Pharmaceutical composition for treating inflammatory bowel disease

Abstract

The present invention relates to a pharmaceutical composition for the prevention or treatment of inflammatory bowel disease, comprising glycol chitosan-thioketal-mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient. The pharmaceutical composition for treating inflammatory bowel disease, of the present invention, can adhere to the intestinal mucosa and selectively release mesalamine only at inflammatory sites, and thus can effectively treat inflammatory bowel disease.

Description

Pharmaceutical composition for the treatment of inflammatory bowel disease

[0001] The present invention relates to a pharmaceutical composition for treating inflammatory bowel disease.

[0002] Inflammatory bowel disease (IBD) is a chronic condition characterized by the interaction of environmental and genetic factors, leading to an immune response and inflammation in the intestines. It can be broadly divided into Crohn's disease, which affects the entire gastrointestinal tract, and ulcerative colitis, which affects only the colon. Ulcerative colitis has a higher incidence. While the exact cause of the disease remains unknown, immune dysregulation is considered a key contributing factor.

[0003] Currently, treatments for inflammatory bowel disease include aminosalicylates, steroids, immunosuppressants, and biologics. Among these, mesalamine, a member of the aminosalicylates family, is currently prescribed to patients. It is known to suppress inflammation by inhibiting Nuclear Factor-kappaB (NF-kB) signaling. However, it is rapidly excreted from the body before reaching the inflamed area, as its absorption into healthy tissues is greater than that of inflamed areas.

[0004] Therefore, there are two main cases in which mesalamine has been used to selectively release drugs in the intestine for the treatment of inflammatory bowel disease.

[0005] First, Asacol, a mesalamine drug applied to capsules that decomposes according to the pH of the intestine, is released not only at the site of inflammation but also throughout the entire intestine, failing to resolve unnecessary absorption in normal areas compared to the site of inflammation. In addition, because it releases a large dose of the drug all at once rather than continuously, it is accompanied by various side effects such as bone marrow suppression and dizziness. Therefore, it requires delivery of a larger amount of drug than is effective in recovering from inflammation, and there are limitations in that the amount excreted due to saturation is greater than the amount actually absorbed.

[0006] Sulfasalazine, developed to address this issue, is a drug that releases mesalamine through intestinal microbes. However, the byproducts released during the breakdown of mesalamine can cause side effects, making patients reluctant to take it.

[0007]

[0008] To improve these problems, the inventors conducted extensive research and designed a pharmaceutical composition for treating inflammatory bowel disease.

[0009] The present invention relates to a pharmaceutical composition for treating inflammatory bowel disease, Glycol chitosan-Thioketal-Mesalamine (GC-M), and more particularly, to a therapeutic agent capable of adsorbing to the intestinal mucosa and selectively releasing a mesalamine drug only at the site of inflammation, in order to improve the above-mentioned problems.

[0010]

[0011] The glycol chitosan of the present invention possesses a large number of cation-rich amine groups, which allows it to interact with the anionic intestinal mucosal mucin layer, resulting in high binding affinity and a long intestinal retention time. Therefore, it plays a role in ensuring that the therapeutic agent of the present invention remains persistently in the intestinal mucosal layer.

[0012] In addition, by utilizing the characteristic that a large amount of reactive oxygen species (ROS) exist in the inflamed area of ​​the intestine compared to the normal area of ​​the intestine, a linker called Thioketal, which can be decomposed by various ROS, is used to bind mesalamine, a drug for treating inflammatory bowel disease, to Glycol chitosan, thereby selectively releasing the mesalamine drug only in the inflamed area.

[0013] To improve these problems, the inventors conducted extensive research and found that:

[0014] A pharmaceutical composition (Glycol chitosan-Thioketal-Mesalamine, GC-M) for the treatment of inflammatory bowel disease was designed.

[0015]

[0016] Accordingly, the present invention

[0017] The purpose of the present invention is to provide a pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0018] In addition, the present invention

[0019] The purpose is to provide a pharmaceutical preparation for preventing or treating inflammatory bowel disease, comprising the above composition.

[0020] In addition, the present invention

[0021] The purpose is to provide a health functional food for preventing or improving inflammatory bowel disease, comprising the above composition.

[0022] In order to achieve the above purpose, the present invention

[0023] A pharmaceutical composition for preventing or treating inflammatory bowel disease is provided, comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0024] In one embodiment of the present invention, the Glycol chitosan may be capable of being absorbed into the intestinal mucosa.

[0025] In another embodiment of the present invention, the Thioketal may be decomposed by ROS at the site of inflammation to selectively release the drug.

[0026] In another embodiment of the present invention, the drug may be Mesalamine.

[0027] In another embodiment of the present invention, the composition may inhibit the production of one or more selected from the group consisting of intracellular reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO).

[0028] In another embodiment of the present invention, the composition may restore tight junctions between cells.

[0029] In another embodiment of the present invention, the composition may inhibit macrophage M1 polarization.

[0030] In another embodiment of the present invention, the composition may suppress the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1 β).

[0031] In another embodiment of the present invention, the composition may be capable of restoring a damaged colon.

[0032] In another embodiment of the present invention, the inflammatory bowel disease may be at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and enteritis.

[0033] In addition, the present invention

[0034] A pharmaceutical preparation for preventing or treating inflammatory bowel disease, comprising the above composition, is provided.

[0035] In one embodiment of the present invention, the formulation may be in the form of an oral dosage form, an injection form, an infusion form, a spray form, or a liquid form.

[0036] In addition, the present invention

[0037] A health functional food for preventing or improving inflammatory bowel disease comprising the above composition is provided.

[0038] In addition, the present invention

[0039] Provided is a pharmaceutical composition comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient for the prevention or treatment of inflammatory bowel disease.

[0040] In addition, the present invention

[0041] A method for preventing or treating inflammatory bowel disease is provided, comprising administering to a subject a pharmaceutical composition comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0042] By the pharmaceutical composition for treating inflammatory bowel disease of the present invention, inflammatory bowel disease can be effectively treated by being able to be absorbed into the intestinal mucosa and selectively releasing the mesalamine drug only at the site of inflammation.

[0043]

[0044] It should be understood that the effects of the present invention are not limited to the effects mentioned above, but include all effects that can be inferred from the detailed description of the present invention or the composition of the invention described in the claims.

[0045] Figure 1 is a schematic diagram for synthesizing Glycol chitosan-thioketal-Mesalamine.

[0046] Figure 2 is a test conducted to confirm whether each component of Glycol chitosan-thioketal-Mesalamine has its own unique chemical properties. 1 This is the result of H-NMR analysis.

[0047] Figure 3 shows the results of comparative measurements of particle size and Zeta potential to evaluate the stability of the drug Glycol chitosan-thioketal-Mesalamine according to pH changes in the intestines when administered orally.

[0048] Figure 4 is a TEM microscope image taken to confirm whether Glycol chitosan-thioketal-Mesalamine is decomposed in the intestinal inflammatory region.

[0049] Figure 5 is the result of Beer Lambert's Law analysis based on an absorbance graph for wavelength values ​​according to the concentration of mesalamine.

[0050] Figure 6 shows the concentration obtained by measuring the absorbance of released mesalamine under ROS environment (H2O2) conditions and measuring the amount of mesalamine released from Glycol chitosan-thioketal-Mesalamine according to the H2O2 concentration in the intestinal inflammation site.

[0051] Figure 7 shows the results of quantitative determination of the binding ratio (w / w) of Glycol chitosan-thioketal and Mesalamine.

[0052] Figure 8 is a graph analyzing the amount of mesalamine released when treated with 0.1, 1, and 10 mM H2O2.

[0053] Figure 9 shows the results of liquid chromatography-mass spectrometry performed to confirm whether the substance released by Glycol chitosan-thioketal-Mesalamine is intact mesalamine.

[0054] Figure 10 is a schematic diagram of the mechanism for releasing mesalamine in its entirety without the functional group of thioketal.

[0055] Figure 11 shows the results of a CCK assay conducted to evaluate the cytotoxicity of GC-M against immune cells (RAW 264.7) and intestinal epithelial cells (Caco-2 cells).

[0056] Figure 12 shows the results of measuring the degree to which the production of extracellular NO released by treating cells in an inflammatory environment induced by LPS with GC, GC-TK, mesalamine, and GC-M was suppressed to confirm the RNS scavenging activity of GC-M.

[0057] Figure 13 shows the results of measuring the degree to which the production of extracellular ROS released when GC, GC-TK, mesalamine, and GC-M were treated in cells in a ROS environment to confirm the intracellular ROS scavenging activity of GC-M.

[0058] Figure 14 shows the results of measuring the amount of mesalamine absorbed by cells when thioketal is broken down by ROS in the inflammatory environment and released when GC-M is treated to cells in the inflammatory environment to quantify mesalamine cellular uptake in the inflammatory environment.

[0059] Figure 15 shows the results of measuring the TEER value over time of an intestinal cell model to determine whether the intestinal cells formed complete tight junctions.

[0060] Figure 16 shows the results of measuring TEER values ​​in a ROS environment of an intestinal cell model to measure the ability of tight junction damage to recover.

[0061] Figure 17 shows the results of immunofluorescence staining performed to evaluate the tight junction recovery efficacy of GC-M in an environment of damaged intestinal epithelial cells.

[0062] Figure 18 shows the results of FACS analysis to confirm the inhibitory effect of GC-M on macrophage M1 polarization in an inflammatory environment.

[0063] Figure 19 shows the qPCR results to confirm the inhibitory effect of GC-M on inflammatory cytokines in an inflammatory environment.

[0064] Figure 20 shows the results of ELISA to confirm the inhibitory effect of GC-M on inflammatory cytokines in an inflammatory environment.

[0065] Figure 21 shows the results of FITC staining to confirm the intestinal mucosal adsorption effect of GC-M.

[0066] Figure 22 is a drawing showing the establishment of an inflammatory bowel disease animal model by supplying 2.5% DSS drinking water to confirm the anti-inflammatory effect of GC-M treatment at various concentrations in an IBD mouse model induced by dextran sodium sulfate (DSS).

[0067] Figure 23 shows the results of measuring the change in body weight of an IBD mouse model induced by dextran sodium sulfate (DSS) to confirm the anti-inflammatory effect of treating an IBD mouse model with GC-M at various concentrations.

[0068] Figure 24 shows the results of measuring the survival rate of an IBD mouse model induced by dextran sodium sulfate (DSS) to confirm the anti-inflammatory effect of GC-M treatment at various concentrations.

[0069] Figure 25 shows the results of measuring the DAI (Disease activity index) value of an IBD mouse model induced by dextran sodium sulfate (DSS) to confirm the anti-inflammatory effect when GC-M was treated at various concentrations in the IBD mouse model.

[0070] Figure 26 shows the results of measuring the colon length of an IBD mouse model to confirm the anti-inflammatory effect of treating GC-M at various concentrations in an IBD mouse model induced by dextran sodium sulfate (DSS).

[0071] Figure 27 shows the results of H&E staining to observe damage and recovery of intestinal tissue.

[0072] Figure 28 shows the results of immunofluorescence staining to confirm the recovery of intestinal proteins and mucin proteins.

[0073] Figure 29 shows the results of a qRT-PCR experiment to confirm the anti-inflammatory effect of GC-M in the DSS negative model.

[0074] Hereinafter, the present invention will be described in detail.

[0075] The present invention

[0076] A pharmaceutical composition for preventing or treating inflammatory bowel disease is provided, comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0077] The term "Glycol chitosan" refers to a water-soluble chitosan derivative produced by conjugation of chitosan and ethylene glycol. The glycol chitosan exhibits non-cytotoxicity and biocompatibility, and can increase intestinal mucosal absorption or drug persistence, and is represented by the following chemical formula 1.

[0078] [Chemical Formula 1]

[0079]

[0080]

[0081] The above term "Thioketal" is a compound formed by combining a thioether and a carbonyl compound, and has the reactivity to be decomposed into a carbonyl compound and a thiol compound when the double bond is oxidized. In the present invention, taking into account the fact that a large amount of reactive oxygen species (ROS) exist in inflamed areas of the intestine compared to normal areas of the intestine, Thioketal, which can be decomposed by various ROS, was used as a linker to conjugate Glycol chitosan and Mesalamine. The Thioketal of the present invention plays a role in selectively releasing the mesalamine drug only in the inflamed area.

[0082] The term "Mesalamine" refers to 5-aminosalicylic acid (5-ASA), also known as mesalazine. It is a drug used to treat inflammatory bowel diseases, including ulcerative colitis and Crohn's disease. Common side effects include headache, nausea, abdominal pain, and fever, while serious side effects include pericarditis, liver disease, and renal failure. Therefore, to minimize these side effects, the present invention aims to administer only a therapeutically effective amount, as represented by the following [Chemical Formula 2].

[0083] [Chemical Formula 2]

[0084]

[0085]

[0086]

[0087] The term "inflammatory bowel disease" refers to a number of diseases characterized by chronic and recurrent inflammation in the intestines, including the small and large intestines, and is emerging as a public health challenge worldwide, but the exact cause of the disease is unknown.

[0088] The above term “prevention” may mean any act of suppressing inflammatory bowel disease in a subject or delaying the onset of disease due to inflammatory bowel disease by administering a pharmaceutical composition according to the present invention.

[0089] The term "treatment" above may mean any action by which the symptoms of an inflammatory bowel disease in a subject are improved or beneficially changed by administration of a pharmaceutical composition according to the present invention.

[0090] The term "administration" refers to introducing a given substance into a subject in an appropriate manner, and "subject" refers to any living organism, including rats, mice, and livestock, including humans, that may have inflammatory bowel disease. A specific example may be a mammal, including humans.

[0091] In one embodiment of the present invention, the Glycol chitosan may be capable of being absorbed into the intestinal mucosa.

[0092] In another embodiment of the present invention, the Thioketal may be decomposed by ROS at the site of inflammation to selectively release the drug.

[0093] In another embodiment of the present invention, the drug may be Mesalamine.

[0094] In another embodiment of the present invention, the composition may inhibit the production of one or more selected from the group consisting of intracellular reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO).

[0095] In another embodiment of the present invention, the composition may restore tight junctions between cells.

[0096] The above term "tight junction" refers to one of the intercellular junctions observed in the human epidermis, located in the intercellular space of the epidermal granular cell layer, which performs various biological functions, including a barrier function that connects adjacent cells and regulates the movement of electrolytes and water.

[0097] In another embodiment of the present invention, the composition may inhibit macrophage M1 polarization.

[0098] The term "macrophage M1 polarization" refers to the process by which macrophages are activated into a pro-inflammatory phenotype. This process is induced by stimuli such as LPS, leading to increased production of inflammatory cytokines (TNF-α, IL-1β, IL-6), and the expression of iNOS, an enzyme that generates nitric oxide (NO), which increases NO production. This process then plays a role in pathogen removal, antigen presentation, and tissue destruction.

[0099] Although M1 polarization occurs early in infection to initiate an inflammatory response and eliminate the pathogen, persistent M1 phenotype can lead to tissue damage due to excessive inflammation.

[0100] In another embodiment of the present invention, the composition may suppress the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1 β).

[0101] The term "cytokine" refers to a relatively small immune protein found in the blood. It is a broad, loosely packed protein secreted by immune cells and plays a crucial role in cell signaling. After being secreted, cytokines can affect other cells or the cells themselves.

[0102] In another embodiment of the present invention, the composition may be capable of restoring a damaged colon.

[0103] In inflammatory bowel disease, colon length is used as an important indicator of recovery. As inflammatory bowel disease worsens, the colon shortens and thickens due to inflammation, swelling, spasms, and fibrosis. Severe inflammation can reduce colon length and impair intestinal function. Therefore, recovery of colon length indicates a reduction in inflammation and restoration of intestinal function.

[0104] In another embodiment of the present invention, the inflammatory bowel disease may be at least one selected from the group consisting of Crohn's disease, ulcerative colitis, intestinal Behcet's disease, and enteritis.

[0105] Additionally, the pharmaceutical composition may be provided as a pharmaceutical composition containing the active ingredient alone or including one or more pharmaceutically acceptable carriers, excipients or diluents.

[0106] Specifically, the carrier may be, for example, a colloidal suspension, a powder, a saline solution, a lipid, a liposome, microspheres, or nano-spheres. These may be complexed or associated with a carrier vehicle and may be transported in vivo using carrier systems known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation agents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances, or fatty acids.

[0107] When the above pharmaceutical composition is formulated, it can be prepared using diluents or excipients such as lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, bulking agents, binders, wetting agents, disintegrating agents, and surfactants that are commonly used. Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and such solid preparations can be prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. Preparations for parenteral administration may include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases may include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin. When manufacturing in the form of eye drops, known diluents or excipients may be used.

[0108] The above pharmaceutical composition may be provided mixed with a pharmaceutical composition for the prevention or treatment of another inflammatory bowel disease, and the pharmaceutical composition for the prevention or treatment of another inflammatory bowel disease may be a pharmaceutical composition for the prevention or treatment of an inflammatory bowel disease known in the art or a pharmaceutical composition for the prevention or treatment of an inflammatory bowel disease that is newly developed.

[0109] When the above pharmaceutical composition further comprises a pharmaceutical composition for the prevention or treatment of the other inflammatory bowel disease or is provided mixed with a pharmaceutical composition for the prevention or treatment of the other inflammatory bowel disease, it is important to mix an amount that can achieve the maximum effect with the minimum amount without causing side effects, which can be easily determined by a person skilled in the art.

[0110] The above pharmaceutical composition may be administered without mixing with other pharmaceutical compositions for the prevention or treatment of inflammatory bowel diseases, in parallel, simultaneously, separately, or sequentially, and may be administered singly or in multiple doses. It is important to consider all of the above factors and administer the amount that achieves maximum effect with the minimum amount possible without causing side effects, a determination readily available to those skilled in the art.

[0111] The above pharmaceutical composition may be administered orally or parenterally, and when administered parenterally, the injection method may be selected from external application to the skin or intraperitoneal injection, intrarectal injection, subcutaneous injection, intravenous injection, intramuscular injection, intraarterial injection, intramedullary injection, intracardiac injection, intrathecal injection, percutaneous injection, intranasal injection, intraenteric injection, local injection, sublingual injection, or intrathoracic injection.

[0112] The above pharmaceutical composition is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level may be determined based on the type and severity of the patient's disease, the activity and sensitivity of the drug, the time of administration, the route of administration, and the excretion rate, the duration of treatment, concomitant medications, and other factors well known in the medical field.

[0113] The pharmaceutical composition may be administered once daily or in several divided doses. For example, it may be administered every other day or once a week. The administration may be once daily or in several divided doses.

[0114]

[0115] In addition, the present invention

[0116] A pharmaceutical preparation for preventing or treating inflammatory bowel disease, comprising the above composition, is provided.

[0117] The terms used in the present invention may be identical to the terms described in the pharmaceutical composition above.

[0118] In one embodiment of the present invention, the formulation may be in the form of an oral dosage form, an injection form, an infusion form, a spray form, or a liquid form.

[0119] The pharmaceutical preparation may further comprise a pharmaceutically acceptable carrier that can be conventionally added to the pharmaceutical preparation. The pharmaceutically acceptable carrier includes additives such as excipients, disintegrants, binders, lubricants, emulsifiers, suspending agents, stabilizers, and pH adjusters that are conventionally used in the pharmaceutical field, and, if necessary, sweeteners, flavoring agents, and / or coloring agents may be further added. The excipients include microcrystalline cellulose, starch, silicon dioxide (SiO2), sugar esters, Ludipress lactose, sucrose, maltose, fructose, sorbitol, and the like. Preferably, a mixture of lactose and silicon dioxide may be used. The amount of the excipient used may be about 90 wt% or less based on the total weight of the pharmaceutical preparation, but is not limited thereto. The disintegrant includes carboxymethylcellulose calcium (CMC-Ca), carboxymethylcellulose sodium (CMC-Na), crospovidone, alginic acid, etc. The amount of the disintegrant used may be in the range of 3-16 wt% based on the total weight of the pharmaceutical formulation, but is not limited thereto. The lubricant includes stearic acid, magnesium stearate, zinc stearate, glyceryl behenate, glyceryl palmitostearate, talc, etc., and may be used in an amount of about 3 wt% or less based on the total weight of the pharmaceutical formulation, but is not limited thereto.

[0120] In addition, the pharmaceutical preparation may be formulated for oral administration, and may be formulated in various forms, such as tablets, films, suspensions, granules, gels, pills, tinctures, decoctions, infusions, spirits, fluidextracts, elixirs, extracts, syrups, powders, aromatic water, lemonades, etc. The above tablets can be formulated in various forms, such as orally disintegrating tablets, mucoadhesive tablets, dispersible tablets, sublingual tablets, buccal tablets, chewable tablets, dispensing tablets, multilayered tablets, press-coated tablets, effervescent tablets, solution tablets, etc. In addition, those skilled in the art can modify and use the various tablets as needed. More preferably, it may be a dosage form that disintegrates (dissolves) in the mouth (i.e., orally disintegrating, orally soluble), such as an orally dispersible (dissolving) dosage form, such as an orally disintegrating film, an orally disintegrating tablet, a suspension, a suspension tablet, a rapid-acting disintegrating tablet, an orally disintegrating granule, an orally disintegrating troche, a sublingual tablet, a powder, and / or a chewable tablet.

[0121] The dosage of the above pharmaceutical preparation may vary depending on the patient's condition (age, sex, weight, etc.) and the severity of the condition being treated. For convenience, the total daily dosage may be divided and administered multiple times throughout the day, as needed.

[0122]

[0123] In addition, the present invention

[0124] A health functional food for preventing or improving inflammatory bowel disease comprising the above composition is provided.

[0125] The term "improvement" above may refer to any action that at least reduces a parameter related to the condition being treated, such as the severity of symptoms. In this case, the health functional food may be used before or after the onset of the disease, or concurrently with or separately from a treatment agent, to prevent or improve inflammatory bowel disease.

[0126] In the above health functional food, the active ingredient can be added directly to the food or used in combination with other foods or food ingredients, and can be used appropriately according to conventional methods. The amount of the active ingredient mixed can be appropriately determined depending on the intended use (prevention or improvement). Generally, when manufacturing a food or beverage, the health functional food can be added in an amount of about 15% by weight or less, more specifically about 10% by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range.

[0127] The above health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further comprising at least one of a carrier, a diluent, an excipient, and an additive. Foods to which the compound according to the present invention may be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, and health functional foods.

[0128] Specific examples of the carrier, excipient, diluent and additive may include at least one selected from the group consisting of lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil.

[0129] In addition to containing the above-mentioned effective ingredient, the above-mentioned health functional food may contain other ingredients as essential ingredients without special restrictions. For example, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. Examples of the above-mentioned natural carbohydrates may include conventional sugars such as monosaccharides, such as glucose, fructose, etc.; disaccharides, such as maltose, sucrose, etc.; and polysaccharides, such as dextrin, cyclodextrin, etc.; and sugar alcohols, such as xylitol, sorbitol, and erythritol. As flavoring agents other than those described above, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The proportion of the above-mentioned natural carbohydrates may be appropriately determined by a person skilled in the art.

[0130] In addition to the above, the health functional food according to the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. These ingredients may be used independently or in combination, and the ratio of these additives may also be appropriately selected by those skilled in the art.

[0131] The above health functional food may be provided mixed with a health functional food for preventing or improving inflammatory bowel disease known in the past or a health functional food for preventing or improving inflammatory bowel disease that is newly developed.

[0132] When the above health functional food further includes a health functional food for preventing or improving inflammatory bowel disease, it is important to mix the amount that can achieve the maximum effect with the minimum amount without causing side effects, and this can be easily determined by a person skilled in the art.

[0133]

[0134] To facilitate understanding of the present invention, the following examples will be described in more detail. However, these examples are intended only to exemplify the content of the present invention and are not intended to limit the scope of the present invention. These examples are provided to more fully explain the present invention to those with average knowledge in the technical field to which the invention pertains.

[0135]

[0136] [Example]

[0137] Example 1. Synthesis method of glycol chitosan-thioketal-mesalamine

[0138] Figure 1 is a schematic diagram for synthesizing Glycol chitosan-thioketal-Mesalamine.

[0139] (1) Synthesis method of thioketal

[0140] 3-Mercaptopropionic acid (5.054 ml, 8.050 M), acetone (2.129 ml, 4.025 M), and Trifluoroacetic acid (TFA) (0.022 ml, 0.004 M) were reacted together at 37°C for 6 hours, and then placed on ice for 12 hours to confirm the formation of the crystal structure of the reactant.

[0141] The crystal material was washed with n-hexane (15 ml) and cold water (15 ml), and the reaction was performed for 5 minutes in an orbital shaker (250 rpm), and the washing process was repeated 3 times to remove liquid other than the crystals through a centrifuge (800 rpm) process for 3 minutes.

[0142] After washing once with cold water on filtering paper, thioektal was dried under vacuum for 24 hours to obtain the final white solid.

[0143]

[0144] (2) Synthesis method of glycol chitosan, thioketal, and mesalamine

[0145] Thioketal (2.524 mg, 1 mM), 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (4.657 mg, 3 mM), and N-hydroxysuccinimide (NHS) (3.453 mg, 3 mM) were dissolved in 10 mL of DMSO and reacted at 23 °C for 6 hours.

[0146] Mesalamine (15.314 mg, 1 mM) was dissolved in 10 mL of DMSO, added dropwise, and reacted for 24 hours. Then, EDC (4.657 mg, 3 mM) and NHS (3.453 mg, 3 mM) were added, and reacted at 23°C for 6 hours.

[0147] An aqueous solution of Glycol chitosan (0.4%, w / v) dissolved in H2O / DMSO mixture (6 mL / 4 mL, v / v) was added dropwise, and the mixture was allowed to react for 2 days. Dialysis was performed for 2 days in the presence of DW using a 2000 Molecular Weight Cut Off (MWCO) dialysis membrane, and the mixture was frozen in a deep freezer for 1 day and then freeze-dried to obtain a powder.

[0148]

[0149] (3) Confirmation of synthesis of Glycol chitosan-thioketal-Mesalamine

[0150] To confirm whether each component of Glycol chitosan-thioketal-Mesalamine contains its own unique chemical properties, 1 H-NMR analysis was performed.

[0151] For this purpose, Glycol chitosan, Thioketal, mesalamine, Glycol chitosan-Thioketal, Glycol chitosan-Thioketal-Mesalamine (GC-M) were each dissolved in deuterium (D2O) at 125 μg / ml. 1 The unique peak of the composite was confirmed using H-NMR (Nuclear Magnetic Resonance, VNMRS 600MHz, Agilent Technologies) equipment.

[0152] As a result, as shown in Fig. 2, a unique peak of Thioketal was confirmed at 1.6 ppm, and it was also found that the corresponding peak was maintained in the experimental results of Glycol chitosan-thioketal-Mesalamine synthesized later using Thioketal. In addition, the unique peaks of Glycol chitosan, Thioketal, and mesalamine, which are the components of Glycol chitosan-thioketal-Mesalamine, were confirmed in the conjugation form (Thioketal: 1.6 ppm, Mesalazine: 6.9, 7.3, 7.7 ppm, Glycol chitosan: formed at 3-4 ppm, amine bond: 2.3 ppm).

[0153] This result indicates that Glycol chitosan-thioketal-Mesalamine was synthesized normally, as it included all the unique peaks of each component.

[0154]

[0155] Example 2. Identification of the physicochemical properties of glycol chitosan-thioketal-mesalamine.

[0156] (1) Results of comparative stability measurement according to pH

[0157] To evaluate the stability of Glycol chitosan-thioketal-Mesalamine drug according to pH changes in the intestine during oral administration, particle size and Zeta potential were measured and compared according to pH. Data are expressed as Mean ± SEM (n = 5).

[0158] First, 1 mg / ml of Glycol chitosan-thioketal-Mesalamine was dissolved in PBS, and 800 μl was placed in a cuvette for measurement. Afterwards, the hydrodynamic diameter and zeta potential were analyzed using a Zetasizer (Nano ZS, Malvern Panalytical, Worcestershire, UK).

[0159] As a result, as shown on the left side of Fig. 3, no specific change in particle size according to pH was observed, and as shown on the right side of Fig. 3, it was confirmed that although the zeta potential value slightly decreased as pH increased, no significant deformation of the particles was observed.

[0160] These results indicate that there is no transformation of Glycol chitosan-thioketal-Mesalamine due to pH changes in the intestine when administered orally.

[0161]

[0162] (2) Measurement of particle size changes in Glycol chitosan-thioketal-Mesalamine in ROS environment using TEM microscopy

[0163] To confirm whether Glycol chitosan-thioketal-Mesalamine was decomposed in a ROS environment, the size of Glycol chitosan-thioketal-Mesalamine particles was measured using a TEM microscope.

[0164] To this end, 1 mg / ml of Glycol chitosan-thioketal-Mesalamine was loaded onto a Cu-TEM grid, dried at room temperature for 24 hours, and then a TEM (Transmission Electron Microscope, JEM 2100F, JEOL, NC) was used to confirm whether the nanoparticles were in particle form and to measure their size and image.

[0165] As a result, as shown on the left side of Fig. 4, the normal particle size under ROS-free conditions (GC-M) was 463 nm, but the particle sizes under ROS conditions (GC-M + H2O2) were confirmed to be divided into 260 nm and 20 nm.

[0166] In addition, as shown on the right side of Fig. 4, it was confirmed that the image of the particle under ROS conditions (H2O2O) was reduced in size compared to the image of the normal particle under ROS-free conditions (H2O2X).

[0167] These results indicate that Glycol chitosan-thioketal-Mesalamine was decomposed by reactive oxygen species (ROS) present in large quantities in the intestinal inflammatory region.

[0168]

[0169] Example 3. Confirmation of the release of mesalamine by ROS and the amount of release

[0170] (1) Confirmation of mesalamine concentration contained in Glycol chitosan-thioketal-Mesalamine

[0171] To obtain a graph of the correlation between the concentration of mesalamine and its absorbance, different concentrations of H2O2 were added to 1 ml of PBS containing 1 mg of mesalamine and reacted in a shaking incubator (200 rpm, 37 degrees). Afterwards, the absorbance value corresponding to each concentration of mesalamine solution was obtained using a UV-visible spectrophotometer.

[0172] As a result, as shown in Fig. 5, the Beer Lambert's Law analysis results were obtained based on the absorbance graph for the wavelength value according to the concentration of Mesalamine. Absorbance was measured for concentrations from 0 to 100 ug / ml by UV-vis spectrometry, and based on this, the absorbance values ​​according to each concentration were substituted into Beer Lambert's Law to obtain a linear relationship, which was later utilized as a method to obtain the concentration based on the absorbance of Mesalamine.

[0173]

[0174] (2) Mesalamine Absorbance Measurement Results and Quantitative Calculation under H2O210mM ​​Conditions

[0175] To measure the mesalamine release amount of Glycol chitosan-thioketal-Mesalamine according to the H2O2 concentration in the intestinal inflammation site,

[0176] After dissolving 1 mg / ml of Glycol chitosan-thioketal-Mesalamine in PBS, different concentrations of H2O2 were added to 1 ml of PBS containing 1 mg of Mesalamine and reacted in a shaking incubator (200 rpm, 37 degrees).

[0177] After reacting in a centrifugal tube (3000 MWCO) at 4000 rpm for 20 min, the absorbance of the filtered lower layer was measured by UV-vis spectrometry at each time point to obtain the results.

[0178] Based on the beer lambert's law formula of mesalamine obtained in Figure 4, the concentration value according to the absorption was calculated and the concentration of mesalamine released at each time point was quantified. (Absorbancemesalamine= Absorbance 측정 -Absorbance blank ) was calculated using.

[0179] As a result of measuring the UV-vis of the lower layer under 10 mM H2O2 conditions, an absorbance value of 0.604 at 214 nm was confirmed, as shown in Fig. 6.

[0180] The 10 mM H2O2 condition is the H2O2 condition at which mesalazine releases the maximum amount when treated with different H2O2, as shown in Fig. 8. Therefore, it was assumed that the total amount of mesalazine bound to GC-M was when treated with 10 mM H2O2, and the binding ratio of glycol chitosan-thioketal and mesalamine in Fig. 7 was calculated based on the experimental results.

[0181]

[0182] (3) Quantification of binding ratio (w / w) of glycol chitosan-thioketal and mesalamine

[0183] In Fig. 7, the binding ratio of mesalamine and its carrier, Glycol chitosan-thioketal, was calculated based on the previous experiment. Based on the absorbance value of 0.604 at 214 nm, the concentration was calculated using the mesalazine beer lambert law in Fig. 5, and the binding ratio was confirmed to be 0.0435 mg / ml. Since the total concentration of GC-M added was 1 mg / ml, based on 1 ml, 1 mg of GC-M contains 0.0435 mg of mesalamine, so it can be interpreted that 0.9565 mg of Glycol chitosan-thioketal and 0.0435 mg of mesalamine combined to form a total of 1 mg / ml of GC-M.

[0184] As a result, as shown in Fig. 7, it was confirmed that the binding ratio (w / w) of GC-thioketal: mesalamine was 22:1.

[0185]

[0186] (4) Analysis of mesalamine release under various H2O2 concentration conditions

[0187] To analyze the release of mesalamine under various H2O2 concentration conditions, experiments were conducted by treating with 0.1 mM, 1 mM, and 10 mM H2O2.

[0188] As a result, the Absrobance of mesalazine was calculated as a concentration based on the Beer Lambert formula of mesalamine obtained in Fig. 6, and the amount of mesalamine released at each time point was quantified. In addition, as mentioned above, when 1 mg of GC-M was treated with 10 mM H2O2, the amount of mesalamine released was maximum, and the value was 0.0435 mg. Assuming that this was the total amount of mesalamine contained, it was expressed as 100%, and the amount of mesalamine released at each time point was quantified.

[0189] As a result, as shown in Fig. 8, it was confirmed that the maximum release amount of mesalamine was 43.25 ug, the ROS concentration at which mesalamine was completely decomposed was 10 mM, and the treatment time was 12 h.

[0190] The experimental results confirmed that mesalamine drug is selectively released only in high ROS inflammatory environments, as mesalamine release was not observed under low ROS conditions, suggesting that this may reduce mesalamine drug delivery to normal sites.

[0191]

[0192] (5) LC-MS analysis of released mesalamine

[0193] To confirm whether the substance released by GC-M was intact mesalamine, a liquid chromatography-mass spectrometry experiment was performed.

[0194] The analysis conditions were set as follows: (1) Column: Agilent Xorbac Eclipse XDB C8 reversed-phase column (150 X 4.6 mm id; 5 μm), (2) Mobile phase: A (15%) ACN (0.1% Formic acid), B (85%) Water (0.1% Formic acid), (3) Flow rate: 1 mL / min, (4) Injection volume: 10 uL, (5) Ion polarity mode: Positive, (6) Fragmentor: 135 V.

[0195] As a result, as shown in Fig. 9, the molecular weight of Mesalamine was 153 g / mol, and proton cleavage was confirmed at 154, 136, and 108 (m / z). In addition, a new peak of 226 or 227 (m / z) was observed in the cleaved form, and the ratio of the two substances was new peak:Mesalamine = 12:88, so it was confirmed that when thioketal was cleaved, mesalamine conjugated to thioketal was released as mesalamine in its original form without including a portion of the linker Thioketal.

[0196] Figure 10 is a schematic diagram of the mechanism for releasing mesalamine in its entirety without the functional group of thioketal.

[0197]

[0198] Example 4. Cytotoxicity evaluation using GC-M CCK assay

[0199] To evaluate the cytotoxicity of GC-M against immune cells (RAW 264.7) and intestinal epithelial cells (Caco-2 cells), a CCK assay was performed to measure cell viability when treated with different concentrations of the substance. Data are expressed as Mean ± SEM (n = 4).

[0200] RAW 264.7, Caco-2 Cells were seeded in 96 well plates at 10 4 The cells were seeded after incubation for 24 hours to ensure the number of cells.

[0201] After washing once with PBS, 100 μl of complete media containing different concentrations (0, 12.5, 25, 50, 100, 200, 400 μg / ml) of drugs (Glycol chitosan, Glycol chitosan-Thioketal, Mesalamine, GC-M) was treated, and after incubation for 24 hours, the supernatant was removed by suction.

[0202] After washing twice with PBS, add 100 μl of Complete media + 10 μl of Cell Counting Kit-8 (CCK-8) to each well and incubate in the dark for 2 hours.

[0203] Absorbance at 450 nm was measured using a plate reader, and the absorbance of the blank was subtracted from the total absorbance to calculate cytotoxicity (%) as (A.sample-A.background) / (A.maximum-A.spontaneous) X 100.

[0204] As a result, as shown in Fig. 11, it was confirmed that administering a drug of 200 ug / ml or less did not affect the cell viability, and based on this, the concentration of the drug to be treated in the subsequent cell experiment was set to 100 ug / ml.

[0205]

[0206] Example 5. In vitro test: Confirmation of ROS / RNS scavenging activity of GC-M

[0207] (1) Confirmation of RNS scavenging activity of GC-M

[0208] When GC, GC-TK, mesalamine, and GC-M were treated in cells (RAW 264.7 cells) in an inflammatory environment induced by LPS, the extent to which the production of NO existing outside the releasing cells was suppressed was investigated. When LPS and gold nanoparticles were co-treated in RAW 264.7 cells stimulated with LPS, the secretion concentration of NO (nitrite oxide) was quantified using Griess reagent. Data are expressed as Mean ± SEM (n = 4).

[0209] To this end, RAW 264.7 cells were seeded in a 48-well plate at a density of 5 x 105 cells and incubated for 24 hours. The cells were washed once with PBS, and then treated with 200 μl of complete media containing different concentrations of drugs (Glycol chitosan, Glycol chitosan-Thioketal, mesalamine, GC-M) (Glycol chtiosan (88, 176 μg / ml), Glyco chitosan (95.5, 191 μg / ml), mesalamine (4.5, 9 μg / ml), GC-M (100, 200 μg / ml), and the same concentration based on GC-M), followed by incubation for 5 hours.

[0210] After washing twice with PBS, NC was treated with 200 μl of normal complete media, and the drug-treated group was treated with 200 μl of media containing LPS (1 μg / ml) and incubated for 20 hours.

[0211] 100 μl of the supernatant was transferred to a new 96-well plate and reacted with 100 μl of Griess reagent for 10 minutes.

[0212] Absorbance at 546 nm was measured using a plate reader. At this time, the concentration was calculated from absorbance using a standard curve according to the molar concentration of NO (0-10 μM).

[0213] As a result, as shown in Figure 12, in the GC-M group treated with the same amount of mesalamine, an RNS scavenging effect greater than that of mesalamine was observed.

[0214]

[0215] (2) Confirmation of intracellular ROS scavenging activity

[0216] To determine the extent to which GC, GC-TK, mesalamine, and GC-M inhibited the production of ROS outside the cells that released it when treated with cells in a ROS environment, DCF-DA assay was performed by treating H2O2 together with gold nanoparticles to determine the ROS scavenging ability of gold nanoparticles in intestinal epithelial cells. Data are expressed as Mean ± SEM (n = 4).

[0217] Caco-2 cells were seeded at 1x10 in a 96-well plate. 4 The cells were seeded after incubation for 48 hours to ensure the number of cells.

[0218] After washing once with PBS, 100 μl of complete media containing different concentrations of drugs (Glycol chitosan, Glycol chitosan-Thioketal, mesalamine, GC-M) (Glycol chtiosan (88, 176 μg / ml), Glyco chitosan (95.5, 191 μg / ml), mesalamine (4.5, 9 μg / ml), GC-M (100, 200 μg / ml), and the same concentration based on GC-M) and H2O2 (100 μM) was treated and incubated for 4 hours.

[0219] 100 μl of complete media containing dichloro-dihydro-fluorescein diacetate (DCFH-DA) (2 uM) was incubated for 15 minutes.

[0220] After washing once with PBS, the plate reader was used to measure the intracellular ROS level, and the excitation / emission value was calculated using the values ​​of exication: 490 nm and emission: 520 nm.

[0221] As a result, as shown in Fig. 13, in the GC-M group treated with the same amount of Mesalamine, a ROS scavenging effect greater than that of Mesalamine was observed.

[0222] This result is interpreted as a combined effect of Thioketal and Mesalamine in GC-M, considering that Thioketal reacts with ROS, breaks it down, and inhibits the production of ROS.

[0223]

[0224] Example 6. Confirmation of mesalamine cellular uptake in an inflammatory environment

[0225] When GC-M was applied to cells in an inflammatory environment, the amount of mesalamine released when thioketal was cleaved by ROS in the inflammatory environment and absorbed by the cells was measured. Data are expressed as Mean ± SEM (n = 3).

[0226] For this, Caco-2 cells were seeded at 0.5x10 in a 12-well plate. 6 The cells were seeded after incubation for 48 hours to reach the cell count.

[0227] After washing once with PBS, 500 μl of complete media containing 100 μg / ml of drugs mesalamine and GC-M and H2O2 (100 μM) was treated and incubated for 4 hours.

[0228] 100 μl of the supernatant and 900 μl of the mobile phase were mixed and analyzed using an LC device, and the amount of mesalamine absorbed into the cells was calculated as ‘the amount of mesalamine treated - the amount of mesalamine in the supernatant.’

[0229] As a result, as shown in Fig. 14, it was confirmed that GC-M was absorbed into cells in a similar or greater amount than mesalamine when ROS was present.

[0230] These results indicate that thioketal is decomposed under an inflammatory environment (ROS conditions) and that the decomposed mesalamine is normally absorbed into cells.

[0231]

[0232] Example 7. Confirmation of the tight junction recovery effect of GC-M

[0233] To determine whether tight junctions (ZO-1, Occludin) are restored when gold nanoparticles are treated in Caco-2 cells stimulated with H2O2, the following experiments were conducted.

[0234] Caco-2 cells (2 × 105 cells / well) were plated on Transwell and incubated for 3 weeks.

[0235] After treatment with H2O2 when the TEER value was 400 ohm or higher, Caco-2 cells were simply washed with PBS and fixed in 4% paraformaldehyde.

[0236] After washing the cells twice with PBS-Tween 20 for approximately 2 minutes each, the cells were incubated in a solution containing 20% ​​goat serum using PBS-Tween 20 as the solvent for blocking at room temperature for 30 minutes.

[0237] Goat serum (20% in PBST-20) and primary antibodies (anti-mouse occludin, anti-rabbit ZO-1) diluted 100:1 were incubated at room temperature for 1 hour.

[0238] After washing with PBS, secondary antibodies (goat anti mouse-488, goat anti rabbit-594) were diluted in PBS at a ratio of 1:200 and then incubated with the cells.

[0239] After protecting the cells from light, they were washed twice in PBS for 3 min each.

[0240] Two drops of DAPI mounting solution were added, a cover slide was placed, and the slide was observed under a fluorescence microscope.

[0241] As a result, as shown in Fig. 15, a TEER value of 400 ohms or more was obtained after 21 days, and was used as an experimental model.

[0242] This means that when the TEER value is 400 ohms or higher, the cell layer can perform a reliable barrier function in the experiment, indicating that the intestinal cells have formed intact tight junctions.

[0243]

[0244] In addition, the model was treated with ROS to induce inflammation and treated with drugs to confirm the recovery of tight junctions as measured by TEER values.

[0245] As a result, as shown in Fig. 16, it was confirmed that the damage to the tight junction was recovered when GC-M was treated.

[0246] In addition, to evaluate the tight junction recovery efficacy of GC-M in an environment of damaged intestinal epithelial cells, Occludin (green) and Zo-1 (red), which are tight junction proteins between intestinal epithelial cells, were observed by immunofluorescence staining.

[0247] As a result, as shown in Fig. 17, it was confirmed that when GC-M was treated, the fluorescence levels of both Occludin and Zo-1 were improved compared to the positive control group (H2O2 group).

[0248] These results indicate that GC-M treatment is effective in alleviating tight junction damage caused by oxidative stress.

[0249]

[0250] Example 8. In vitro test: Confirmation of anti-inflammatory activity of GC-M

[0251] (1) Inhibitory effect of GC-M on macrophage M1 polarization in an inflammatory environment

[0252] Flow cytometry was performed to determine the M1 and M2 polarization ratios in Raw 264.7 cells treated with LPS and in groups treated with LPS, mesalamine, and GC-M. Data are expressed as Mean ± SEM (n = 3).

[0253] For this purpose, Raw 264.7 cells were seeded on a 100 mm dish (2.0 X 106 cells) and incubated for 24 hours. The cells were washed with PBS and incubated for 5 hours with or without 100 ㎍ / ml of mesalamine and GC-M. The cells were then scraped off with a scraper and centrifuged at 12,000 rpm for 3 minutes to separate the cells.

[0254] After removing the supernatant, the cells were re-dispersed in PBS and incubated with or without antibodies for 20 minutes at room temperature. The antibody types used were (CD206 APC-eFluor 780 / iNOS-PE (eBioscienceTM)).

[0255] Experiments were performed on negative control (CD206 APC-eFluor 780, iNOS-PE co-staining), positive control (unstained), Raw cells and CD206 marker (staining), Raw cells and iNOS marker (staining), Raw cells and CD206 and iNOS marker co-staining, mesalamine-treated Raw cells and CD206 and iNOS marker co-staining, and GC-M-treated Raw cells and CD206 and iNOS marker co-staining.

[0256] As a result, as shown in Figure 18, compared to when LPS was treated alone, M1 macrophages tended to decrease when mesalamine was treated, and when GC-M was treated, they tended to decrease even more.

[0257] These results indicate that mesalamine itself has an anti-inflammatory effect and that thioketal present in GC-M plays a ROS scavenging role.

[0258]

[0259] (2) Confirmation of the inflammatory cytokine suppression effect of GC-M in an inflammatory environment using qPCR

[0260] To determine how much GC-M inhibits pro-inflammatory cytokine secretion in macrophages in an inflammatory environment, LPS-stimulated Raw cells were treated with the drugs mesalamine and GC-M, and qPCR analysis was performed to measure the expression levels of inflammatory cytokines. Data are expressed as Mean ± SEM (n = 3).

[0261] Raw 264.7 cells were seeded in a 12-well plate (1.0 x 10 5 per well) and cultured in complete media for 24 hours, washed with PBS, and incubated with mesalamine and GC-M for 5 hours.

[0262] Cells were washed with PBS before incubation in medium with or without LPS (1 μg / ml) for 20 h.

[0263] The analyzed factors were TNF-α, IL-6, and IL-1 beta. Total RNA from cells was extracted using QIAzol Lysis Reagent and RNeasy Mini Kit (QIAGEN, Germany), and then 1 μg RNA was reverse transcribed into cDNA using iscript cNDA synthesis Kit (BIO RAD Laboratories, USA).

[0264] Next, qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems™, USA) at Applied Biosystems Instrument (USA). GAPDH was used as an endogenous control to normalize the relative mRNA expression of the following genes. The primer sequences used are as follows.

[0265] GAPDH: Forward CAGGAGGCATTGCTGATGAT / Reverse: GAAGGCTGGGGCTCATTT

[0266] TNF α: Forward CCCTCACACTCAGATCATCTTCT / Reverse: GCTACGACGTGGGCTACAG

[0267] IL-6: Forward TAGTCCTTCCTACCCCAATTTCC / Reverse: TTGGTCCTTAGCCACTCCTTC

[0268] IL-1β: Forward GCAACTGTTCCTGAACTCAACT / Reverse: ATCTTTTGGGGTCCGTCAACT

[0269] As a result, as shown in Figure 19, it was confirmed that the expression level of inflammatory cytokines was suppressed in both the group treated with mesalamine drug and the GC-M group compared to the group treated with LPS alone.

[0270] These results demonstrate the anti-inflammatory effect of GC-M.

[0271]

[0272] (3) Inflammatory cytokine suppression effect of GC-M in inflammatory environment by ELISA

[0273] To determine how much GC-M inhibits pro-inflammatory cytokine secretion in macrophages in an inflammatory environment, LPS-stimulated Raw cells were treated with the drugs mesalamine and GC-M, and ELISA was performed to measure the expression levels of inflammatory cytokines. Data are expressed as Mean ± SEM (n = 4).

[0274] Raw 264.7 cells were seeded in a 12-well plate (1.0 x 10 5 per well) and cultured for 24 hours in complete media (DMEM, 10% FBS, 1% PS), washed with PBS, and incubated with AuNP (125 μg / ml) for 5 hours.

[0275] Cells were washed with PBS before incubation for 20 h in medium with or without LPS (1 μg / ml), and cell supernatants were harvested and stored at -20 °C before analysis.

[0276] The protocol provided in the purchased ELISA kit was followed, and the factors analyzed were TNF-alpha (EliKine™ Mouse TNF-α ELISA Kit, Abbkine), IL-6 (IL-6 Mouse ELISA Kit, Invitrogen), IL-1 beta (IL-1 beta Mouse ELISA Kit, Invitrogen), and iNOS (Mouse NOS2 / iNOS (Nitric Oxide Synthase 2, Inducible, ELISA Kit).

[0277] As a result, as shown in Figure 20, compared to when LPS was treated alone, the group treated with the mesalamine drug showed an inhibitory effect on the expression of inflammatory cytokines, and the group treated with the GC-M drug showed an even greater inhibitory effect on the expression of cytokines.

[0278] These results indicate that GC-M has a more superior anti-inflammatory effect than mesalamine alone.

[0279]

[0280] Example 9. Confirmation of the intestinal mucosal absorption effect of GC-M

[0281] To confirm the intestinal mucosal adsorption by Glycol chitosan of GC-M, FITC was conjugated to Glycol chitosan of GC-M, and the intestines were separated over time to confirm the degree of intestinal retention through fluorescence.

[0282] After dissolving 10 mg of fluorescein isothiocyanate (FITC) in 5 ml of ethanol, 50 mg of Glycol chitosan, GC-M was dissolved in 5 ml of ethanol containing acetic acid (0.1 M), and the FITC solution dissolved in the previous step (1) was added dropwise, followed by reaction in a dark environment for 2 hours.

[0283] After dialysis for 2 days in the presence of DW using a 14000 MWCO dialysis membrane, a powder-type composite was obtained through freeze-drying.

[0284] Finally, Bagg Albino (BALB / c) mice were orally administered with a solution of Glycol chitosan, GC-M 100 mg / kg dissolved in PBS, and sacrificed after 1, 3, 6, 12, and 24 hours. The organs (heart, liver, gallbladder, kidney, and intestine (small intestine-large intestine)) were separated and observed for FITC using an in vivo imaging system.

[0285] As a result, as shown in Fig. 21, similar to glycol chitosan (top), which is known to have existing intestinal mucosal adsorption properties, GC-M (bottom) was confirmed to remain in the intestines for 6 and 12 hours, showing almost the same intestinal adsorption ability.

[0286] These results indicate that although thioketal and mesalamine are combined with GC-M, the intestinal mucosal adsorption ability of glycol chitosan is not affected, and that the drug mesalamine can be continuously released while remaining in the intestinal mucosa for a long time.

[0287]

[0288] Example 10. Confirmation of the anti-inflammatory effect of GC-M through in vivo experiments.

[0289] (1) Establishment of an animal model of inflammatory bowel disease through DSS drinking

[0290] To confirm the anti-inflammatory effect of GC-M treatment at various concentrations in an IBD mouse model induced by dextran sodium sulfate (DSS), an inflammatory bowel disease animal model was established by providing drinking water containing 2.5% DSS.

[0291] As shown in Figure 22, after inducing inflammatory bowel disease by supplying DSS drinking water for 7 days, the drug was orally administered daily for the following 7 days to confirm the drug's anti-inflammatory effect in the inflammatory state model.

[0292]

[0293] (2) Confirmation of weight changes in IBD mouse models

[0294] To confirm the anti-inflammatory effect of GC-M at various concentrations in a dextran sodium sulfate (DSS)-induced IBD mouse model, body weight changes in the IBD mouse model were measured to determine whether IBD was cured. Data are expressed as Mean ± SEM (n = 5).

[0295] As a result, as shown in Figure 23, both mesalamine and GC-M showed a decrease in body weight, but from around day 10, the body weight increased, confirming the recovery of IBD. In particular, the degree of body weight recovery was confirmed to be better with GC-M (4.5 equiv.).

[0296]

[0297] (3) Measurement of survival rate in IBD mouse model

[0298] To determine the anti-inflammatory effect of GC-M at various concentrations in a dextran sodium sulfate (DSS)-induced IBD mouse model, the survival rate of the IBD mouse model was measured. Data are expressed as Mean ± SEM (n = 5).

[0299] As a result, as shown in Figure 24, in the group administered DSS, one animal died on the 12th day and another animal died on the 13th day, resulting in survival rates of 80% and 60%, respectively. However, it was confirmed that no animal in the mesalamine and GC-M groups died and the survival rate was maintained at 100%.

[0300]

[0301] (4) Measurement of DAI (Disease activity index) values ​​in IBD mouse models

[0302] To determine the anti-inflammatory effect of GC-M at various concentrations in a dextran sodium sulfate (DSS)-induced IBD mouse model, the disease activity index (DAI) values ​​of the IBD mouse model were measured. Data are expressed as Mean ± SEM (n = 5).

[0303] The DAI index value was evaluated by stool consistency (hard: 0 points, soft: 2 points, diarrhea: 4 points), the degree of bleeding in the stool using Hemoccult Sensa (Beckman Coulter) (none: 0 points, present: 2 points, macroscopically visible: 4 points), and body weight loss (less than 1%: 0 points, 1-5%: 1 point, 5-10%: 2 points, 10-20%: 3 points, 20% or more: 4 points).

[0304] As a result, as shown in Fig. 25, it was confirmed that the Mesalaizne, GC-M (4.5 equiv.) group showed the lowest DAI value, confirming that the degree of inflammation was alleviated.

[0305]

[0306] (5) Measurement of colon length in IBD mouse model

[0307] To determine the anti-inflammatory effect of GC-M at various concentrations in a dextran sodium sulfate (DSS)-induced IBD mouse model, colon length was measured. Data are expressed as Mean ± SEM (n = 5).

[0308] As a result, as shown in Fig. 26, the colon tissue length of mice fed DSS on the 14th day to induce IBD was approximately 5 cm shorter than that of the control, but the colon tissue length of mice administered GC-M (4.5 equiv.) was confirmed to have recovered to a length similar to that of the control.

[0309]

[0310] Example 11. Confirmation of the anti-inflammatory effect of GC-M through intestinal tissue staining in an IBD mouse model.

[0311] (1) Pretreatment for H&E staining and immunofluorescence staining

[0312] The previously isolated organs were placed in a volume of 4% paraformaldehyde (PFA) equivalent to 5 to 10 times the organ's volume, placed in an embedding cassette of appropriate size, placed in a beaker, and sealed with gauze. The beaker was allowed to drain under running tap water for 4 to 5 hours to ensure sufficient rinsing of the PFA.

[0313] For paraffin embedding, dehydration was performed by soaking the specimens twice in 70%, 80%, and 95% ethanol for 1 hour each. Subsequently, dehydration was performed by soaking them three times in 100% ethanol for 1 hour each.

[0314] The temperature was set to 56-58℃, and after immersing in paraffin twice for 90 minutes each, paraffin at a temperature of 56-58℃ was poured directly into the cassette, and the molding process was performed by placing it on ice to solidify the paraffin. The solidified paraffin block containing the tissue in the cassette was stored frozen.

[0315]

[0316] (2) Comparison of intestinal tissue staining results after oral drug administration to IBD mouse models

[0317] To observe the damage and recovery of intestinal tissue through H&E staining, the paraffin block was first cut into 7 μm thick pieces using a Leica TP1020 semi-enclosed benchtop tissue processor, and the cut pieces were placed on slide glass and naturally dried for 2-3 days.

[0318] The slide was placed in a 55℃ oven for 1 hour to melt the paraffin, and then the slide was placed in a container for subsequent steps.

[0319] Before the paraffin hardened, it was washed by immersing it up and down 10 times in xylene, and this process was repeated 3 times in different xylene solutions.

[0320] It was washed by immersing it up and down 10 times in 100% ethanol, and the process was repeated twice in another 100% ethanol.

[0321] After washing by immersing in 90%, 80%, and 70% ethanol in that order 10 times, it was washed in tap water for 1 minute.

[0322] Soak in Mayer's Hematoxylin for 30 seconds and wash in tap water for 5 minutes.

[0323] Soak in EosinY for 1 minute and wash in tap water for 30 seconds.

[0324] Washing was performed by immersing in 70%, 80%, and 90% ethanol in that order 10 times.

[0325] After washing by immersing in 100% ethanol up and down 10 times, the process was repeated twice in another 100% ethanol.

[0326] After washing by immersing in xylene up and down 10 times, the process was repeated 3 times in different xylene solutions.

[0327] After mounting with DAPI mounting solution, the sample was prepared by placing a cover glass on top, and the cell nuclei (blue, Hematoxylin), cytoplasm, and extracellular matrix (pink, EosinY) were observed through an optical microscope.

[0328] As a result, as shown in Fig. 27, damage to intestinal tissue was observed in the DSS group (PBS), and a relaxed intestinal condition was observed in both the M 50 and GC-M (4.5 equiv.) groups compared to the DSS group.

[0329]

[0330] (3) Fluorescent immunostaining results of intercellular proteins and mucin layer of intestinal tissue after oral drug administration to IBD mouse model

[0331] To confirm the recovery of intestinal intercellular proteins and mucin proteins through immunofluorescence staining, Occludin, ZO-1, and MUC-2, which correspond to intercellular proteins of intestinal tissue, and the mucin layer were stained with fluorescent immunofluorescence.

[0332] To this end, the paraffin block was cut into 7 μm thick pieces using a Leica TP1020 semi-enclosed benchtop tissue processor, and the cut pieces were placed on slide glass and naturally dried for 2-3 days.

[0333] Place the side in a 55℃ oven for 1 hour to melt the paraffin.

[0334] The washing process of soaking in xylene for 3 minutes was repeated 3 times in different xylene solutions, and the process was carried out by placing a slide glass in a Coplin jar and pouring the solution.

[0335] The washing process of soaking in 100% ethanol for 3 minutes was repeated twice in different 100% ethanol solutions.

[0336] After washing, soak in 90% and 80% ethanol in that order for 1 minute, then soak in distilled water for 1 minute.

[0337] After washing twice with PBST solution containing 0.2% Tween 20, the moisture was removed.

[0338] Afterwards, the tissue was soaked in water and a slide glass was placed on top of the soaked tissue in a Coplin jar to carry out the next process in a moist environment.

[0339] After spraying 50 μl of a solution containing 80% PBST and 20% Goat Serum onto each slide, the slide was sealed with parafilm to prevent air bubbles and allowed to react for 30 minutes.

[0340] After removing the parafilm and removing moisture, 50 μl of a solution of Occludin, ZO-1 antibody: (PBST 80% + Goat Serum 20%) = 1:100 was sprayed (primary antibodies are anti-mouse occludin, anti-rabbit ZO-1).

[0341] After covering with parafilm and reacting at 4°C for 24 hours, the parafilm was removed, placed in a Coplin jar, and washed twice with PBS for 2 minutes each.

[0342] Mouse antibody, rabbit antibody: 50 μl of a solution containing PBS = 1:200 was sprayed (secondary antibodies are (goat anti rabbit-488 (anti-rabbit occludin), goat anti-human RITC (anti-human ZO-1))).

[0343] After covering with parafilm and reacting in the dark at room temperature for 1 hour, the cells were washed three times with PBS, 50 μl of DAPI solution was sprayed, a cover glass was placed, and the results were observed through a fluorescence microscope (Green at the top of Figure 28 represents Occludin, Red represents ZO-1, and Red at the bottom of Figure 28 represents MUC-2 protein).

[0344] As a result, as shown in Fig. 28, it was confirmed that the fluorescence intensity increased in the mesalamine, GC-M (M 4.5 equiv.) group compared to the DSS group.

[0345] These results indicate that the GC-M drug has the effect of restoring tight junctions and mucin, thereby alleviating the degree of inflammation.

[0346]

[0347] Example 12. Confirmation of the anti-inflammatory effect of GC-M through evaluation of inflammatory cytokine expression levels in an IBD mouse model.

[0348] To confirm the anti-inflammatory effect of GC-M in the DSS negative model, animal tissues were prepared and qRT-PCR experiments were performed. Data are expressed as Mean ± SEM (n = 3).

[0349] After cutting off the end of the colon tissue, 600 μl of RLT buffer (RNeasy Mini Kit, QIAGEN, Germany) was added per 30 mg of tissue, and 10 μl of 2-mercaptoethanol (Sigma) was added per 1 ml of RLT buffer.

[0350] After homogenizing using a homogenizer (FastPrep-24 5G, MP Biomedicals, LLC, USA), the supernatant was collected by centrifugation at 14,800 rpm for 3 minutes at 4°C, an equal volume of 70% EtOH was added, and immediately pipetted. mRNA in the tissue was extracted using the RNeasy Mini Kit (QIAGEN, Germany).

[0351] 1 μg RNA was reverse transcribed into cDNA using the iscript cNDA synthesis Kit (BIO RAD Laboratories, USA).

[0352] qRT-PCR was performed using SYBR Green PCR Master Mix (Applied BiosystemsTM, USA) in an Applied Biosystems Instrument (USA).

[0353] GAPDH was used as an endogenous control to normalize the relative mRNA expression of TNFα, IL-6, IL-1β, MCP-1, and iNOS genes, and the primer sequences used are as follows.

[0354] GAPDH: Forward CAGGAGGCATTGCTGATGAT / Reverse: GAAGGCTGGGGCTCATTT

[0355] TNF α: Forward CCCTCACACTCAGATCATCTTCT / Reverse: GCTACGACGTGGGCTACAG

[0356] IL-6: Forward TAGTCCTTCCTACCCCAATTTCC / Reverse: TTGGTCCTTAGCCACTCCTTC

[0357] IL-1β: Forward GCAACTGTTCCTGAACTCAACT / Reverse: ATCTTTTGGGGTCCGTCAACT

[0358] MCP-1: Forward TTAAAAACCTGGATCGGAACC / Reverse: GCATTAGCTTCAGATTTACGGGT

[0359] iNOS: Forward CCCCGCTACTACTCCATCAG / Reverse: CCACTGACACTTCGCACAAA

[0360] As a result, as shown in Figure 29, the mRNA level of inflammatory cytokines was significantly improved in DSS-negative mice, whereas the mRNA level of inflammatory cytokines was lower in the mesalamine and GC-M (M 4.5 equiv.) groups.

[0361]

[0362] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

2. In claim 1, A composition characterized in that the above Glycol chitosan is capable of being absorbed into the intestinal mucosa.

3. In claim 1, A composition characterized in that the above Thioketal is decomposed by ROS at the site of inflammation to selectively release the drug.

4. In claim 3, A composition characterized in that the drug is Mesalamine.

5. In claim 1, The composition is characterized in that it inhibits the production of at least one selected from the group consisting of intracellular reactive oxygen species (ROS), reactive nitrogen species (RNS), and nitric oxide (NO).

6. In claim 1, A composition characterized in that the composition restores tight junctions between cells.

7. In claim 1, A composition characterized in that the composition inhibits macrophage M1 polarization.

8. In claim 1, The composition is characterized in that it suppresses the expression of one or more inflammatory cytokines selected from the group consisting of TNF-α (tumor necrosis factor-α), IL-6 (Interleukin 6), and IL-1β (Interleukin-1 β).

9. In claim 1, A composition characterized in that the composition restores a damaged colon.

10. In claim 1, the inflammatory bowel disease is Crohn's disease, ulcer A composition characterized by at least one selected from the group consisting of ulcerative colitis, intestinal Behcet's disease and enteritis.

11. A pharmaceutical preparation for preventing or treating inflammatory bowel disease, comprising a composition according to any one of claims 1 to 10.

12. In claim 11, A pharmaceutical preparation characterized in that the above preparation is in the form of an oral preparation, injection preparation, infusion preparation, spray preparation or liquid preparation.

13. A health functional food for preventing or improving inflammatory bowel disease, comprising a composition according to any one of claims 1 to 10.

14. Use of a pharmaceutical composition comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient for preventing or treating inflammatory bowel disease.

15. A method for preventing or treating inflammatory bowel disease, comprising administering to a subject a pharmaceutical composition comprising Glycol chitosan-Thioketal-Mesalamine or a pharmaceutically acceptable salt thereof as an active ingredient.

Images