wherein the above vector is a non-viral vector.

[0430]

[0431] In B08. B07,

[0432] A pharmaceutical composition wherein the non-viral vector is any one selected from the group consisting of a plasmid, a phage, naked DNA, a DNA-RNA lipid complex, a liposome, a nanoparticle, a DNA-polymer complex, mRNA, an artificial chromosome, and a cosmid.

[0433]

[0434] B09. In any one of B01 to B08,

[0435] A pharmaceutical composition, characterized in that the pharmaceutical composition further comprises one or more pharmaceutically acceptable additional components.

[0436]

[0437] In B10. B09,

[0438] A pharmaceutical composition wherein each of the above pharmaceutically acceptable additional components is independently selected from a carrier, an excipient, a diluent, and a preservative.

[0439]

[0440] B11. In any one of B01 to B10,

[0441] A pharmaceutical composition wherein the above NDST3 protein is a human NDST3 protein.

[0442]

[0443] B12. In B11,

[0444] A pharmaceutical composition wherein the human NDST3 protein is a wild-type human NDST3 protein or a mutant thereof.

[0445]

[0446] B13. In B11,

[0447] A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having 80% or more and less than 100% sequence identity thereto.

[0448]

[0449] B14. In B11,

[0450] A pharmaceutical composition, wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO: 01.

[0451]

[0452] B15. In B11,

[0453] A pharmaceutical composition wherein the human NDST3 protein is a wild-type human NDST3 protein or a functional equivalent thereof.

[0454]

[0455] B16. In B11,

[0456] The human NDST3 protein is a variant of a wild-type human NDST3 protein, wherein the variant of the wild-type NDST3 protein comprises a conservative substitution of one or more amino acid residues from the wild-type human NDST3 protein having the amino acid sequence of SEQ ID NO: 01,

[0457] A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence having a sequence identity of 80% or more and less than 100% with the amino acid sequence of the wild-type human NDST3 protein.

[0458]

[0459] B17. In any one of B01 to B10,

[0460] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein comprises an NDST3 protein coding region, wherein the NDST3 protein coding region has a nucleic acid sequence encoding the NDST3 protein.

[0461]

[0462] B18. In B17,

[0463] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a DNA sequence, an RNA sequence, or a DNA / RNA hybrid sequence.

[0464]

[0465] B19. In any one of B17 to B18,

[0466] A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the NDST3 gene, the ORF (open reading frame) sequence of the NDST3 gene, the CDS (coding sequence) of the NDST3 gene, or the cDNA sequence of the NDST3 gene.

[0467]

[0468] B20. In any one of B17 to B19,

[0469] A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the wild-type human NDST3 gene, the ORF sequence of the wild-type human NDST3 gene, the CDS of the wild-type human NDST3 gene, or the cDNA sequence of the wild-type human NDST3 gene.

[0470]

[0471] B21. In any one of B17 to B19,

[0472] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having a sequence identity of 80% or more and less than 100% thereto.

[0473]

[0474] B22. In any one of B17 to B19,

[0475] A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is the nucleic acid sequence of SEQ ID NO: 07.

[0476]

[0477] B23. In any one of B17 to B22,

[0478] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises one or more additional elements.

[0479]

[0480] B24. In B23,

[0481] A pharmaceutical composition, wherein each of the one or more additional elements is independently selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), a nuclear localization signal coding sequence, and 2A self-cleaving peptides.

[0482]

[0483] B25. In any one of B17 to B24,

[0484] A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

[0485]

[0486] B26. In B25,

[0487] A pharmaceutical composition, wherein the promoter is an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

[0488]

[0489] B27. A pharmaceutical composition for treating Parkinson's disease, comprising:

[0490] Viral vector encoding the NDST3 protein.

[0491]

[0492] B28. In B27,

[0493] A pharmaceutical composition wherein the above NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having 80% or more and less than 100% sequence identity thereto.

[0494]

[0495] B29. In B27,

[0496] A pharmaceutical composition wherein the above NDST3 protein has an amino acid sequence of sequence number 01.

[0497]

[0498] B30. In any one of B27 to B29,

[0499] A pharmaceutical composition wherein the above viral vector is an AAV vector.

[0500]

[0501] B31. In any one of B27 to B30,

[0502] A pharmaceutical composition wherein the viral vector is an AAV9 vector.

[0503]

[0504] Exemplary embodiments of a method for treating Parkinson's disease

[0505] C01. A method for treating Parkinson's disease in a subject, comprising:

[0506] Administering to a subject any one pharmaceutical composition selected from A01 to A29 and B01 to B31.

[0507]

[0508] In C02. C01,

[0509] A method wherein the subject is a subject having Parkinson's disease.

[0510]

[0511] C03. In any one of C01 to C02,

[0512] A method wherein the subject is a subject diagnosed as having Parkinson's disease.

[0513]

[0514] C04. In any one of C01 to C03,

[0515] A method wherein the Parkinson's disease of the above subject is stage 1, stage 2, stage 3, stage 4, or stage 5 Parkinson's disease.

[0516]

[0517] C05. In any one of C01 to C04,

[0518] The Parkinson's disease of the above subject is early-stage, mid-stage, or advanced-stage Parkinson's disease.

[0519]

[0520] C06. In any one of C01 to C05,

[0521] A method wherein the pharmaceutical composition is administered to the subject via a parenteral route.

[0522]

[0523] C07. In any one of C01 to C06,

[0524] A method wherein the pharmaceutical composition is administered intravenously, subcutaneously, intramuscularly, intradermally, intraperitoneally, intraarterially, intramucosally, spinally, intrathecally, nasally or intracerebrally.

[0525]

[0526] C08. In any one of C01 to C06,

[0527] A method wherein the pharmaceutical composition is administered by intracerebroventricular injection (ICV injection).

[0528]

[0529] C09. In any one of C01 to C06,

[0530] The above pharmaceutical composition is administered by intrathecal injection,

[0531]

[0532] In C10. C09,

[0533] A method wherein the pharmaceutical composition is administered intravenously (cisterna magna).

[0534]

[0535] Experimental example

[0536] 1. Obtaining an AAV vector encoding Ndst3

[0537] Obtaining an AAV vector encoding human NDST3 protein

[0538] The inventors of the present application constructed an AAV vector encoding human NDST3 protein (an AAV vector encoding Ndst3). Information regarding the CDS (coding sequence) of NDST3 was obtained from human cells. After constructing the AAV vector encoding Ndst3, the inventors of the present application administered the vector to in vitro and in vivo models induced with Parkinson's disease, thereby confirming the therapeutic effect of Ndst3 on Parkinson's disease. Herein, the AAV vector encoding Ndst3 refers to an AAV vector constructed to enable expression of human NDST3 protein in cells, including a nucleic acid sequence encoding the human NDST3 protein. The method for constructing the AAV vector encoding Ndst3 used in the experiments disclosed in the present application is described in detail below.

[0539] AAV 293 cell line (Cell biolabs; Catalog Number: AAV-100) was used to produce the vector encoding Ndst3. AAV 293 cells were cultured in DMEM (Dulbecco's Modified Eagle Medium; Gibco; Cat No. 12430054), 10% fetal bovine serum (Gibco; Cat No. 10100147), 0.1 mM NEAA (MEM TM Non-Essential TM In a medium containing 150 mm of 1% P / S (Penicillin-Streptomycin; Gibco; Cat No. 15140122), 2 mM L-glutamine (L-glutamine; Gibco; Cat No. A2916801), and 1% P / S (Penicillin-Streptomycin; Gibco; Cat No. 11140050), 2 In cell culture dishes, culture was performed at 37°C and 5% CO2 conditions.

[0540] Thereafter, for transfection of the helper plasmid, the Rep-Cap plasmid, and the transfer plasmid having a nucleic acid sequence encoding human NDST3 protein, AAV 293 cells were treated with the helper plasmid (pHelper, 10 ug per dish), the Rep-Cap plasmid (pRC, 10 ug per dish), and the transfer plasmid having a nucleic acid sequence encoding human NDST3 protein (transfer plasmid, 10 ug per dish), and cultured for 48 hours. A schematic diagram of the transfer plasmid having a sequence encoding human NDST3 protein is disclosed in Fig. 01. At this time, the nucleic acid sequence encoding human NDST3 protein included in the transfer plasmid has a nucleic acid sequence of SEQ ID NO: 07. At this time, the sequence of the CMV promoter included in the transfer plasmid has a nucleic acid sequence of SEQ ID NO: 08.

[0541] Thereafter, an AAV vector encoding Ndst3 (AAV9 vector encoding human NDST3 protein) was obtained from the transfected AAV 293 cell population using an AAV extraction solution and purification kit (Takara; Cat No. 6679). Here, the human NDST3 protein has the amino acid sequence of SEQ ID NO: 01. A schematic diagram of the nucleic acid contained in the obtained AAV vector encoding Ndst3 is disclosed in Fig. 02.

[0542] Thereafter, when administered to a human, the AAV vector may comprise a nucleic acid that does not include M13 ori and NeoR / KanR, a schematic diagram of which is disclosed in FIG. 03. Furthermore, an AAV vector encoding Ndst3 can be produced using a method similar to the above-described method using an NG2 promoter instead of a CMV promoter, and schematic diagrams of the AAV vector encoding Ndst3 are disclosed in FIG. 04 and FIG. 05.

[0543] The nucleic acid sequence encoding the human NDST3 protein (SEQ ID NO: 07), the nucleic acid sequence of the CMV promoter (SEQ ID NO: 08), the nucleic acid sequence of the M13 ori (SEQ ID NO: 09), the nucleic acid sequence of the NeoR / KanR (SEQ ID NO: 10), and the nucleic acid sequence of the NG2 promoter (SEQ ID NO: 11) are disclosed below.

[0544]

[0545] - hNDST3:

[0546]

[0547]

[0548] (Sequence number 07)

[0549]

[0550] - CMV promoter:

[0551] Gtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttgg caccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagct (SEQ ID NO: 08)

[0552]

[0553] - M13 ori:

[0554]

[0555] (Sequence number 09)

[0556]

[0557] - NeoR / KanR:

[0558]

[0559] (Sequence number 10)

[0560]

[0561] - NG2 promoter:

[0562]

[0563] (Sequence number 11)

[0564]

[0565] 2. Confirmation of the therapeutic effect of Ndst3 on Parkinson's disease

[0566] 2.1. Creation of an in vitro model of Parkinson's disease using 6-OHDA and treatment with AAV vectors

[0567] Creation of an in vitro model of Parkinson's disease

[0568] (1) Obtaining and culturing primary dopaminergic neurons

[0569] Skulls were removed from E13-15 mouse embryos, and brains were extracted. Meninges were then removed from the extracted brains. The midbrain was then collected and chopped using a cross-section. The chopped tissues were transferred to a conical tube using Dulbecco's Phosphate-Buffered Saline (DPBS). The tissues were sedimented by centrifugation, and the supernatant was removed. To dissociate the tissues, TrypLE (Gibco; Cat No. 12605010) and 0.5 M ascorbic acid (Sigma; Cat No. A4403) were added to the chopped tissues, inverted, and incubated at 37°C for 20 minutes, inverting every 10 minutes. The obtained tissue was then neutralized with plating medium (Neurobasal medium (Gibco; Cat No. 21103049) + 1x B27 (Gibco; Cat No. 17504044) + 1.2 mg / ml Laminin (Corning; Cat no. 354232) + 1% L-glu (Gibco; Cat No. A2916801) + 10% FBS (Gibco; Cat no. 10100147) + 1% penicillin-streptomycin (P / S; Gibco; Cat No. 15140122)). The dissociated tissue was then filtered with a 70 μm cell strainer (Falcon, Cat No. 352350) and centrifuged at 1200 rpm for 3 minutes to obtain cells from the dissociated tissue. The obtained cells (dopaminergic neurons) were seeded on cell culture dishes coated with PDL (Poly-d-lysine) together with plating medium. For the culture of primary dopaminergic neurons, the following day, the medium in the dish was replaced with culture medium (Neurobasal medium (Gibco) + 1.The medium was replaced with 2 mg / ml Laminin (Corning) + 0.25% L-glu (Gibco) + 1% FBS (Gibco) + 1% penicillin-streptomycin (P / S, Gibco)).

[0570]

[0571] (2) Creation of an in vitro model of Parkinson's disease through 6-OHDA treatment

[0572] An in vitro model of 6-OHDA-induced Parkinson's disease was created by treating primary dopaminergic neurons with 6-hydroxydopamine hydrochloride (6-OHDA; Sigma; Cat no. H4381), which is used to model Parkinson's disease. Three days after cell seeding, primary dopaminergic neuron culture dishes were treated with 100 μM 6-OHDA.

[0573]

[0574] Processing of AAV vectors encoding Ndst3

[0575] The day after 6-OHDA treatment, the AAV vector encoding Ndst3 (Ndst3, 1 x 10) obtained in the experimental example "1. Obtaining AAV vector encoding Ndst3" was inoculated into a primary dopaminergic neuron culture dish. 8 GC) was treated. Afterwards, the AAV vector-treated and untreated groups were cultured for the experiment. The group treated or injected with the AAV vector encoding Ndst3 may also be referred to as the Ndst3-treated group.

[0576]

[0577] Experimental Timeline

[0578] A timeline of experiments performed involving the 6-OHDA-induced Parkinson's disease in vitro model is summarized below.

[0579] Table 04. Experimental timeline related to the 6-OHDA-induced Parkinson's disease in vitro model.

[0580]

[0581]

[0582] 2.2. Creation of a Parkinson's disease mouse model through 6-OHDA and administration of an AAV vector encoding Ndst3

[0583] Creation of a 6-OHDA-induced Parkinson's disease mouse model

[0584] A 6-OHDA-induced Parkinson's disease mouse model was created. Eight-week-old ICR mice (Daehan Biolink, DBL) were anesthetized by intraperitoneal injection of avertin (125–250 mg / kg). After anesthesia, the mice were secured on the operating table, and the surgical site was disinfected with povidone-dopa and 70% ethanol and thoroughly dried. After confirming anesthesia, the cortex of the head was incised, and the coordinates were fixed. A 6-OHDA-induced Parkinson's disease model was created by injecting 2 μL of 6-OHDA (10 μg / μL, dissolved in 0.02% ascorbate / saline) at the following locations: -1.1 mm medial-lateral (ML), -3.1 mm anterior-posterior (AP), and -4.4 mm dorsal-ventral (DV).

[0585]

[0586] Administration of an AAV vector encoding Ndst3

[0587] An AAV vector encoding Ndst3 was injected into a 6-OHDA-induced Parkinson's disease mouse model. 3-5 days after the creation of the 6-OHDA-induced Parkinson's disease model, the AAV vector encoding Ndst3 (1 x 10) obtained in "1. Obtaining an AAV vector encoding Ndst3" of the experimental example was injected into the ML -1.1 mm, AP -3.1 mm, and DV -4.4 mm regions. 8 GC) was injected.

[0588]

[0589] Experimental Timeline Summary

[0590] A timeline of experiments performed involving a 6-OHDA-induced Parkinson's disease mouse model is summarized below.

[0591] Table 05. Experimental timeline related to the 6-OHDA-induced Parkinson's disease mouse model.

[0592]

[0593]

[0594] 2.3. Creation of a Parkinson's disease mouse model through MPTP and administration of an AAV vector encoding Ndst3.

[0595] Generation of a mouse model of MPTP-induced Parkinson's disease

[0596] A mouse model of MPTP-induced Parkinson's disease was created. 8-week-old C57BL / 6 mice (Daehan Biolink, DBL) were injected intraperitoneally with MPTP (30 mg / kg; Sigma; Cat no. M0896) for 7 consecutive days to create an MPTP-induced Parkinson's disease model.

[0597]

[0598] Administration of an AAV vector encoding Ndst3

[0599] An AAV vector encoding Ndst3 was injected into a mouse model of MPTP-induced Parkinson's disease. Seven days after completion of MPTP injection, the AAV vector encoding Ndst3 (1 x 10) obtained in "1. Obtaining an AAV vector encoding Ndst3" of the experimental example was injected into the ML -1.1 mm, AP -3.1 mm, and DV -4.4 mm sites. 8 GC) was injected.

[0600]

[0601] Experimental Timeline Summary

[0602] A timeline of experiments performed involving the MPTP-induced Parkinson's disease mouse model is summarized below.

[0603] Table 06. Experimental timeline related to the MPTP-induced Parkinson's disease mouse model.

[0604]

[0605]

[0606] 2.4. Confirmation of the therapeutic effect of Ndst3 on Parkinson's disease - in vitro

[0607] Expression analysis of neuronal markers (TUJ1, MAP) (1) - Immunofluorescence staining analysis

[0608] (1) Method

[0609] As described above, primary dopaminergic neuron culture dishes were treated with an AAV vector encoding Ndst3 (Ndst3 treatment) and then cultured for 10 days (for the treatment group). Afterwards, for cell fixation, the cells were washed twice with PBS for 5 minutes each, and 4% paraformaldehyde (ThermoFisher) was added to the cell culture dishes and incubated for 10 minutes at room temperature. The dishes were washed three times with PBS for 5 minutes each. Afterwards, for blocking, 1% BSA+PBST (PBS + 0.1% Tween 20) was added to the dishes and incubated for 30 minutes at room temperature. For immunofluorescence staining analysis, Tuj1 antibody (Abcam; Dilution concentration 1:1000) and Map2 antibody (Cell signaling; 1:200) were used as primary antibodies. The primary antibodies, anti-Tuj1 antibody and anti-Map2 antibody, were added to 1% BSA+PBST and incubated overnight at 4°C. After washing three times with PBS for 5 minutes each, the secondary antibodies, Alexa Fluor TM488 antibody (ThermoFisher; 1:1000) was added to 1% BSA+PBST and incubated in the dark at room temperature for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0610]

[0611] (2) Results

[0612] The results of confirming dopaminergic neuron markers (Tuj1, Map2) in the control group, 6-OHDA treated group (Ndst3 untreated group), and Ndst3 treated group (6-OHDA and Ndst3 treated groups) are disclosed in Figs. 06 and 07. Fig. 06 is a photograph confirming the expression of neuron markers through immunofluorescence staining in each group. Fig. 07 is a numerical representation of the results of immunofluorescence staining analysis. The analysis results confirmed that the intensity of the neuron markers Tuj1 and Map2 increased in the Ndst3 treated group compared to the 6-OHDA treated group. The increase in the neuron markers Tuj1 and Map2 indicates an increase in neurons. The result of increasing Tuj1 and Ma2p in the NDST3 treated group compared to the 6-OHDA treated group indicates that neurons increased due to NDST3 treatment.

[0613]

[0614] Analysis of dopaminergic neuron marker (TH) expression (2) - Western blot analysis

[0615] (1) Method

[0616] As described above, primary dopaminergic neuron culture dishes were treated with Ndst3 and cultured for 10 days. Cells were washed twice with PBS (Gibco) for 5 minutes each. Lysis buffer [RIPA buffer (Sigma, R0278), 1 x Protease inhibitor cocktail (GenDEPOT, P3100)] was added to the dishes, and cells were collected using a scraper. The cells were then transferred to an EP-tube, vortexed for 15 seconds, and centrifuged at 14,000 rpm for 10 minutes. Supernatant was obtained from the centrifuged sample, mixed with 5 x loading dye, and Western blot samples were prepared. The samples were loaded onto an acrylamide gel and electrophoresed. Proteins separated on the gel were then transferred to a membrane. The membrane with the transferred proteins was blocked with 5% skim milk (in TBST). Afterwards, the primary antibody, Anti-TH antibody (1:1000, Millipore), was added to 5% skim milk (in TBST) and incubated overnight at 4°C. After washing three times with TBST for 10 minutes each, the secondary antibody, HRP (1:1000, Thermofisher), was incubated for 1 hour at room temperature. After washing three times with TBST for 10 minutes each, detection was performed with ECL buffer (GenDEPOT, W3652-020).

[0617]

[0618] (2) Results

[0619] The results of confirming the dopaminergic neuron marker (Tyrosine Hydroxylase; TH) of the control group, 6-OHDA treatment group (Ndst3 untreated group), and Ndst3 treatment group (6-OHDA and Ndst3 treatment groups) are disclosed in Fig. 8. Fig. 8A shows the results of confirming the expression of the neuron marker (TH) of the control group (control), 6-OHDA treatment group (6-OHDA), and Ndst3 treatment group (6-OHDA+Ndst3) through Western blotting. Fig. 8B is a graph that quantifies the results of Fig. 8A. The analysis results confirmed that the expression level of the dopaminergic neuron marker TH was higher in the Ndst3 treatment group than in the 6-OHDA treatment group (Fig. 8). The results of increased expression of TH, a dopaminergic neuron marker, in the NDST3-treated group compared to the 6-OHDA-treated group indicate that dopaminergic neurons increased due to NDST3 treatment.

[0620]

[0621] Action potential and resting membrane potential analysis

[0622] (1) Method

[0623] Action potential and resting membrane potential analyses were performed on groups cultured for 10 days after Ndst3 treatment in primary dopaminergic neuron culture dishes. Whole-cell electrical response recordings of neurons were recorded in artificial cerebrospinal fluid (aCSF in mM: 124 NaCl, 2.5 KCl, 1.2 NaH2PO4, 24 NaHCO3, 5 HEPES, 12.5 glucose, 2 MgSO4, and 2 CaCl2, pH 7.4). Electrical responses were acquired using a Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA), DigiDATA (Molecular Devices, Sunnyvale, CA), and pClamp software (version 10.6, Molecular Device). Patch pipettes with a resistance of 4–8 MΩ were used and filled with internal aqueous solution (in mM: 120 K-gluconate, 10 KCl, 2 Mg-ATP, 0.5 Na-GTP, 0.5 EGTA, 20 HEPES, and 10 phosphocreatine, pH 7.3). Neuronal action potentials were measured using current steps (20 pA / step from 0 pA to 140 pA).

[0624]

[0625] (2) Results

[0626] The results of the analysis of action potentials and resting membrane potentials of the control group, the 6-OHDA-treated group (Ndst3-untreated group), and the Ndst3-treated group (6-OHDA and Ndst3-treated groups) are disclosed in Figs. 09 to 11. Fig. 09 shows the results of analyzing the action potential (AP) of each group. Fig. 10 shows the results of analyzing the AP firing rate of each group. Fig. 11 shows the results of analyzing the resting membrane potential of each group. The electrophysiological analysis results confirmed that the AP firing frequency increased in the Ndst3-treated group compared to the 6-OHDA-treated group. Furthermore, it was observed that the resting membrane potential in the Ndst3-treated group recovered to a level similar to that of the control group. The results of the increased firing rate of action potentials and the recovery of resting membrane potential in the Ndst3-treated group compared to the 6-OHDA-treated group indicate that the function of neurons was restored by Ndst3.

[0627]

[0628] 2.5. Confirmation of the therapeutic effect of Ndst3 on Parkinson's disease - in vivo

[0629] Analysis of dopaminergic neuron marker (TH) expression in a 6-OHDA-induced mouse model - immunofluorescence staining analysis

[0630] (1) Method

[0631] Mice from the control group, 6-OHDA-induced Parkinson's disease group (6-OHDA treatment and Ndst3 untreated), and Ndst3 treatment group (6-OHDA treatment and Ndst3 treatment) were sacrificed 23-25 ​​days after 6-OHDA injection. The brains of the mice were then removed and fixed with 4% paraformaldehyde overnight at 4°C. Coronal sections were performed on the area including the substantia nigra of the brain. After sectioning, the tissues were transferred to dishes and washed twice with PBS for 5 minutes each. For permeabilization, PBS + 0.1% Triton-X was added to the container containing the tissues and incubated at room temperature for 10 minutes. For blocking, 1% BSA + PBST (PBS + 0.1% Tween 20) was added to the dishes and incubated at room temperature for 30 minutes. For immunofluorescence staining analysis, anti-TH antibody (Millipore, 1:1000) was used as the primary antibody. Anti-TH antibody was added to 1% BSA + PBST (PBS + 0.1% Tween 20) and incubated overnight at 4°C. After washing three times with PBS for 5 minutes each, secondary antibody Alexa Fluor TM 488 antibody (ThermoFisher, 1:1000) was added to 1% BSA + PBST (PBS + 0.1% Tween 20) and incubated in the dark at room temperature for 1 hour. After washing three times with PBS for 5 minutes each, DAPI staining was performed.

[0632]

[0633] (2) Results

[0634] Figures 12 and 13 show the results of confirming the expression of a neuronal marker (TH) by immunofluorescence staining after treating a 6-OHDA-induced Parkinson's disease mouse model with Ndst3. Figure 12 discloses the results of confirming the expression of a neuronal marker (TH) in the control group not treated with 6-OHDA and Ndst3 (indicated as Sham in the figure), 6-OHDA-induced Parkinson's disease mice (6-OHDA-treated group; 6-OHDA-treated and Ndst3-untreated; indicated as 6-OHDA in the figure), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated; indicated as 6-OHDA + Ndst3 in the figure). Figure 13 quantifies the results of the neuronal marker (TH) expression. In a Parkinson's disease mouse model, Ndst3 treatment resulted in an increase in the expression of TH (Tyrosine hydroxylase), a neuronal marker, compared to Ndst3-untreated Parkinson's disease mice. The increased expression of TH, a neuronal marker, in the Ndst3-treated group indicates an increase in dopaminergic neurons.

[0635]

[0636] Analysis of dopaminergic neuron marker expression (TH, DAT) in a 6-OHDA-induced mouse model - DAB staining analysis

[0637] (1) Method

[0638] Mice from the control group, 6-OHDA-induced Parkinson's disease group (6-OHDA treatment and Ndst3 untreated), and Ndst3 treatment group (6-OHDA treatment and Ndst3 treatment) were sacrificed 23-25 ​​days after 6-OHDA injection. The brains of the mice were removed and fixed with 4% paraformaldehyde overnight at 4°C. Coronal sections were performed on regions including the striatum or substantia nigra of the brain. After sectioning, the tissues were transferred to a dish and washed twice with PBS for 5 minutes each. For permeabilization, PBS + 0.1% Triton-X was added and incubated at room temperature for 10 minutes. The tissues were washed three times with PBS for 5 minutes each. For blocking, 1% BSA + PBST (PBS + 0.1% Tween 20) was added and incubated at room temperature for 30 minutes. As the primary antibody, anti-TH antibody (Millipore, 1:1000) was used for TH expression analysis, and anti-DAT antibody (Millipore, 1:1000) was used for DAT expression analysis. The primary antibody (anti-TH antibody or anti-DAT antibody) was added to 1% BSA + PBST and incubated at 4℃ overnight. After washing three times with PBS for 5 minutes each, the secondary antibody horseradish peroxidase (HRP) (ThermoFisher, 1:1000) was added to 1% BSA + PBST and incubated at room temperature for 1 hour. Color development was performed using the DAB Substrate Kit (Abcam).

[0639]

[0640] (2) TH expression analysis results

[0641] Figures 14 and 15 show the results of confirming the expression of the neuronal marker (TH) in the substantia nigra (SN) and striatum (ST) by immunostaining (DAB staining) after treating Ndst3 in a 6-OHDA-induced Parkinson's disease mouse model. Figure 14 discloses the results of confirming the expression of the neuronal marker (TH) in the control group not treated with 6-OHDA and Ndst3 (Healthy control; indicated as Sham), 6-OHDA-induced Parkinson's disease mice (6-OHDA-treated and Ndst3-untreated; indicated as 6-OHDA), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated; indicated as 6-OHDA + Ndst3). Figure 15 quantifies the results of Figure 14. As a result of Ndst3 treatment in a Parkinson's disease mouse model, it was confirmed that the expression level of TH (Tyrosine hydroxylase), a neuronal cell marker, increased compared to Parkinson's disease mice not treated with Ndst3.

[0642] Figures 16 and 17 show the results of confirming the expression of the neuronal marker (TH) in the lateral substantia nigra (SNL), substantia nigra pars compacta (SNc), and ventral tegmental area (VTA) by immunostaining (DAB staining) after treating Ndst3 in a 6-OHDA-induced Parkinson's disease mouse model. Figure 16 discloses the results of confirming the expression of the neuronal marker (TH) in each region (SNL, SNc, VTA) of the control group not treated with 6-OHDA and Ndst3 (indicated as Sham), 6-OHDA-induced Parkinson's disease mice (6-OHDA-treated and Ndst3-untreated; indicated as 6-OHDA), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated; indicated as 6-OHDA + Ndst3). Figure 17 quantifies the results of Figure 16. In a Parkinson's disease mouse model, Ndst3 treatment resulted in an increase in the expression of TH (Tyrosine hydroxylase), a neuronal marker, in each region compared to Ndst3-untreated Parkinson's disease mice. The increased expression of TH, a neuronal marker, in the NDST3-treated group indicates an increase in dopaminergic neurons.

[0643]

[0644] (3) DAT expression analysis results

[0645] Figures 18 and 19 show the results of confirming the expression of a neuronal marker (DAT) in the substantia nigra (SN) after treating a 6-OHDA-induced Parkinson's disease mouse model with Ndst3 using immunostaining (DAB staining). Figure 18 discloses the results of confirming the expression of a neuronal marker (DAT) in the control group not treated with 6-OHDA and Ndst3 (Healthy control; indicated as Sham), 6-OHDA-induced Parkinson's disease mice (6-OHDA-treated and Ndst3-untreated; indicated as 6-OHDA), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated; indicated as 6-OHDA + Ndst3). Figure 19 quantifies the results of Figure 18. In a Parkinson's disease mouse model, Ndst3 treatment increased the expression of the neuronal marker DAT (Dopamine transporter) compared to untreated Parkinson's disease mice. The increased expression of the neuronal marker DAT in the NDST3-treated group indicates an increase in dopaminergic neurons.

[0646]

[0647] Analysis of NDST3 expression in a 6-OHDA-induced mouse model - qPCR analysis

[0648] (1) Method

[0649] Mice from the control group, 6-OHDA-induced Parkinson's disease group (6-OHDA-treated and Ndst3-untreated), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated) were sacrificed on days 23–25 after 6-OHDA injection. Afterwards, brain regions including the substantia nigra of the mice were collected. RNA was extracted from the tissues according to the protocol using an RNA extraction kit (Qiagen, 74104). The extracted RNA was analyzed by AccuPower® CycleScript TMcDNA was synthesized using RT PreMix & Master Mix (Bioneer). qPCR (SYBR Green Realtime PCR Master Mix, enzynomics) was performed. The primers used are listed in Table 7 below.

[0650] Table 07. Primer Information

[0651]

[0652]

[0653] (2) Results

[0654] Figure 20 shows the results of confirming the expression of Ndst3 through real-time polymerase chain reaction (qRT-PCR) after treating Ndst3 in a 6-OHDA-induced Parkinson's disease mouse model. Figure 20 shows the results of confirming the expression of Ndst3 in the control group (indicated as sham in the figure), the 6-OHDA-induced Parkinson's disease mouse model (indicated as 6-OHDA in the figure), and the Ndst3 treatment group (indicated as 6-OHDA+Ndst3 in the figure). When Ndst3 was treated in the 6-OHDA-induced Parkinson's disease mouse model, the expression level of Ndst3 was confirmed to be higher than in the 6-OHDA treatment group (Figure 20). These results confirm that Ndst3 treatment in the Parkinson's disease-induced mouse model increases the expression of Ndst3, which was reduced in the Parkinson's disease-induced mice.

[0655]

[0656] Analysis of dopaminergic neuron marker expression (TH, DAT) in an MPTP-induced mouse model - DAB staining analysis

[0657] (1) Method

[0658] Mice from the control group, MPTP-induced Parkinson's disease group (MPTP-treated and Ndst3-untreated), and Ndst3-treated group (MPTP-treated and Ndst3-treated) were sacrificed on days 37-39. The brains were then removed and fixed with 4% paraformaldehyde overnight at 4°C. Coronal sections were performed on regions including the striatum or substantia nigra. After sectioning, the tissues were transferred to a dish and washed twice with PBS for 5 minutes each. For permeabilization, PBS + 0.1% Triton-X was added and incubated at room temperature for 10 minutes. The tissues were washed three times with PBS for 5 minutes each. For blocking, 1% BSA + PBST (PBS + 0.1% Tween 20) was added and incubated at room temperature for 30 minutes. For the primary antibody, anti-TH antibody (Millipore, 1:1000) was used for TH expression analysis, and anti-DAT antibody (Millipore, 1:1000) was used for DAT expression analysis. The primary antibody (anti-TH antibody or anti-DAT antibody) was added to 1% BSA + PBST and incubated overnight at 4℃. After washing three times with PBS for 5 minutes each, the secondary antibody horseradish peroxidase (HRP) (ThermoFisher, 1:1000) was added to 1% BSA + PBST and incubated at room temperature for 1 hour. Color development was performed using the DAB Substrate Kit (Abcam).

[0659]

[0660] (2) TH expression analysis results

[0661] Figures 21 and 22 show the results of confirming the expression of the neuronal marker (TH) in the striatum (ST) and substantia nigra (SN) by immunohistochemistry (DAB staining) after treating Ndst3 in a MPTP-induced Parkinson's disease mouse model. Figure 21 shows the results of confirming the expression of the neuronal marker (TH) in the control group (indicated as Sham in the figure), the MPTP-induced Parkinson's disease mouse group (indicated as MPTP in the figure), and the Ndst3 treatment group (indicated as MPTP+Ndst3 in the figure). Figure 22 quantifies the results of Figure 21. As a result of treating the MPTP-induced Parkinson's disease mouse model with Ndst3, it was confirmed that the expression amount of the neuronal marker TH increased compared to the MPTP treatment group. The increase in the expression of the neuronal marker TH in the Ndst3-treated group indicates an increase in dopaminergic neurons.

[0662]

[0663] (3) DAT expression analysis results

[0664] Figures 23 and 24 show the results of confirming the expression of the neuronal marker (DAT) in the substantia nigra (SN) by immunostaining (DAB staining) after treating Ndst3 in a MPTP-induced Parkinson's disease mouse model. Figure 23 shows the results of confirming the expression of the neuronal marker (DAT) in the control group, the MPTP-induced Parkinson's disease mouse group, and the Ndst3 treatment group. Figure 24 is a graph that quantifies the results of Figure 23. As a result of treating Ndst3 in the MPTP-induced Parkinson's disease mouse model, it was confirmed that the expression of the neuronal marker DAT increased compared to the MPTP treatment group. The increase in the expression of the neuronal marker DAT in the NDST3-treated group indicates an increase in dopaminergic neurons.

[0665]

[0666] Behavioral Analysis - Rotation Test

[0667] The inventors of the present application performed a rotation test on a 6-OHDA-induced Parkinson's mouse model treated with Ndst3. At least 21 days after 6-OHDA treatment, mice from the control group, 6-OHDA-treated group (6-OHDA treatment and no Ndst3 treatment), and Ndst3-treated group (6-OHDA treatment and Ndst3 treatment) were placed in a cylinder and observed for 5 minutes. Rotation was calculated by quantifying the direction of rotation.

[0668] The results of the rotational test are shown in Figure 25. Figure 25A shows photographs of mice from each group undergoing the rotational test. Figure 25B is a graph quantifying the results of the rotational test. The results of the rotational test confirmed that the Ndst3-treated group recovered a similar degree of directionality as the control group.

[0669]

[0670] Behavioral Analysis - Tail Suspension Test

[0671] The inventors of the present invention treated a 6-OHDA-induced Parkinson's mouse model with Ndst3 and then performed a tail suspension test. At least 21 days after the 6-OHDA treatment, mice from the control group, the 6-OHDA-treated group (6-OHDA treatment and no Ndst3 treatment), and the Ndst3-treated group (6-OHDA treatment and Ndst3 treatment) were placed in a tail suspension device and observed for 5 minutes. The direction of movement of the mice was quantified to calculate behavioral characteristics.

[0672] The results of the tail suspension test for the control group, 6-OHDA treatment group, and Ndst3 treatment group are disclosed in Figure 26. Figure 26A shows photographs of mice in each group undergoing the tail suspension test. Figure 26B is a graph quantifying the results of the tail suspension test. The results of the tail suspension test confirmed that the Ndst3 treatment group recovered behavioral abilities similar to those of the control group.

[0673]

[0674] 2.6. Confirmation of the therapeutic effect of Ndst3 on Parkinson's disease through intrathecal administration - in vivo

[0675] Intrathecal injection (administration into the cisterna magna) of an AAV vector encoding Ndst3

[0676] The AAV vector encoding Ndst3 obtained in "1. Obtaining the AAV vector encoding Ndst3" was injected into the cisterna magna region of the 6-OHDA-induced Parkinson's disease mouse model prepared in "2.2. Preparation of a Parkinson's disease mouse model through 6-OHDA and administration of an AAV vector encoding Ndst3." Specifically, 5 days after preparation of the Parkinson's disease model, 1 x 10 10 An AAV vector encoding Ndst3 in GC / Head was injected.

[0677]

[0678] Behavioral Analysis - Cylinder Test

[0679] At least 21 days after 6-OHDA treatment, mice in the control group, 6-OHDA-treated group (6-OHDA-treated and Ndst3-untreated), and Ndst3-treated group (6-OHDA-treated and Ndst3-treated) were placed in cylinders and observed for 5 minutes. The behavior of the mice was analyzed by measuring the number of times the ipsilateral and contralateral forelimbs of the mice touched the cylinder wall.

[0680] The behavioral analysis results of the control group, 6-OHDA group, and Ndst3 treatment group are disclosed in Figure 27. Figure 27A is a graph quantifying the number of times each group used the ipsilateral forelimb. Figure 27B is a graph quantifying the number of times each group used the contralateral forelimb. The cylinder test results confirmed that the Ndst3 treatment group showed a recovery in behavior compared to the 6-OHDA treatment group.

[0681]

[0682] The above results show that Ndst3 is effective in the recovery and treatment of Parkinson's disease symptoms.

Claims

1. A pharmaceutical composition for treating Parkinson's disease comprising: A vector comprising a nucleic acid encoding NDST3 protein.

2. In paragraph 1, A pharmaceutical composition wherein the above vector is a viral vector.

3. In paragraph 2, A pharmaceutical composition wherein the viral vector is any one of retrovirus, lentivirus, adenovirus, adeno-associated virus, vaccinia virus, poxvirus, human immunodeficiency virus (HIV), murineleukemia virus (MLV), avian sarcoma / leukosis (ASLV), spleen necrosis virus (SNV), rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), herpes simplex virus, epizomal, and herpes simplex virus.

4. In paragraph 2, A pharmaceutical composition wherein the viral vector is an adeno-associated virus (AAV) vector.

5. In paragraph 4, A pharmaceutical composition wherein the AAV is any one selected from among AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-retro, AAV-PHP.B, AAV-PHP.eB, and AAV-PHP.S.

6. In paragraph 4, A pharmaceutical composition wherein the above AAV is AAV9.

7. In paragraph 1, A pharmaceutical composition wherein the above vector is a non-viral vector.

8. In paragraph 7, A pharmaceutical composition wherein the non-viral vector is any one selected from the group consisting of a plasmid, a phage, naked DNA, a DNA-RNA lipid complex, a liposome, a nanoparticle, a DNA-polymer complex, mRNA, an artificial chromosome, and a cosmid.

9. In paragraph 1, A pharmaceutical composition, characterized in that the pharmaceutical composition further comprises one or more pharmaceutically acceptable additional components.

10. In paragraph 9, A pharmaceutical composition wherein each of the above pharmaceutically acceptable additional components is independently selected from a carrier, an excipient, a diluent, and a preservative.

11. In paragraph 1, A pharmaceutical composition wherein the above NDST3 protein is a human NDST3 protein.

12. In paragraph 1, A pharmaceutical composition wherein the human NDST3 protein is a wild-type human NDST3 protein or a mutant thereof.

13. In paragraph 11, A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having 80% or more and less than 100% sequence identity thereto.

14. In paragraph 11, A pharmaceutical composition, wherein the human NDST3 protein has an amino acid sequence of SEQ ID NO:

01.

15. In paragraph 11, A pharmaceutical composition wherein the human NDST3 protein is a wild-type human NDST3 protein or a functional equivalent thereof.

16. In paragraph 11, The human NDST3 protein is a variant of a wild-type human NDST3 protein, wherein the variant of the wild-type NDST3 protein comprises a conservative substitution of one or more amino acid residues from the wild-type human NDST3 protein having the amino acid sequence of SEQ ID NO: 01, A pharmaceutical composition wherein the human NDST3 protein has an amino acid sequence having a sequence identity of 80% or more and less than 100% with the amino acid sequence of the wild-type human NDST3 protein.

17. In paragraph 1, A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein comprises an NDST3 protein coding region, wherein the NDST3 protein coding region has a nucleic acid sequence encoding the NDST3 protein.

18. In paragraph 17, A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a DNA sequence, an RNA sequence, or a DNA / RNA hybrid sequence.

19. In paragraph 17, A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the NDST3 gene, the ORF (open reading frame) sequence of the NDST3 gene, the CDS (coding sequence) of the NDST3 gene, or the cDNA sequence of the NDST3 gene.

20. In paragraph 17, A pharmaceutical composition having a nucleic acid sequence encoding the above NDST3 protein, the full-length sequence of the wild-type human NDST3 gene, the ORF sequence of the wild-type human NDST3 gene, the CDS of the wild-type human NDST3 gene, or the cDNA sequence of the wild-type human NDST3 gene.

21. In paragraph 17, A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having a sequence identity of 80% or more and less than 100% thereto.

22. In paragraph 17, A pharmaceutical composition wherein the nucleic acid sequence encoding the above NDST3 protein is the nucleic acid sequence of SEQ ID NO:

07.

23. In paragraph 17, A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises one or more additional elements.

24. In paragraph 23, A pharmaceutical composition, wherein each of the one or more additional elements is independently selected from a promoter, an enhancer, a polyadenylation signal, a Kozak consensus sequence, an inverted terminal repeat (ITR), a long terminal repeat (LTR), a terminator, an origin of replication, a multicloning site (MCS), an internal ribosome entry site (IRES), a nuclear localization signal coding sequence, and 2A self-cleaving peptides.

25. In paragraph 17, A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

26. In paragraph 25, A pharmaceutical composition, wherein the promoter is an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

27. A pharmaceutical composition for treating Parkinson's disease comprising: Viral vector encoding NDST3 protein, At this time, the viral vector encoding the NDST3 protein contains a nucleic acid encoding the NDST3 protein.

28. In paragraph 27, A pharmaceutical composition wherein the above NDST3 protein has an amino acid sequence of SEQ ID NO: 01 or an amino acid sequence having 80% or more and less than 100% sequence identity thereto.

29. In paragraph 27, A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein comprises an NDST3 protein coding region, wherein the NDST3 protein coding region has a nucleic acid sequence of SEQ ID NO: 07 or a nucleic acid sequence having a sequence identity of 80% or more and less than 100% thereto.

30. In paragraph 29, A pharmaceutical composition wherein the nucleic acid encoding the NDST3 protein further comprises a promoter, wherein the promoter is operably linked to the NDST3 protein coding region.

31. In paragraph 30, A pharmaceutical composition, wherein the promoter is an SV40 early promoter, a mouse mammary tumor virus long terminal repeat (LTR) promoter, an adenovirus major late (Ad MLP) promoter, a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter, a rous sarcoma virus (RSV) promoter, a U6 promoter, a CBA promoter, a PGK promoter, an NG2 promoter, a NES promoter, a GFAP promoter, a CaMKII promoter, a NSE promoter, a SYN1 promoter, or a CAG promoter.

32. In paragraph 27, A pharmaceutical composition wherein the above viral vector is an AAV vector.

33. In paragraph 27, A pharmaceutical composition wherein the viral vector is an AAV9 vector.

34. A method for treating Parkinson's disease in a subject comprising: Administering to a subject any one of the pharmaceutical compositions of claims 1 to 33.

35. In paragraph 34, A method wherein the subject is a subject having Parkinson's disease.

36. In paragraph 34, A method wherein the pharmaceutical composition is administered to the subject via a parenteral route.

37. In paragraph 34, A method wherein the pharmaceutical composition is administered intravenously, subcutaneously, intramuscularly, intradermally, intraperitoneally, intraarterially, intramucosally, spinally, intrathecally, nasally or intracerebrally.

Images