Therapeutic adeno-associated virus using nucleic acid encoding alpha-glucosidase (GAA) for treating pompe disease, with heterologous signal peptide

Abstract

Disclosed herein is a method for the treatment of Pompe Disease comprising administering a recombinant AAV (rAAV) vector comprising a rAAV genome comprising a heterologous nucleic acid encoding a heterologous BM40 signal peptide and an acid alpha-glucosidase (GAA) polypeptide, or N-terminal truncation thereof, where the heterologous nucleic acid is operatively linked to a liver-specific promoter, where the nucleic acid encoding GAA polypeptide can be wild type nucleic acid sequence, or modified nucleic acid sequence, or a codon optimized nucleic acid sequence, and can optionally be modified to reduce or completely eliminate CG and CpG dinucleotides and, optionally eliminated alternative reading frames (ARF) content.

Description

THERAPEUTIC ADENO-ASSOCIATED VIRUS USING NUCLEIC ACID ENCODING ALPHA-GLUCOSIDASE (GAA) FOR TREATING POMPE DISEASE, WITH HETEROLOGOUS SIGNAL PEPTIDECROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 539,000 filed September 18, 2023, the contents of which are incorporated herein by reference in their entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in XML format via Patent Center and is hereby incorporated by reference in its entirety. Said XML copy, created on September 13, 2024, is named 046192-000115WOPT_SL.xml and is 477,431 bytes in size.FIELD OF THE INVENTION

[0003] The present invention relates to methods to treat Pompe disease by administering adeno-associated virus (AAV) particles, virions and vectors for expression of an alpha-glucosidase (GAA) polypeptide, where the nucleic acid encoding GAA can be codon optimized and / or truncated and include the heterologous BM40 signal peptide. The compositions as disclosed herein can be used in methods to treat Pompe disease, including without the clinical need for administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time.BACKGROUND

[0004] Pompe disease (Glycogen storage disease type II; acid maltase deficiency; MIM 232300) is caused by recessive mutations of the GAA gene leading to complete or partial deficiency of the lysosomal enzyme acid a-glucosidase (GAA). Absence of GAA leads to the progressive accumulation of glycogen in the lysosomes of many tissues, particularly skeletal muscle and cardiomyocytes. Impaired energy metabolism then leads secondarily to severely disrupted muscle architecture, dysfunction, autophagy, and in adults, significant fatty replacement of skeletal muscle myocytes.

[0005] Clinically, the condition ranges from a fulminant infantile -onset Pompe disease (IOPD) typically leading to death before 12 months of age to a late-onset Pompe disease (LOPD), which is slowly progressive leading to myopathy causing loss of mobility and typically death from respiratory failure 5-15 years after diagnosis. Infantile-onset patients have cardiomyopathy often noted even at birth or even antenatally, with elevated creatine kinase (CK) and then within weeks to the first months of life develop severe hypotonia, respiratory insufficiency requiring ventilator support and massive cardiomegaly. Deaths are most often the result of cardiorespiratory failure, aspiration pneumonia or ventricular arrhythmias.Late-onset Pompe Disease (LOPD) patients (mostly adults, some juveniles) experience slowly progressive muscle weakness often leading to delayed diagnosis, extensive fatty replacement of trunk and proximal limb muscles, progressing to respiratory failure which is the primary cause of death (Carlier et al. 2011, Neuromuscul. Disord. 21(11): 791-799). Basilar artery aneurysms occur and can be life threatening if they rupture (El-Gharbawy et al. 2011, Mol Genet Metab. 103(4): 362-366; Hobson-Webb et al. 2012, Mol Genet Metab. 106(4): 462-469). As an alternative or adjunct to enzyme therapy, the feasibility of gene therapy approaches to treat GSD-II have been investigated (Amalfitano, A., et al., (1999) Proc. Natl. Acad. Sci. USA 96:8861-8866, Ding, E„ et al. (2002) Mol. Ther. 5:436-446, Fraites, T. J., et al., (2002) Mol. Ther. 5:571-578, Tsujino, S„ et al. (1998) Hum. Gene Ther. 9: 1609-1616).

[0006] MYOZYME® (alglucosidase alfa) was the first US approved product (2006) for the treatment of Pompe disease; LUMIZYME® (alglucosidase alfa) was approved in 2010 and is the current standard-of- care (SOC) treatment for infantile -onset and late-onset Pompe patients. Alglucosidase alfa is administered intravenously every 2 weeks as an infusion at a dose of 20 mg / Kg (LUMIZYME Prescribing Information 2014). Alglucosidase alfa provides an exogenous source of GAA. Binding to mannose-6-phosphate receptors on the cell surface has been shown to occur via carbohydrate groups on the GAA molecule, after which it is internalized and transported into lysosomes, where it undergoes proteolytic cleavage that results in increased enzymatic activity. It then exerts enzymatic activity in cleaving glycogen. Although this enzyme replacement therapy (ERT) prolongs survival in most patients with infantile Pompe disease, a subset have either died, suffered ongoing muscle weakness or remained profoundly hypotonic requiring mechanical ventilator support despite compliance with SOC ERT. For late-onset patients, ERT moderately improves muscle function and pulmonary function parameters, initially, followed by stable function or decline and remains far from an ideal therapy (Schoser et al. 2017, Neurol, 264: 621-30).

[0007] For infantile-onset patients, especially those with severe or null mutations (cross-reacting immune material [CRIM])-negatives), high and sustained anti-rhGAA Immunoglobulin G (IgG) -mediated immunity against the GAA enzyme is a primary reason for impaired or inadequate response to ERT. That is, ERT is known to provoke an antibody response in the form of both IgG and IgE and can also lead to infusion-associated reactions (Kishnani et al. 2007, Neurology 68(2): 99-109; Kishnani et al. 2010, Mol Genet Metab. 99(1): 26-33). Current practice is to initiate immune modulation with ERT for patients with LOPD at risk for antibody formation.

[0008] Additionally, enzyme replacement therapy (ERT) with alglucosidase alfa(MY OZYME® / LUMIZYME®) is delivered as an onerous every other week, or weekly infusion, and is the only treatment currently available. Forthose with infantile-onset Pompe disease (IOPD), GAA is absent (CRIM negative) or minimal (~I% of normal) and causes rapidly progressive cardiorespiratory failure and death by the age of 2 years if left untreated (Parini et al. 2018, Orphanet J Rare Dis. 13(1): 32). Subjects with a marked deficiency of GAA present as juveniles or adults (Late-Onset Pompe disease [LOPD]) with less severe symptoms and slower progression. Moreover, missing biweekly treatments can result in significant setbacks requiring many months of ERT to return to the same levels.

[0009] Accordingly, despite temporary therapeutic success, alglucosidase alfa ERT leaves a clear unmet medical need in both IOPD and LOPD. Longitudinal data in subjects confirm that ERT does not lead to complete correction or normalization of patients with Pompe disease. Ultimately subjects typically still decline, albeit at a slower rate, delaying the inevitable progression to death (Kuperus et al. 2017, Neurology 89(23): 2365-2373; Parini et al. 2018, supra). While alglucosidase alfa prolongs survival for subjects with both IOPD and LOPD (LUMIZYME Prescribing Information, 2014) the antibody responses to the GAA and decline in effect poses several drawbacks.

[0010] Therefore, from a clinical perspective, long-term treatment of Pompe patients with ERT has had limited success. In the IOPD subset of patients, many experience high, sustained anti-rhGAA antibody titers (HSAT). Pompe patients who lack any residual GAA protein are deemed CRIM-negative. CRIM negative patients develop HSAT, and a subset of CRIM positive patients who also develop high or sustained intermediate titers suffer greatly increased mortality (Banugaria et al. 2011, Genet Med.13 (8) : 729-736) . Furthermore, the use of immunosuppression to prevent antibody formation in patients at risk for HSAT significantly prolonged survival and confirmed the clinical relevance of HSAT (Mendelsohn et al. 2009, N Engl J Med. 360(2): 194-195; Banugaria et al. 2011, supra). Moreover, literature indicates that only about ~I% of ERT is pharmacologically active.

[0011] Therefore, while enzyme therapy has demonstrated reasonable efficacy for severe infantile GSD II, the benefit of GAA enzyme therapy is limited by the need for frequent infusions as well as the subject developing inhibitor or neutralizing antibodies against recombinant hGAA protein (Amalfitano, A., et al. (2001) Genet. In Med. 3: 132-138), there is a need for improved methods and alternative therapies to treat patients with Pompe disease. Adeno-associated virus (AAV) vector-mediated gene transfer provides an appropriate and feasible alternative.SUMMARY

[0012] The technology described herein relates generally to a recombinant adeno-associated virus (rAAV) vectors.

[0013] In one aspect, described herein is a recombinant adeno-associated virus (rAAV) vector, comprising in its genome: (a) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; and (b) located between the 5’ ITR and 3’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising: (i) a nucleotide sequence encoding a BM40 signal peptide; and (ii) a nucleotide sequence encoding an alpha- glucosidase (GAA) polypeptide; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

[0014] In some embodiments of any of the aspects, the GAA polypeptide comprises SEQ ID NO: 1, or an amino acid sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0015] In some embodiments of any of the aspects, the GAA polypeptide comprises SEQ ID NO: 312, or an amino acid sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0016] In some embodiments of any of the aspects, the GAA polypeptide has an N-terminus that corresponds to an N-terminal truncation of a full-length native GAA protein.

[0017] In some embodiments of any of the aspects, the GAA polypeptide comprises: (a) residues 28-952 of SEQ ID NO: 1; (b) residues 57-952 of SEQ ID NO: 1; (c) SEQ ID NO: 1 lacking 1 or more amino acid from its N-terminus; (d) SEQ ID NO: 1 lacking 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more amino acids from its N-terminus; (e) SEQ ID NO: 1 lacking 56 or more amino acids from its N-terminus; (f) a polypeptide from Table 1; (g) an amino acid sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or (h) a functional fragment of (a), (b), (c), (d), (e), (f), or (g).

[0018] In some embodiments of any of the aspects, the GAA polypeptide comprises: (a) residues 28-952 of SEQ ID NO: 312; (b) residues 57-952 of SEQ ID NO: 312; (c) SEQ ID NO: 312 lacking 1 or more amino acid from its N-terminus; (d) SEQ ID NO: 312 lacking 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more amino acids from its N-terminus; (e) SEQ ID NO: 312 lacking 56 or more amino acids from its N-terminus; (f) a polypeptide from Table 1A; (g) an amino acid sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or (h) a functional fragment of (a), (b), (c),(d), (e), (f), or (g).

[0019] In some embodiments of any of the aspects, the GAA polypeptide lacks an endogenous GAA signal peptide comprising SEQ ID NO: 269.

[0020] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: (a) SEQ ID NO: 313; (b) SEQ ID NO: 314; (c) nucleotides 169-2859 of SEQ ID NO: 313; (d) nucleotides 82-2859 of SEQ ID NO: 313; (e) nucleotides 82-2859 of SEQ ID NO: 314; (f) nucleotides 169-2859 of SEQ ID NO: 314; (g) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or (h) a functional fragment of (a), (b), (c), (d),(e), (f) or (g).

[0021] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: (a) SEQ ID NO: 315; (b) SEQ ID NO: 316; (c) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) or (b); or (d) a functional fragment of (a), (b) or (c).

[0022] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: a) SEQ ID NO: 28; b) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to a) or b); or c) a functional fragment of a) or b).

[0023] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide is codon optimized.

[0024] In some embodiments of any of the aspects, the codon optimized nucleotide sequence encoding the GAA polypeptide comprises: (a) one of SEQ ID NOs: 2-18; (b) nucleotides 169-2859 of one of SEQ ID NOs: 2-18; (c) nucleotides 82-2859 of one of SEQ ID NOs: 2-18; (d) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b) or (c); or (e) a functional fragment of(a), (b), (c) or (d).

[0025] In some embodiments of any of the aspects, the nucleotide sequence encoding the BM40 signal peptide comprises: (a) SEQ ID NO: 27; (b) a codon optimized version of SEQ ID NO: 27; (c) a nucleotide sequence that is at least 80%, at least 85%, or at least 90% identical to SEQ ID NO: 27; or (d) a fragment of (a), (b), or (c) which encodes a polypeptide with signal peptide activity.

[0026] In some embodiments of any of the aspects, the BM40 signal peptide comprises: (a) SEQ ID NO: 33; (b) an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 33; or (c) a fragment of (a) or (b) with signal peptide activity.

[0027] In some embodiments of any of the aspects, the nucleic acid has a nucleotide sequence comprising: (a) SEQ ID NO: 26; (b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO: 26; or (c) a functional fragment of (a) or (b).

[0028] In some embodiments of any of the aspects, the nucleic acid is codon-optimized.

[0029] In some embodiments of any of the aspects, the genome further comprises at least one un- translated region (UTR).

[0030] In some embodiments of any of the aspects, the at least one UTR is a 5 ’ UTR and / or a 3 ’ UTR.

[0031] In some embodiments of any of the aspects, the 5 ’ UTR comprises a nucleotide sequence of one of SEQ ID NOs: 28, 34, or 35, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0032] In some embodiments of any of the aspects, the 5’ UTR is located: (a) 5’ of the nucleic acid; and(b) 3’ of the 5’ ITR and the liver-specific promoter.

[0033] In some embodiments of any of the aspects, the 5’ UTR further comprises at least one intron.

[0034] In some embodiments of any of the aspects, the at least one intron comprises SEQ ID NO: 250, 251, 252, 253, and / or 254, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0035] In some embodiments of any of the aspects, the 3 ’ UTR comprises a nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0036] In some embodiments of any of the aspects, (a) the 3’ UTR is located: (i) 3’ of the nucleic acid; and (ii) 5’ of the 3’ ITR; and / or (b) the 3’ UTR is located between: (i) the nucleic acid; and (ii) a polyA signal sequence or an RNA pol II terminator sequence.

[0037] In some embodiments of any of the aspects, the genome further comprises at least one polyA signal sequence.

[0038] In some embodiments of any of the aspects, the polyA signal sequence comprises a full-length human growth hormone (hGH) polyA signal sequence.

[0039] In some embodiments of any of the aspects, the polyA signal sequence comprises a nucleotide sequence of SEQ ID NO: 30, 36, 37, or 38, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0040] In some embodiments of any of the aspects, the polyA signal sequence is located: (a) 3’ of thenucleic acid; and (b) 5 ’ of the 3 ’ ITR.

[0041] In some embodiments of any of the aspects, the genome further comprises a reverse RNA polll terminator sequence.

[0042] In some embodiments of any of the aspects, the reverse RNA polll terminator sequence comprises SEQ ID NO: 39, SEQ ID NO: 255, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0043] In some embodiments of any of the aspects, the reverse RNA polll terminator sequence is located: (a) 3’ of the nucleic acid; (b) 3’ of a polyA signal sequence; and (c) 5’ of the 3’ ITR.

[0044] In some embodiments of any of the aspects, the 5 ’ ITR and / or the 3 ’ ITR comprises a native ITR or a synthetic ITR (e.g., in Table 4) with an insertion, deletion or substitution.

[0045] In some embodiments of any of the aspects, the 5 ’ ITR comprises a nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0046] In some embodiments of any of the aspects, the 3 ’ ITR comprises a nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0047] In some embodiments of any of the aspects, the 5’ or 3’ ITR is a native ITR or a synthetic ITR (e.g., in Table 4) with one or more CpG removed.

[0048] In some embodiments of any of the aspects, the liver specific promoter comprises a nucleotide sequence of one of SEQ ID NOs: 24, 60-78, 84-249, or 256-258, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0049] In some embodiments of any of the aspects, the liver specific promoter comprises a nucleotide sequence of SEQ ID NO: 24, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0050] In some embodiments of any of the aspects, the genome comprises a nucleotide sequence of SEQ ID NO: 22, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, or a functional fragment thereof.

[0051] In some embodiments of any of the aspects, the BM40 signal peptide is directly fused to the GAA polypeptide.

[0052] In some embodiments of any of the aspects, the genome comprises, in the 5 ’ to 3 ’ direction: (a) the 5’ ITR; (b) the liver-specific promoter; (c) a 5’ UTR; (d) the nucleic acid, comprising, from 5’ to 3’: (i) the nucleotide sequence encoding the BM40 signal peptide; (ii) the nucleotide sequence encoding the alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 57- 952 of SEQ ID NO: 1; (e) a polyA signal sequence; (f) a reverse RNA pol II terminator sequence; and (g) the 3’ ITR.

[0053] In some embodiments of any of the aspects, the genome comprises, in the 5 ’ to 3 ’ direction: (a) the5 ’ ITR; (b) the liver-specific promoter; (c) a 5 ’ UTR, optionally further comprising an intron of SEQ ID NO: 250, 251, 252, 253, or 254; (d) a nucleic acid comprising, from 5’ to 3’: (i) the nucleotide sequence encoding the BM40 signal peptide; (ii) the nucleotide sequence encoding the GAA polypeptide, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1; (e) a 3’ UTR; (f) a polyA signal sequence; (g) optionally a reverse RNA pol II terminator sequence; and (h) the 3’ ITR.

[0054] In some embodiments of any of the aspects, the GAA polypeptide has an amino acid sequence of residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

[0055] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 313 or 314, or is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, and the encoded GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

[0056] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 2, or is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, and the encoded GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

[0057] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 315 or 316 or is at least 80%, or at least 85%, or at least 90% identical thereto and in the encoded GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

[0058] In some embodiments of any of the aspects, the nucleic acid further comprises a nucleotide sequence encoding an endogenous GAA signal peptide and / or a nucleotide sequence encoding a heterologous signal peptide that is not the BM40 signal peptide.

[0059] In some embodiments of any of the aspects, the endogenous GAA signal peptide comprises an amino acid sequence of residues SEQ ID NO: 269 or a sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0060] In some embodiments of any of the aspects, the heterologous signal peptide comprises one of: a 201 IgG signal peptide (SEQ ID NO: 270), an IL2 wild type signal peptide (SEQ ID NO: 271), a modified IL2 signal peptide (SEQ ID NO: 272), an A2M signal peptide (SEQ ID NO: 273), a PZP signal peptide (SEQ ID NO: 274), an artificial signal peptide (SEQ ID NO: 275), a cathepsin L signal peptide (SEQ ID NO: 276), or a signal peptide with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 270-276.

[0061] In some embodiments of any of the aspects, the nucleotide sequence encoding the endogenous GAA signal peptide and / or the nucleotide sequence encoding the heterologous signal peptide is / are located: (a) 5’ or 3’ of the nucleotide sequence encoding the BM40 signal peptide; and (b) 5’ of the nucleotide sequence encoding the GAA polypeptide.

[0062] In some embodiments of any of the aspects, the GAA polypeptide has a C-terminus that corresponds to a C-terminal truncation of a full-length native GAA protein.

[0063] In some embodiments of any of the aspects, the C-terminus ends at a position that corresponds to that of residue 779, 790, 791, 792, 793, or 796 of SEQ ID NO: 1.

[0064] In some embodiments of any of the aspects, the GAA polypeptide comprises residues 35-952, 40- 952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792- 952, 793-952, or 796-952 of SEQ ID NO: 1, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0065] In some embodiments of any of the aspects, the GAA polypeptide comprises residues 35-952, 40- 952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792- 952, 793-952, or 796-952 of SEQ ID NO: 312, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

[0066] In some embodiments of any of the aspects, the rAAV vector is a virus particle.

[0067] In some embodiments of any of the aspects, the rAAV vector is manufactured from a plasmid template comprising a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

[0068] In some embodiments of any of the aspects, the rAAV vector is manufactured from a covalently- closed circular or linear DNA (neDNA) template, which is not a plasmid, comprising a nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

[0069] In some embodiments of any of the aspects, the rAAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or rational polyploid AAV vector.

[0070] In some embodiments of any of the aspects, the rAAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector with a capsid of any AAV serotype (e.g., a serotype in Table 5).

[0071] In some embodiments of any of the aspects, the rAAV vector has a capsid from serotype AAV843 / XL32.1.

[0072] In some embodiments of any of the aspects, the rAAV vector has a XL32 capsid.

[0073] In some embodiments of any of the aspects, the rAAV vector has a liver specific capsid comprising a capsid protein encoded by: SEQ ID NO: 306 or SEQ ID NO: 307 or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0074] In some embodiments of any of the aspects, the rAAV vector has a liver specific capsid comprising a capsid protein with an amino acid sequence of SEQ ID NO: 308 or SEQ ID NO: 309 or atleast 80%, at least 85%, or at least 90% identical thereto that confers liver specificity to the capsid.

[0075] In some embodiments of any of the aspects, the rAAV vector increases GAA activity and / or decreases glycogen level in a GAA activity target tissue of a subject following administration of the rAAV vector to the subject.

[0076] In some embodiments of any of the aspects, the administration to the subject is by intramuscular, sub-cutaneous, intraspinal, intracistemal, intrathecal, or intravenous administration.

[0077] In some embodiments of any of the aspects, the GAA activity target tissue is muscle tissue.

[0078] In some embodiments of any of the aspects, the GAA activity target tissue is cardiac muscle tissue and / or skeletal muscle tissue.

[0079] In one aspect, described herein is a nucleic acid construct comprising a nucleotide sequence that encodes a BM40 signal peptide and a nucleotide sequence that encodes a GAA polypeptide, wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

[0080] In some embodiments of any of the aspects, the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1 or an amino sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical thereto, optionally where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

[0081] In some embodiments of any of the aspects, the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 312 or an amino sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical thereto.

[0082] In some embodiments of any of the aspects, the GAA polypeptide comprises an R at position 199, a H at position 223, and an I at position 780 (corresponding to positions in SEQ ID NO: 312).

[0083] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: (a) SEQ ID NO: 313; (b) SEQ ID NO: 314; (c) 169-2859 of SEQ ID NO: 313; (d) 169-2859 of SEQ ID NO: 314; (e) nucleotides 82-2858 of SEQ ID NO: 313; (f) nucleotides 82-2859 of SEQ ID NO: 314; (g) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or (h) a functional fragment of (a), (b), (c), (d), (e), (f) or (g).

[0084] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: (a) SEQ ID NO: 315; (b) SEQ ID NO: 316; (c) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) or (b); or (d) a functional fragment of (a), (b) or (c).

[0085] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide comprises: (a) SEQ ID NO: 28; (b) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a); or (c) a functional fragment of (a) or (b).

[0086] In some embodiments of any of the aspects, the nucleotide sequence encoding the GAA polypeptide is codon optimized.

[0087] In some embodiments of any of the aspects, the codon optimized nucleotide sequence encoding the GAA polypeptide comprises: (a) one of SEQ ID NOs: 2-18; (b) nucleotides 169-2859 of one of SEQID NOs: 2-18; (c) nucleotides 82-2859 of one of SEQ ID NOs: 2-18; (d) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) (b) or (c); or (e) a functional fragment of (a), (b), (c) or (d).

[0088] In some embodiments of any of the aspects, the nucleotide sequences comprise SEQ ID NO: 26 or a sequence at least 80%, at least 85%, or at least 90% identical thereto.

[0089] In some embodiments of any of the aspects, the nucleic acid construct comprises a nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

[0090] In some embodiments of any of the aspects, the nucleic acid construct is in the context of a plasmid backbone.

[0091] In some embodiments of any of the aspects, the nucleic acid construct comprises a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

[0092] In some embodiments of any of the aspects, the nucleic acid construct is in the context of an neDNA backbone.

[0093] In some embodiments of any of the aspects, the nucleic acid construct comprises a nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

[0094] In one aspect, described herein is a recombinant AAV (rAAV) comprising a nucleic acid construct as described herein.

[0095] In one aspect, described herein is a pharmaceutical composition comprising an rAAV vector as described herein in a pharmaceutically acceptable carrier.

[0096] In one aspect, described herein is a rAAV vector or a pharmaceutical composition for use in treating a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide.

[0097] In one aspect, described herein is a recombinant adeno-associated virus (rAAV) vector for use in treating a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, wherein the rAAV vector has a capsid from serotype AAV843 / XL32. 1 and comprises in its genome: (a) a 5’ inverted terminal repeat (ITR) and a 3 ’ ITR; and (b) located between the 5 ’ ITR and 3 ’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising: (i) a nucleotide sequence encoding a BM40 signal peptide; and (ii) a nucleotide sequence encoding an alpha-glucosidase (GAA) polypeptide comprising residues 57-952 of SEQ ID NO: 1; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

[0098] In one aspect, described herein is a method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising administering a therapeutically effective amount of an rAAV vectoror a pharmaceutical as described herein, to the subject.

[0099] In one aspect, described herein is a method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising administering to the subject a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) vector, which has a capsid from serotype AAV843 / XL32. 1 and comprises in its genome: (a) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; and (b) located between the 5’ ITR and 3’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising: (i) a nucleotide sequence encoding a BM40 signal peptide; and (ii) a nucleotide sequence encoding an alpha- glucosidase (GAA) polypeptide comprising residues 57-952 of SEQ ID NO: 1; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

[0100] In some embodiments of any of the aspects, the administering results in secretion of a functional GAA polypeptide from the subject’s liver, and uptake of the secreted GAA polypeptide by at least one different target tissue (GAA uptake target tissue).

[0101] In some embodiments of any of the aspects, the GAA uptake target tissue is skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or any combination thereof.

[0102] In some embodiments of any of the aspects, uptake of the secreted GAA polypeptide results in a reduction of lysosomal glycogen stores in the at least one GAA uptake target tissue.

[0103] In some embodiments of any of the aspects, the administering is by intramuscular, sub- cutaneous, intraspinal, intracistemal, intrathecal, or intravenous administration.

[0104] In some embodiments of any of the aspects, the rAAV vector is administered at a dosage of from 1.0E11 viral genomes per kilogram of the subject (vg / kg) to 5.0E13 vg / kg.

[0105] In some embodiments of any of the aspects, the rAAV vector is administered at a dosage of from 5.0E12 vg / kg to 2.0E13 vg / kg.

[0106] In some embodiments of any of the aspects, the rAAV vector is administered at a dosage of 5.0el2 vg / kg.

[0107] In some embodiments of any of the aspects, the use or method further comprises periodically administering GAA protein enzyme replacement therapy (ERT) prior to the administering of the rAAV vector or pharmaceutical composition, and withdrawing the GAA protein ERT at least one month prior to the administering of the rAAV vector or pharmaceutical composition.

[0108] In some embodiments of any of the aspects, the use or method further comprises periodically administering GAA protein enzyme replacement therapy (ERT) prior to the administering of the rAAV vector or pharmaceutical composition, and withdrawing the GAA protein ERT on the same day, a day after or, any time between day 1 and 26 weeks after administering the rAAV vector or pharmaceutical composition.

[0109] In some embodiments of any of the aspects, the use or method further comprises periodically administering an immune suppressant in a dosage and a frequency to provide an effective amount, beginning prior to, or at the same time as administering the rAAV vector or pharmaceutical composition.

[0110] In some embodiments of any of the aspects, the immune suppressant is begun 24 hours prior to the administering the rAAV vector or pharmaceutical composition.

[0111] In some embodiments of any of the aspects, the use or method further comprises decreasing the dosage or frequency and / or ceasing the administration of the immune suppressant on the same day, a day after, any time between day 1 and 26 weeks, or later, after administering the rAAV vector or pharmaceutical composition.

[0112] In some embodiments of any of the aspects, the initial dosage is 60 mg / day or is 1 mg / kg.

[0113] In some embodiments of any of the aspects, the dosage is decreased to ≤ 60 mg / dose, ≤ 55 mg / dose, ≤ 50 mg / dose, ≤ 45 mg / dose, ≤ 40 mg / dose, ≤ 35 mg / dose, ≤ 30 mg / dose, ≤ 25 mg / dose, ≤ 20 mg / dose, ≤ 15 mg / dose, ≤ 10 mg / dose, or ≤ 5 mg / dose, or administration is ceased.

[0114] In some embodiments of any of the aspects, the dosage is reduced by 5 mg / day every 7 days until cessation, following an initial 2 week administration period.

[0115] In some embodiments of any of the aspects, the dosage is decreased or the administering of the immune suppressant is ceased at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administering of the rAAV vector or pharmaceutical composition.

[0116] In some embodiments of any of the aspects, the frequency of the administering of the immune suppressant remains the same and the dosage is decreased in periodic intervals until a final reduced dosage is maintained or the administering of an immune suppressant is ceased entirely.

[0117] In some embodiments of any of the aspects, the periodic intervals begin after about 2 weeks after the administering the rAAV vector or pharmaceutical composition.

[0118] In some embodiments of any of the aspects, the periodic interval is about 2 weeks, 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day.

[0119] In some embodiments of any of the aspects, the subject is not administered an immune suppressant prior to, after, or neither prior to or after the administering of the rAAV vector or pharmaceutical composition.

[0120] In some embodiments of any of the aspects, the immune suppressant is selected from the group consisting of prednisone, methyl prednisone, prednisolone, methyl prednisolone, tacrolimus, sirolimus, methotrexate, azathioprine, and combinations thereof.

[0121] In some embodiments of any of the aspects, the immune suppressant is prednisone.

[0122] In one aspect, described herein is a method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising the steps: (a) administering an rAAV vector as described herein or a pharmaceutical composition as described herein to the subject; (b) administering an immune suppressant periodically, at a dosage and frequency that delivers an effective amount to the subject, beginning prior to, at the same time as, or after administering step (a); and (c) decreasing the dosage or frequency of administration and / or ceasing the administration of the immune suppressant at a time following theadministration of the rAAV vector or pharmaceutical composition.

[0123] In some embodiments of any of the aspects, administering step b) begins 24 hours prior to administering step a).

[0124] In some embodiments of any of the aspects, initial dosage is 60 mg / day, and the dosage is decreased to less than 60 mg / dose, ≤ 55 mg / dose, ≤ 50 mg / dose, ≤ 45 mg / dose, ≤ 40 mg / dose, ≤ 35 mg / dose, ≤ 30 mg / dose, ≤ 25 mg / dose, ≤ 20 mg / dose, ≤ 15 mg / dose, ≤ 10 mg / dose, or ≤ 5 mg / dose, or the administering of the immune suppressant is ceased.

[0125] In some embodiments of any of the aspects, the dosage is reduced by 5 mg / day every 7 days until cessation, following an initial 2 week administration period.

[0126] In some embodiments of any of the aspects, the dosage and / or frequency of administration is decreased, or the dosage is ceased, on the same day, a day after, or any time between day 1 and 26 weeks, or more after the administrating of the rAAV vector or pharmaceutical composition.

[0127] In some embodiments of any of the aspects, the dosage and / or frequency of administration is decreased, or the dosage is ceased, at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administrating of the rAAV vector or pharmaceutical composition.

[0128] In some embodiments of any of the aspects, the frequency of the administering of the immune suppressant remains the same and the dosage is decreased in periodic intervals, until a final reduced dosage is maintained, or the administering of an immune suppressant is ceased entirely.

[0129] In some embodiments of any of the aspects, the periodic intervals begin after about 2 weeks after the administering the rAAV vector or pharmaceutical composition.

[0130] In some embodiments of any of the aspects, the periodic interval is about 2 weeks, 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day.

[0131] In some embodiments of any of the aspects, the immune suppressant is selected from the group consisting of prednisone, methyl prednisolone, tacrolimus, sirolimus, methotrexate, azathioprine, and combinations thereof.

[0132] In some embodiments of any of the aspects, the immune suppressant is prednisone.

[0133] In some embodiments of any of the aspects, at least one determination of liver toxicity in the subject remains within a normal range over an extended period of time following the administering of the rAAV vector.

[0134] In some embodiments of any of the aspects, the determination of liver toxicity is alanine aminotransferase (ALT) or aspartate aminotransferase (AST) levels in the subject’s serum.

[0135] In some embodiments of any of the aspects, the ALT level in the subject’s serum is ≤ 50, 60, 70, 80, 90, or 100 lU / mL over baseline following the administering of the rAAV vector.

[0136] In some embodiments of any of the aspects, the extended period of time is at least 10 days, at least 50 days, at least 100 days, at least 300 days, at least 1 year.

[0137] In some embodiments of any of the aspects, the subject fails to mount a substantial immuneresponse specific to the rAAV vector or the GAA polypeptide following the administering of the rAAV vector.

[0138] In some embodiments of any of the aspects, the subject fails to mount a substantial immune response to the rAAV vector or the GAA polypeptide for a period of from 10 to 1000 days following the administering of the rAAV vector.

[0139] In some embodiments of any of the aspects, the subject has a serum GAA concentration of at least 0.3 pmol / L / hr, at least 0.4 pmol / L / hr, at least 0.5 pmol / L / hr, at least 0.6 pmol / L / hr, at least 0.7 pmol / L / hr, at least 0.8 pmol / L / hr, at least 0.9 pmol / L / hr, at least 1 pmol / L / hr, at least 2 pmol / L / hr, at least 3 pmol / L / hr, at least 4 pmol / L / hr, at least 5 pmol / L / hr, at least 6 pmol / L / hr, at least 7 pmol / L / hr, at least 8 pmol / L / hr, at least 9 pmol / L / hr, at least 10 pmol / L / hr, at least 11 pmol / L / hr, at least 12 pmol / L / hr, at least 13 pmol / L / hr, at least 14 pmol / L / hr, or at least 15 pmol / L / hr, following the administering of the rAAV vector.

[0140] In some embodiments of any of the aspects, the serum GAA concentration is detected 10 to 1000 days after the administering of the rAAV vector.

[0141] Aspects of the present invention teach certain benefits in construction and use which give rise to the exemplary advantages described below. Other features and advantages of aspects of the present invention will become apparent from the following more detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, the principles of aspects of the invention.BRIEF DESCRIPTION OF THE DRAWINGS

[0142] Fig. 1 is a schematic showing the Actus (Pl 6) and D9 constructs. D9 replaced P16 1-56aa of GAA with BM40.

[0143] Fig. 2 is a line graph showing 4MU GAA activity in serum of Pompe model mice.

[0144] Fig. 3A-3B are a series of bar graphs showing 4MU GAA activity in heart and tibialis anterior of Pompe model mice.

[0145] Fig. 4A-4B are a series of bar graphs showing glycogen in heart and tibial anterior muscle of Pompe model mice.

[0146] Fig. 5A-5B are a series of bar graphs showing 4MU GAA activity in quadriceps and triceps of Pompe model mice.

[0147] Fig. 6A-6B are a series of bar graphs showing glycogen in quadriceps and triceps of Pompe model mice.

[0148] Fig. 7A-7C are a series of graphs showing a dose dependent study of D9 injection in Pompe model mice.

[0149] Fig. 8 is a line graph showing serum levels of GAA and alanine aminotransferase (ALT) in three human subjects for the first 63 days following D9 administration, with ultimate withdrawal of immunesuppressant therapy.

[0150] Fig. 9 is a line graph showing expected levels of GAA and alanine aminotransferase (ALT) in the serum in human subjects for 52 weeks following D9 administration and withdrawal of immune suppressant therapy.

[0151] The above described figures illustrate aspects of the invention in at least one of its exemplary embodiments, which are further defined in detail in the following description. Features, elements, and aspects of the invention that are referenced by the same numerals in different figures represent the same, equivalent, or similar features, elements, or aspects, in accordance with one or more embodiments.DETAILED DESCRIPTION

[0152] The technology described herein is directed to recombinant AAV (rAAV) vectors and constructs for rAAV for delivering a GAA polypeptide to a subject in the methods to treat Pompe Disease. Some embodiments use a wildtype GAA modified to enhance expression. In some embodiments, the GAA is modified to comprise an N-terminus that corresponds to an N-terminal truncation of a full-length native GAA protein , for example to remove at least an endogenous GAA signal peptide and / or inclusion of a BM40 signal peptide (see e.g., SEQ ID NO: 33), for example in place or addition to the endogenous GAA signal peptide; and / or one or more amino acid mutations described herein. Furthermore, the rAAV constructs described herein for delivering a GAA polypeptide to a subject comprise improvements such as, e.g., incorporation of a 5’ UTR located between the nucleic acid expressing the GAA polypeptide and the liver specific promoter, and / or use of specific terminator sequences 3’ nucleic acid expressing the GAA polypeptide, such as, e.g., specific poly A sequences and / or terminator sequences, multiple polyA sequences, etc.

[0153] In some embodiments, the heterologous nucleic acid encoding GAA polypeptide is codon optimized to reduce an immune response and for enhanced and improved efficiency of expression in human subjects. That is, the rAAV constructs described herein for delivering a GAA polypeptide to a subject comprise improvements, such as but not limited to, a codon optimized nucleic acid sequence encoding a GAA polypeptide, where the codon optimized nucleic acid sequence encoding the GAA polypeptide is modified include features for example, (i) enhanced expression in vivo, (ii) to reduce CpG islands and / or to eliminate CG dinucleotide content, (iii) modification of STOP sequences or elimination of alternative reading frames (ARF), and (iv) to reduce the innate immune response.

[0154] The technology described herein relates to improved recombinant AAV (rAAV) vectors and constructs for rAAV for delivering a GAA polypeptide to a subject in the methods to treat Pompe Disease to those previously disclosed in International Patent Application W02020102645 and WO2021102107 and International Application PCT / US2023 / 015531 filed March 17, 2023, published as WO2023177885A2 on September 21, 2023, each of which are incorporated herein in their entirety by reference.

[0155] In particular, described herein are targeted viral vectors, e.g., using rAAV vectors as an exemplary example, that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), a liver specific promoter, a heterologous gene, a poly-A tail and potentially other regulator elements for use to treat Pompe disease, wherein the heterologous gene is human GAA, and wherein the vector, e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and / or organ for expression of the heterologous gene and treatment of the disease, e.g., Pompe disease. In several aspects of the invention, the encoded human GAA polypeptide is WT GAA or, WT GAA having R, H, and I at positions 199, 223, and 780 respectively, i.e., having three point mutations H199R, R223H, and V780I; or, N-terminal truncation thereof.

[0156] One aspect described herein provides a recombinant adenovirus associated (AAV) vector comprising in its genome: (a) 5’ and 3’ AAV inverted terminal repeats (ITR) sequences, and (b) located between the 5’ and 3’ ITRs, a heterologous nucleic acid sequence encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter as disclosed herein.

[0157] In some embodiments, the heterologous nucleic acid sequence encodes a GAA polypeptide comprising the BM40 secretory signal fused to the GAA polypeptide, wherein the secretory signal (also referred to herein as “signal peptide”) is 5 ’ of the endogenous GAA polypeptide, or an exogenous GAA polypeptide. In some embodiments, the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein. In some embodiments, the nucleotide sequence encoding the BM40 signal peptide and the nucleotide sequence encoding the GAA polypeptide are directly fused to each other; i.e., there are no intervening nucleotide sequences between the nucleotide sequence encoding the BM40 signal peptide and the nucleotide sequence encoding the GAA polypeptide. In some embodiments, the BM40 signal peptide and the GAA polypeptide are directly fused to each other; i.e., there are no intervening amino acid sequences between the BM40 signal peptide and the GAA polypeptide. In some embodiments, the nucleotide sequence encoding the BM40 signal peptide and the nucleotide sequence encoding the GAA polypeptide are indirectly fused to each other; i.e., there are intervening nucleotide sequences between the nucleotide sequence encoding the BM40 signal peptide and the nucleotide sequence encoding the GAA polypeptide. In some embodiments, the BM40 signal peptide and the GAA polypeptide are indirectly fused to each other; i.e., there are intervening amino acid sequences between the BM40 signal peptide and the GAA polypeptide.

[0158] In some embodiments, the nucleic acid encoding the human GAA protein is selected from any of SEQ ID NO: 313-316, or a functional variant having least 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity to any of SEQ ID NO: 313-316, or an N-terminal truncation thereof.

[0159] In one embodiment of any aspect herein, the nucleic acid sequence encoding the GAA polypeptide is the human GAA gene or a human codon optimized GAA gene (coGAA) or a modified GAA nucleic acid sequence. As disclosed herein, the nucleic acid encoding the human GAA protein isselected from any of SEQ ID NO: 1-18, or a functional variant having least 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 98% sequence identity to any of SEQ ID NO: 1-18, or an N-terminal truncation thereof.

[0160] In some embodiments, GAA expressed that comprises at least a signal peptide that promotes secretion of GAA polypeptide from the liver. In some embodiments, the GAA polypeptide, or modified GAA, is expressed as a fusion protein comprising at least the BM40 signal peptide that promotes secretion of the GAA polypeptide from the liver.

[0161] In all aspects of all embodiments of the technology described herein, the liver specific promoter expresses the hGAA polypeptide preferentially in the liver. In all aspects of all embodiments of the technology described herein, in some embodiments where the AAV vector comprises at least one capsid protein targeting the liver.I. Recombinant AAV expressing GAA

[0162] As disclosed herein, one aspect of the technology relates to a method to treat Pompe disease using a rAAV vector comprising a capsid, and within its capsid, a nucleotide sequence referred to as the “rAAV vector genome”. The rAAV vector genome (also referred to as “rAAV genome”) includes multiple elements, including, but not limited to two inverted terminal repeats (ITRs, e.g., the 5’-ITR and the 3’-ITR), and located between the ITRs are additional elements, including a promoter, a heterologous gene encoding a GAA polypeptide and a poly- A tail. In various embodiments, the heterologous gene encoding a GAA polypeptide is not codon optimized. In some embodiments, the heterologous gene encoding a GAA polypeptide is codon optimized, e.g., including but not limited to, reducing CpGs, reduced CpG islands, and minimizing or eliminating internal start codons. In various embodiments, the rAAV vector genome is a single stranded (ss) genome. In some embodiments, the rAAV vector genome is a self-complementary genome, e.g., as described in U.S. Patent Number 7,790,154. Self-complementary rAAV vector genomes may comprise three ITRs including two wild type AAV2 ITRs and one mutated ITR, or only one intact ITR, which is the minimal requirement for packaging particles.

[0163] In some embodiments, the rAAV genome disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5’ITR and the 3’ ITR, a promoter, e.g., a liver specific promoter sequence as disclosed herein, which operatively linked to a heterologous nucleic acid encoding a nucleic acid encoding an alpha-glucosidase (GAA) polypeptide, where the heterologous nucleic acid is codon optimized as disclosed herein, and where there is a 5’ UTR located between the nucleic acid encoding a GAA polypeptide and the liver specific promoter sequence. In some instances, there is also a 3’ UTR. In some embodiments, the UTR can contain an intron. In one embodiment, the heterologous nucleic acid sequence can optionally further comprise one or more of the following elements: an intron sequence, a nucleic acid encoding a heterologous SP as disclosed herein (e.g., BM40), a poly A sequence, and a terminator sequence. In some embodiments, the 5’ UTR sequence comprises SEQ ID NO: 25, SEQ IDNO: 34, or comprises SEQ ID NO: 35, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NOs: 25, 34, or 35. In some embodiments, the poly A sequence is a full length HGH poly A sequence comprising SEQ ID NO: 30 or SEQ ID NO: 36, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NO: 30 or SEQ ID NO: 36. In some embodiments, the terminator sequence is a reverse RNA pol II terminator sequence. In some embodiments, a reverse RNA pol II terminator sequence comprises sequence SEQ ID NO: 39, or a sequence having at least 85%, or at least 90% or more sequence identity to SEQ ID NO: 39. In some embodiments, the terminator sequence is a reverse poly A sequence as described in the International Publication No. WO2019143950. The reverse poly A can be any poly A sequence that is known in the art and is placed in 3’ to 5’ orientation.

[0164] In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide encodes a truncated GAA polypeptide, such as, for example, beginning at amino acid residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, and / or a C-terminal truncation beginning at residues 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1, or a GAA polypeptide that has at least 80%, or at least 85%, or at least 90% or at least 95% sequence identity to SEQ ID NO: 1 over the amino acid residues 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952 and 796-952 of SEQ ID NO: 1.

[0165] In some embodiments, the nucleic acid encoding a truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74 of SEQ ID NO: 1 and / or a second truncation starting at residues 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1) that has a heterologous signal peptide (e.g., BM40) attached to the N-terminal of the GAA polypeptide, e.g., comprises heterologous signal peptide comprising residues of SEQ ID NO: 27.

[0166] In some embodiments, the GAA polypeptide is a N-terminal truncated GAA polypeptide, with the truncation beginning at any amino acids 29-35 of SEQ ID NO: 1. In some embodiments, the nucleic acid encoding an alpha-glucosidase (GAA) polypeptide comprises (i) a heterologous signal peptide as disclosed herein (e.g., BM40), and (ii) a GAA polypeptide, e.g., a N-terminal truncated GAA polypeptide, e.g., a GAA polypeptide beginning at any of residues 35, 40, 50, 57, 60, 68, 69, 70, 72, 74, 779, 790, 791, 792, 793 and 796 of SEQ ID NO: 1. In some embodiments, the GAA polypeptide can comprise a C- terminal truncation of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least between 5- 10, or between 10-20, or between 20-30 amino residues at the C-terminus of the GAA polypeptide. Exemplary heterologous signal peptides are disclosed herein, including, but not limited to, the BM40 signal peptide comprising amino acids selected from SEQ ID NO: 33.

[0167] In some embodiments, the signal peptide attached to the N-terminal of the truncated GAA polypeptide comprises SEQ ID NO: 32 or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 32. In some embodiments, nucleic acid encoding the signal peptide attached to the N-terminal of the truncated GAA polypeptide comprises SEQ ID NO: 26 or an amino acid sequence that is at least 70%, 75%≤ 80%, 85%,90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 26.A. Alpha-glucosidase (GAA) polypeptide

[0168] The GAA gene (NM_000152.3) is approximately 18.3 kilobases (kb) long and contains 20 exons (Dasouki et al. 2014). Its complementary DNA has 2,859 nucleotides of coding sequence which encode the immature 952 amino acid enzyme. GAA is synthesized as a membrane bound, catalytically inactive (with respect to the natural substrate glycogen) precursor which is sequestered in the endoplasmic reticulum. It undergoes sugar chain modification in the Golgi complex, followed by transport into the (minor) secretory pathway, or into lysosomes where it is trimmed in a stepwise process at both the amino- and carboxyl -termini. Phosphorylation of mannose residues ensures efficient transport of the enzyme to the lysosomes via the mannose 6-phosphate receptor. In the lysosomes, GAA catalyzes the hydrolysis of a 1— >4 glucosidic linkages in glycogen in the low potential hydrogen (pH) environment to glucose. Specificity for the natural substrate (glycogen) is gained during its maturation.

[0169] Many normal allelic variants exist in GAA and are responsible for the three known alloenzymes (GAA1, GAA2, and GAA4). More than 450 mutations in GAA have been reported in individuals with Pompe disease. Nonsense mutations, large and small gene rearrangements, and splicing defects have been observed with many mutations being potentially specific to families, geographic regions, or ethnicities. Combinations of mutations that result in either complete or nearly complete absence of GAA enzyme activity (typically <1% of normal activity in skin fibroblasts) are seen more commonly in individuals with infantile-onset Pompe disease (IOPD), whereas those combinations that allow partial enzyme activity (approximately 2-40% of normal activity in skin fibroblasts) typically have late-onset Pompe disease (LOPD) presentation. GAA mutations result in messenger RNA instability and / or severely truncated acid a-glucosidase or an enzyme with markedly decreased activity. Dysfunction or absence of GAA leads to the accumulation of glycogen in lysosomes and in the cytoplasm in multiple tissues, resulting in the destruction of skeletal, smooth and cardiac muscle. The effect of the enzyme deficiency may extend to vesicle systems that are linked to lysosomes and may also affect receptors, such as glucose transporter 4, that cycle through these organelles. Evidence has also shown a failure of productive autophagy and the progressive accumulation of autophagosomes that disrupt the contractile apparatus in muscle fibers, which correlated with a lack of correction of skeletal muscle during ERT.

[0170] Alpha-glucosidase (GAA) polypeptide is a member of family 31 of glycoside hydrolases. Human GAA is synthesized as a 110 kDal precursor (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The mature form of the enzyme is a mixture of monomers of 70 and 76 kDal (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The precursor enzyme has seven potential glycosylation sites and four of these are retained in the mature enzyme (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31). The proteolytic cleavage events which produce the mature enzyme occur in late endosomes or in the lysosome (Wisselaar et al. (1993) J. Biol. Chem. 268(3): 2223-31).

[0171] The rAAV vector genome can encode a GAA polypeptide can include, for example, amino acid residues 57-952 of human GAA, or a smaller portion, such as amino acid residues 57-790.

[0172] The C-terminal 160 amino acids are absent from the mature 70 and 76 kDal GAA polypeptide species. However, certain Pompe alleles resulting in the complete loss of GAA activity map to this region, for example Val949Asp (Becker et al. (1998) J. Hum. Genet. 62:991). The phenotype of this mutant indicates that the C-terminal portion of the protein, although not part of the 70 or 76 kDal species, plays an important role in the function of the protein. It has also been reported that the C-terminal portion of the protein, although cleaved from the rest of the protein during processing, remains associated with the major species (Moreland et al. (Nov. 1, 2004) J. Biol. Chem., Manuscript 404008200). Accordingly, the C-terminal residues could play a direct role in the catalytic activity of the protein, and / or may be involved in promoting proper folding of the N-terminal portions of the protein.

[0173] The native GAA gene encodes a precursor polypeptide which possesses a signal sequence and an adjacent putative trans-membrane domain, a trefoil domain (PF AM PF00088) which is a cysteine-rich domain of about 45 amino acids containing 3 disulfide linkages (Thim (1989) FEBS Lett. 250:85), the domain defined by the mature 70 / 76 kDal polypeptide, and the C-terminal domain. It has been reported that both the trefoil domain and the C-terminal domain are required for the production of functional GAA, and that it is possible that the C-terminal domain interacts with the trefoil domain during protein folding perhaps facilitating appropriate disulfide bond formation in the trefoil domain.

[0174] In some embodiments of the methods and compositions as disclosed herein, the human GAA protein expressed by the AAV comprises amino acids 57-952 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to amino acids 57-952 of SEQ ID NO: 1.

[0175] In some embodiments, the hGAA polypeptide comprises a signal peptide (SP), e.g., a heterologous signal peptide. One of ordinary skill in the art can appreciate particular positions of GAA to which a signal peptide (SP) can be fused.

[0176] In some embodiments of the methods and compositions as disclosed herein, the human GAA protein expressed by the AAV comprises amino acids of SEQ ID NO: 1, or fragments or variants thereof, for example a human GAA protein beginning at any of residues selected from: 40,50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1. Accordingly, in one aspect the invention relates to a GAA protein, where the SP is fused to N-terminal amino acid 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of human GAA of SEQ ID NO: 1. In some embodiments, the GAA polypeptide expressed by the AAV vector disclosed herein has at least 80%, or at least 85%, or at least 90% or at least 95% sequence identity to amino acid residues selected from: 28-952, 35-952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952 and 796-952 of SEQ ID NO: 1, and can further comprise a N-terminal signal peptide, where the signal peptide can be a heterologous signal peptide as disclosed herein.

[0177] In some embodiments of the methods and compositions as disclosed herein, the human GAA protein expressed by the AAV comprises amino acids is a human GAA protein beginning at any ofresidues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 1, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto.(i) Modified GAA (modGAA) polypeptides

[0178] In some embodiments, the modified human GAA protein comprises a polypeptide with at least one modification selected from: H199R, R223H, V780I or H201L of SEQ ID NO: 1 or 312, or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 amino acids of SEQ ID NO: 1 or 312 having at least one of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide comprises at least two modifications selected from: H199R, R223H, V780I or H201L of SEQ ID NO: 1 or 312, or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 consecutive amino acids of SEQ ID NO: 1 or 312 having at least two of these modifications. In some embodiments, the modified human GAA protein comprises a polypeptide with three modifications selected from: H199R, R223H, V780I and H201L of SEQ ID NO: 1 or 312 (GAA-H199R-H201L-R223H or GAA-H199R-H201L- V780I), or a variant of at least 80%, 90%, 95%, or 99% homology to at least 500, 550, 600, 650, 700, 750, 800, 850, or 900 consecutive amino acids of SEQ ID NO: 1 or 312 having these three modifications. In other words, reference to modification of SEQ ID NO: 1 with respect to H199R, R223H, V780I, which are present therein refers to modification of the existing amino acid at that position to something else (e.g., to the sequence of SEQ ID NO: 312, or a conservative a.a. substitution). In contrast, SEQ ID NO: 312 does not have any of H199R, R223H, V780I or H201L, so reference to modification with respect to H199R, R223H, V780I or H201L refers to the recited specific amino acid substitution.

[0179] One can use these modified GAA polypeptides and fragments thereof. In some embodiments, the human modified GAA protein expressed by the AAV comprises a GAA polypeptide of SEQ ID NO: 1 as modified above, or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1, or a nucleic acid encoding such a sequence (e.g., SEQ ID NOs: 2-18, 313-316), or a fragment of SEQ ID NO: 1, wherein the fragment begins at any of residues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of any of SEQ ID NO: 1 (modGAA; H199R, R223H, V780I) or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 1, where there is R at amino acid position 199; a H at amino acid position 223; and I at amino acid position 780. Actus 101 (SEQ ID NO: 1) while comprising three point mutations, is considered a wildtype GAA. SEQ ID NO: 1 comprises (H199R, R223H, V780I) as compared to another wildtype GAA SEQ ID NO: 312.

[0180] In some embodiments, the human modified GAA protein expressed by the AAV comprises a GAA polypeptide of SEQ ID NO: 82 (H199R, R223H) or fragment thereof, wherein the fragment begins at any of residues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 82 (H199R, R223H) or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or98%, or 99% identical to SEQ ID NO: 82 (H199R, R223H) where there is R at amino acid position 199; and a H at amino acid position 223.

[0181] In some embodiments, the human modified GAA protein expressed by the AAV comprises a GAA polypeptide of SEQ ID NO: 83 (H199R, H201L, R223H) or fragment thereof, wherein the fragment begins at any of residues selected from: 40, 50, 57, 68, 69, 70, 71, 72, 779, 787, 789, 790, 791, 792, 793, or 796 of SEQ ID NO: 83 (H199R, H201L, R223H) or a protein at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical to SEQ ID NO: 83 (H199R, H201L, R223H), where there is R at amino acid position 199; L at amino acid position 201; and H at amino acid position 223.

[0182] In some embodiments, GAA is modified to add or remove glycosylation sites such as N-linked glycosylation sites, O-linked glycosylation sites or both. In certain embodiments, the addition or removal of glycosylation sites are achieved by N-terminal deletions, C-terminal deletions, internal deletions, random point mutagenesis, or, site directed mutagenesis. In some embodiments, the exemplary GAA modification involve addition of one or more Asparagine (Asn) residue / s or, one or more mutation to yield Asparagine (Asn) residue / s or, deletion of one or more Asparagine (Asn) residue / s. In certain embodiments, all or some of the N-linked, and / or, O-linked glycosylation sites present in GAA are mutated. In some embodiments, GAA modifications will yield information pertaining to the biological activity, physical structure and / or substrate binding potential of GAA.

[0183] In one embodiment, the modified human GAA protein comprises a deletion of the stretch of amino acids between and inclusive of 1-56 of SEQ ID NO: 1. In one embodiment, a modified human GAA protein comprising a deletion of the stretch of amino acids between and inclusive of 1-56 of SEQ ID NO: 1 is no longer maintained within the cell.

[0184] In one embodiment, the modified human GAA protein comprises a polypeptide with at least one modification selected from Table 2. Modifications listed on Table 2 are commonly identified GAA polymorphisms but are not associated with a disease, e.g., Pompe disease. See e.g., CLINGEN Allele Registry, available on the world wide web at reg.clinicalgenome.org / redmine / projects / registry / genboree_registry(ii) Nucleotide sequences: N-terminal GAA polypeptide truncations and nucleic acid sequences encoding GAA polypeptides and N-terminal truncations, with the heterologous BM40 signal peptide.

[0185] In some embodiments, the nucleic acid encoding a GAA polypeptide disclosed herein comprises SEQ ID NO: 313 or SEQ ID NO: 314 or a nucleotide sequence at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto, or a fragment thereof, as described further herein.

[0186] In some embodiments, the nucleic acid encoding a GAA polypeptide disclosed herein comprises SEQ ID NO: 315 or SEQ ID NO: 316 or a nucleotide sequence at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% identical thereto, or a fragment thereof, as described further herein, and in the encoded GAA polypeptide amino acid residue 199 is an R (199R), amino acid residue 223 is an H (223H) and amino acid residue 780 is an I (7801).

[0187] In some embodiments, the nucleic acids encoding a GAA protein disclosed herein, e.g., SEQ ID NOS: 2-18 that are codon optimized GAA nucleic acid sequence, for example, which have been modified from the NCBI GAA sequence of NM_00152.5 to include, any one or more of (i) enhanced expression in vivo, (ii) reduce CpG islands or reduction or elimination of CG dinucleotides, (iii) to reduce the innate immune response, and (iv) to reduce or eliminate alternative reading frames (ARF), or open reading frames (ORF). Exemplary codon optimized GAA nucleic sequences encompassed for use in the methods and rAAV compositions as disclosed herein can be selected from any of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 or SEQ ID NO: 18 as disclosed herein, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 2-18, where SEQ ID NO: 2-18 or variants of at least 80% sequence identity thereto encode GAA polypeptide, where amino acid at position 199 is R (199R); amino acid at position 233 is H (233H), and amino acid at position 780 is I (7801).

[0188] In some embodiments, codon optimized GAA nucleic sequences encompassed for use in the methods and rAAV compositions as disclosed herein can be selected from any of: SEQ ID NO: 3 or SEQ ID NO: 4, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 3 or SEQ ID NO: 4.

[0189] The rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises the heterologous nucleic acid sequence encoding the BM40 signal peptide (SP) fused in frame to the 5' terminus of a GAA nucleic acid sequence that encodes an N-terminal truncated GAA polypeptide, as disclosed herein. For example, the heterologous nucleic acid sequence encoding the BM40 signal peptide (SP) is fused in frame to the 5' terminus of a GAA nucleic acid sequence that encodes the N-terminal truncated GAA polypeptide, so that both polypeptides are expressed from the rAAV genome when the rAAV vector transduces a mammalian cell.

[0190] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 3, or a portion of SEQ ID NO: 3, where expression of a portion of the nucleic acid of SEQ ID NO: 3 produces a functional hGAA protein, and where the functional hGAA protein can comprise a N-terminal deletion of SEQ ID NO: 1, or a N-terminal and C-terminal truncation of SEQ ID NO: 1 as disclosed herein.

[0191] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence comprising SEQ ID NO: 2-18, or SEQ ID NO: 313-316, or nucleotides 169-2859 of SEQ ID NO: 2-18, or nucleotides 169-2859 of SEQ ID NO: 313-316, or a nucleic acid having at least 85% sequence identity thereto, where nucleotides 1-168 of SEQ ID NO: 2-18 (e.g., SEQ ID NO: 262 corresponds to nucleotides 1-168 of SEQ ID NO: 14), or nucleotides 1-168 of SEQ ID NO: 313-316, which encodes for a codon optimized hGAA signal peptide are replaced with the nucleic acid encoding the heterologous BM40 signal peptide or a codon optimized version as disclosed herein, e.g., SEQ ID NO: 27 (BM40), or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0192] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises one or more base pair deletions at the 5’ end of SEQ ID NO: 2-18, or one or more base pair deletions at the 5’ end of SEQ ID NO: 313-316.

[0193] For example, in some embodiments, the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any of: 82-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 103-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 118-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 148-2859bp of SEQ ID NO: 3 or SEQ NO: 2- 18 or SEQ ID NO: 313-316, 169-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 199-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 205-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 208-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 214-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 220-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 265-2859bp of SEQ ID NO: 3 or SEQ NO: 2- 18 or SEQ ID NO: 313-316, 2335-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2368-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2371-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2374-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2377-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2386- 2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, or a nucleic acid having at least 85% sequence identity thereto, and attached to the 5’ of said sequence, SEQ ID NO: 27 or nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto, which encodes for a BM40 signal peptide.

[0194] In an alternative embodiment, the heterologous nucleic acid sequence in the AAV genome can comprise nucleotides selected from any of: 82-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ IDNO: 313-316, 103-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 118-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 148-2859bp of SEQ ID NO: 3 or SEQ NO: 2- 18 or SEQ ID NO: 313-316, 169-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 199-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 205-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 208-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 214-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 220-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 265-2859bp of SEQ ID NO: 3 or SEQ NO: 2- 18 or SEQ ID NO: 313-316, 2335-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2368-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2371-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2374-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2377-2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, 2386- 2859bp of SEQ ID NO: 3 or SEQ NO: 2-18 or SEQ ID NO: 313-316, or a nucleic acid having at least 85% sequence identity thereto, and attached to the 5’ of said sequence, SEQ ID NO: 27, which encodes for a BM40 signal peptide, or a codon optimized version, and at least one additional heterologous signal peptide as disclosed herein, e.g., selected from any of SEQ ID NOS: 261, 264-288, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0195] In some embodiments, the truncated GAA can be wildtype (e.g., of SEQ ID NO: 312). For example, exemplary 5’ deletions of SEQ ID NO: 313 or SEQ ID NO: 314 are disclosed in Table 1A herein, which each encode for a wild-type N-terminal truncated GAA polypeptide. In some embodiments, the 5’ of the 5’ deletions of SEQ ID NO: 313 or SEQ ID NO: 314 can be attached to the 3’ of a nucleic acid encoding a signal peptide as disclosed herein, e.g., a BM40 signal peptide encoded by the nucleic acid sequence of SEQ ID NO: 27, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0196] Table 1A: Table of exemplary N-terminal truncations of wild-type GAA polypeptide of SEQ ID NO: 312, and the 5’ deletions of nucleic acid sequence of SEQ ID NO: 313 or SEQ ID NO: 314.

[0197] In some embodiments, the truncated GAA can include Actus mutations (e.g., H199R, R223H, and V780I) and / or be codon optimized. For example, exemplary 5’ deletions of SEQ ID NO: 315 or SEQID NO: 316, or of codon-optimized SEQ ID NOs: 2-18, are disclosed in Table 1 herein, which each encode for an N-terminal truncated GAA polypeptide. In some embodiments, the 5’ of the 5’ deletions of SEQ ID NO: 315 or of SEQ ID NO: 316 (or codon-optimized SEQ ID NOs: 2-18) can be attached to the 3’ of a nucleic acid encoding a signal peptide as disclosed herein, e.g., a BM40 signal peptide encoded by the nucleic acid sequence of SEQ ID NO: 27, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0198] Table 1: Table of exemplary N-terminal truncations of GAA polypeptide of SEQ ID NO: 1, and the 5’ deletions of nucleic acid sequence of SEQ ID NO: 3, 315 and 316.

[0199] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 103-2859 of SEQ ID NO: 2-18 or nucleotides 103-2859 of SEQ ID NO: 313-316, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0200] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 118-2859 of SEQ ID NO: 2-18 or nucleotides 118-2859 of SEQ ID NO: 313-316, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized BM40signal peptide (i.e. for example , a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, , or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0201] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 148-2859 of SEQ ID NO: 2-18 or nucleotides 148-2859 of SEQ ID NO: 313-316, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0202] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 169-2859 of SEQ ID NO: 2-18 or nucleotides 169-2859 of SEQ ID NO: 313-316, attached to the 5’ of said sequence, there is nucleic acid encoding, e.g., a codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0203] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 199-2859 ofSEQ ID NO: 2-18 or nucleotides 199-2859of SEQ ID NO: 313-316, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0204] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 205-2859 or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316, where attached to the 5 ’ of said sequence, there is nucleic acid encoding a wild-type or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0205] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises nucleotides 220-2859 or nucleotides 208-2859, or nucleotides 214-2859 of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316, where attached to the 5 ’ of said sequence, there is nucleic acid encoding a wild-type or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27) or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0206] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that comprises any of: nucleotides 265- 2859, or nucleotides 2335-2859, or nucleotides 2368-2859, or nucleotides 2371-2859bp of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316, where attached to the 5’ of said sequence, there is nucleic acid encoding a wildtype or codon optimized BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity thereto.

[0207] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that encodes the signal sequence as disclosed herein, and a N-terminal truncated GAA polypeptide, where the GAA polypeptide begins at amino acid residues selected from any of: 28, 35, 40, 50, 57, 57, 68, 69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796, and optionally, where the GAA polypeptide also has a C-terminal deletion of at least about 10, or about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, or about 100, or about 110, or more than 110 amino acid residues from the C-terminus of SEQ ID NO: 1. In some embodiment, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that encodes a signal sequence as disclosed herein (e.g., BM40), and a GAA polypeptide or a N-terminal truncated GAA polypeptide, where the GAA polypeptide begins at amino acid residues selected from any of: 28, 35, 40, 50, 57, , 68,69, 70, 72, 74, 89, 779, 790, 791, 792, 793 or 796, and where the C-terminal of the GAA polypeptide occurs at any residue after amino acid residue 500, 600, 700, 800, 842, 852, 862, 875, 885, 895, 900, 905, 915, 920, 925, 930, 935, 940, 945, 950, 951 of SEQ ID NO. 1.

[0208] In some embodiments, the rAAV genome useful in the methods to treat Pompe Disease as disclosed herein comprises a heterologous nucleic acid sequence that (i) comprises a wildtype or codon optimized BM40 nucleotide sequence encoding BM40 signal peptide (i.e., for example a nucleic acid comprising SEQ ID NO: 27), or fragment thereof, or a nucleotide sequence having at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% sequence identity to SEQ ID NO: 27, and (ii) encodes a GAA polypeptide, the GAA polypeptide encoded by a nucleic acid sequence beginning at base pairs selected from any of: 82, 103, 118, 148, 169, 199, 205, 208, 214, 220, 265 of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316, and ending at base pair selected from any of: 2553 (i.e., deletion of 100 C-terminal residues, ends at 851aa), 2583 (i.e., deletion of 90 C-terminal residues, ends at 861aa), 2613 (i.e., deletion of 80 C-terminal residues, ends at 871aa), 2643 (i.e., deletion of 70 C- terminal residues, ends at 871aa), 2673 (i.e., deletion of 60 C-terminal residues, ends at 881aa), 2703 (i.e., deletion of 50 C-terminal residues, ends at 891aa), 2733 (i.e., deletion of 40 C-terminal residues, ends at 901aa), 2763 (i.e., deletion of 30 C-terminal residues, ends at 911aa), 2823 (i.e., deletion of 20 C- terminal residues, ends at 921aa), 2775 (i.e., deletion of 27 C-terminal residues, ends at 925aa), 2826 (i.e., deletion of 10 C-terminal residues, ends at 942aa) of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316, or ending anywhere between base pairs 2553- 2859 of SEQ ID NO: 2-18 or of SEQ ID NO: 313-316.B. Signal Peptide (SP)

[0209] The native GAA signal peptide is not cleaved in the ER thereby causing native GAA polypeptide to be membrane bound in the ER (Tsuji et al. (1987) Biochem. Int. 15(5):945-952). Disruption of the membrane association of GAA can be accomplished by replacing the endogenous GAA signal peptide (and optionally adjacent sequences) with an alternate signal peptide for GAA.

[0210] In the compositions and methods described herein, the BM40 signal peptides serve a general purpose of assisting the secretion of the GAA polypeptide from the liver cells into the blood, where it can travel and be targeted to the lysosomes of mammalian cells, for example, human cardiac and skeletal muscle cells, as described herein.

[0211] Generally, secretory signal peptides are cleaved within the endoplasmic reticulum and, in some embodiments, the signal peptide is cleaved from the GAA polypeptide prior to secretion. It is not necessary, however, that the signal peptide is cleaved as long as secretion of the GAA polypeptide from the cell is enhanced and the GAA polypeptide is functional. Thus, in some embodiments, the signal peptide is partially or entirely retained.

[0212] In some embodiments, the rAAV genome, or an isolated nucleic acid as disclosed herein comprises a nucleic acid encoding a chimeric polypeptide comprising a GAA polypeptide operably linked to the BM40 secretory signal peptide, and the chimeric polypeptide is expressed and produced from a celltransduced with the rAAV vector and the GAA polypeptide is secreted from the cell. The GAA polypeptide can be secreted after cleavage of all or part of the secretory signal peptide. Alternatively, the GAA polypeptide can retain the signal peptide (i.e., the signal peptide is not cleaved). Thus, in this context, the “GAA polypeptide” can be or exist in a chimeric polypeptide comprising the heterologous secretory peptide. In general, the heterologous signal peptide (e.g., BM40), and optionally a GAA-signal peptide and / or an additional heterologous signal peptide, will be at the amino-terminus (N-terminus) of the GAA polypeptide (i.e., the nucleic acid segment encoding the signal peptide is at the 5' end to the heterologous nucleic acid encoding the GAA peptide in the rAAV vector or rAAV genome as disclosed herein). Alternatively, the signal peptide may be at the carboxyl-terminus or embedded within the GAA polypeptide, as long as the signal peptide is operatively associated therewith and directs secretion of the GAA polypeptide or GAA fusion polypeptide of interest (either with or without cleavage of the signal peptide from the GAA polypeptide) from the cell.

[0213] The signal peptide is operatively associated with the GAA polypeptide, including N-terminal truncated GAA polypeptides as disclosed in Table 1 and Table 1A herein, and is targeted to the secretory pathway. Alternatively stated, the signal peptide is operatively associated with the GAA polypeptide such that the GAA-polypeptide is secreted from the cell at a higher level (i.e., a greater quantity) than in the absence of the secretory signal peptide. In general, typically at least about 20%, 30%, 40%, 50%, 70%, 80%, 85%, 90%, 95% or more of the GAA-polypeptide is secreted from the cell when a signal peptide is attached as compared to in the absence of the attachment of a secretory signal peptide. In other embodiments, essentially all of the detectable polypeptide (alone and / or in the form of the fusion polypeptide) is secreted from the cell.

[0214] By the phrase “secreted from the cell”, the polypeptide may be secreted into any compartment (e.g., fluid or space) outside of the cell including but not limited to: the interstitial space, blood, lymph, cerebrospinal fluid, kidney tubules, airway passages (e.g., alveoli, bronchioles, bronchia, nasal passages, etc.), the gastrointestinal tract (e.g., esophagus, stomach, small intestine, colon, etc.), vitreous fluid in the eye, and the cochlear endolymph, and the like.

[0215] Accordingly, in representative embodiments, the rAAV vector and rAAV genome useful in the methods to treat Pompe disease as disclosed herein further comprises a heterologous nucleic acid encoding a GAA polypeptide to be transferred to a target cell, attached to a heterologous nucleic acid sequence that encodes a heterologous signal peptide in the place of the endogenous GAA signal peptide. The heterologous nucleic acid encoding a GAA polypeptide, including N-terminal truncations of the GAA polypeptide, is operatively associated with the segment encoding the secretory signal peptide, such that upon transcription and translation a fusion polypeptide is produced containing the secretory signal sequence operably associated with (e.g., directing the secretion of) the N-terminal truncated GAA polypeptide.(i) BM40 signal peptide

[0216] The BM40 signal peptide is derived from native BM40 (e.g., human BM40). As used herein the term “derived from” means the BM40 signal peptide has the same amino acid sequence as the native signal peptide of BM40 (e.g., human BM40), has the same amino acid sequence as a fragment of the native signal peptide, and / or has one or more amino acid substitutions, insertions or deletions, of the native signal peptide of BM40 or the fragment , and further maintains the function of the native BM40 signal peptide (e.g., secretion signal). As such, the BM40 signal peptides, and their encoding nucleotide sequences, can be different sequences or lengths.

[0217] Basement-membrane protein 40 (BM-40, BM40) is also referred to as Osteonectin (ON) or secreted protein acidic and rich in cysteine (SPARC). BM-40 s a protein that in humans is encoded by the SPARC gene. The human SPARC gene is 26.5 kb long, and contains 10 exons and 9 introns and is located on chromosome 5q31-q33. BM40 is a cysteine-rich acidic matrix-associated protein. The BM40 protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. Inclusion of a BM40 signal peptide can hasten the rate at which a polypeptide moves through the ER, decreasing intracellular accumulation.

[0218] In some embodiments, the BM40 signal peptide is encoded by a nucleic acid comprising SEQ ID NO: 27 or a nucleic acid that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 27 or a fragment thereof in which the encoded polypeptide maintains its function (e.g., secretion signal).

[0219] In some embodiments, the BM40 signal peptide comprises SEQ ID NO: 33 (MRAWIFFLLCLAGRALA) or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 33 or a fragment thereof that maintains its function (e.g., secretion signal).

[0220] In some embodiments, at least the endogenous signal peptide of hGAA (i.e., amino acids 1-27 of SEQ ID NO: 1 (encoded by an endogenous nucleic acid corresponding to SEQ ID NO: 261 or a codon optimized nucleic acid sequence corresponding to SEQ ID NO: 263, or the amino acid sequence SEQ ID NO: 269)) is replaced with a heterologous signal peptide (also referred to herein as a “signal sequence” or “leader sequence”) of SEQ ID NO: 33 (BM40; e.g., encoded by SEQ ID NO: 27) or a signal peptide with at least 90% sequence identity or fragment thereof that maintains its function (e.g., secretion signal). In some embodiments, amino acids 1-56 of SEQ ID NO: 1 (SEQ ID NO: 269, encoded by a nucleic acid sequence corresponding to SEQ ID NO: 262) is replaced with a heterologous signal peptide (also referred to herein as a “signal sequence” or “leader sequence”) of SEQ ID NO: 33 (BM40; e.g., encoded by SEQ ID NO: 27) or a signal peptide with at least 90% sequence identity or fragment thereof that maintains its function (e.g., secretion signal).

[0221] In some embodiments, the nucleic acid sequence that encodes a BM40-signal peptide encodes at least 1-5, or at least 1-10, or at least 1-11, or at least about 1-12, or at least about 1-13, or at least about 1- 14, or at least about 1-15, or at least about 1-16, or at least about 1-17 consecutive amino acids (i.e., the full BM40 signal peptide sequence), or non-consecutive amino acids of the BM40 signal peptide of SEQID NO: 33. In some embodiments, the nucleic acid sequence encoding a BM40-signal peptide encodes a BM40 signal peptide that comprises at least one deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10 amino acids of SEQ ID NO: 33, where the one or more deletions can be consecutive, or non-consecutive deletions.

[0222] In some embodiments, the nucleic acid sequence that encodes a BM40-signal peptide can comprise the entire nucleic acid of SEQ ID NO: 27 (encoding BM40 signal peptide comprising amino acids 1-17 of SEQ ID NO: 33). In alternative embodiments, the nucleic acid sequence that encodes a BM40-signal peptide can comprise a portion of the nucleic acid sequence of SEQ ID NO: 27, e.g., portions of SEQ ID NO: 27 that are selected from consecutive bases of SEQ ID NO: 27 having the length of any of: 1-3bp, 1-4bp, 1-5bp, 1-6bp, 1-7bp, 1-8bp, 1-9bp, 1-10bp, 1-1 Ibp, 1-12bp, 1-13bp, 1-14bp, 1- 15bp, 1-16bp, 1-17bp, 1-18bp, 1-19bp, 1-20bp, 1-2 Ibp, 1-22bp, 1-23bp, 1-24bp, 1-25bp, 1-26bp, 1-27bp, 1-28bp, 1-29bp, 1-30bp, 1-33bp, 1-36bp, 1-39bp, 1-42bp, 1-45bp, or 1-48bp in any region of the nucleic acid sequence of SEQ ID NO: 27. That is, using a 2 Ibp portion of SEQ ID NO: 27 as an exemplary example, the GAA signal peptide can comprise a nucleic acid that is a 2 Ibp portion of SEQ ID NO: 27, where the 21bp can be any 21-concenceutive base pairs of SEQ ID NO: 27. For example, a 1-21bp portion beginning at base pair 1 of SEQ ID NO: 27 would encode for a GAA-signal peptide comprising amino acids 1-7 of SEQ ID NO: 33, whereas a 1-21bp portion beginning at base pair 15 of SEQ ID NO: 27 would encode for a GAA-signal peptide comprising amino acids 5-12 of SEQ ID NO: 33. In some embodiments, a portion of the BM40 signal peptide of SEQ ID NO: 33 is the N-terminal portion of SEQ ID NO: 33 (i.e., has a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or more than 15 amino acids at the C-terminal of SEQ ID NO: 33).

[0223] In some embodiments, the nucleic acid sequences in the rAAV vector or rAAV genome is a sequence selected from SEQ ID NO: 20-22. In one embodiment, the nucleic acid sequences in the rAAV vector or rAAV genome comprises at least a portion of a sequence selected from SEQ ID NO: 20-22 (i.e., a sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of the sequence of SEQ ID NO: 20-22).

[0224] In some embodiments, exemplary nucleic acid sequences in the rAAV vector or rAAV genome as disclosed herein are shown in exemplary constructs provided herein below:• D9, is a plasmid comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]- [5’UTR]-[BM40 signal peptide]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: 1]- [3’UTR]-[hGH polyA signal]- [R-ITR], See, e.g., SEQ ID NO: 20.• pP160, is a closed-end circular DNA, e.g., neDNA™ or doggy bone DNA comprising in the 5’ to 3’ direction: [L-ITR]- [(LSP:Liver Specific Promoter)]-[5’UTR]-[BM40 signal peptide]-[GAA polypeptide starting at amino acid 57 of SEQ ID NO: l]-[3’UTR]-[hGH polyA signal] -[R-ITR], See, e g., SEQ ID NO: 21.• SEQ ID NO: 22 comprises the ITR-to-ITR construct of SEQ ID NO: 20 and SEQ ID NO: 21.

[0225] In some embodiments, the nucleic acid construct described herein is in the context of a plasmid backbone. In some embodiments, the plasmid backbone is in the form of a template for generation of the rAAV vector described herein. In some embodiments, the plasmid (e.g. backbone and / or template) comprises a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto. In some embodiments, the rAAV vector is manufactured from such a template.

[0226] In some embodiments, the nucleic acid construct described herein is in the context of neDNA. neDNA is a covalently-closed circular or linear DNA, which is not a plasmid. In some embodiments, neDNA is made using the method described in granted US patents US 9,109,250; U.S. Patent No. 9,499,847; or U.S. Patent No. 10,501,782; or International publication Nos. WO 2018033730 Al or WO 2019 / 246544; all of which are herein incorporated by reference in their entireties. In some embodiments, the neDNA comprising the nucleic acid construct described herein can serve as a template for production of the rAAV vectors of the invention. In some embodiments, the neDNA template comprises a nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto. In some embodiments, the rAAV vector described herein is manufactured from such an neDNA template.

[0227] In some embodiments, the exemplary constructs have codon optimized GAA, including codon optimized GAA signal peptide, or portion thereof, e.g., the GAA and / or GAA signal peptide is encoded by seqlOO (SEQ ID NO:3), or seq3 (SEQ ID NO:4), or one of SEQ ID NOs: 5-18, or a fragment thereof. In some embodiments of the invention, the GAA and / or GAA signal peptides, or portion thereof in the exemplary constructs are not codon optimized, e.g., the GAA and / or GAA signal peptide is encoded by one of SEQ ID NOs:2, 313-316, or fragment thereof.

[0228] In some embodiments, the exemplary constructs described herein can be in a plasmid DNA backbone, or in a close ended linear duplexed DNA backbone (e.g., neDNA™) or a precursor plasmid of close ended linear duplexed DNA backbone.

[0229] In some embodiments, the exemplary constructs described herein comprise 5’UTRs as described in the instant application including but not limited to SEQ ID NO: 28 or SEQ ID NO: 34 or SEQ ID NO: 35.

[0230] In some embodiments, the nucleic acid encoding GAA the invention including but not limited to exemplary constructs, have 130 bp ITRs. In some embodiments of the invention, the nucleic acid encoding GAA of the invention including but not limited to exemplary constructs, have 145 bp ITRs (see e.g., SEQ ID NOs: 23 and 31). In some embodiments, rAAV of the invention to treat Pompe disease is manufactured using neDNA or, plasmid DNA as starting material.

[0231] Accordingly, in some embodiments, a AAV expressing GAA useful in the methods to treat Pompe Disease as disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5’ITR and the 3’ ITR, a liver specific promoter operatively linked to a heterologous nucleic acid encodinga secretory peptide (e.g., BM40 signal peptide) and nucleic acid encoding an alpha-glucosidase (GAA) polypeptide (e.g., the heterologous nucleic acid encodes an N-terminal GAA polypeptide comprising a signal peptide-GAA polypeptide).

[0232] In alternative embodiments, a AAV expressing GAA useful in the methods to treat Pompe Disease as disclosed herein comprises a 5’ ITR and 3’ ITR sequence, and located between the 5’ITR and the 3’ ITR, a promoter operatively linked to a heterologous nucleic acid encoding a secretory peptide (e.g., BM40 signal peptide) and nucleic acid encoding an alpha-glucosidase (GAA) polypeptide.

[0233] In one aspect described herein is a recombinant adenovirus associated (rAAV) vector comprising in its genome in the 5’ to 3’ direction: a) a 5’ ITR, b) a liver-specific promoter sequence, c) a 5’ UTR sequence, d) a nucleic acid encoding the heterologous BM40 signal peptide, e) a nucleic acid encoding the alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, wherein the GAA polypeptide is functionally active, f) a poly A sequence, and g) a reverse RNA pol II terminator sequence.

[0234] In another aspect described herein is a recombinant adenovirus associated (rAAV) vector comprising in its genome in the 5’ to 3’ direction: a) a 5’ ITR, b) a liver-specific promoter sequence, c) a 5’ UTR sequence, optionally further comprising an intron (e.g., SEQ ID NO: 250, 251, 252, 253, or 254), d) a nucleic acid encoding the heterologous BM40 signal peptide, e) a nucleic acid encoding the alpha- glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, wherein the GAA polypeptide is functionally active, f) a 3’ UTR sequence, g) a poly A sequence, optionally further comprising a reverse RNA pol II terminator sequence, and h) a 3’ ITR.

[0235] Such rAAV vectors encoding the heterologous BM40 signal peptide and amino acid residues 57- 952 of SEQ ID NO: 1 (truncated GAA) exhibit increased serum GAA activity (see e.g., Fig. 2, Fig. 7A), increased GAA activity in tissues in need thereof, (referred to herein as “GAA activity target tissues”) (see e.g., Fig. 3A-3B, Fig. 5A-5B, Fig. 7C), and / or decreased glycogen levels in said tissues (see e.g., Fig. 4A-4B, Fig. 6A-6B, Fig. 7B) in a subject with Pompe disease, e.g., as compared to rAAV vector not encoding the heterologous BM40 signal peptide and / or amino acid residues 57-952 of SEQ ID NO: 1 (truncated GAA). Increased GAA activity in a tissue may result from either transduction and gene expression in those tissues or uptake of secreted GAA from rAAV expression in other tissues.(ii) GAA signal peptide

[0236] In some embodiments, the AAV vector encodes a GAA polypeptide and BM40 signal peptide that does not comprise the endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1 (also referred to as “innate GAA” or “cognate GAA” signal peptide). In some embodiments, the AAV vector encodes a GAA polypeptide that comprises the endogenous GAA signal peptide (e.g., amino acids 1-27 of SEQ ID NO: 1 (also referred to as “innate GAA” or “cognate GAA” signal peptide), e.g., in addition to the BM40 signal peptide and / or at least one additional heterologous signal peptide. In some embodiments, the AAV vector encodes a GAA polypeptide that comprises the endogenous GAA signalpeptide (e.g., amino acids 1-27 of SEQ ID NO: 1, or a portions thereof) and an additional heterologous (i.e., non native) signal sequence (e.g., BM40). In some embodiments, the GAA polypeptide or N- terminal GAA polypeptide disclosed herein that lacks the endogenous signal peptide of amino acids 1-27 of GAA of SEQ ID NO: 1 is fused to a heterologous signal peptide (also referred to as “secretory signal peptide”).

[0237] In some embodiments, the heterologous nucleic acid encoding a GAA polypeptide fused to a BM40 signal peptide can further comprise, at the 5 ’ end, a nucleic acid sequence encoding a portion of the cognate (e.g., endogenous) GAA signal peptide, e.g., encoding at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1-25, or at least about 1-26, or the entire GAA signal peptide, e.g., or at least about 1-27 consecutive amino acids of the endogenous GAA signal peptide. Stated differently, in some embodiments, the heterologous nucleic acid sequence can comprise, in the 5’ to 3’ direction, a nucleic acid sequence encoding the entire GAA signal peptide of SEQ ID NO: 26 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 26, a nucleic acid sequence encoding a heterologous signal peptide (e.g., non-GAA signal peptide; e.g., BM40) and a nucleic acid sequence encoding a GAA polypeptide, such as the wild-type nucleic acid sequences, or a sequence encoding at least 1-3 amino acid variants, or a codon-optimized nucleic acid sequence encoding a GAA polypeptide, including N-terminal GAA truncations. For example, in some embodiments, the nucleic acid sequence encoding the GAA polypeptide encodes a N-terminal truncated GAA polypeptide, such as those disclosed in Table 1 and Table 1A herein.

[0238] In some embodiments, the order of the signal peptides are changed, for example, in some embodiments, the heterologous nucleic acid sequence can comprise, in the 5’ to 3’ direction, a nucleic acid sequence encoding a heterologous signal peptide as disclosed herein, the entire GAA signal peptide of SEQ ID NO: 26 or a portion of the endogenous GAA signal peptide of SEQ ID NO: 26 and a wildtype or codon-optimized nucleic acid sequence encoding a GAA polypeptide, including N-terminal GAA truncations.

[0239] In some embodiments, there can be a portion of the GAA polypeptide (e.g., any 1 amino acid, or 2 amino acids or more than 2 consecutive amino acids located in the region of amino acids 28-56 of SEQ ID NO: 1) located between the GAA signal peptide (or portion thereof), and the heterologous signal peptide (e.g., BM40) and upstream (e.g., N-terminal) of a N-terminal truncated GAA polypeptide. For example, and without wishing to be bound by theory, in some embodiments, the heterologous nucleic acid sequence can comprise, in the 5 ’ to 3 ’ direction, (i) the entire full length GAA signal peptide or a portion thereof as disclosed herein, (ii) a portion of at the GAA polypeptide, e.g., amino acids 28-35 of SEQ ID NO: 1, amino acid 28 of SEQ ID NO: 1, or amino acids 28-31 of SEQ ID NO: 1, (iii) a heterologous BM40 signal peptide, and (iv) a GAA polypeptide, e.g., a N-terminal truncated GAA polypeptide beginning at amino acid 57 of SEQ ID NO: 1. It is envisioned that the portion of at the GAA polypeptide located between the GAA polypeptide or signal peptide and the heterologous signal peptide (e.g., the BM40 signal peptide) can be any length, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10-12, 12-14,14-16, 16-18, 18-20, or more than 20 amino acids of residues 28-56 of SEQ ID NO: 1, and the N-terminal GAA polypeptide does not need to start at the next or sequential amino acid of the earlier GAA polypeptide portion. Certain of the amino acids in this 28-56 amino acid region can cause cellular retention. In one embodiment, those amino acids are removed or replaced.

[0240] In some embodiments, the nucleic acid sequence that encodes a GAA-signal peptide encodes at least 1-5, or at least 1-10, or at least 1-20, or at least about 1-23, or at least about 1-24, or at least about 1- 25, or at least about 1-26, or at least about 1-27 consecutive amino acids (i.e., the full GAA signal peptide sequence), or non-consecutive amino acids of the endogenous GAA signal peptide of SEQ ID NO: 269. In some embodiments, the nucleic acid sequence encoding a GAA-signal peptide encodes a GAA signal peptide that comprises at least one deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14, or at least 15, or at least 16, or at least 17, or at least 18, or at least 19, or at least 20 amino acids of SEQ ID NO: 269, where the one or more deletions can be consecutive, or non-consecutive deletions.

[0241] In some embodiments, the nucleic acid sequence that encodes a GAA-signal peptide can comprise the entire nucleic acid of SEQ ID NO: 261 or 263 (encoding GAA signal peptide comprising amino acids 1-27 of SEQ ID NO: 269). In alternative embodiments, the nucleic acid sequence that encodes a GAA-signal peptide can comprise a portion of the nucleic acid sequence of SEQ ID NO: 261 or 263, e.g., portions of SEQ ID NO: 261 or 263 that are selected from consecutive bases of SEQ ID NO: 261 or 263 having the length of any of: 1-3bp, 1-4bp, 1-5bp, 1-6bp, 1-7bp, 1-8bp, 1-9bp, 1-10bp, 1-1 Ibp, 1-12bp, 1-13bp, 1-14bp, 1-15bp, 1-16bp, 1-17bp, 1-18bp, 1-19bp, 1-20bp, 1-21bp, 1-22bp, 1-23bp, 1- 24bp, 1-25bp, 1-26bp, 1-27bp, 1-28bp, 1-29bp, 1-30bp, 1-33bp, 1-36bp, 1-39bp, 1-42bp, 1-45bp, 1-48bp, 1-5 Ibp, 1-54bp, 1-57bp, 1-60bp, 1-63bp, 1-66bp, 1-69bp, 1-72b, 1-75bp and 1-78bp in any region of the nucleic acid sequence of SEQ ID NO: 261 or 263. That is, using a 21bp portion of SEQ ID NO: 261 or 263 as an exemplary example, the GAA signal peptide can comprise a nucleic acid that is a 2 Ibp portion of SEQ ID NO: 261 or 263, where the 21bp can be any 21-concenceutive base pairs of SEQ ID NO: 261 or 263. For example, a 1-2 Ibp portion beginning at base pair 1 of SEQ ID NO: 261 or 263 would encode for a GAA-signal peptide comprising amino acids 1-7 of SEQ ID NO: 269, whereas a 1-21bp portion beginning at base pair 15 of SEQ ID NO: 261 or 263would encode for a GAA-signal peptide comprising amino acids 5-12 of SEQ ID NO: 269. In some embodiments, a portion of the GAA signal peptide of SEQ ID NO: 269is the N-terminal portion of SEQ ID NO: 269 (i.e., has a deletion of at least 1, or at least 2, or at least 3, or at least 4, or at least 5, or at least 6, or at least 7, or at least 8, or at least 9, or at least 10, or at least 11, or at least 12, or at least 13, or at least 14 or at least 15 amino acids, or more than 15 amino acids at the C-terminal of SEQ ID NO: 269).

[0242] In some embodiments, the nucleic acid encoding a heterologous BM40 signal peptide as disclosed herein can be inserted into the nucleic acid sequence encoding a GAA-signal peptide. The insertion can occur at any location in the 1 -8 Ibp of SEQ ID NO: 263. In some embodiments, a nucleicacid sequence encoding a heterologous signal peptide as disclosed herein is inserted in a portion of the nucleic acid encoding a GAA-signal peptide, e.g., generating a chimeric signal peptide comprising, for example, a 5’ nucleic acid sequence encoding a portion of a GAA signal peptide (e.g., a portion of SEQ ID NO: 261 or 263, as discussed above) and attached to the 3’ of said sequence, a nucleic acid encoding the heterologous BM40 signal peptide as disclosed herein. In some embodiments, there can also be a nucleic acid encoding a N-terminal portion of the GAA polypeptide with a deletion of amino acids thereafter, e.g., encoding amino acids 28, 28-29, 28-30, 28-31, 28-32, 28-33 etc., of SEQ ID NO: 1 followed by a deletion of about 4-40 amino acids of SEQ ID NO: 1. In some embodiments, a heterologous signal peptide can be inserted immediately following the N-terminal amino acids, e.g., after position 28, 29, 30, 31, 32 or 33.(Hi) Heterologous signal peptides

[0243] In some embodiments, the nucleic acid further comprises at least one heterologous signal sequence in addition to the BM40 signal sequence, selected from the group consisting of: SEQ ID NO: 60 (201 IgG signal peptide), or an IL2 wild type signal peptide (SEQ ID NO: 271), modified IL2 signal peptide (SEQ ID NO: 272), A2M signal peptide (SEQ ID NO: 273), or PZP signal peptide (SEQ ID NO: 274), or artificial signal peptide (SEQ ID NO: 275), or cathepsin L signal peptide (SEQ ID NO: 276) or signal peptides at least 90% sequence identity to SEQ ID NOS: 60-66.

[0244] In some embodiments, a heterologous signal peptide is selected from any of: a AAT signal peptide, a fibronectin signal peptide (FN1), 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, or an active fragment of AAT, FN1, 201, wtIL2, mutIL2, A2M or PZP signal peptide having secretory signal activity.

[0245] In some embodiments, the signal peptide is heterologous to (i.e., foreign or exogenous to) the polypeptide of interest (e.g., GAA). For example, a heterologous signal peptide is a fibronectin secretory signal peptide, the polypeptide of interest is not fibronectin. In some embodiments, the signal peptide is selected from any of: FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide having secretory signal activity. In alternative embodiments, the signal peptide is not heterologous to GAA, i.e., the signal peptide is the GAA signal peptide (i.e., residues 1-27 of SEQ ID NO: 1, which the endogenous GAA polypeptide).

[0246] In some embodiments, the endogenous GAA signal peptide (SEQ ID NO: 269) or a fragment or portion thereof remains present, and an additional BM40 signal peptide is added, and any one or more of signal peptides AAT, FN1, 201 signal peptide, wtIL2 signal peptide, mutIL2 signal peptide, A2M signal peptide, PZP signal peptide, as disclosed herein.

[0247] Other signal peptide are encompassed for use in the methods and compositions as disclosed herein, e.g., in addition and / or in combination with the BM40 signal peptides described herein. For example, numerous secreted proteins and sequences that direct secretion from the cell are known in theart, are disclosed in US Patent 9,873,868, which is incorporated herein in its entirety by reference. Exemplary secreted proteins (and their secretory signals) include but are not limited to: erythropoietin, coagulation Factor IX, cystatin, lactotransferrin, plasma protease Cl inhibitor, apolipoproteins (e.g., APO A, C, E), MCP-1, a-2-HS-glycoprotein, a-1-microgolubilin, complement (e.g., C1Q, C3), vitronectin, lymphotoxin-a, azurocidin, VIP, metalloproteinase inhibitor 2, glypican-1, pancreatic hormone, clusterin, hepatocyte growth factor, insulin, a- 1 -antichymotrypsin, growth hormone, type IV collagenase, guanylin, properdin, proenkephalin A, inhibin P (e.g., A chain), prealbumin, angiocenin, lutropin (e.g., P chain), insulin-like growth factor binding protein 1 and 2, proactivator polypeptide, fibrinogen (e.g., P chain), gastric triacylglycerol lipase, midkine, neutrophil defensins 1, 2, and 3, a- 1 -antitrypsin, matrix gla- protein, a-tryptase, bile -salt-activated lipase, chymotrypsinogen B, elastin, IG lambda chain V region, platelet factor 4 variant, chromogranin A, WNT-1 proto-oncogene protein, oncostatin M, [3-neoendorphin- dynorphin, von Willebrand factor, plasma serine protease inhibitor, serum amyloid A protein, nidogen, fibronectin, rennin, histatin 3, phospholipase A2, cartilage matrix Protein, GM-CSF, matrilysin, neuroendocrine protein 7B2, placental protein 11, gelsolin, M-CSF, transcobalamin I, lactase -phlorizin hydrolase, elastase 2B, pepsinogen A, MIP 1-P, prolactin, trypsinogen II, gastrin-releasing peptide II, atrial natriuretic factor, secreted alkaline phosphatase, pancreatic a-amylase, secretogranin I, p-casein, serotransferrin, tissue factor pathway inhibitor, follitropin P-chain, coagulation factor XII, growth hormone-releasing factor, prostate seminal plasma protein, interleukins (e.g., 2, 3, 4, 5, 9, 11), inhibin (e.g., alpha chain), angiotensinogen, thyroglobulin, IG heavy or light chains, plasminogen activator inhibitor- 1, lysozyme C, plasminogen activator, antileukoproteinase 1, statherin, fibulin-1, isoform B, uromodulin, thyroxine -binding globulin, axonin-1, endometrial a-2 globulin, interferon (e.g., alpha, beta, gamma), P-2 -microglobulin, procholecystokinin, progastricsin, prostatic acid phosphatase, bone sialoprotein II, colipase, Alzheimer's amyloid A4 protein, PDGF (e.g., A or B chain), coagulation factor V, triacylglycerol lipase, haptoglobuin-2, corticosteroid-binding globulin, triacylglycerol lipase, prorelaxin H2, follistatin 1 and 2, platelet glycoprotein IX, GCSF, VEGF, heparin cofactor II, antithrombin-III, leukemia inhibitory factor, interstitial collagenase, pleiotrophin, small inducible cytokine Al, melanin-concentrating hormone, angiotensin-converting enzyme, pancreatic trypsin inhibitor, coagulation factor VIII, a-fetoprotein, a-lactalbumin, senogelin II, kappa casein, glucagon, thyrotropin beta chain, transcobalamin II, thrombospondin 1, parathyroid hormone, vasopressin copeptin, tissue factor, motilin, MPIF-1, kininogen, neuroendocrine convertase 2, stem cell factor procollagen al chain, plasma kallikrein keratinocyte growth factor, as well as any other secreted hormone, growth factor, cytokine, enzyme, coagulation factor, milk protein, immunoglobulin chain, and the like.

[0248] In one embodiment, the secretory signal peptide is not a secretory signal peptide of a-1- antitrypsin (e.g., amino acids 1-24 of a-1-antitrypsin), chymotrypsinogen B2 (e.g., amino acids 1-20 of chymotrypsinogen B2), iduronate-2-sulphatase (e.g., amino acids 1-25 of iduronate-2- sulphatase), or protease Cl inhibitor (e.g., amino acids 1-23 of protease CI inhibitor).

[0249] In some embodiments, other secretory signal peptides encoded by the rAAV genome and in therAAV vector as disclosed herein can be selected from, but are not limited to, the signal peptide sequences from prepro-cathepsin L (e.g., GenBank Accession Nos. KHRTL, NP_037288; NP_034114, AAB81616, AAA39984, P07154, CAA68691; the disclosures of which are incorporated by reference in their entireties herein) and prepro-alpha 2 type collagen (e.g., GenBank Accession Nos. CAA98969, CAA26320, CGHU2S, NP_000080, BAA25383, P08123; the disclosures of which are incorporated by reference in their entireties herein) as well as allelic variations, modifications and functional fragments thereof (as discussed above with respect to the fibronectin signal peptide sequence). Exemplary signal peptide sequences include for preprocathepsin L (Rattus norvegicus. MTPLLLLAVLCLGTALA [SEQ ID NO: 287]; Accession No. CAA68691) and for prepro-alpha 2 type collagen (Homo sapiens, MLSFVDTRTLLLLAVTLCLATC [SEQ ID NO: 288]; Accession No. CAA98969). Also encompassed are longer amino acid sequences comprising the full-length signal peptide sequence from preprocathepsin L and prepro-alpha 2 type collagen or functional fragments thereof (as discussed above with respect to the fibronectin signal peptide sequence).

[0250] In some embodiments, the signal peptide is derived in part or in whole from a secreted polypeptide that is produced by liver cells. In some embodiments, a signal peptide can further be in whole or in part synthetic or artificial. Synthetic or artificial secretory signal peptides are known in the art, see e.g., Barash et al., “Human signal peptide description by hidden Markov model and generation of a strong artificial signal peptide for secreted protein expression,” Biochem. Biophys. Res. Comm. 294:835-42 (2002); the disclosure of which is incorporated herein in its entirety. In particular embodiments, the signal peptide comprises, consists essentially of, or consists of the artificial secretory signal: MWWRLWWLLLLLLLLWPMVWA (SEQ ID NO: 275) or variations thereof having 1, 2, 3, 4, or 5 amino acid substitutions (optionally, conservative amino acid substitutions, conservative amino acid substitutions are known in the art).

[0251] Exemplary signal peptides for use in the methods and compositions as disclosed herein can be selected from any signal peptide disclosed in Table 3, or portions thereof or functional variants thereof. Exemplary signal peptides are Fibronectin (FN1), or AAT. In some embodiments of the methods and compositions disclosed herein, the rAAV vector composition comprises the nucleic acid encoding a secretory signal peptide, e.g., encoding a signal peptide selected from an AAT signal peptide (e.g., SEQ ID NO: 277), a fibronectin signal peptide (FN1) (e.g., SEQ ID NO: 278-281), an hIGF2 signal peptide (e.g., SEQ ID NO: 282) or an active fragment thereof having secretory signal activity, e.g., a nucleic acid encoding an amino acid sequence that has at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NOs: 277-282.

[0252] In some embodiments of the methods and compositions as disclosed herein, the nucleic acid encoding the signal peptide is selected from any of SEQ ID NO: 54-58, 67, 72-76 and 72, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to any of SEQ ID NOs: 264-268, 277, and 282-286.

[0253] Fibronectin secretory signal peptide:

[0254] In some embodiments, the signal peptide is a fibronectin secretory signal peptide or portions thereof or functional variants thereof, which term includes modifications of naturally occurring sequences (as described in more detail below).

[0255] In some embodiments, the signal peptide is a fibronectin signal peptide, e.g., a signal sequence of human fibronectin or a signal sequence from rat fibronectin. Fibronectin (FN1) signal sequences and modified FN 1 signal peptides encompassed for use in the rAAV genome and rAAV vectors described herein are disclosed in US patent 7,071,172, which is incorporated herein in its entirety by reference, and in Table 3 of provisional application 62 / 937,556, filed on November 19, 2019 or International Application WO2021102107, which is incorporated herein in its reference. Examples of exemplary fibronectin signal peptide sequences include, but are not limited to those listed in Table 1 of US patent 7,071,172, which is incorporated herein in its entirety by reference.

[0256] Table 3: Exemplary Fibronectin (FN1) secretory signal peptidesC. Peptidase cleavage sites

[0257] In some embodiments, one or more exogenous peptidase cleavage site may be inserted into the signal peptide -GAA polypeptide, e.g., between the signal peptide and the GAA polypeptide. In particular embodiments, an autoprotease (e.g., the foot and mouth disease virus 2A autoprotease) is inserted between the signal peptide and the GAA polypeptide. In other embodiments, a protease recognition site that can be controlled by addition of exogenous protease is employed (e.g., Lys — Arg recognition site for trypsin, the Lys — Arg recognition site of the Aspergillus KEX2-like protease, the recognition site for a metalloprotease, the recognition site for a serine protease, and the like). Modification of the GAA polypeptide to delete or inactivate native protease sites is encompassed herein and disclosed in U.S.Provisional Application 62,937,556, filed on November 19, 2019 and International Application WO2021102107, which is incorporated herein in its reference.D. Spacer and fusion junction of the GAA polypeptide

[0258] Where GAA is expressed with a heterologous signal peptide (e.g., BM40), the signal peptide can be fused directly to the GAA polypeptide or can be separated from the GAA polypeptide by a linker. An amino acid linker (also referred to herein as a “spacer”) incorporates one or more amino acids other than that appearing at that position in the natural protein. Spacers can be generally designed to be flexible or to interpose a structure, such as an a-helix, between the two protein moieties.

[0259] Accordingly, in some embodiments of the methods and compositions disclosed herein, a recombinant AAV vector comprises a heterologous nucleic acid sequence encoding a GAA polypeptide, wherein the GAA protein further comprises a spacer comprising a nucleotide sequence of at least 1 amino acid in length, which is located N-terminal to the GAA polypeptide.

[0260] In one embodiment, the spacer at least 50% identical to the sequence GGGTVGDDDDK (SEQ ID NO: 112).

[0261] In some embodiments, a spacer or linker can be relatively short, e.g., at least 1, 2, 3, 4 or 5 amino acids, or such as the sequence Gly-Ala-Pro or Gly-Gly-Gly-Gly-Gly-Pro (SEQ ID NO: 290), or can be longer, such as, for example, 5-10 amino acids in length or 10-25 amino acids in length. For example, flexible repeating linkers of 3-4 copies of the sequence (e.g., GGGGS (SEQ ID NO: 291)) and a-helical repeating linkers of 2-5 copies of the sequence (e.g., EAAAK (SEQ ID NO: 292)) have been described (Arai et al. (2004) Proteins: Structure, Function and Bioinformatics 57:829-838). In some embodiments, a linker comprising GGGTVGDDDDK (SEQ ID NO: 112) is also encompassed for use. Linkers incorporating an a-helical portion of a human serum protein can be used to minimize immunogenicity of the linker region. In some embodiments, the spacer is encoded by nucleic acids GGCGCGCCG which encodes the amino acid spacer comprising amino acids GAP or Gly-Ala-Pro.

[0262] The site of a fusion junction in the GAA polypeptide to fuse with either the signal peptide should be selected with care to promote proper folding and activity of each polypeptide in the fusion protein and to prevent premature separation of a signal peptide from a GAA polypeptide.

[0263] In some embodiments, a spacer has a helical structure. In another specific embodiment, a spacer is at least 50% identical to the sequence GGGTVGDDDDK (SEQ ID NO: 112).

[0264] In some embodiments, a signal peptide can be fused, directly or by a spacer, to amino acids of the GAA polypeptide as disclosed in Table 1 and Table 1A herein, permitting expression of the GAA polypeptide or N-terminal truncated GAA polypeptide, and proper secretion of the GAA polypeptide as described herein in the Examples.

[0265] In order to facilitate folding of the signal peptide, GAA amino acid residues adjacent to the fusion junction can be modified. For example, since it is possible that GAA cysteine residues mayinterfere with proper folding of the signal peptide, the terminal GAA cysteine 952 can be deleted or substituted with serine to accommodate a C-terminal signal peptide. The signal peptide can also be fused immediately preceding the final Cys952. The penultimate cys938 can be changed to proline in conjunction with a mutation of the final Cys952 to serine.E. Liver Specific Promoters (LSP)

[0266] In some embodiments, to achieve appropriate levels of GAA expression, the rAAV genotype comprises a liver specific promoter (LSP). A LSP enables expression of the operatively linked gene in the liver, and can in some embodiments, be and inducible LSP. In an embodiment, a LSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the GAA protein.

[0267] Exemplary liver-specific promoters useful in the AAV to treat Pompe according to the method disclosed herein are disclosed in International W02020102645 and WO2021102107, which are incorporated herein in their entirety by reference.

[0268] In some embodiments, encompassed herein are any liver-specific promoters disclosed W02020102645 and WO2021102107, where the LSP has been improved. For example, a liver specific promoter useful in the rAAV vectors as disclosed herein is any LSP disclosed International W02020102645 and WO2021102107 which has been modified to replace the sequence of SEQ ID NO: 60 (corresponding to as SEQ ID NO: 126 in WO2021102107 or referred to as CRE0052 or LVR_CRE_0052_G6PC sequence) in any of the LSP sequences in WO2021102107 with a sequence selected from SEQ ID NO: 34 or 35, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. Using SP131A1 (or LVR131_A1) promoter as an exemplary promoter, which is disclosed as SEQ ID NO: 94 in WO2021102107, in the current application the promoter has been modified to replace SEQ ID NO 60 (corresponding to SEQ ID NO: 126 inWO2021102107) with SEQ ID NO: 34 or 35, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. Any promoter disclosed in WO2021102107 is encompassed for use herein, wherein if the promoter comprises SEQ ID NO 60 (corresponding to SEQ ID NO: 126 in WO2021102107), it can be replaced with SEQ ID NO: 34 or 35, or a sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0269] In some embodiments, the promoter is a LSP promoter (SEQ ID NO: 24), or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0270] In some embodiments, a synthetic liver specific promoter is selected from any of: SEQ ID NOS: 24, 60-78, 84-249, or 256-258 as disclosed herein, or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical thereto or to the source regulatory nucleic acid sequence.

[0271] In some embodiments, the liver specific promoter is selected from any one of: SEQ ID NOS: 257 or 258, or a liver specific promoter having at least 80% sequence identity to SEQ ID NOs: 257 or 258.

[0272] In some embodiments, the liver specific promoter is SEQ ID NO: 256, or a liver specificpromoter having at least 80% sequence identity to SEQ ID NO: 256.

[0273] In some embodiments, the promoter is a LP1 promoter (SEQ ID NO: 242), or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0274] In some embodiments of the methods to treat Pompe disease disclosed herein, a synthetic liver- specific promoter useful in the AAV vector is any LSP promoter selected from SEQ ID NOS: 61, 63, 66- 71, 74-78, 247-249 as disclosed herein, or any LSP selected from SEQ ID NO: 84-151 or 152-240 as disclosed herein, or a synthetic liver-specific promoter thereof which is able to promote liver-specific transgene expression and has an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TTR promoter comprising SEQ ID NO: 241 as International Application WO2021102107, or a synthetic promoter which is disclosed in Table 4 of International Application WO2021102107, which is incorporated herein in its entirety by reference.

[0275] In some embodiments, a synthetic liver specific promoter is selected from any of: SEQ ID NOS: 61, 63, 66-71, 74-78, or 84-240 as disclosed herein, or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical thereto or to the source regulatory nucleic acid sequence.

[0276] In some embodiments, a liver-specific promoter (LSP) in a AAV expressing a GAA polypeptide as disclosed herein and useful in the methods to treat Pompe disease as disclosed herein comprises a nucleic acid sequence selected from any promoter listed from SEQ ID NOS: 61 (CRM 0412), SEQ ID NO: 66 (SP0412) or SEQ ID NO: 67 (SP0422), SEQ ID NOS: 68 (SP0239), SEQ ID NO: 69 (SP0265), SEQ ID NO: 70 (SP0240) or SEQ ID NO: 71 (SP0246), or SEQ ID NO: 74 (SP0265-UTR), SEQ ID NO: 75 (SP0239-UTR), SEQ ID NO: 76 (SP0240-UTR), SEQ ID NO: 77 (SP0246-UTR) or SEQ ID NO: 78 (SP0131-A1-UTR), SEQ ID NO: 247 (LVR 0243); SEQ ID NO: 248 (LVR 0412) and SEQ ID NO: 249 (Al Promoter), as disclosed herein, or a functional fragment or variant of any LSP selected from SEQ ID NO: 84-151 or 152-240, or a functional fragment or variant thereof of SEQ ID NOS: 61, 63, 66-71, or 74- 78, 247-249 or 84-240.

[0277] In some embodiments of the methods to treat Pompe disease disclosed herein, a synthetic liver- specific promoter is selected from any or any LSP promoter selected from SEQ ID NOS: 61 (CRM 0412), SEQ ID NO: 66 (SP0412) or SEQ ID NO: 67 (SP0422), SEQ ID NOS: 68 (SP0239), SEQ ID NO: 69 (SP0265), SEQ ID NO: 70 (SP0240) or SEQ ID NO: 71 (SP0246), or SEQ ID NO: 74 (SP0265-UTR), SEQ ID NO: 75 (SP0239-UTR), SEQ ID NO: 76 (SP0240-UTR), SEQ ID NO: 77 (SP0246-UTR) or SEQ ID NO: 78 (SP0131-A1-UTR), SEQ ID NO: 247 (LVR 0243); SEQ ID NO: 248 (LVR 0412) and SEQ ID NO: 249 (Al Promoter), or any LSP selected from SEQ ID NO: 84-151 or 152-240 as disclosed herein, where the synthetic liver-specific promoter is able to promote liver-specific transgene expression and has an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter of SEQ ID NO: 245.

[0278] In some embodiments of the methods to treat Pompe disease disclosed herein, a synthetic liver-specific promoter is selected from any or any LSP promoter selected from any of SEQ ID NO: 256, SEQ ID NO: 257 or SEQ ID NO: 258, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. In some embodiments of the methods to treat Pompe disease disclosed herein, a synthetic liver- specific promoter is selected from any or any LSP promoter selected from SEQ ID NO: 256, SEQ ID NO: 257 or SEQ ID NO: 258, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto, where the synthetic liver-specific promoter is able to promote liver-specific transgene expression and has an activity in liver cells which is at least 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 350% or 400% of the activity of the TBG promoter of SEQ ID NO: 245.

[0279] In some embodiments, to achieve appropriate levels of GAA expression, the rAAV genotype comprises a liver specific promoter (LSP). A LSP enables expression of the operatively linked gene in the liver, and can in some embodiments, be and inducible LSP. In an embodiment, a LSP is located upstream 5’ and is operatively linked to the heterologous nucleic acid sequence encoding the GAA protein. Exemplary liver-specific promoters are disclosed herein, and include for example, the M3 liver specific promoter comprising a sequence of SEQ ID NO: 258, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity of SEQ ID NO: 258.

[0280] In one embodiment, the liver promoter is a promoter that has some expression in the liver. In one embodiment, the promoter that has some expression in the liver is the M2 liver promoter comprising a sequence of SEQ ID NO: 257, or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identity of SEQ ID NO: 257.

[0281] In some embodiments, the synthetic liver specific promoter comprises SEQ ID NO: 258, or nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90% or 95% identical to the source regulatory nucleic acid sequence. In some embodiments, a synthetic liver specific promoter comprises SEQ ID NO: 258, or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to nucleotides 1-26 of SEQ ID NO: 258.

[0282] In some embodiments, a synthetic liver specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 258 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 258 are altered. In some embodiments, a synthetic liver-specific promoter useful in the methods and compositions as disclosed herein is the same length, or not substantially altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 258.

[0283] In some embodiments, no nucleotides have been deleted when compared to SEQ ID NO: 258. In some embodiments, no nucleotides are inserted when compared to SEQ ID NO: 258. In someembodiments, all modifications made to SEQ ID NO: 258 are nucleotide substitutions.

[0284] In some embodiments, a synthetic liver specific promoter that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 258 comprises a source regulatory nucleic acid sequence which is active in liver, and the second type of cell or tissue is muscle; or a source regulatory nucleic acid sequence which is active in liver, and the second type of cell or tissue is CNS; or a source regulatory nucleic acid sequence which is active in muscle, and the second type of cell or tissue is liver; or a source regulatory nucleic acid sequence which is active in muscle, and the second type of cell or tissue is CNS.

[0285] In some embodiments, a liver-specific promoter which is a functional variant of a given promoter element preferably retains at least 80% of its activity, more preferably at least 90% of its activity, more preferably at least 95% of its activity, and yet more preferably 100% of its activity (compared to the reference promoter comprising the unmodified promoter element). Suitable assays for assessing liver- specific promoter activity are disclosed in Examples 12 and 13 of International Application WO2021102107 which is incorporated herein in its entirety by reference.

[0286] In some embodiments, liver specific promoters include, but are not limited to, transthyretin promoter (TTR), LSP promoter (LSP), a synthetic liver specific promoter. For example, in some embodiments of the methods and compositions as disclosed herein, the promoter is a liver specific promoter (LSP), and can be selected from any liver specific promoters including, but not limited to, a transthyretin promoter (TTR), a Liver specific promoter (LSP), for example, as disclosed in 5,863,541 (TTR promoter), or LSP promoter (PNAS; 96: 3906-3910, 1999. See e.g. p. 3906, Materials and Methods, rAAV construction), a synthetic liver promoter, the references which are incorporated herein in their entireties by reference. Other liver promoters can be used, for example, synthetic liver promoters.

[0287] In some embodiments, the TTR promoter is a truncated TTR promoter, e.g., comprising SEQ ID NO: 241, or SEQ ID NO: 12 as disclosed in International WO 2020102645, which is incorporated herein in its entirety by reference, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. In some embodiments, the LSP is a TBG promoter, e.g., comprising SEQ ID NO: 245, or a variant having at least sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0288] Other liver specific promoters include, but are not limited to promoters for the LDL receptor, Factor VIII, Factor IX, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC), and a 1 - antitrypsin (hAAT), and HCB promoter. In Other liver specific promoters include the AFP (alpha fetal protein) gene promoter and the albumin gene promoter, as disclosed in EP Patent Publication 0 415 731, the a-1 antitrypsin gene promoter, as disclosed in Rettenger, Proc. Natl. Acad. Sci. 91 (1994) 1460-1464, the fibrinogen gene promoter, the APO-A1 (Apolipoprotein Al) gene promoter, and the promoter genes for liver transference enzymes such as, for example, SGOT, SGPT and g-glutamyle transferase. See also 2001 / 0051611 and PCT Patent Publications WO 90 / 07936 and WO 91 / 02805, which are incorporated herein in their entirety by reference. In some embodiments, the liver specific promoter is a recombinant liver specific promoter, e.g., as disclosed in US20170326256A1, which is incorporated herein in itsentirety by reference.

[0289] In some embodiments, a liver specific promoter is the hepatitis B X-gene promoter and the hepatitis B core protein promoter. In some embodiments, liver specific promoters can be used with their respective enhancers. The enhancer element can be linked at either the 5' or the 3' end of the nucleic acid encoding the GAA polypeptide. The hepatitis B X gene promoter and its enhancer can be obtained from the viral genome as a 332 base pair EcoRV-NcoI DNA fragment employing the methods described in Twu, J Virol. 61 (1987) 3448-3453. The hepatitis B core protein promoter can be obtained from the viral genome as a 584 base pair BamHI-Bglll DNA fragment employing the methods described in Gerlach, Virol 189 (1992) 59-66. It may be necessary to remove the negative regulatory sequence in the BamHI- Bglll fragment prior to inserting it.

[0290] It is encompassed that the LSP is selected in conjunction with the BM40 signal sequence, so that the strength of the liver specific promoter (LSP) that is operatively linked to the nucleic acid encoding the GAA polypeptide can be counter-balanced with the ability of the cell to secrete the expressed GAA protein. Thus, if the liver specific promoter is strong, the specific signal sequence must be sufficiently effective to allow for the expressed GAA can be secreted from the cell so that GAA does not accumulate and create cell toxicity and / or induce an immune response. Thus, the cell secretory pathway, and the selected signal sequence must be able to match the level of GAA expressed by the AAV, where the level of GAA expression is dependent on both the AAV transduction efficiency (determined by AAV dose and capsid) and the strength of the liver specific promoter.F. UTRs, Regulatory sequences and Intron sequences

[0291] In some embodiments, the liver-specific promoters as set out above are operably linked to one or more additional regulatory sequences. An additional regulatory sequence can, for example, enhance expression compared to the liver-specific promoter which is not operably linked the additional regulatory sequence. Generally, it is preferred that the additional regulatory sequence does not substantively reduce the specificity of the liver-specific promoter.

[0292] For example, the liver-specific promoter can be operably linked to a sequence encoding an un- translated region (UTR) (e.g., a 5’ and / or 3’ UTR), an intron, or an UTR (e.g., 5’ or 3’) and an intron, or such. In some embodiments, the liver-specific promoter is operably linked to sequence encoding a UTR, e.g., a 5’ UTR. A 5' UTR can contain various elements that can regulate gene expression. The 5’ UTR in a natural gene begins at the transcription start site and ends one nucleotide before the start codon of the coding region. It should be noted that 5' UTRs as referred to herein may be an entire naturally occurring 5’ UTR or it may be a portion of a naturally occurring 5’ UTR. The 5 ’UTR can also be partially or entirely synthetic. In eukaryotes, 5' UTRs have a median length of approximately 150 nt, but in some cases they can be considerably longer. Regulatory sequences that can be found in 5' UTRs are disclosed in International Application WO2021102107 which is incorporated herein in its entirety by reference.

[0293] In some embodiments, a 5-UTR sequence is located 3’ of a liver specific promoter as disclosed herein, and 5’ of the heterologous nucleic acid sequence (e.g., encoding a signal peptide and GAA polypeptide).

[0294] In one embodiment, an exemplary 5-UTR sequence comprises SEQ ID NO: 25 or a functional variant having at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 25.

[0295] In one embodiment, an exemplary 5-UTR sequence comprises, for example, a 24bp sequence of SEQ ID NO: 35, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 35.

[0296] In one embodiment, an exemplary 5-UTR sequence comprising SEQ ID NO: 35 is the sequence of SEQ ID NO: 34, or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 34.

[0297] In some embodiments, the 5-UTR sequence comprises SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34, or nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90% or 95% identical to the source regulatory nucleic acid sequence. In some embodiments, a 5-UTR sequence comprises SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34 or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to nucleotides of SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34.

[0298] In some embodiments, a 5-UTR that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 25 or SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34 are altered. In some embodiments, a 5-UTR sequence useful in the methods and compositions as disclosed herein is the same length, or not substantially altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 25 or SEQ ID NO: 35 or SEQ ID NO: 34.

[0299] Introns within 5' UTRs have been linked to regulation of gene expression and mRNA export. In some embodiments, a liver-specific promoter as set out above is operably linked to a sequence encoding a 5’ UTR derived from the CMV major immediate gene (CMV-IE gene). For example, the 5’ UTR from the CMV-IE gene suitably comprises the CMV-IE gene exon 1 and the CMV-IE gene exon 1, or portions thereof. In some cases, the promoter element may be modified in view of the linkage to the 5 ‘UTR, for example sequences downstream of the transcription start site (TSS) in the promoter element can be removed (e.g. replaced with the 5’ UTR).

[0300] The CMV-IE 5’UTR is described in Simari, et al, Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR sequences discussed in Simari, et al. are also set out in W02002 / 031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used. Other UTRs that can be used in combination with a promoter are known in the art, e.g. in Leppek, K., Das, R. & Barna, M. “Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them”. Nat Rev Mol Cell Biol 19, 158-174 (2018), incorporated by reference.

[0301] In some embodiments the sequence encoding the 5’ UTR comprises SEQ ID NO: 73 as disclosed herein, or a functional variant thereof. In some embodiments, functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 73 as disclosed herein encodes a CMV-IE 5’ UTR.

[0302] In some embodiments the sequence encoding the 5’ UTR comprises SEQ ID NO: 254 as disclosed herein, or a functional variant thereof. In some embodiments, functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. SEQ ID NO: 254 as disclosed herein, which is a modified CMV-IE intron sequence.

[0303] In some embodiments the 5’ UTR comprises a nucleic acid motif that functions as the protein translation initiation site, e.g. sequences that define a Kozak sequence in the mRNA produced. For example, in some embodiments, the sequence encoding the 5 ’ UTR comprises the sequence motif GCCACC at or near its 3’ end. Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g. Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUG Initiator Codon Enhance Translation in Mammalian Cells” J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak “An analysis of 5'- noncoding sequences from 699 vertebrate messenger RNAs” Nucleic Acids Research. Vol. 15 (20) 1987, all of which are incorporated herein by reference). The protein translation initiation site (e.g. Kozak sequence) is preferably positioned immediately adjacent to the start codon.

[0304] In some embodiments, a sequence encoding a 5’ UTR comprises SEQ ID NO: 246 as disclosed herein, or a functional variant thereof. In some embodiments, functional variants may have a sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto. This 5’ UTR comprises six nucleotides of GCCACC, which define a Kozak sequence at the 3’ end of the CMV-IE 5’ UTR.

[0305] In some embodiments, the rAAV expressing GAA for use in the methods to treat Pompe as disclosed herein comprises an intron sequence located 3’ of the promoter sequence and 5’ of the heterologous nucleic acid (i.e., 5’ of the nucleic acid encoding the signal peptide and GAA polypeptide). Intron sequences serve to increase one or more of: mRNA stability, mRNA transport out of nucleus and / or expression and / or regulation of the expressed GAA polypeptide. In alternative embodiments, arAAV genotype does not comprise an intron sequence.

[0306] In one embodiment, a UTR sequence described herein can be used as a 3’UTR.

[0307] In some embodiments, exemplary 3-UTR sequences comprise SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44 or a functional variant have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44.

[0308] In some embodiments, the 3-UTR sequence comprises SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44, or nucleic acid sequence that is at least 50%, preferably 60%, 70%, 80%, 90% or 95% identical to the source regulatory nucleic acid sequence. In some embodiments, a 3- UTR sequence comprises SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44 or nucleic acid sequence that is at least 80%, or at least 90% or 95% identical to nucleotides of SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44.

[0309] In some embodiments, a 3-UTR that is at least 50%, 60%, 70%, 80%, 90% or 95% identical to SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44 comprises a nucleic acid sequence where 2% or 1% or fewer of the nucleotides of SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44 are altered. In some embodiments, a 3-UTR sequence useful in the methods and compositions as disclosed herein is the same length, or not substantially altered, or 1, 2, 3, 4, 5, or 6 nucleotides longer or 1, 2, 3, 4, 5, or 6 shorter than the length of SEQ ID NO: 29 or SEQ ID NO: 42 or SEQ ID NO: 43 or SEQ ID NO: 44.

[0310] A synthetic liver-specific promoter according to the present invention can be operably linked to a sequence encoding a UTR (e.g. a 5’ and / or 3’ UTR), and / or an intron, or suchlike. In some embodiments, a synthetic liver specific promoter as set herein, is operably linked to a sequence encoding a 5 ’ UTR and an intron. In some embodiments, the 5’ UTR and intron is derived from the CMV major immediate gene (CMV-IE gene). The CMV-IE 5’UTR and intron is described in Simari, et al., Molecular Medicine 4: 700-706, 1998 “Requirements for Enhanced Transgene Expression by Untranslated Sequences from the Human Cytomegalovirus Immediate-Early Gene”, which is incorporated herein by reference. Variants of the CMV-IE 5’ UTR and intron sequences discussed in Simari, et al. are also set out in W02002 / 031137, incorporated by reference, and the regulatory sequences disclosed therein can also be used. In some embodiments the 5’ UTR or the 5’ UTR and intron suitably comprises a nucleic acid motif that functions as the protein translation initiation site, e.g. sequences that define a Kozak sequence in the mRNA produced. For example, in some embodiments, the sequence encoding the 5’ UTR comprises the sequence motif GCCACC at or near its 3’ end. Other Kozak sequences or other protein translation initiation sites can be used, as is known in the art (e.g. Marilyn Kozak, “Point Mutations Define a Sequence Flanking the AUG Initiator Codon That Modulates Translation by Eukaryotic Ribosomes” Cell, Vol. 44, 283-292, January 31, 1986; Marilyn Kozak “At Least Six Nucleotides Preceding the AUGInitiator Codon Enhance Translation in Mammalian Cells” J. Mol. Rid. (1987) 196, 947-950; Marilyn Kozak “An analysis of 5”-noncoding sequences from 699 vertebrate messenger RNAs” Nucleic Acids Research. Vol. 15 (20) 1987, all of which are incorporated herein by reference). The protein translation initiation site (e.g. Kozak sequence) is preferably positioned immediately adjacent to the start codon.

[0311] In some embodiments, any one of the promoters described herein, or variants thereof, is linked to a sequence encoding a 5’ UTR and / or a 5’UTR and an intron to provide a composite promoter. Herein, such composite promoter may be referred to simply as “composite promoters”, or in some cases simply “promoters” for brevity.

[0312] In some embodiments, the intron sequence is a MVM intron sequence, for example, but not limited to intron sequence of SEQ ID NO: 250, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0313] In some embodiments, the intron sequence is a HBB2 intron sequence, for example, but not limited to an intron sequence of SEQ ID NO: 251 or SEQ ID NO: 252 or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto.

[0314] In some embodiments of the methods and compositions disclosed herein, a recombinant AAV vector comprises a heterologous nucleic acid sequence that further comprises an intron sequence located 5’ of the sequence encoding the secretory signal peptide, and 3’ of the promoter. In some embodiments, the intron sequence comprises a MVM sequence or a HBB2 sequence, wherein the MVM sequence comprises the nucleic acid sequence of SEQ ID NO: 250, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 250, and the HBB2 sequence comprises the nucleic acid sequence of SEQ ID NO: 251 or SEQ ID NO: 252, or a nucleic acid sequence at least about 75%, or 80%, or 85%, or 90%, or 95%, or 98%, or 99% sequence identity to SEQ ID NO: 251 or SEQ ID NO: 252.

[0315] In some embodiments, the intron sequence is a ubiquitin C (UBC) intron sequence, e.g., intron 1 from the UBC gene, or a portion thereof, e.g., as disclosed in Bianchi et al, 2009, Gene, 448 (1); 88-101, where the intron 1 sequence of the UBC gene is 812bp and starts at chromosomal location 124,914,586, and ends at 124,913,775. In some embodiments, the intron sequence is a UBC intron, for example, but not limited to intron sequence of SEQ ID NO: 253, or nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 253.

[0316] In some embodiments, the rAAV genotype comprises an intron sequence selected in the group consisting of a human beta globin b2 (or HBB2) intron, a FIX intron, a chicken beta-globin intron, a CMVIE intron, a UBC intron, a HBB intron sequence, a MVM sequence and a SV40 intron. In some embodiment, the intron is intron 1 from human RNA pol II. In some embodiments, the intron is optionally a modified intron such as a modified HBB2 intron (see, e.g., SEQ ID NO: 17 in of WO2018046774A1): a modified FIX intron (see., e.g., SEQ ID NO: 19 in WO2018046774A1), or a modified chicken beta-globin intron (e.g., see SEQ ID NO: 21 in WO2018046774A1), or modified HBB2 or FIX introns disclosed in WO2015 / 162302, which are incorporated herein in their entirety by reference.G. Poly-A sequences and Terminator sequences

[0317] In some embodiments, an rAAV vector genome includes at least one poly-A tail signal sequence that is located 3 ’ and downstream from the heterologous nucleic acid gene encoding the GAA polypeptide. The terms “polyA sequence”, “polyA signal”, “polyA signal sequence”, “poly A” or “polyA tail” are used interchangeably herein. The terms “polyA”, “poly-A”, “poly A”, “poly-adenylation”, or “poly-adenylated” are used interchangeably herein. Any polyA sequence can be used, including but not limited to hGH polyA, BGH polyA, SV40 polyA, synpA polyA, and the like. In some embodiments, the polyA is a synthetic polyA sequence. In some embodiments, the polyA signal sequence is a full length hGH polyA signal sequence. In one embodiment, the polyA signal sequence can be a functional fragment of the hGH polyA signal sequence.

[0318] In some embodiments, the rAAV vector genome comprises two poly-A tails, e.g., a hGH polyA sequence and another polyA sequence, where a spacer nucleic acid sequence is located between the two polyA sequences.

[0319] In some embodiments, the polyA signal is 3 ’ of the heterologous nucleic acid sequence encoding the GAA polypeptide. In some embodiments, the rAAV genome comprises 3’ of the nucleic acid encoding the GAA polypeptide, a first polyA sequence and a reverse RNA polymerase II terminator sequence (rev RNA PolII terminator sequence), and the 3’ ITR. Non limiting examples of first polyA is hGH polyA, BGH polyA, SV40 polyA or, any functional fragment thereof in 5’ to 3’ orientation. Non limiting examples of reverse RNA polymerase II terminator sequence is hGH poly A, BGH poly A, SV40 poly A or, any functional fragment thereof in 3’ to 5’ orientation.

[0320] In some embodiments, the rAAV genome comprises 3 ’ of the nucleic acid encoding the GAA polypeptide, a first polyA sequence, a spacer nucleic acid sequence (e.g., of between 100-400bp, or about 100-250bp, or about 250-400bp, or about 20-100bp, or about 20-400 bp), a second polyA sequence, a spacer nucleic acid sequence, and the 3’ ITR.

[0321] In some embodiments, the first and / or second polyA sequence is a hGH polyA sequence, and in some embodiments, the first and second polyA sequences are a synthetic polyA sequence. In some embodiments, the first polyA sequence is a hGH polyA sequence, and the second polyA sequence is a synthetic sequence, or vice versa - that is, in alternative embodiments, the first polyA sequence is a synthetic polyA sequence and the second polyA sequence is a hGH polyA sequence.

[0322] In some embodiments, the polyA sequence is selected from any of: SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 37 or SEQ ID NO: 38, where SEQ ID NOS: 30 or 36-38 comprises the signal AATAAA, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to any of SEQ ID NOS: 30 or 36-38.

[0323] In some embodiments, the polyA sequence is selected from any of: SEQ ID NO: 40 or SEQ ID NO: 41, or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%nucleotide sequence identity to any of SEQ ID NOS: 40 or 41.

[0324] In some embodiments, the polyA sequence is, for example, SEQ ID NO: 15 as disclosed in International WO2021102107 (hGH polyA sequence), or a polyA nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 15 as disclosed in International Application WO2021102107. In some embodiments, the hGH polyA sequence encompassed for use is described in Anderson et al. J. Biol. Chem 264(14); 8222-8229, 1989 (See, e.g., p. 8223, 2nd column, first paragraph) which is incorporated herein in its entirety by reference.

[0325] In one embodiment, the recombinant AAV disclosed herein comprises in its genome a transcriptional terminator signal sequence or a transcriptional pause signal sequence in the reverse orientation between polyA and 3’ITR. In one embodiment, the recombinant AAV disclosed herein comprises in its genome a transcriptional terminator signal sequence or a transcriptional pause signal sequence that is in the 3 ’-5’ orientation between the polyA and 3’ITR. Any transcription termination signal can be used including, e.g., inverted natural polyA sequences from any species or synthetic polyA signals or fragments thereof, or other nucleic acid structure terminators known in the art. Exemplary polyA signals and / or transcription terminators include, but are not limited to the polyA signals of BGH, SV40, HGH, Betaglobin, RNA polymerase II transcriptional pause signal from alpha 2 globin gene, transcription termination signal for pol III, or fragments thereof, and in any combination thereof.

[0326] In some embodiments, a transcriptional terminator signal sequence is a reverse RNA polymerase II terminator sequence which is, in a 5’ to 3’ orientation SEQ ID NO: 39 or SEQ ID NO: 255, or a rev RNA PolII terminator sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity to SEQ ID NO: 39 or SEQ ID NO: 255, where SEQ ID NO: 39 or SEQ ID NO: 255 can be orientated in a 5’ to 3’ direction is located between the 3’ of the poly A sequence and 5’ of the right ITR sequence (or 3’ ITR).

[0327] A transcription terminator signal or reverse RNA Polymerase II terminator sequence as described here is also interchangeably be called a “reverse poly A,” which refers to a polyA signal sequence placed in a 3 ’-5’ orientation downstream of the nucleic acid encoding GAA and upstream of 3’ITR. Any natural or synthetic poly A in 3 ’-5’ orientation can be used as reverse poly A. In some embodiments, the reverse poly A is the poly A (pA) as described in International publication no. WO2019143950 and US application publication no. US20200340013, which are incorporated herein by reference in its entirety.

[0328] For the sake of clarity, “reverse poly A,” “the double stranded RNA termination element,” and “reverse RNA Polymerase II terminator sequence” are used interchangeably herein. In 3’ to 5’ orientation, the reverse poly A or termination element does not allow transcription from 3’ITR, and hence double stranded RNA is not transcribed from 3’ITR. The reverse poly A or double stranded RNA termination element can be heterologous, e.g., from a different gene, for example, other than the gene of interest, or homologous to, e.g., the same gene as the gene of interest. In various embodiments, the poly A signal comprises the double stranded RNA transcription element, RNA termination element, or reverse poly A. Reverse poly A can be any poly A signal known in the art in 3’5’ orientation, and used in therAAV genome described herein e.g., as described in International publication no: WO 2019143950. For example, the poly A signal of several aspects of the invention described herein comprises a full length poly A signal in 5’ to 3’ orientation and another poly A signal in 3’ to 5’ orientation. In some embodiments, the 5’ end of double stranded RNA termination element or reverse poly A sequence, and the 3’ end of poly A signal are immediately next to each other, or at least 1 nucleotide apart, or at least 2 nucleotides apart, or at least 3 nucleotides apart, or at least 4 nucleotides apart, or at least 5 nucleotides apart, or at least 6 nucleotides apart, or at least 7 nucleotides apart, or at least 8 nucleotides apart, or at least 9 nucleotides apart, or at least 10 nucleotides apart, or more apart. In some embodiments, the poly A signal does not comprise double stranded RNA transcription element or reverse poly A. In some embodiments, the poly A signal comprises AATAAA or AAUAAA. In some embodiments, the poly A signal comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 repeats or more of AATAAA or AAUAAA. In some embodiments, the poly A signal comprises transcription termination signal for Pol III as described in "Delineation of the Exact Transcription Termination Signal for Type 3 Polymerase III. Mol Ther Nucleic Acids. 2018 Mar 2;10:36- 44, which is incorporated herein by reference in its entirety. In some embodiments, the one or more transcription termination signals for Pol III is in 3’ to 5’ orientation. In some embodiments, the poly A signal comprises TTTT. In some embodiments, poly A signal comprises AAAAAAA. The poly A sequences as described in “Definition of an efficient synthetic poly(A) site” Genes Dev. 1989 Jul;3(7): 1019-25. doi: 10.110 l / gad.3.7.1019., which is incorporated by reference in its entirety. All the above poly A sequences and or terminator sequences described herein can be used as inverted sequence e.g., in 3’ to 5’ orientation.

[0329] In some aspects of the invention described herein, the poly A sequence comprises poly A sequence and a terminator sequence, e.g., the poly A sequence comprises hGH Poly A sequence and a Pol III terminator sequence. In various aspects of the invention, the poly A sequence and Pol III terminator sequences are interchangeably referred to as “poly A.” In several aspects of the invention described herein, the poly A sequence further comprises a Reverse RNA Polymerase II terminator sequence, or RNA Polymerase II transcriptional pause signal sequence, or reverse poly A. Without any limitation, an example of Reverse RNA Polymerase II terminator sequence, or RNA Polymerase II transcriptional pause signal sequence, or reverse Poly A, is the 3’ sequence of the human hemoglobin alpha gene.

[0330] In some embodiments, a poly-A tail can be engineered to stabilize the RNA transcript that is transcribed from an rAAV vector genome, including a transcript for a heterologous gene, which in one embodiment is a GAA, and in alternative embodiments, the poly-A tail can be engineered to include elements that are destabilizing.

[0331] In one embodiment, the polyA is a bi-directional polyA sequence. Bi-directional polyA sequences are commonly isolated from viral DNA, for example, the SV40 polyA is a bi-directional polyA.

[0332] In some embodiments of the methods to treat Pompe disease as disclosed herein, a recombinantAAV vector comprises at least one polyA sequence located 3 ’ of the nucleic acid encoding the GAA gene and 5’ of the 3’ ITR sequence. In some embodiments, the poly A is a full length poly A (fl -polyA) sequence. In some embodiments, the polyA is a truncated polyA sequence as disclosed in International WO2021102107, which is incorporated herein in its entirety.

[0333] In an embodiment, a poly-A tail can be engineered to become a destabilizing element by altering the length of the poly-A tail. In an embodiment, the poly-A tail can be lengthened or shortened.

[0334] In some embodiments, there is a 3’ untranslated region (3’UTR) located between the heterologous gene encoding the GAA polypeptide and the poly-A tail. In some embodiments, there is a 3’ UTR located 3’ of the nucleic acid sequence encoding the GAA polypeptide. In some embodiments, a 3’ untranslated region (3’UTR) comprises GAA 3’ UTR (SEQ ID NO: 44) or a 3’ UTR (e.g., SEQ ID NO: 43, SEQ ID NO: 42 or SEQ ID NO: 29) as disclosed herein.

[0335] In another embodiment, a promoter region, or 3 ’ UTR or polyA region can comprise a destabilizing element, which is a target sequence for a microRNA (miRNA) that has the ability to silence (repress translation and promote degradation) the RNA transcripts when the miRNA binds to a miRNA target sequence. Accordingly, in some embodiments, addition or deletion of seed regions within the 3- UTR or a poly-A tail can increase or decrease expression of a protein, such as the GAA polypeptide. In some embodiments, the miRNA target region is a synthetic miRNA target region which is targeted by an artificial miRNA (amiRNA) according to methods known in the art.

[0336] In another embodiment, seed regions can also be engineered into the 3’ untranslated regions (3’UTRs) located between the heterologous gene and the poly-A tail. In a further embodiment, the destabilizing agent can be an siRNA. The coding region of the siRNA can be included in an rAAV vector genome and is generally located downstream, 3’ of the poly-A tail.

[0337] In all aspects of the methods for treating Pompe disease as disclosed herein, the rAAV genome may also comprise a Staffer DNA nucleic sequence. An exemplary staffer DNA sequence is SEQ ID NO: 71 as disclosed in International Application WO2021102107, or a nucleic acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% nucleotide sequence identity thereto. In some embodiments, the staffer sequence is located 3’ of the poly A tail, for example, and is located 5’ of the ‘3 ITR sequence. In some embodiments, the staffer DNA sequence comprises a synthetic polyadenylation signal in the reverse orientation.

[0338] In some embodiments, a staffer nucleic acid sequence (also referred to as a “spacer” nucleic acid fragment) can be located between the poly A sequence and the 3’ ITR (i.e., a staffer nucleic acid sequence is located 3’ of the polyA sequence and 5’ of the 3’ ITR). Such a staffer nucleic acid sequence can be about 30bp, 50pb, 75bp, lOObp, 150bp, 200bp, 250bp, 300bp or longer than 300bp. In some embodiments of the methods and compositions as disclosed herein, a staffer nucleic acid fragment is between 20-5 Obp, 50- lOObp, 100-200bp, 200-3 OObp, 300-500bp, or any integer between 20-5 OObp. Exemplary staffer (or spacer) nucleic acid sequence can be selected from any of: SEQ ID NO: 16, SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application WO2021102107, or a nucleic acidsequence at least about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, identical to SEQ ID NO: 16 or SEQ ID NO: 71 or SEQ ID NO: 78 as disclosed in International Application WO2021102107.H. CS sequence

[0339] In some embodiments of the methods and compositions disclosed herein, a recombinant AAV vector comprises a heterologous nucleic acid sequence that can further comprises at collagen stability (CS) sequence located 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the 3’ ITR sequence. In some embodiments, the rAAV genome disclosed herein comprises a heterologous nucleic acid sequence that can optionally comprise a Collagen stability sequence (CS or CSS), which is positioned 3’ of the nucleic acid encoding the GAA polypeptide and 5’ of the nucleic acid encoding a polyA signal. In some embodiments, the CS sequence can be replaced by a 3’ UTR sequence as disclosed herein.

[0340] Exemplary collagen stability sequences include CCCAGCCCACTTTTCCCCAA (SEQ ID NO: 259) or a sequence at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. An exemplary collagen stability sequence can have an amino acid sequence of PSPLFP (SEQ ID NO: 260) or an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto. CS sequences are disclosed in Holick and Liebhaber, Proc. Nat. Acad. Sci. 94: 2410-2414, 1997 (See, e.g. Figure 3, p. 5205), which is incorporated herein its entirety by reference.I. AAV ITRs

[0341] The rAAV vector or genome as disclosed herein for use in the methods to treat Pompe disease can comprise AAV ITRs that have desirable characteristics and can be designed to modulate the activities of, and cellular responses to vectors that incorporate the ITRs. In another embodiment, the AAV ITRs are synthetic AAV ITRs that has desirable characteristics and can be designed to manipulate the activities of and cellular responses to vectors comprising one or two synthetic ITRs, including, as set forth in U.S. Patent No. 9,447433, which is incorporated herein by reference.

[0342] In another embodiment, an ITR exhibits modified transcription activity relative to a naturally occurring ITR, e.g., an ITR from AAV843, e.g., ITR2 from AAV2; for example, it is known that the ITR2 sequence inherently has promoter activity. It also inherently has termination activity, similar to a poly(A) sequence. The functional ITR of the present invention exhibits transcription activity as shown in the examples. In some embodiments, a minimal functional ITR exhibits transcription activity, although at a diminished level relative to ITR2. Thus, in some embodiments, the ITR is functional for transcription. In other embodiments, the ITR is defective for transcription. In certain embodiments, the ITR can act as a transcription insulator, e.g., preventing transcription of a transgenic cassette present in the vector when the vector is integrated into a host chromosome.

[0343] One aspect of the invention relates to an rAAV vector genome comprising at least one syntheticAAV ITR, wherein the nucleotide sequence of one or more transcription factor binding sites in the ITR is deleted and / or substituted, relative to the sequence of a naturally occurring AAV ITR such as ITR2. In some embodiments, the AAV ITR is from AAV843; see e.g., See e.g., Xu et al., “Prevalence of neutralizing antibodies against AAV8, AAV9, and AAV843 in a Chinese population.” Int J Clin Exp Med 2019; 12(8) : 10253-10261, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the ITR is the minimal functional ITR in which one or more transcription factor binding sites are deleted and / or substituted. In some embodiments at least 1 transcription factor binding site is deleted and / or substituted, e.g., at least 5 or more or 10 or more transcription factor binding sites, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 transcription factor binding sites.

[0344] Another embodiment, a rAAV vector, including an rAAV vector genome as described herein comprises a polynucleotide comprising at least one synthetic AAV ITR, wherein one or more CpG islands (a cytosine base followed immediately by a guanine base (a CpG) in which the cytosines in such arrangement tend to be methylated) that typically occur at, or near the transcription start site in an ITR are deleted and / or substituted. In an embodiment, deletion or reduction in the number of CpG islands can reduce the immunogenicity of the rAAV vector. This results from a reduction or complete inhibition in TLR-9 binding to the rAAV vector DNA sequence, which occurs at CpG islands. It is also well known that methylation of CpG motifs results in transcriptional silencing. Removal of CpG motifs in the ITR is expected to result in decreased TLR-9 recognition and / or decreased methylation and therefore decreased transgene silencing. In some embodiments, it is the AAV843 ITR in which one or more CpG islands are deleted and / or substituted. In some embodiments, it is the minimal functional ITR in which one or more CpG islands are deleted and / or substituted, e.g., as described in International application no. PCT / US2014 / 028119, and US Patent No: US 9,447,433, which are incorporated in entirety by reference. In an embodiment, AAV ITR2 is known to contain 16 CpG islands of which one or more, or all 16 can be deleted.

[0345] In some embodiments, at least 1 CpG motif is deleted and / or substituted, e.g., at least 4 or more or 8 or more CpG motifs, e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 CpG motifs.

[0346] In another embodiment, the synthetic ITR comprises, consists essentially of, or consists of one of the nucleotide sequences listed in Table 4. In other embodiments, the synthetic ITR comprises, consist essentially of, or consist of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to any one of the nucleotide sequences listed in Table 4. In some embodiments, the ITR is a sequence is disclosed in FIG. 1 of Samulski et al., 1983, Cell, 33; 135-143 (referred to “Samulski et al, 1983” as which is incorporated herein in its entirety by reference), which discloses modified ITR sequences in FIG. 1. In some embodiments, the ITR sequence comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one of the ITR sequences in FIG. 1 as disclosed in Samulski et al, 1993. In some embodiments, the ITR comprises, or consists of a nucleotide sequence that is at least 80% identical, e.g.,at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of pSM 609 right disclosed in the middle panel of FIG. 1 (that lacks the 9bp) disclosed in Samulski et al, 1983. In some embodiments, the ITR comprises a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to the ITR sequence of any of SEQ ID NOs: 23, 31, and 45-59.

[0347] In some embodiments, the ITR sequence, e.g., Right ITR (or 3’ ITR) is SEQ ID NO: 31 or SEQ ID NO: 46 or SEQ ID NO: 48 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 31 or SEQ ID NO: 46 or SEQ ID NO: 48. In some embodiments, the ITR sequence, e.g., left ITR (or 5’ ITR) is SEQ ID NO: 23 or SEQ ID NO: 45 or SEQ ID NO: 47 or a nucleotide sequence that is at least 80% identical, e.g., at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% or 99.5% identical to SEQ ID NO: 23 or SEQ ID NO: 45 or SEQ ID NO: 47. In some embodiments, at least one of left ITR or, right ITR is 145 bp long or, less than 145 bp long. Non limiting exemplary lengths of ITRs are 145 bp, 143 bp, 142 bp, 141 bp, 140 bp, 135 bp, 130 bp, 128 bp, or, 119 bp, or less. In certain embodiments at least one ITR is 30 bp, 130 bp, or, 119 bp long.

[0348] Table 4: Exemplary synthetic ITR sequencesII. Vectors and Virions

[0349] In one embodiment, the rAAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein, and a rAAV genome in the capsid protein. A rAAV capsid of the rAAV virion used to treat Pompe Disease is any of those listed in Table 5 herein, or, has at least one capsid selected from the serotypes listed herein in Table 5, or in Table 1 as disclosed in International Applications W02020 / 102645, and W02020 / 102667, each of which are incorporated herein in their entirety. In one embodiment, a rAAV capsid of the rAAV virion used to treat Pompe Disease is an AAV843 capsid;AAV843 is also referred to as XL32. 1. In one embodiment, a rAAV vector is a variant from AAV2 that was developed by DNA shuffling. In one embodiment, a rAAV capsid of the rAAV virion used to treat Pompe Disease is an AAV8 capsid. In one embodiment, a rAAV vector is an rAAV8 vector.

[0350] Table 5 : AAV Serotypes and exemplary Published corresponding capsid sequence

[0351] In some embodiments, the recombinant AAV vector is selected from the group consisting of: a AAVXL32 vector, a AAVXL32. 1 vector, a AAV8 vector, or a haploid AAV8 vector comprising at least one AAV8 capsid protein. In some embodiments, the serotype is AAV3b. In some embodiments, theAAV3b serotype comprises one or mutations in a capsid protein selected from any of: 265D, 549A, Q263Y. In some embodiments, the AAV3b serotype is selected from any of: AAV3b265D, AAV3b265D549A, AAV3b549A or AAV3bQ263Y, or AAV3bSASTG.

[0352] In some embodiments, the recombinant AAV vector is a AAVXL32 vector or a AAVXL32. 1 vector, or a AAV8 vector, or a haploid AAV8 vector, or a rational polyploid AAV8 vector comprising at least one AAV8 capsid protein.

[0353] In one embodiment, the AAV vector (also referred to as a rAAV virion) as disclosed herein comprises a capsid protein from any of those disclosed in WO2019 / 241324, which is specifically incorporated herein in its entirety by reference. In some embodiments of the invention described herein, the rAAV vector comprises a liver specific capsid, e.g., a liver specific capsid selected from XL32 and XL32.1, as disclosed in International patent publication WO2019 / 241324, US patent publication US20210246467A1, European patent publication EP3807297A1, the contents of each of which are incorporated herein their entireties by reference. In some embodiments, the rAAV vector is a AAVXL32 or AAVXL32.1 as disclosed in WO2019 / 241324, US202I0246467AI, EP3807297A1 which are incorporated herein in their entireties by reference.

[0354] In one embodiment, the rAAV vector has liver specific capsid XL32. In one embodiment, the rAAV vector has liver specific capsid XL32.1. In one embodiment, the rAAV vector comprises a liver specific capsid encoded by SEQ ID NO: 306 or SEQ ID NO: 307 or a nucleic acid sequence having at least 80%, or at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 306 or SEQ ID NO: 307.

[0355] In one embodiment, the rAAV vector comprises a liver specific capsid comprising SEQ ID NO: 308 or SEQ ID NO: 309 or an amino acid sequence having at least 80%, or at least 85%, at least 90%, at least 95%, or at least 98% sequence identity to SEQ ID NO: 308 or SEQ ID NO: 309, e.g., that maintains the same function.

[0356] SEQ ID NO: 306, AAVXL32 capsid gene DNA sequence (see e g., SEQ ID NO:2 in US20210246467), 2214 nt

[0357] SEQ ID NO: 307, AAVXL32.1 capsid gene DNA sequence (see e.g., SEQ ID NO:3 in US20210246467) 2214 nt

[0358] SEQ ID NO: 308, AAVXL32 capsid amino acid sequence (see e.g., SEQ ID NO:5 in US20210246467), 737 aa

[0359] SEQ ID NO: 309, AAV XL32.1 capsid amino acid sequence (see e.g., SEQ ID NO:6 inUS20210246467), 737 aa

[0360] Exemplary chimeric or variant capsid proteins that can be used as the AAV capsid in the rAAV vector described herein can be selected from Table 2 from U.S. provisional application 62,937,556, filed on November 19, 2019, which is specifically incorporated herein in its reference, or can be used with any combination with wild type capsid proteins and / or other chimeric or variant capsid proteins now known or later identified and each is incorporated herein. In some embodiments, the rAAV vector encompassedfor use is a chimeric vector, e.g., as disclosed in 9,012,224 and US 7,892,809, which are incorporated herein in their entirety by reference.

[0361] In some embodiments, the rAAV vector is a haploid rAAV vector, as disclosed in US application US2018 / 0371496 and PCT / US 18 / 22725, or polyploid (e.g., rational polyploid) rAAV vector, e.g., as disclosed in PCT / US2018 / 044632 filed on 7 / 31 / 2018 and in US patent US 10,550,405, each of which are incorporated herein in their entirety by reference. In some embodiments, the rAAV vector is a rAAV3 vector, as disclosed in 9,012,224 and WO 2017 / 106236 which are incorporated herein in their entirety by reference.

[0362] In a particular embodiment, the rAAV is a AAVXU32 or AAVXU32. 1 AAV vector as disclosed in WO2019 / 241324, which is incorporated herein in its entirety by reference. In some embodiments, the rAAV vector comprises a capsid disclosed in WO2019241324A1, or International Patent application PCT / US2019 / 036676, which are incorporated herein in their entirety by reference. In some embodiments, the AAV vector is a AAV8 vector or a rational haploid comprising an AAV8 capsid protein. In some embodiments, the recombinant AAV vector is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or rational polyploid AAV vector. In some embodiments, the recombinant AAV vector is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector from any AAV serotypes, for example, from any AAV serotype disclosed in Table 1 as disclosed in International Applications W02020 / 102645, and W02020 / 102667, each of which are incorporated herein in their entirety.

[0363] In an embodiment, an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b capsid. AAV3b capsids encompassed for use are described in 2017 / 106236, and 9,012,224 and 7,892,809, and International application PCT / US 19 / 61653, filed Nov 15, 2019, and International Applications W02020 / 102645, and W02020 / 102667, each of which are incorporated herein in their entirety. In addition, AAV3b capsids of the AAV vector for use according to the methods as disclosed herein are disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107, which are incorporated herein in its entirety by reference herein.

[0364] In some embodiments, the AAV3b capsid comprises SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In an embodiment, the AAV capsid used in the treatment of Pompe Disease can be a modified AAV capsid that is derived in whole or in part from the AAV capsid set forth in SEQ ID NO: 44 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from an AAV3b capsid as set forth in SEQ ID NO: 44 (as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107) can be, or are substituted with amino acids from another capsid of a different AAV serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0365] In another embodiment, an AAV capsid used in the treatment of Pompe Disease is an AAV3b265D capsid. In this particular embodiment, an AAV3b265D capsid comprises a modification inthe amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265. In some embodiments, an AAV3b265D capsid comprises SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 46 as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b265D as set forth in SEQ ID NO: 46 (as set forth in International Patent Applications WO 2020 / 102645 and WO2021102107) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0366] In another embodiment an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b265D549A capsid. In this particular embodiment, an AAV3b265D549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid G265 of the AAV3b capsid with D265 and replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments, an AAV3b265D549A capsid comprises SEQ ID NO: 50 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 50 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b265D549A as set forth in SEQ ID NO: 50 (as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids. In some embodiments, the amino acids from AAV3bSASTG (i.e., a AAV3b capsid comprising Q263A / T265 mutations) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0367] In another embodiment, an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3b549A capsid. In this particular embodiment, an AAV3b549A capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid T549 of the AAV3b capsid with A549. In some embodiments, an AAV3b549A capsid comprises SEQ ID NO: 52 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 52 as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3b549A as set forth in SEQ ID NO: 52 (as disclosed herein International Patent Applications WO 2020 / 102645 and WO2021102107) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein thesubstituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0368] In another embodiment, an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is an AAV3bQ263Y capsid. In this particular embodiment, an AAV3bQ263Y capsid comprises a modification in the amino acid sequence of the two-fold axis loop of an AAV3b capsid via replacement of amino acid Q263 of the AAV3b capsid with Y263. In some embodiments, an AAV3b549A capsid comprises SEQ ID NO: 54 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. However, the modified virus capsids of the invention are not limited to AAV capsids set forth in SEQ ID NO: 54 as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107. In some embodiments, the amino acids from AAV3bQ263Y as set forth in SEQ ID NO: 54 (as disclosed in International Patent Applications WO 2020 / 102645 and WO2021102107) can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0369] In another embodiment, an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid. In this particular embodiment, an AAV3bSASTG capsid comprises a modification in the amino acid sequence to comprise a SASTG (SEQ ID NO: 311) mutation, in particular, the AAV3b capsid was modified to resemble AAV2 Q263A / T265 subvariant by introducing these modifications at similar positions in the AAV3b capsid (as disclosed in Messina EL, et al., Adeno-associated viral vectors based on serotype 3b use components of the fibroblast growth factor receptor signaling complex for efficient transduction. Hum. Gene Ther. 2012 Oct: 23(10): 1031-4, Piacentino III, Valentino, et al. "X-linked inhibitor of apoptosis protein-mediated attenuation of apoptosis, using a novel cardiac-enhanced adeno-associated viral vector." Human gene therapy 23.6 (2012): 635-646, which are both incorporated herein in their entirety by reference). Accordingly, in some embodiments, an rAAV vector useful in the treatment of Pompe Disease as disclosed herein is AAV3bSASTG serotype or comprises a AAV3bSASTG capsid comprising a AAV3b Q263A / T265 capsid. In some embodiments, the amino acids from AAV3bSASTG can be, or are substituted with amino acids from a capsid from an AAV of a different serotype, wherein the substituted and / or inserted amino acids can be from any AAV serotype, and can include either naturally occurring or partially or completely synthetic amino acids.

[0370] One can target desired tissues using the appropriate capsids. For example, the central nervous system using AAV9 or a rhesus capsid or a rational haploid using at least one of a AAV9 or Rhesus viral protein. One can target the muscle using myo AAV, see, e.g., WO2019 / 2071323 and W02022 / 020616, which are incorporated herein in their entirety by reference.

[0371] In order to facilitate their introduction into a cell, an rAAV vector genome useful in the invention are recombinant nucleic acid constructs that include (1) a heterologous sequence to be expressed (in one embodiment, a polynucleotide encoding a GAA polypeptide) and (2) viral sequence elements thatfacilitate integration and expression of the heterologous genes. The viral sequence elements may include those sequences of an AAV vector genome that are required in cis for replication and packaging (e.g., functional ITRs) of the DNA into an AAV capsid. In an embodiment, the heterologous gene encodes GAA, which is useful for correcting a GAA-deficiency in a patient suffering from Pompe Disease. In an embodiment, such an rAAV vector genome may also contain marker or reporter genes. In an embodiment, an rAAV vector genome can have one or more of the AAV3b wild-type (WT) cis genes replaced or deleted in whole or in part, but retain functional flanking ITR sequences.III. Optimized rAAV Vector Genome

[0372] In some embodiments of the methods and compositions as disclosed herein, an optimized rAAV vector genome is created from any of the elements disclosed herein and in any combination, including nucleic acid sequences encoding a promoter, an ITR, a poly-A tail, elements capable of increasing or decreasing expression of a heterologous gene, and in one embodiment, a nucleic acid sequence that is codon optimized for expression of GAA protein in vivo (i.e., wildtype GAA or codon optimized GAA) and optionally, one or more element to reduce immunogenicity. Such an optimized rAAV vector genome can be used with any AAV capsid that has tropism for the tissue and cells in which the rAAV vector genome is to be transduced and expressed.

[0373] In some embodiments, rAAV genome lacks the AAV P5 promoter or, a fragment thereof, which can be located upstream of a liver-specific promoter as disclosed herein. Normally, the P5 promoter controls expression of the AAV rep / cap proteins during AAV replication. In some embodiments, this P5 promoter fragment is present in the rAAV vector as disclosed herein which contains predicted transcription factor binding sites, e.g., cyclic AMP -responsive element-binding protein 3 (CREB3), which can be activated by endoplasmic reticulum (ER) / Golgi stress (Sampieri 2019), activating transcription factor 2 (ATF2), which is also involved in stress response (Watson 2017), Nuclear Receptor Subfamily 1 Group I Member 2 (NR1I2) (also known as Pregnane X receptor [PXR]) is known to be enriched in liver, and is activated by pregnane steroids, rifampin and other molecules including dexamethasone (NR1I2_HGNC) (Xing 2020). Accordingly, in some embodiments, a fragment of the AAV P5 promoter in the rAAV genome is removed without affecting the intended performance of the GAA cassette. In some embodiments, the rAAV vector also comprises an RNA polymerase II termination sequence located between the polyA signal and the 3’ ITR. An exemplary terminal sequence is SEQ ID NO: 39, or SEQ ID NO: 255, the later of which introduces two termination codons and one restriction site (e.g., Xhol) replaces TAG, and is located immediately downstream of the last coding amino acids of hGAA, and immediately located upstream of the 3’ UTR.IV. Subjects amenable to treatmentA. Pompe Disease

[0374] The recombinant AAV expressing GAA protein as disclosed herein can be used in methods to treat Pompe disease. Pompe disease is a rare genetic disorder caused by a deficiency in the enzyme acid alpha-glucosidase (GAA), which is needed to break down glycogen, a stored form of sugar used for energy. Pompe disease is also known as glycogen storage disease type II, GSD II, type II glycogen storage disease, glycogenosis type II, acid maltase deficiency, alpha- 1,4-glucosidase deficiency, cardiomegalia glycogenic diffusa, and cardiac form of generalized glycogenosis. The build-up of glycogen causes progressive muscle weakness (myopathy) throughout the body and affects various body tissues, particularly in the heart, skeletal muscles, liver, respiratory and nervous system.

[0375] Glycogen storage disease type II, also referred to as Pompe disease, is a rare disorder of metabolism inherited in an autosomal recessive manner, caused by deficiency of the lysosomal enzyme acid a-glucosidase (GAA). This disorder leads to the accumulation of lysosomal glycogen and destruction of skeletal, smooth and cardiac muscle. Pompe disease ranges in severity from a severe, infantile-onset myopathy accompanied by severe hypotonia and hypertrophic cardiomyopathy (infantile -onset Pompe disease [IOPD]) to a late-onset myopathy (LOPD). The defect in GAA can vary from complete to partial deficiency of GAA, which correlates with clinical severity. LOPD presents with proximal leg weakness and in some cases respiratory insufficiency without significant cardiac involvement and may progress to fatal respiratory failure.

[0376] Early onset (or the infantile form, IOPD) is the result of complete or near complete deficiency of GAA. Symptoms begin in the first months of life and progress rapidly, with feeding problems, poor weight gain, muscle weakness, floppiness, and head lag. Respiratory difficulties are often complicated by lung infections. The heart is grossly enlarged. Many infants with Pompe disease also have enlarged tongues. If untreated with Lumizyme, most babies die from cardiac or respiratory complications before their first birthday.

[0377] Late onset (or juvenile / adult, LOPD) Pompe disease is the result of a partial deficiency of GAA. The onset can be as early as the first decade of childhood or as late as the sixth decade of adulthood and is therefore characterized as slowly progressive. The primary symptom is proximal muscle weakness progressing to respiratory weakness and death from respiratory failure after a course lasting several years. The heart is usually not involved.

[0378] The presenting clinical manifestations of Pompe disease can vary widely depending on the age of disease onset and residual GAA activity. Residual GAA activity correlates with both the amount and tissue distribution of glycogen accumulation as well as the severity of the disease. Infantile-onset Pompe disease (less than 1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, and massive glycogen accumulation incardiac and other muscle tissues. Death usually occurs within one year of birth due to cardiorespiratory failure. Juvenile-onset (1-10% of normal GAA activity) and adult-onset (10-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with greater variation in age of onset, clinical presentation, and disease progression. Juvenile- and adult-onset Pompe disease are generally characterized by lack of severe cardiac involvement, later age of onset, and slower disease progression, but eventual respiratory or limb muscle involvement results in significant morbidity and mortality. While life expectancy can vary, death generally occurs due to respiratory failure.

[0379] In any embodiment of the methods as disclosed herein, a GAA enzyme suitable for treating Pompe disease includes a wild-type human GAA, or a fragment or sequence variant thereof which retains the ability to cleave a1-4 linkages in linear oligosaccharides. In some embodiments of the methods and compositions as disclosed herein, the GAA protein encoded by a GAA nucleic acid sequence, e.g., SEQ ID NO: 1-18 or SEQ ID NO: 313-316 as disclosed herein, or a N-terminal truncation thereof as disclosed herein in Table 1 or Table 1A (e.g., amino acids 57-952 of SEQ ID NO: 1). In some embodiments of the methods and compositions as disclosed herein, the GAA protein is encoded by a codon optimized GAA nucleic acid sequence, for example, for any one or more of: (1) enhanced expression in vivo, (2) to reduce CpG islands or (3) reduce the innate immune response. In some embodiments of the methods and compositions as disclosed herein, the GAA protein is encoded by a codon optimized GAA nucleic sequence, for example, any nucleic acid sequence selected from any of: SEQ ID NO: 1-18, or a nucleic acid sequence having at least 60%, or 70%, or 80%, 85% or 90% or 95%, or 98%, or 99% sequence identity to SEQ ID NOS: 1-18, which encode a GAA polypeptide, where amino acid at position 199 is R (199R); amino acid at position 233 is H (233H), and amino acid at position 780 is I (7801), as compared to the wild type GAA protein (e.g., SEQ ID NO: 312).

[0380] In some embodiments of the methods and compositions as disclosed herein, a rAAV vector as described herein transduces the liver of a subject and secretes the hGAA polypeptide into the blood, which perfuses patient tissues where the hGAA polypeptide, is taken up by cells and transported to the lysosome, where the GAA enzyme acts to eliminate material that has accumulated in the lysosomes due to the enzyme deficiency. For lysosomal enzyme replacement therapy to be effective, the therapeutic enzyme must be delivered to lysosomes in the appropriate cells in tissues where the storage defect is manifest.

[0381] In some embodiments, upon administration, the AAV vector selectively expresses and secretes GAA from transduced hepatocytes. The primary mechanism of action of a AAV vector expressing hGAA polypeptide as disclosed herein is to secrete continuous levels of GAA from the liver into the systemic circulation in order to provide therapeutic exposure levels of GAA to tissue (e.g., the muscle, but not exclusively the muscle), resulting in glycogen removal and restoration of cellular architecture and function.B. Increasing GAA Activity in A Subject with Pompe Disease

[0382] In any embodiment of the methods as disclosed herein, administration of a AAV vector expressing GAA is administration to a muscle, and can be by any suitable method including intravenous administration, intra-arterial administration, and / or intra-peritoneal administration. Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and / or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g., to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intralymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). The most suitable route in any given case will depend on the nature and severity of the condition being treated and / or prevented and on the nature of the particular vector that is being used.

[0383] In any embodiment of the methods as disclosed herein, administration of a AAV vector expressing GAA as disclosed herein is to skeletal muscle according to the present invention, and includes but is not limited to administration to skeletal muscle in the limbs (e.g., upper arm, lower arm, upper leg, and / or lower leg), back, neck, head (e.g., tongue), thorax, abdomen, pelvis / perineum, and / or digits. Suitable skeletal muscles that can be injected are disclosed in International Application WO2021102107, which is incorporated herein its entirety by reference.

[0384] In any embodiment of the methods as disclosed herein, the rAAV vectors and / or rAAV genome are administered to the skeletal muscle, liver, diaphragm, costal, and / or cardiac muscle cells of a subject. For example, a conventional syringe and needle can be used to inject a rAAV virion suspension into an animal. Parenteral administration of a the rAAV vectors and / or rAAV genome, by injection can be performed, for example, by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain agents for a pharmaceutical formulation, such as suspending, stabilizing and / or dispersing agents. Alternatively, the rAAV vectors and / or rAAV genome as disclosed herein can be in powder form (e.g., lyophilized) for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use.

[0385] In particular embodiments, more than one administration (e.g., two, three, four, five, six, seven, eight, nine, 10, etc., or more administrations) may be employed to achieve the desired level of GAA expression over a period of various intervals, e.g., hourly, daily, weekly, monthly, yearly, etc. Dosing can be single dosage or cumulative (serial dosing), and can be readily determined by one skilled in the art. As disclosed herein, it is envisioned that treatment of Pompe Disease according to the methods as disclosedherein comprises a one-time administration of an effective dose of a pharmaceutical composition comprising a AAV vector encoding a GAA polypeptide.

[0386] However, in alternative embodiments, treatment of a subject with Pompe disease may comprise multiple administrations of a pharmaceutical composition comprising a AAV vector encoding a GAA polypeptide when the subject is not administered long-term ERT, where the multiple administrations can be carried out over a range of time periods, such as, e.g., once yearly, or every 6-months, or about every 2-years, or about every 3-years, or about every 4 years, or about every 5-years or longer than 5-year intervals. The timing of administration can vary from individual to individual, depending upon such factors as the severity of an individual's symptoms. For example, in some embodiments, an effective dose of a AAV vector encoding a GAA polypeptide as disclosed herein can be administered to an individual once every year, or once every two years, or every six months for an indefinite period of time, or until the individual no longer requires therapy. A person of ordinary skill in the art will recognize that the condition of the individual can be monitored throughout the course of treatment and that the effective amount of a AAV vector encoding a GAA polypeptide as disclosed herein that is administered can be adjusted accordingly.

[0387] Injectables comprising a AAV vector encoding a GAA polypeptide as disclosed herein can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer a AAV vector encoding a GAA polypeptide as disclosed herein in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the virus vector and / or virus capsid can be delivered adhered to a surgically implantable matrix (e.g., as described in U.S. Patent Publication No. US- 2004-0013645 -Al). In some embodiments, a AAV vector encoding a GAA polypeptide as disclosed herein can be administered to the lungs of a subject by any suitable means, optionally by administering an aerosol suspension of respirable particles comprised of the virus vectors and / or virus capsids, which the subject inhales. The respirable particles can be liquid or solid. Aerosols of liquid particles comprising the virus vectors and / or virus capsids may be produced by any suitable means, such as with a pressure- driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g., U.S. Patent No. 4,501,729. Aerosols of solid particles comprising the virus vectors and / or capsids may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.

[0388] In some embodiments, a AAV vector encoding a GAA polypeptide as disclosed herein can be formulated in a solvent, emulsion or other diluent in an amount sufficient to dissolve an rAAV vector disclosed herein. In other aspects of this embodiment, the rAAV vectors and / or rAAV genome encoding GAA polypeptide as disclosed herein can herein may be formulated in a solvent, emulsion or a diluent in an amount of, e.g., less than about 90% (v / v), less than about 80% (v / v), less than about 70% (v / v), less than about 65% (v / v), less than about 60% (v / v), less than about 55% (v / v), less than about 50% (v / v), less than about 45% (v / v), less than about 40% (v / v), less than about 35% (v / v), less than about 30%(v / v), less than about 25% (v / v), less than about 20% (v / v), less than about 15% (v / v), less than about 10% (v / v), less than about 5% (v / v), or less than about 1% (v / v). In other aspects, the rAAV vectors and / or rAAV genome encoding a GAA polypeptide as disclosed herein can disclosed herein may comprise a solvent, emulsion or other diluent in an amount in a range of, e.g., about 1% (v / v) to 90% (v / v), about 1% (v / v) to 70% (v / v), about 1% (v / v) to 60% (v / v), about 1% (v / v) to 50% (v / v), about 1% (v / v) to 40% (v / v), about 1% (v / v) to 30% (v / v), about 1% (v / v) to 20% (v / v), about 1% (v / v) to 10% (v / v), about 2% (v / v) to 50% (v / v), about 2% (v / v) to 40% (v / v), about 2% (v / v) to 30% (v / v), about 2% (v / v) to 20% (v / v), about 2% (v / v) to 10% (v / v), about 4% (v / v) to 50% (v / v), about 4% (v / v) to 40% (v / v), about 4% (v / v) to 30% (v / v), about 4% (v / v) to 20% (v / v), about 4% (v / v) to 10% (v / v), about 6% (v / v) to 50% (v / v), about 6% (v / v) to 40% (v / v), about 6% (v / v) to 30% (v / v), about 6% (v / v) to 20% (v / v), about 6% (v / v) to 10% (v / v), about 8% (v / v) to 50% (v / v), about 8% (v / v) to 40% (v / v), about 8% (v / v) to 30% (v / v), about 8% (v / v) to 20% (v / v), about 8% (v / v) to 15% (v / v), or about 8% (v / v) to 12% (v / v).

[0389] In any embodiment of the methods as disclosed herein, a AAV vector encoding a GAA polypeptide can be an AAV of any serotype, including but not limited to encapsulated by any AAV843 capsid, AAV8 capsid, or any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 295); AAV3b265D capsid (SEQ ID NO: 297), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 299), AAV3b265D549A capsid (SEQ ID NO: 301); AAV3b549A capsid (SEQ ID NO: 303); AAV3bQ263Y capsid (SEQ ID NO: 305) or AAV3bSASTG capsid (i.e., a AAV3b capsid comprising Q263A / T265 mutations).

[0390] To facilitate delivery of a AAV vector encoding a GAA polypeptide as disclosed herein, it can be mixed with a carrier or excipient. Carriers and excipients that might be used include saline (especially sterilized, pyrogen-free saline) saline buffers (for example, citrate buffer, phosphate buffer, acetate buffer, and bicarbonate buffer), amino acids, urea, alcohols, ascorbic acid, phospholipids, proteins (for example, serum albumin), EDTA, sodium chloride, liposomes, mannitol, sorbitol, and glycerol. USP grade carriers and excipients are particularly useful for delivery of virions to human subjects.

[0391] In addition to the formulations described previously, a AAV vector encoding a GAA polypeptide as disclosed herein can also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by IM injection. Thus, for example, a rAAV vector and / or rAAV genome as disclosed herein may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives.

[0392] In any embodiment of the methods as disclosed herein, the method is directed to treating Pompe Disease that results from a deficiency of GAA in a subject, wherein a AAV vector encoding a GAA polypeptide as disclosed herein is administered to a patient suffering from Pompe Disease, and following administration, GAA is secreted from cells in the liver and there is uptake of the secreted GAA by cells in skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue or a combination thereof, whereinuptake of the secreted GAA results in a reduction in lysosomal glycogen stores in the tissue(s), including but not limited to muscle. In some embodiments, a AAV vector encoding a GAA polypeptide as disclosed herein is encapsulated in a capsid, e.g., encapsulated by any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 294); AAV3b265D capsid (SEQ ID NO: 296), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 298), AAV3b265D549A capsid (SEQ ID NO: 300); AAV3b549A capsid (SEQ ID NO: 302); AAV3bQ263Y capsid (SEQ ID NO: 304) or AAV3bSASTG capsid (i.e., a AAV3b capsid comprising Q263A / T265 mutations).

[0393] In some embodiments, at least about l.OxlO11to about 5.0xl013vg / kg will be administered per dose in a pharmaceutically acceptable carrier. In some embodiments, at least about 5.0xl012to about 2.0xl013vg / kg will be administered per dose in a pharmaceutically acceptable carrier. In a particular embodiment, at least about 1.6xl012to about 4.0xl012vg / kg will be administered per dose in a pharmaceutically acceptable carrier. In a particular embodiment, at least about 5.0xl012vg / kg will be administered per dose in a pharmaceutically acceptable carrier. In a further embodiment, dosages of the virus vector and / or capsid to be administered to a subject depend upon the mode of administration, the severity and type of Pompe disease (i.e., LOPD or IOPD) to be treated and / or prevented, the individual subject's condition, age and gender, and the particular virus vector or capsid, the nucleic acid encoding GAA polypeptide to be delivered, and the like, and can be determined in a routine manner.

[0394] Exemplary doses for achieving therapeutic effects are titers of at least about between 1.0E9vg / kg and 5.0E13 vg / kg, e.g., at least about between 1.0E9vg / kg and 5.0E12 vg / kg; at least about between 5.0E9vg / kg and 5.0E12 vg / kg; at least about between 5.0E9vg / kg and 1.0E12 vg / kg; at least about between 5.0E9vg / kg and 5.0E11 vg / kg; at least about between 5.0E9vg / kg and 5.0E10 vg / kg; or at least about between 1 ,0E9vg / kg and 1.0E10 vg / kg. 1.5 x 1011vg / kg. Non-limiting exemplary doses are at least about 1.5xl012vg / kg, or at least about 4.0 xlO12vg / kg, or, at least about 5X1012vg / kg, at least about IxlO13vg / kg, at least about 2xl013vg / kg, or, at least about 5X1013vg / kg. It is encompassed that the dose for achieving therapeutic effects as disclosed herein may also be determined by the strength of the liver specific promoter (LSP) operatively linked to the nucleic acid encoding the GAA polypeptide, as well as specific signal sequence, and ability of the cell to cleave the signal sequence when secreted from the cell. In contrast, the dose of the AAV encoding the GAA polypeptide as disclosed herein can be lower than about 1 ,6xl012when the liver specific promoter is stronger than the LSP (SEQ ID NO: 256) used in a AAV8-LSPhGAA vector, however, the dose of AAV should be titrated and determined based on the level of GAA expressed in the cell, as determined by transduction efficiency of the AAV capsid and the LSP, and the ability of the cell to secrete the expressed GAA polypeptide in order to avoid GAA accumulation in the transfected cell and any associated cell toxicity.

[0395] In another aspect, disclosed herein is a method of treating Pompe Disease by administering a nucleic acid encoding a GAA to a cell, comprising contacting the cell with a rAAV vector and / or rAAV genome as disclosed herein, under conditions for the nucleic acid to be introduced into the cell andexpressed to produce GAA. In some embodiments, the cell is a cell in vivo. In some embodiments, the cell is a mammalian cell in vivo.C. Increasing Motor neuron Function In A Mammal

[0396] In any embodiment of the methods as disclosed herein, a AAV vector encoding a GAA polypeptide as disclosed herein is useful in methods to increase phrenic nerve activity in a mammal having Pompe disease and / or insufficient GAA levels. For example, a AAV vector encoding a GAA polypeptide as disclosed herein, e.g., a rAAV vector and / or rAAV genome encapsulated in a capsid, e.g., encapsulated by AAV843 or AAV8 or any AAV3b capsid selected from: AAV3b capsid (SEQ ID NO: 294); AAV3b265D capsid (SEQ ID NO: 296), AAV3b ST (S663V+T492V) capsid (SEQ ID NO: 298), AAV3b265D549A capsid (SEQ ID NO: 300); AAV3b549A capsid (SEQ ID NO: 302); AAV3bQ263Y capsid (SEQ ID NO: 304) or AAV3bSASTG capsid, can be administered to the central nervous system (e.g., neurons). In another embodiment, retrograde transport a AAV vector encoding a GAA polypeptide as disclosed herein from the diaphragm (or other muscle) to the phrenic nerve or other motor neurons can result in biochemical and physiological correction of Pompe disease. These same principles could be applied to other neurodegenerative disease.

[0397] In an embodiment, a rAAV capsid of the rAAV virion used to treat Pompe Disease is any of those listed in Table 1 as disclosed in International Applications W02020 / 102645, and W02020 / 102667, each of which are incorporated herein in their entirety, and includes any of AAV843 or AAV8 or AAV3, or AAV3b (including but not limited to AAV3b serotypes AAV3b265D, AAV3b265D549A, AAV3b549A, AAV3bQ263Y, AAV3bSASTG (i.e., a AAV3b capsid comprising Q263A / T265 mutations) serotypes) is capable of reducing any one or more of the symptoms of (i) the feeling of weakness in a patient’s lower extremities, including, the legs, trunk and / or arms, (ii) a shortness of breath, a hard time exercising, lung infections, a big curve in the spine, trouble breathing while sleeping, an enlarged liver, an enlarged tongue and / or a stiff joint, (iii) in a patient suffering from Pompe Disease by, e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90% or at least 95% as compared to a patient not receiving the same treatment. In other aspects of this embodiment, an AAV GAA of any serotype is capable of reducing any one or more of the systems of (i) the feeling of weakness in a patient’s lower extremities, including, the legs, trunk and / or arms, ii) a shortness of breath, a hard time exercising, lung infections, a big curve in the spine, trouble breathing while sleeping, an enlarged liver, an enlarged tongue and / or a stiff joint, (iii) in a patient suffering from Pompe Disease by, e.g., about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% toabout 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70% as compared to a patient not receiving the same treatment.

[0398] In any embodiment of the methods and compositions as disclosed herein, at least one symptom associated with Pompe Disease, or at least one adverse side effect associated with Pompe Disease are reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%, and the severity of at least one symptom associated with Pompe Disease, or at least one adverse side effect is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%. In another embodiment, at least one symptom associated with Pompe Disease, or at least one adverse side effect associated with Pompe Disease is reduced by about 10% to about 100%, about 20% to about 100%, about 30% to about 100%, about 40% to about 100%, about 50% to about 100%, about 60% to about 100%, about 70% to about 100%, about 80% to about 100%, about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 70% to about 90%, about 10% to about 80%, about 20% to about 80%, about 30% to about 80%, about 40% to about 80%, about 50% to about 80%, or about 60% to about 80%, about 10% to about 70%, about 20% to about 70%, about 30% to about 70%, about 40% to about 70%, or about 50% to about 70%.V. Methods of Administration

[0399] Without wishing to be bound by theory, the only current treatment for Pompe disease is long- term administration of recombinant human GAA (rhGAA) ERT, which is typically administered on an every-other week regimen. Herein, the inventors have demonstrated that a subject with Pompe disease can take breaks from the normal ERT regimen for extended period of time (e.g., extended periods of ERT cessation) without a clinical set back if the subject is administered a specific dose of AAV vector expressing a GAA polypeptide as disclosed herein. In some embodiments, withdrawal of the administration of long-term ERT begins at about the time of administration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, withdrawal of the administration of long-term ERT can occur at about 26 weeks, or anywhere within about 24 to about 26 weeks after administration of the AAV vector.

[0400] In some embodiments, a subject administered a AAV vector expressing GAA as disclosed herein, can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administeredafter about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT. Stated differently and without wishing to be bound by theory, the technology disclosed herein relates to a method whereby a subject with Pompe disease who is administered a AAV vector expressing GAA as disclosed herein, can have breaks or “holidays” from the normal long-term ERT administration. That is, according to the methods as disclosed herein, a subject administered an AAV vector expressing GAA as disclosed herein can have extended periods of time with the absence of administration of long-term ERT administration. In some embodiments, the methods as disclosed herein enable flexibility in normal ERT regimens, in that extended breaks or withdrawal of administration of long-term ERT does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT.

[0401] In some embodiments, the methods as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAA expressed by the AAV permits ERT flexibility. In some embodiments, the complementary ERT is pulse administration of ERT, as disclosed herein. In some embodiments, the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long-term ERT.

[0402] Accordingly, the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time-consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti -rhGAA antibodies against the ERT, and also circumvents the need for administration of immune suppressants normally co-administered with the ERT. As such, the methods to treat Pompe disease as disclosed here leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.

[0403] Accordingly, in one embodiment, the technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in expressible form wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., ERT administration can be withdrawn or stopped at about 24, or at about 26 weeks, or earlier than 24- or 26 weeks, after administration of the recombinant AAV). In some embodiments, the dosage of the recombinant AAV comprising nucleic acid encoding GAA polypeptide ranges from l.OEl lvg / kg and 5.0E13 vg / kg, or between 5.0E12vg / kg and 2.0E13 vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 160 to ≤ 2,260 nmol / mL / hr, 165 to ≤ 2,260 nmol / ml / hr, 175 to ≤2,260 nmol / ml / hr, 180 to ≤ 2,260 nmol / ml / hr, 185 to ≤ 2,260 nmol / ml / hr, 189 to ≤ 2,260 nmol / ml / hr, 160 to ≤4000 nmol / ml / hr (see e.g., Fig. 2), or 160 to ≤20800 nmol / ml / hr (see e.g., Fig. 7A) of at least within two weeks (or within at least 4-12 weeks) of administration. In some embodiments, the dosage of the AAV expressing a GAA polypeptide ranges from 1.0E1 Ivg / kg and 5.0E13 vg / kg, and in some embodiments, is no more than 4.0E12vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ≤ 2,260, 160 to ≤4000 (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr of at least within two weeks (or within at least 4-12 weeks) of administration. In some embodiments, the dosage of the AAV expressing GAA is no more than 4.0E12vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ≤ 2,260 nmol / mL / hr of at least within two weeks of administration. In some embodiments, the dosage of the AAV expressing GAA is no more than 2.0E13vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 160 to ≤20800 nmol / mL / hr (see e.g., Fig. 7A) of at least within two to six weeks of administration.

[0404] In some embodiments, the dosage of AAV expressing GAA is no more than 5.0E”vg / kg. In some embodiments, the dosages range from 1.0E9vg / kg to 5.0E1’vg / kg.

[0405] In some embodiments, the dosage of AAV expressing GAA is no more than 5.0E13vg / kg. In some embodiments, the dosages range from 1.0E9vg / kg to 5.0E13vg / kg. In some embodiments, higher dosages of rAAV of the invention are accompanied with at least one immunomodulator.

[0406] In particular, the technology described herein relates to the discovery that a single infusion of a rAAV vector expressing human acid alpha-glucosidase (GAA) can be a stand-alone replacement for repeated infusions of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA). The inventors demonstrate that a one-time administration of AAV expressing GAA leads to long-term transduction of a normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Accordingly, the inventors demonstrate herein that administration of a composition comprising AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally receive. That is, the inventors have demonstrated herein that subjects with Pompe that are administered a AAV expressing hGAA as disclosed herein can have long term cessation of ERT.

[0407] In particular, described herein is a method of treating Pompe in a subject in need thereof by administering the subject a composition comprising a AAV vector expressing the a-glucosidase (GAA) protein, where the subject is not being concurrently administered a GAA enzyme replacement therapy. In some embodiments, the technology relates to a method of administering a AAV expressing GAA where the subject can be withdrawn from a GAA enzyme replacement therapy (ERT) for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least V / z years and points in between 6 months or longer. In some embodiments, the subject is withdrawn from ERT on theday of, or shortly before administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more, as disclosed herein. In some embodiments, the subject is withdrawn from ERT at any time between 1-2 days before or after administration, and about 6-months after administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more Pompe symptoms for at least 6 months, as disclosed herein.

[0408] Additionally, the inventors have also discovered that Pompe patients administered a AAV expressing GAA according to the methods and dose ranges as disclosed herein, there is minimal immune response to the GAA protein expressed by the AAV. According, in some embodiments, there is minimal, or no need for immune modulation or administration of immune suppressants at the time of, or before, or after the administration of the AAV to the subject, and therefore normal immune suppressants protocols which are typically administered when a subject is administered a viral vector, or undergoing gene therapy are not required.

[0409] Accordingly, in all embodiments herein, the method to treat Pompe comprises, or consists essentially of, or consists of, administering an AAV vector expressing GAA as disclosed herein, in the absence of administration of ERT for Pompe, and also in the absence of immune modulation. In some embodiments, the subject has late onset Pompe Disease (LOPD) or infantile -onset Pompe disease.

[0410] In all aspects disclosed herein, the AAV that comprise a nucleotide sequence containing inverted terminal repeats (ITRs), a promoter, a heterologous gene, a poly-A tail and potentially other regulator elements for use to treat a Pompe disease, e.g., late onset Pompe disease (LOPD), wherein the heterologous gene is GAA, and wherein the vector, e.g., rAAV can be administered to a patient in a therapeutically effective dose that is delivered to the appropriate tissue and / or organ for expression of the heterologous GAA gene and treatment of the disease, e.g., Pompe disease.

[0411] In some embodiments, a subject administered a AAV vector expressing GAA as disclosed herein, can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administered after about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT. Stated differently and without wishing to be bound by theory, the technology disclosed herein relates to a method whereby a subject with Pompe disease who is administered a AAV vector expressing GAA as disclosed herein, can have breaks or “holidays” from the normal long-term ERT administration. That is, according to the methods as disclosed herein, a subject administered an AAV vector expressing GAA as disclosed herein can have extended periods of time with the absence of administration of long-term ERT administration. In some embodiments, the methods as disclosed herein enable flexibility in normal ERT regimens, in that extended breaks or withdrawal of administration of long-term ERT does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT.

[0412] In some embodiments, the methods as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAAexpressed by the AAV permits ERT flexibility. In some embodiments, the complementary ERT is pulse administration of ERT, as disclosed herein. In some embodiments, the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long-term ERT.

[0413] Accordingly, the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time-consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti -rhGAA antibodies against the ERT, and also circumvents the need for administration of immune suppressants normally co-administered with the ERT. As such, the methods to treat Pompe disease as disclosed here leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.

[0414] Accordingly, in one embodiment, the technology relates to a method of treating Pompe disease in a subject, comprising administering to the subject a pharmaceutical composition comprising a recombinant adeno-associated virus (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding an alpha-glucosidase (GAA) polypeptide in expressible form wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, in the absence of administration of long-term GAA enzyme replacement therapy (ERT) for an extended period of time (e.g., ERT administration can be withdrawn or stopped at about 24, or at about 26 weeks, or earlier than 24- or 26 weeks, after administration of the recombinant AAV). In some embodiments, the dosage of the recombinant AAV comprising nucleic acid encoding GAA polypeptide ranges from 1.0E9 vg / kg to 5.0E13 vg / kg, or between 5.0E12vg / kg and 2.0E13 vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 160 to ≤ 2,260 nmol / mL / hr, 165 to ≤ 2,260 nmol / ml / hr, 175 to ≤ 2,260 nmol / ml / hr, 180 to ≤ 2,260 nmol / ml / hr, 185 to ≤ 2,260 nmol / ml / hr, 189 to ≤ 2,260 nmol / ml / hr, 160 to ≤4000 nmol / ml / hr (see e.g., Fig. 2), or 160 to ≤20800 nmol / ml / hr (see e.g., Fig. 7A) of at least within two weeks of administration. In some embodiments, the dosage of the AAV expressing GAA is in the range of 1.0E9vg / kg and 5.0E13 vg / kg, or between 5.0E12vg / kg and 2.0E13 vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ≤ 2,260 nmol / mL / hr of at least within two weeks of administration. In some embodiments, the dosage of the AAV expressing GAA is in the range of 1.0E9vg / kg and 5.0E13 vg / kg, or between 5.0E12vg / kg and 2.0E13 vg / kg, and in some embodiments, the GAA is expressed to a level that the subject obtains a blood serum level of GAA expressed by the AAV at a pharmaceutical activity range from 189 to ≤ 2,260 nmol / mL / hr of at least within two weeks of administration.

[0415] In particular, the technology described herein relates to the discovery that a single infusion of arAAV vector expressing human acid alpha-glucosidase (GAA) can be a stand-alone replacement for repeated infusions of enzyme replacement therapy (ERT) with recombinant human GAA protein (rhGAA). The inventors demonstrate that a one-time administration of AAV expressing GAA leads to long-term transduction of a normal GAA gene into hepatocytes and continuous constitutive expression of GAA in the systemic circulation. Accordingly, the inventors demonstrate herein that administration of a composition comprising AAV expressing hGAA can replace the biweekly exogenous administration of ERT that subjects with Pompe disease normally receive. That is, the inventors have demonstrated herein that subjects with Pompe that are administered a AAV expressing hGAA as disclosed herein can have long term cessation of ERT.

[0416] In particular, described herein is a method of treating Pompe in a subject in need thereof by administering the subject a composition comprising a AAV vector expressing the a-glucosidase (GAA) protein, where the subject is not being concurrently administered a GAA enzyme replacement therapy. In some embodiments, the technology relates to a method of administering a AAV expressing GAA where the subject can be withdrawn from a GAA enzyme replacement therapy (ERT) for an extended period of time, e.g., at least 3 months, at least 4 months, at least 5 months, at least 1 year, at least 1½ years and points in between 6 months or longer. In some embodiments, the subject is withdrawn from ERT on the day of, or shortly before administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more, as disclosed herein. In some embodiments, the subject is withdrawn from ERT at any time between 1-2 days before or after administration, and about 6-months after administration of a AAV expressing GAA, and is clinically stable with respect to at least one or more Pompe symptoms for at least 6 months, as disclosed herein.

[0417] Additionally, the inventors have also discovered that Pompe patients administered a AAV expressing GAA according to the methods and dose ranges as disclosed herein, there is minimal immune response to the GAA protein expressed by the AAV. According, in some embodiments, there is minimal, or no need for immune modulation or administration of immune suppressants at the time of, or before, or after the administration of the AAV to the subject, and therefore normal immune suppressants protocols which are typically administered when a subject is administered a viral vector, or undergoing gene therapy are not required.

[0418] Accordingly, in all embodiments herein, the method to treat Pompe comprises, or consists essentially of, or consists of, administering an AAV vector expressing GAA as disclosed herein, in the absence of administration of ERT for Pompe, and also in the absence of immune modulation. In some embodiments, the subject has late onset Pompe Disease (LOPD) or infantile-onset Pompe disease.

[0419] The disclosure herein relates, in general, to a method to treat a subject with Pompe Disease, comprising administering to the subject with Pompe disease a pharmaceutical composition comprising, or consisting essentially of, a recombinant adenovirus associated (AAV) vector comprising in its genome, a heterologous nucleic acid sequence encoding a polypeptide comprising an alpha-glucosidase (GAA) polypeptide, wherein the heterologous nucleic acid is operatively linked to a liver-specific promoter, andwherein the subject is not administered a GAA enzyme replacement therapy (ERT) for an extended period of time, or can have extended breaks from ERT. In one embodiment, ERT is continued, but at least one of: dosage or frequency is reduced.

[0420] Without wishing to be bound by theory, the inventors have discovered a method to treat Pompe disease with AAV-mediated delivery of GAA to the subject, where the rAAV expresses GAA to a steady state shortly after administration, such that the subject could be withdrawn from ERT as early as, or at, or around the time of the rAAV administration, e.g., ERT can be withdrawn the day before administration, the same day of administration, or the day after administration, or within a week, or within 2-weeks of administration. As disclosed herein, a steady state of GAA expression by the rAAV as disclosed herein is a serum level of GAA at a pharmacological activity range from 189 to ≤ 2,260, 160 to ≤4000 (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr.

[0421] In some embodiments, the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of a therapeutically effective amount of a rAAV to result in a serum level of expressed hGAA within a pharmacological activity range of between 189 to 410 nmol / mL / hr, or 410 to ≤ 2,260 nmol / mL / hr, or 160 to ≤4000 nmol / ml / hr (see e.g., Fig. 2), or 160 to ≤20800 nmol / ml / hr (see e.g., Fig. 7A).

[0422] In some embodiments, the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of a rAAV to result in a serum level of expressed hGAA within a range of 189 to ≤ 2,260, 160 to ≤4000 (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr, and where the subject achieves clinical stability of one or more symptoms of Pompe disease. Clinical stability includes a steady state in any one or more of the parameters: the 6MWT (6-minute walk test), FVC (Forced vital capacity). In some embodiments, clinical stability refers to a stable level in either motor function (as determined by the 6MWT) and / or pulmonary function (as determined by the FVC) in two consecutive assessments no less than 3 -months apart. In some embodiments, a clinical stable level of motor function as determined by the 6MWT is ≤ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3 -months apart. Stated differently, a clinical stable level of motor function as determined by the 6MWT position is within a 0-12% decline from a baseline level in two consecutive assessments no less than 3-months apart.

[0423] In some embodiments, a clinical stable level of pulmonary function as determined by the FVC % predicted in an upright position is ≤ 15% decrease from baseline in two consecutive assessments no less than 3-months apart. Stated differently, a clinical stable level of pulmonary function as determined by the % FVC predicted in an upright position is between 1-14% from a baseline in two consecutive assessments no less than 3-months apart.

[0424] In some embodiments, the baseline level of the 6MWT or FVC is the level measured at or before administration of the rAAV expressing GAA. In some embodiments, the baseline level of the 6MWT or FVC is the level measured at or before administration of the rAAV expressing GAA when the subject is concurrently administered GAA ERT. In some embodiments, the baseline level of the 6MWT or FVC isthe level measured at or before administration of the rAAV expressing GAA when the subject is withdrawn from GAA ERT. In some embodiments, the baseline level of the 6MWT or, FVC is the level before withdrawing GAA ERT, e.g., at about 24 to about 26 weeks. In some embodiments, clinical stability is maintained between before ERT withdrawal and after ERT withdrawal of Pompe patients where the patients have received single administration of AAV comprising nucleic acid encoding GAA administrated at the time of ERT administration, before ERT administration, or, after ERT administration. Clinical stability is maintained indicate that 6MWT and or, FVC are within the ranges from baseline as described herein.

[0425] In some embodiments, the method to treat Pompe disease with rAAV expressing GAA as disclosed herein comprises administration of an amount of rAAV to result in a reduction of glycogen levels in one or more tissues to within a normal range, where the normal range is the glycogen levels in the comparative tissue of a subject without Pompe disease.A. AAV-hGAA Dosages

[0426] In some embodiments, the methods disclosed herein relate to human subjects can be administered a rAAV expressing GAA as disclosed herein at a dose in the range of 1.0E1 Ivg / kg and 5.0E13 vg / kg, or in some embodiments at a dose in the range of 5.0E12vg / kg and 2.0E13 vg / kg. In some embodiments, ERT withdrawal can occur at the time of the administration of the rAAV expressing GAA, or occurring at about 24 or 26 weeks after recombinant AAV administration. In some embodiments, there can be a therapeutic correction of disease pathophysiology with administration of the rAAV expressing GAA as disclosed herein, even in the absence of ERT, and also protection against immune response to the expressed hGAA e.g., as measured by the antibodies against the expressed hGAA, therefore demonstrating that subjects with Pompe disease that are administered a AAV expressing hGAA as disclosed herein can have long term cessation of ERT, which is further discussed, e.g., in International Patent Application No. PCT / US2023 / 013713, which is incorporated herein by reference in its entirety.

[0427] In some embodiments the dose of the a rAAV vector or rAAV genome to be administered to the subject according to the method to treat Pompe Disease as disclosed herein depends upon the mode of administration, the promoter used, the signal peptide used, the severity of the Pompe disease or other condition to be treated and / or prevented, the individual subject's condition, the particular virus vector or capsid, the liver-specific promoter being used and the nucleic acid to be delivered, including but not limited to, nucleic acid encoding the signal peptide attached to the 5’ of the nucleic acid encoding expressible GAA polypeptide, and the like, and can be determined in a routine manner.

[0428] In some embodiments, the therapeutically effective amount of the rAAV vector expressing GAA is an amount that results in a serum GAA concentration at steady state similar to the GAA pharmacological activity achieved by long tern GAA ERT (e.g. within 5%, 10%, 20% of such levels). For example, a target GAA serum concentration at steady state ranging from about 160 to ≤ 2,260 nmol / mL / hr, from about 189 to ≤ 2,260 nmol / mL / hr, or ranging from 410 to ≤ 2,260 nmol / mL / hr, or 160to ≤4000 nmol / ml / hr (see e.g., Fig. 2), or 160 to ≤20800 nmol / ml / hr (see e.g., Fig. 7A). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to achieve a target GAA serum concentration at steady state that confers pharmacological activity ranges from 189 to ≤ 2,260 nmol / mL / hr. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to achieve a target GAA serum concentration at steady state that confers pharmacological activity ranges from 160 to ≤4000 nmol / mL / hr (see e.g., Fig. 2). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to achieve a target GAA serum concentration at steady state that confers pharmacological activity ranges from 160 to ≤20800 nmol / mL / hr (see e.g., Fig. 7A).

[0429] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to >0.30 pmol 4MU / min / gram of tissue, where the normal range of tissue GAA content in a subject without Pompe disease is 0.36 ± / 0. 13 pmol 4MU / min / gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to between 0.25 to 0.4 pmol 4MU / min / gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue GAA content of about 0.36 pmol 4MU / min / gram of tissue, e.g.. about 0.25, or about 0.26, or about 0.27, or about 0.28, or about 0.29, or about 0.30, or about 0.31, or about 0.32, or about 0.33, or about 0.34, or about 0.35, or about 0.36, or about 0.37, or about 0.38, or about 0.39, or about 0.40 pmol 4MU / min / gram of tissue.

[0430] In some embodiments, the dose of the rAAV vector expressing GAA (e.g., D9; e.g., BM40 signal peptide and truncated GAA (e.g., amino acids 57-952 of SEQ ID NO: 1) is a therapeutically effective amount to increase the tissue GAA levels in the subject to between 1 to 80 nmol 4MU / min / gram of tissue (see e.g., Fig. 3A-3B, Fig. 5A-5B, Fig. 7C). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue GAA content of about 1, or about 2, or about 3, or about 4, or about 5, or about 6, or about 7, or about 8, or about 9, or about 10, or about 20, or about 30, or about 40, or about 50, or about 60, or about 70, or about 80, or about 90, nmol 4MU / min / gram of tissue.

[0431] In some embodiments, the dose of the rAAV vector expressing GAA (e.g., D9; e.g., BM40 signal peptide and truncated GAA (e.g., amino acids 57-952 of SEQ ID NO: 1) is a therapeutically effective amount to decrease the tissue glycogen levels in the subject to less than 1 mmol glucose per gram of protein (see e.g., Fig. 4A-4B, Fig. 6A-6B, Fig. 7B). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue glycogen level of at most 0.1, at most 0.2, at most 0.3, at most 0.4, at most 0.5, at most 0.6, at most 0.7, at most 0.8, at most 0.9, at most 1.0, at most 1.1, at most 1.2, at most 1.3, at most 1.4, at most 1.5, at most 1.6, at most 1.7, at most 1.8, at most 1.9, or at most 2.0 mmol glucose per gram of protein.

[0432] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase the tissue GAA levels in the subject to between 0. 1-0.5 pmol 4MU / min / gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in a normal tissue GAA content of about greater than 0.36 pmol 4MU / min / gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content or levels in the subject within the range 0.2-0.4 pmol 4MU / min / gram of tissue. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the normal muscle tissue GAA content of 0.36 ± 0.13 (pmol 4MU / min / gram of tissue), where the GAA content of normal muscle tissue is a reference level of GAA in a subject without Pompe Disease. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject greater than 0.1 mol 4MU / min / gram of tissue, where the normal range GAA content in subjects with Pompe disease is 0.05 ± 0.04 (pmol 4MU / min / gram of tissue). In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject more than 2-fold, or 3 -fold, or 4-fold, or 5 -fold, or 6-fold, or 7-fold, or 8 -fold, or 9-fold, or 10-fold, or more than 10-fold of the level of GAA tissue content in the subject with Pompe. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to increase tissue GAA content in the subject to about 50%, or, about 40%, or about 30%, or about 20%, or about 10%, or about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2% or about 1% of the level of GAA tissue content in the subject with Pompe. In some embodiments, the GAA activity in muscle is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 8 fold, or at least 10 fold than the level prior to AAV administration. In some embodiments, the GAA activity in muscle is at least 1.5 fold, at least 2 fold, at least 3 fold, at least 5 fold, at least 8 fold, or at least 10 fold than the level after the long term ERT was withdrawn for at least about 24 weeks.

[0433] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to reduce the tissue glycogen levels in the subject within the range 0.25 % wet tissue weight to about 1.5 % wet tissue weight. In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to reduce the muscle tissue glycogen levels in the subject to within 40%, or within 30%, or within 20%, or within 10%, or within 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% of the normal muscle tissue glycogen content of 0.99% ± 0.74 (% wet tissue weight), which is the normal muscle tissue glycogen content (measured as % wet tissue weight), of a subject that does not have Pompe disease.

[0434] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount of GAA to exhibit an improvement in the therapeutic index of 3- to 5-fold.

[0435] In some embodiments, the dose of the rAAV vector expressing GAA is a therapeutically effective amount to result in the subject having clinically stable levels of hGAA at 10-weeks, or at least 20 weeks, or 30 weeks post AAV administration.

[0436] In an embodiment, as used herein, without limitation, the term “effective amount” is synonymous with “therapeutically effective amount”, “effective dose”, or “therapeutically effective dose.” In an embodiment, the effectiveness of a therapeutic compound disclosed herein to treat Pompe Disease can be determined, without limitation, by observing an improvement in an individual based upon one or more clinical symptoms, and / or physiological indicators associated with Pompe Disease. In an embodiment, an improvement in the symptoms associated with Pompe Disease can be indicated by a reduced need for a concurrent therapy.

[0437] In some embodiments, exemplary doses for achieving therapeutic effects of a rAAV vector expressing hGAA as disclosed herein is within the range of l.OE9vg / kg to 5.0E1’vg / kg. In some embodiments, the dose administered to a subject is at least about l.OE9vg / kg, at least about l.OE10vg / kg, at least about 1.0E11 vg / kg, at least about 1.0E12vg / kg, about LIE 12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg, about l .OE 13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.3E13 vg / kg, about1.4E13 vg / kg, about 1.5E13 vg / kg, about 1.6E13 vg / kg, about 1.7E13 vg / kg, about 1.8E13 vg / kg, about1.9E13 vg / kg, about 2.0E13 vg / kg, about 3.0E13 vg / kg, about 4.0E13 vg / kg, about 5.0E13 vg / kg, about6.0E13 vg / kg, about 7E13 vg / kg, about 8E13 vg / kg, about 9E13 vg / kg, or about 10E14 vg / kg. In some embodiments the rAAV administration is accompanied with immunomodulators, e.g., prednisone, methotrexate or, a combination thereof. In some embodiments the rAAV of the invention is packaged within AAV XL 32 or AAV XL 32.1 capsid.

[0438] In preferred embodiments, exemplary doses for achieving therapeutic effects according to the methods as disclosed herein are titers of at between 1.2E12 and 4.0E12 vg / kg, for example, least about 1.0E12 vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg, about 1.3E12 vg / kg, about 1.4E12 vg / kg, about1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about2.0E12 vg / kg, about 2.1E12 vg / kg, about 2.2E12 vg / kg, about 2.3E12 vg / kg, about 2.4E12 vg / kg, about2.5E12 vg / kg, about 2.6E12 vg / kg, about 2.7E12 vg / kg, about 2.8E12 vg / kg, about 2.9E12 vg / kg, about3.0E12 vg / kg, about 3.1E12 vg / kg, about 3.2E12 vg / kg, about 3.3E12 vg / kg, about 3.4E12 vg / kg, about3.5E12 vg / kg, about 3.6E12 vg / kg, about 3.7E12 vg / kg, about 3.8E12 vg / kg, about 3.9E12 vg / kg, about4.0E12 vg / kg.

[0439] In preferred embodiments, exemplary doses for achieving therapeutic effects according to the methods as disclosed herein are titers of at between 1.0E11 vg / kg and 5.0E13 vg / kg, for example, l.OEl lvg / kg, l.lEl lvg / kg, 1.2El lvg / kg, 1.3El lvg / kg, 1.4El lvg / kg, 1.5El lvg / kg, 1.6El lvg / kg, 1.7El lvg / kg, 1.8El lvg / kg, 1.9El lvg / kg, about 1.0E12vg / kg, about 1.1E12 vg / kg, about 1.2E12 vg / kg,I l labout 1.3E12 vg / kg, about 1.4E12 vg / kg, about 1.5E12 vg / kg, about 1.6E12 vg / kg, about 1.7E12 vg / kg, about 1.8E12 vg / kg, about 1.9E12 vg / kg, about 2.0E12 vg / kg, about 3.0E12 vg / kg, about 4.0E12 vg / kg, about 5.0E12 vg / kg, about 6.0E12 vg / kg, about 7.0E12 vg / kg, about 8.0E12 vg / kg, about 9.0E12 vg / kg, about LOEB vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.2E13 vg / kg, about 1.3E13 vg / kg, about 1.4E13 vg / kg, about 1.5E13 vg / kg, about 1.6E13 vg / kg, about 1.7E13 vg / kg, about 1.8E13 vg / kg, about 1.9E13 vg / kg, about 2.0E13 vg / kg, about 3.0E13 vg / kg, about 4.0E13 vg / kg, about 5.0E13 vg / kg.

[0440] In some embodiments, a rAAV vector expressing hGAA as disclosed herein useful for the methods to treat Pompe Diseases, exemplary doses for achieving therapeutic effects are titers of at least about 1.0E12 to 4.0E12 vg / kg, or about 1.2E12 to 3.0E12 vg / kg, or about 1.2E12 to 2.5E12 vg / kg, or about 2.5E12 to 4.0E12 vg / kg.

[0441] In some embodiments, the dosage may be modified by a person of ordinary skill in the art, e.g., the dose administered can be lower than 1.0E 12 vg / kg, or lower than about 5.0E 11 vg / kg where a stronger promoter than the LSP of SEQ ID NO: 256 is operatively linked to the nucleic acid encoding GAA. In contrast, in alternative embodiments, the dosage may be modified by a person of ordinary skill in the art, e.g., the dose of the rAAV vector administered can be higher than about 1.6E12 vg / kg, or higher than about 5.0E12 vg / kg when a weaker liver-specific promoter than the LSP of SEQ ID NO: 256 used in the AAV8-LSPhGAA vector is operatively linked to the nucleic acid encoding GAA. Exemplary doses for achieving therapeutic effects are titers of at least about LOE5, LOE6LOE7, LOE8, LOE9, LOE10, LOE”, LOE12vg / kg, optionally about LOE10to about LOE12transducing units (vg / kg), and optionally does not exceed about 4.0E12vg / kg or optionally is about 3.0E12transducing units (vg / kg).

[0442] In one embodiment, no percentage of the administered dose of rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.

[0443] In one embodiment, less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%,32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%,50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%,86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the administered dose of rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.

[0444] In one embodiment, less than LOE9vg / kg to 5.0E1’vg / kg of the administered rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.

[0445] In one embodiment, less than LOE9vg / kg, LOE10vg / kg, 1.0E11 vg / kg, 1.0E12vg / kg, 1. IE 12 vg / kg, 1.2E12 vg / kg, 1.3E12 vg / kg, 1.4E12 vg / kg, 1.5E12 vg / kg, 1.6E12 vg / kg, 1.7E12 vg / kg, 1.8E12 vg / kg, 1.9E12 vg / kg, 2.0E12 vg / kg, 3.0E12 vg / kg, 4.0E12 vg / kg, 5.0E12 vg / kg, 6.0E12 vg / kg, 7.0E12vg / kg, 8.0E12 vg / kg, 9.0E12 vg / kg, 1.0E13 vg / kg, 1.2E13 vg / kg, 1.2E13 vg / kg, 1.2E13 vg / kg, 1.3E13 vg / kg, 1.4E13 vg / kg, 1.5E13 vg / kg, 1.6E13 vg / kg, 1.7E13 vg / kg, 1.8E13 vg / kg, 1.9E13 vg / kg, 2.0E13 vg / kg, 3.0E13 vg / kg, 4.0E13 vg / kg, or 5.0E13 vg / kg of the administered rAAV vector expressing hGAA as disclosed herein is retained in the liver following administration, e.g., at least 1, 2, 3, 4 weeks or more following administration.

[0446] In a further embodiment, administration of rAAV vector or rAAV genome according to the methods as disclosed herein to treat a subject with Pompe disease can result in production of a GAA protein with a circulatory half-life of 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 1 week, 2 weeks, 3 weeks, 4 weeks, one month, two months, three months, four months or more.

[0447] In some embodiments, the methods for treatment of Pompe as disclosed herein relate to a single dose of a rAAV expressing hGAA is used to treat a subject in a single administration. However, in some embodiments, the dose of rAAV to be administered can be given to the subject in multiple administrations, e.g., a dose of rAAV can be divided into sub-doses and administered in multiple administrations.

[0448] In some embodiments, it is envisioned that the methods for treatment of Pompe as disclosed herein can comprise multiple administrations of a single dose of a rAAV expressing hGAA, that is, the subject can be treated with a booster administration (i.e., a second, third, fourth, etc.) of a rAAV expressing hGAA after a defined period of time after the initial or first administration. The dose of a booster administration (i.e., 2nd, 3rd, 4th, or 5thetc.) can be the same dose (amount) of rAAV-hGAA administered in the first administration, or can be a higher dose, or a lower dose, depending on the factors above, including, but not limited to, a therapeutically effective dose to achieve any one or more of (i) serum GAA levels indicating steady state of GAA expression, (ii) reduced glycogen levels and / or, maintained glycogen levels within normal range in the muscle, and (iii) one or more Pompe symptoms, including muscle function and / or pulmonary function within clinically stable levels. As disclosed herein, a steady state of GAA expression by the rAAV as disclosed herein is a serum level of GAA at a pharmacological activity range from 165 to≤ 2260 nmol / ml / hr, or from 189 to ≤ 2,260 nmol / ml / hr, or 160 to ≤4000 nmol / ml / hr (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr. Stability of one or more symptoms of Pompe disease can be determined by the clinical stability parameters as disclosed herein, and includes a steady state in the 6MWT (6-minute walk test) and / or FVC (Forced vital capacity) in two consecutive assessments no less than 3-months apart as disclosed herein. In some embodiments, a clinical stable level of motor function as determined by the 6MWT is ≤ 12% decline, or less than a 43 -meter decrease from baseline in two consecutive assessments no less than 3-months apart. In some embodiments, a clinical stable level of pulmonary function as determined by the FVC % predicted in an upright position is ≤ 15% decrease from baseline in two consecutive assessments no less than 3-months apart.

[0449] In an embodiment, the time period of between administration of a first dose, and a subsequent dose (i.e., a booster dose) of a rAAV vector according to the methods for treatment of Pompe as disclosed herein is selected from any of the following: about 4 months, about 6 months, about 7 months, about 8 months, about 9 months, about 12 months, about 18 months, about 24 months, or about 3 years, about 4 years, about 5 years, or more than 5 years

[0450] In another embodiment, administration of a rAAV vector or rAAV genome as disclosed herein for the treatment of Pompe Disease results in an increase in weight by, e.g., at least 0.5 pounds, at least 1 pound, at least 1.5 pounds, at least 2 pounds, at least 2.5 pounds, at least 3 pounds, at least 3.5 pounds, at least 4 pounds, at least 4.5 pounds, at least 5 pounds, at least 5.5 pounds, at least 6 pounds, at least 6.5 pounds, at least 7 pounds, at least 7.5 pounds, at least 8 pounds, at least 8.5 pounds, at least 9 pounds, at least 9.5 pounds, at least 10 pounds, at least 10.5 pounds, at least 11 pounds, at least 11.5 pounds, at least 12 pounds, at least 12.5 pounds, at least 13 pounds, at least 13.5 pounds, at least 14 pounds, at least 14.5 pounds, at least 15 pounds, at least 20 pounds, at least 25 pounds, at least 30 pounds, at least 50 pounds.

[0451] In another embodiment, an AAV GAA of any serotype, as disclosed herein for the treatment of Pompe Disease results in an increase in weight by, e.g., from 0.5 pounds to 50 pounds, from 0.5 pounds to 30 pounds, from 0.5 pounds to 25 pounds, from 0.5 pounds to 20 pounds, from 0.5 pounds to 15 pounds, from 0.5 pounds to ten pounds, from 0.5 pounds to 7.5 pounds, from 0.5 pounds to 5 pounds, from 1 pound to 15 pounds, from 1 pound to 10 pounds, from 1 pound to 7.5 pounds, form 1 pound to 5 pounds, from 2 pounds to ten pounds, from 2 pounds to 7.5 pounds.B. Withdrawal of long-term ERT

[0452] Treatment of Pompe disease is normally by administration of long-term enzyme replacement therapy (ERT) with recombinant human acid a-glucosidase (rhGAA) and has previously reported to prolong survival of both LOPD and IOPD patients through improvement in pulmonary and muscle function. However, Schoser et al, report that after a period of stabilization, both these parameters continue to decline over time (see Schoser et al., 2017 Neurol, 264: 621-30). Additionally, ERT with recombinant GAA protein has numerous disadvantages, including but not limited to, short-half life of the administered recombinant GAA in the blood, lack of efficient skeletal muscle uptake, potential for high titer antibody response and even some patients failing to respond to ERT, and rigorous administration of a recombinant GAA infusion every 2 weeks, that can take between 5-8 hours.

[0453] Moreover, while disease progression is slowed compared with untreated subjects, the benefits of ERT may not be long-lasting, and many patients die or remain weak despite treatment compliance (Tamopolsky et al. 2016 Can J Neurol Sci, 43: 472-85).

[0454] The waning efficacy in subjects receiving recombinant GAA protein ERT is partially explained by an immune response to ERT where high, sustained anti -GAA antibody titers (HSAT) are formed. Subjects with HSAT demonstrated greatly increased mortality, in comparison with patients who formed no or only low titer antibodies (Banugaria et al. 2011). Furthermore, the ability to prevent antibodyformation in subjects at risk for HSAT with immunosuppression, which significantly prolonged survival, confirmed the clinical relevance of HSAT (Mendelsohn et al. 2009; Banugaria et al. 2013; Kazi et al. 2017).

[0455] Subjects with Pompe’s disease are considered as cross-reactive immunologic material (CRIM) positive if they have residual GAA enzyme activity and CRIM negative if no residual GAA activity is detected. Based on pooled clinical studies data, 28% of Pompe’s disease cases are infantile-onset, of which about 85% are classic infantile -onset and three quarters of those are CRIM positive (Kemper, Comeau, and Green 2013). Determination of CRIM status in newly diagnosed IOPD patients is important since it allows for the institution of preventive immunomodulatory measures before beginning ERT, thus offsetting the worst damaging effects of HSAT. CRIM-negative Pompe disease subjects produced HSAT and demonstrated markedly reduced efficacy from ERT with rhGAA (Amalfitano et al. 2001). In the first pilot study of ERT in Pompe disease using Chinese hamster ovary cell-derived rhGAA, the two subjects who were CRIM-negative produced higher titers of anti -GAA antibodies than the third subject who was CRIM-positive. This corresponded with a markedly reduced efficacy of ERT in the CRIM-negative subjects. The relevance of antibody formation to efficacy of therapy in Pompe disease has been emphasized by the poor response of CRIM-negative subjects to ERT, which correlated with the onset of HSAT (Kishnani et al. 2010).

[0456] While no LOPD subjects are CRIM negative, some mount high antibody responses to rhGAA capable of interfering with optimal efficacy of ERT (Patel et al. 2012; de Vries et al. 2017; "LUMIZYME Prescribing Information" 2014). In addition, all Pompe subjects mount some level of anti -GAA antibody response with unknown effects on ERT efficacy.

[0457] In some embodiments, the rAAV vectors expressing a GAA polypeptide as disclosed herein can be used in methods to treat subjects with Pompe disease, and comprises administering a AAV expressing hGAA as disclosed herein that enables the subject to have an extended period of cessation of the administration of long-term ERT. In particular, rAAV vectors expressing a GAA polypeptide as disclosed herein can be administered to a subject with Pompe disease that enables them to have the ability to reduce, or eliminate the clinical need for long-term hGAA ERT administration for an extended period of time.

[0458] Accordingly, another aspect of the technology disclosed herein relates to a method to treat Pompe Disease by administrating to the subject with Pompe disease a composition comprising a rAAV vector expressing a GAA polypeptide as disclosed herein, where in some embodiments, the methods enable subjects with Pompe disease to withdraw from, or stop long-term administration of recombinant human GAA (rhGAA) ERT, which is normally administered on a weekly or every-other week regimen. In some embodiments, the methods disclosed herein enable a subject with Pompe disease to take breaks from the normal ERT regimen for extended period of time (e.g., extended periods of ERT cessation) if the subject is administered a specific dose of AAV vector expressing a GAA polypeptide as disclosed herein. In some embodiments, withdrawal of the administration of long-term ERT begins at about the time ofadministration of the AAV vector to the subject (e.g., the day before, the day of, or the day after), or in some embodiments, withdrawal of the administration of long-term ERT can occur at about 24 weeks, or anywhere within about 24 weeks to about 26 weeks after administration of the AAV vector.

[0459] As disclosed herein, “long-term ERT” refer to the standard-of-care (SOC) treatment for a subject with Pompe disease, including IOPD and LOPD, and is normally a regimen of intravenous administration of recombinant human alglucosidase alfa protein (rhGAA) to the subject on a regular and frequent basis, e.g., every week or every 2 weeks, without any breaks in the regimen, and where the administered rhGAA protein provides an exogenous source of GAA. MYOZYME® (alglucosidase alfa) which was first US approved product (2006) for the treatment of Pompe disease and LUMIZYME® (alglucosidase alfa) which was approved in 2010 are exemplary current standard-of-care (SOC) treatments for infantile-onset and late-onset Pompe patients. The normal long-term ERT administration regimen is intravenously administration of Alglucosidase alfa every 2 weeks as an infusion at a dose of 20 mg / Kg (LUMIZYME Prescribing Information 2014).

[0460] As disclosed herein, in some embodiments, the methods as disclosed herein by administering a AAV expressing hGAA as disclosed herein enable the withdrawal or cessation of administration of long- term ERT for an extended period of time. In some embodiments, the extended period of time is at least about 3 -months, or at least about 6-months, or at least about 1 year, or longer than 1 year.

[0461] As disclosed herein, “extended period” of time, as referred to in reference to time period that administration of long-term ERT is stopped, refers to a time period that is longer than 1 month, and in some embodiments is a time period longer than if up to 5 administrations of ERT are missed.

[0462] Accordingly, in some embodiments, the methods to treat a subject with Pompe Disease with a AAV expressing hGAA as disclosed herein comprises administering to the subject a pharmaceutical composition comprising a AAV expressing GAA and where the subject is not administered long-term GAA enzyme replacement therapy (ERT) for an extended period of time. In some embodiments, the cessation or withdrawal of administration of long-term ERT occurs anywhere between 1-2 days of administration and at least 24 weeks after the administration of the AAV-GAA vector. That is, in some embodiments, the subject being treated can stop the administration of ERT on the day of, or the day before or after administration of AAV-GAA. In some embodiments, the subject being treated according to the methods as disclosed herein can stop ERT after about 1 week, or about 2 weeks, or about 3 weeks, or about 1 month, or about 2 months, or about 3 months, or about 4 months, or about 5 months, or about 6 months after the administration of the AAV-GAA.

[0463] The exact timeframe for stopping ERT, or for ERT cessation, by each subject according to the methods as disclosed herein can be determined by an ordinary skilled practitioner, but without wishing to be limited by theory, encompassed herein is a method to treat a subject with Pompe disease by administering a AAV expressing hGAA as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is near or about a serum level of within a pharmacological activity range of at least 165 nmol / ml / hr or, of at least 189 nmol / ml / hr, for example,between 189 to ≤ 2,260, or 160 to ≤4000 (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr. In some embodiments, encompassed herein is a method where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is within 50%, or within 60%, or within 70% or within 80% of a serum level of within a pharmacological activity range of between 189 nmol / mL / hr. In some embodiments, encompassed herein is a method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from expression by the AAV-hGAA is within 50%, or within 60%, or within 70% or within 80% of a serum level of within a pharmacological activity range of between 165 to about 2000, or 160 to ≤4000 (see e.g., Fig. 2), or 160 to ≤20800 (see e.g., Fig. 7A) nmol / mL / hr.

[0464] In some embodiments, encompassed herein is a method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where ERT is stopped at time point that the serum GAA levels achieved from a normal ERT regimen are replaced with a GAA serum level achieved from expression by the AAV-hGAA. For example, as the serum GAA levels due to the recombinant hGAA from the last ERT administration declines, there is a concurrent increase in serum GAA levels achieved from expression by the AAV-hGAA, so that ERT withdrawal or cessation does not result in a decline in clinical stability of one or more symptoms of Pompe disease in the subject, as measured by the 6MWT or FVC according to the methods as disclosed herein. For illustration purposes only, in some embodiments, ERT withdrawal or cessation occurs when the administered AAV-hGAA results in the expressed GAA to achieve a serum GAA level for clinical stability of one or more symptoms of Pompe disease in the subject, for example, a clinical stable level of motor function as determined by the 6MWT is ≤ 12% decline, or less than a 43-meter decrease from baseline in two consecutive assessments no less than 3 -months apart, or a clinical stable level of pulmonary function as determined by the FVC % in an upright position is ≤ 15% decrease from baseline in two consecutive assessments no less than 3-months apart, therefore making superfluous the recombinant hGAA from the last ERT administration.

[0465] In some embodiments, the method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enables long term cessation of ERT for a period of about 1 year, or about 15 months, or about 18 months, or about 24 months, or about 30 months or more than 30 months while maintaining clinical stable with one or more symptoms of Pompe disease, as measured by 6MWT and / or % FVC, as disclosed herein.

[0466] Accordingly, the rAAV vectors encoding a GAA polypeptide as disclosed herein and the methods as disclosed herein provide significant advantages to subjects with Pompe disease, including but not limited to reducing or eliminating the rigorous and arduous weekly, or every-other week infusions of long-term rhGAA ERT treatment, which are significantly time-consuming and geographically limiting, and hinders a patient with Pompe disease from travelling for prolonged periods from areas where their ERT infusions are administered. Additionally, as disclosed herein, the absence of ERT administration also reduces any side effects due to anti-rhGAA antibodies against the ERT, and also circumvents the need foradministration of immune suppressants normally co-administered with the ERT. As such, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein leads to greater flexibility in Pompe treatment and an improvement in quality of life and lifestyle of subjects with Pompe disease.C. Administration of Complementary ERT

[0467] In some embodiments, the method to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enables a subject to have breaks or “holidays” from the normal regimen of administration long-term ERT. That is, according to the methods as disclosed herein, a subject who is administered an AAV vector expressing GAA as disclosed herein can take extended periods of time in the absence of administration of long-term ERT. Moreover, in some embodiments, a subject administered a AAV vector expressing GAA as disclosed herein, can, after an initial period of withdrawal of the administration of long-term ERT for an extended period of time, be administered complementary ERT, where the complementary ERT is administered after about 6-months, or about 1 year, or longer than a year of cessation of the long-term ERT. Accordingly, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein enable flexibility in normal long-term ERT administration regimens, allowing both extended breaks or absence of administration of long-term ERT which does not result in a clinical decline - that is, a subject remains clinically stable despite not having ongoing long-term ERT administration for an extended period of time.

[0468] In some embodiments, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompass re-administration of ERT (herein referred to as “complementary ERT”) after an extended period of time of cessation of ERT administration, and enable flexibility in normal ERT regimen, as the continued production of GAA expressed by the AAV permits include ERT flexibility. In some embodiments, the complementary ERT is pulse administration of ERT, as disclosed herein. In some embodiments, the complementary ERT is at less frequent intervals, or at a lower dose, or at irregular doses, or at irregular intervals as compared to the prior administration of long- term ERT.

[0469] In some embodiments, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompass recommencement of ERT (herein referred to as “complementary ERT”) after an extended period of at least 6 months to about 1 year of absence of long- term ERT administration. In some embodiments, complementary ERT can be for a short-period of time, and can be followed by a second extended period of ERT administration cessation. In some embodiments, complementary ERT can be for a period of anywhere between 3 months to about 2 years, for example, about 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, lOmonths, 11 months, or for about 1 year.

[0470] In some embodiments, the methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein encompasses administering a rAAV expressing GAA according toas subject with Pompe, wherein administration of long-term ERT continues after administration of the recombinant AAV. However, the ERT is at a lower dose and / or frequency than before the administration of the recombinant AAV vector. For example, after administration of the AAV vector, long-term ERT can be administered every 3 weeks, once a month, bimonthly, once every 3 months, every 4 months, every 5 months, every 6 months for at least 24 weeks after administration of the AAV-GAA. Dosage of the long- term ERT can be reduced in one embodiment. In one method, a pulse administration regimen of long- term ERT after administration of the AAV vector can be used so that an irregular dosing schedule and / or amount can be used. As discussed herein, in some embodiments, administration of long-term ERT can be withdrawn at 24 weeks, or earlier as disclosed herein.

[0471] In some embodiments, due to continued expression of GAA by the administered AAV vector, the methods disclosed herein enable flexibility of administration of both long-term ERT or complementary ERT, such that if a subject plans to miss, or inadvertently or accidently misses one or more ERT administrations of a long-term ERT or complementary ERT regimen, the subject will maintain clinical stability. Currently, if ERT is missed, a much larger amount of ERT is needed to return to the same clinical level.

[0472] In some embodiments, the complementary ERT is at less frequent administration intervals, or at a lower dose, or at irregular doses, or at irregular administration intervals as compared to the prior administration of long-term ERT. For example, in some embodiments, the dose of rhGAA administered in a complementary ERT is less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% of the normal dose of the rhGAA administered in a long-term ERT regimen.

[0473] In some embodiments, the complementary ERT is administered as pulse administration. In alternative embodiments, as a subject administered the rAAV vector compositions as disclosed herein can take breaks or interruptions from the regular dosing regimen of the long-term ERT administration or complementary ERT, where the long-term ERT or complementary ERT are administered by pulse administration. For example, in some embodiments, the administration of the long-term ERT or complementary ERT can be administered by pulsed administration. In certain embodiments, a subject administered the compositions can have pulsed administration of the long-term ERT or complementary ERT.

[0474] In certain embodiments, pulsed administration of the complementary ERT is suitable provided the subject has been administered the AAV vector composition as disclosed herein at a sufficient dose for continuous expression of GAA to maintain clinical stability and / or maintain a serum GAA level at or above 189 nmol / hr (e.g., during the entire duration of the ERT break or “ERT holiday” where the regularly scheduled ERT is not administered). In certain embodiments, the methods disclosed herein allows a subject to undergo pulsed administration of complementary ERT for the lifetime of the subject.

[0475] In some embodiments, the regimen of administration of the complementary ERT can have intermittent breaks, where the administration of ERT is halted (e.g., the duration of the break or “ERT holiday” where the regimen of administration of ERT is halted).

[0476] In some embodiments, the methods encompass administration of complementary ERT by pulsed administration, where the pulsed administration of complementary ERT occurs least once a month, at least every other month, or at least every 6 months, or at least every year, or every other year. As the methods disclosed herein comprise administering a AAV vector at a sufficient dose for continuous expression of GAA in the subject and to maintain a serum GAA level at or above 189 n mol / hr*, if complementary ERT is administered, pulsed administration can substantially reduce the amount of ERT administered to the patient per dose or per total treatment regimen with an increased effectiveness, and allows for increased flexibility in a ERT administration regimen. This represents a significant saving in time, effort and expense and, more importantly, improved quality of life for Pompe patients, as well as a lower ERT dose which can lessens any side effects, including anti -GAA antibodies to the administered rhGAA protein.

[0477] In some embodiments, administration of complementary ERT is a pulsed administration. In certain embodiments, a pulsed administration comprises administering complementary ERT for about 8 weeks, followed by not administering complementary ERT for about 4 weeks. In some embodiments, the pulsed administration comprises administering complementary ERT for about 6 weeks (i.e., 6 weekly infusions, or 3 infusions every 2 weeks), followed by not administering a complementary ERT for about 2 weeks. In certain embodiments, the pulsed administration comprises administering complementary ERT for about 4 weeks, followed by not administering complementary ERT for about 2 weeks. In some embodiments, the pulsed administration comprises administering complementary ERT for about 2 weeks, followed by not administering complementary ERT for about 2 weeks.D. Absence of long-term immune suppression

[0478] In another aspect, the technology relates to methods to treat Pompe disease by administering a AAV expressing a hGAA polypeptide as disclosed herein, where the administration of a composition comprising an AAV-GAA vector is administered to the subject without ongoing immune suppression. That is, in some embodiments, immune suppression is not administered to the subject long term.

[0479] In some embodiments, an immune suppressant or immune modulator is administered to the subject intermittently, or for a transient period, e.g., as an immune prophylaxis to the subject to prevent or reduce any immune response to the administered AAV vector, therefore allowing, if necessary, a subsequent or booster administration of the AAV vector expressing GAA according to the methods as disclosed herein.

[0480] In some embodiments, an immune modulator is administered for an initial period at, or around the time the AAV vector expressing GAA as disclosed herein is administered to the subject. For example, an immune modulator is administered starting at about 24hrs before AAV vector expressing GAA isadministered to the subject. In some embodiments, an immune modulator is administered starting at about 24hrs before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or for longer than 1 week after administration of the AAV vector expressing GAA. In some embodiments, an immune modulator is administered starting at, or about 24hrs before AAV administration and is administered for no more than 1 day, or 2 days, 3 days, or 4 days, or 5 days, or 6 days, or for 1 week, or for 2 weeks, or for 3 weeks or for 1 month after administration of the AAV vector expressing GAA.

[0481] In some embodiments, an immune modulator is administered to the subject at tapering lower doses, e.g., at a first dose for a first period of time, at a second lower dose for a second period of time, and third dose that is lower than the second dose - for a third period of time, and so forth until no immune response to the AAV or GAA is produced. For example, in some embodiments, the first dose of an immune modulator is started at, or about 24hrs before AAV administration and is administered for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week, or about 2 weeks, or about 3 weeks, or about 4 weeks, after which the immune modulator is reduced to a third dose (which is lower than the second dose) for a third period of time (e.g., for at least 1 day, or at least 2 days, or at least 3 days or at least 4 days, or at least 5 days, or at least 6 days, or for about 1 week).

[0482] For exemplary purposes only, in some embodiments, the methods to treat Pompe Disease as disclosed herein comprise administering prednisone as an immune suppressant, i.e., immune prophylaxis, at a first dose of 60 milligrams (given orally) starting 24 hours prior to AAV vector administration. In some embodiments, prednisone is continued at 60 mg / day po through the completion of week four after vector administration, after which, at the beginning of week 5 the prednisone dose is tapered to a second dose level of 55 mg / day po and maintained for 7 days. In some embodiments, at the Beginning of week 6 the dose is tapered to a third dose level of 50 mg / day po and maintained for 7 days etc., so that the dose of the immune suppressant (i.e., prednisone) is tapered on a weekly basis by 5 mg / day, after an initial immune suppressant dose for 4 weeks.

[0483] The use of prednisone is exemplified herein as an immune suppressant for immune prophylaxis according to the methods as disclosed herein. However, it is envisioned that prednisone can be readily substituted with a different immune modulator and administration regimen known by a person of ordinary skill in the art.

[0484] In some embodiments, normal immune prophylaxis for preventing immune reactivity to the expressed GAA is stopped, or withdrawn on day 1, or shortly before or after administration of the rAAV expressing GAA according to the methods as disclosed herein.

[0485] In some embodiments, the methods described herein further comprise periodically administering an immune suppressant in a dosage and a frequency to reduce or prevent an immune response to the administered rAAV vector and / or an expressed polypeptide, to thereby prevent inhibition of the therapeutic benefit of the administered rAAV vector by the subject’s immune system. Such an amount isreferred to herein as an “effective amount”. In some embodiments, the frequency of the immune suppressant administration is initially daily, every other day, thrice weekly, twice weekly, once weekly, once every 2 weeks, once every 3 weeks, monthly, or longer in between doses. In some embodiments, the frequency of the immune suppressant administration is initially daily. In some embodiments, the immune suppressant administration begins prior to administering the rAAV vector or pharmaceutical composition. In some embodiments, the immune suppressant administration begins at the same time as administering the rAAV vector or pharmaceutical composition. In some embodiments, the immune suppressant is administered in an amount expected to reduce or prevent immune reactivity to the administered rAAV and / or the GAA polypeptide expressed by the rAAV vector.

[0486] In some embodiments, the rAAV and / or the expressed polypeptide may be minimally to non- immunogenic in the subject, or the subject may develop immunotolerance. In such instances, the immune suppressant may be administered merely as a precaution, and / or tapered later. In such instances the amount administered is that which would be effective to reduce an immune response to a more immunogenic rAAV vector or in a subject which had not developed a tolerance.

[0487] In some embodiments, the methods described herein further comprise decreasing the dosage of the immune suppressant. In some embodiments, the methods described herein further comprise decreasing the frequency of the administration. In some embodiments, the methods described herein further comprise decreasing both the dosage and the frequency of the immune suppressant administration. In some embodiments, the methods described herein further comprise ceasing the administration of the immune suppressant (e.g., following a tapering to a lower dosage and / or frequency).

[0488] Immune suppressants such as prednisone are administered on a daily basis, although it is envisioned that prednisone, or another immune suppressant (e.g., the examples described herein) may be administered at a lower periodic frequency initially, or tapered to a lower frequency following an initial higher frequency regimen. In some embodiments, the dosage is administered on a daily basis, and the amount of the daily dose is decreased, while the frequency of administration remains the same. In some embodiments, the dosage is decreased overtime until the administration is ultimately discontinued.

[0489] In some embodiments, the immune suppressant is begun 24 hours prior to the administering the rAAV vector or pharmaceutical composition. In some embodiments, the initial dosage of the immune suppressant is 60 mg / day. In some embodiments, the initial dosage of the immune suppressant is 1 mg / kg.

[0490] In some embodiments, decreasing the dosage and / or frequency of the immune suppressant occurs on the same day, a day after, any time between day 1 and 26 weeks, or later, after administering the rAAV vector or pharmaceutical composition. In some embodiments, the dosage and / or frequency of the immune suppressant is decreased at about 20 weeks after, at about 15 weeks after, at about 10 weeks after, at about 5 weeks after, at about 5 days after, or at about 1 day after the administering of the rAAV vector.

[0491] In some embodiments, ceasing the administration of the immune suppressant occurs on the same day, a day after, any time between day 1 and 26 weeks, or later, after administering the rAAV vector. In some embodiments, the administration of the immune suppressant is decreased at about 20 weeks after, atabout 15 weeks after, at about 10 weeks after, at about 5 weeks after, at about 5 days after, or at about 1 day after the administering of the rAAV vector.

[0492] In some embodiments, the dosage of the immune suppressant is decreased to ≤ 60 mg / dose, ≤ 55 mg / dose, ≤ 50 mg / dose, ≤ 45 mg / dose, ≤ 40 mg / dose, ≤ 35 mg / dose, ≤ 30 mg / dose, ≤ 25 mg / dose, ≤ 20 mg / dose, ≤ 15 mg / dose, ≤ 10 mg / dose, or ≤ 5 mg / dose, or administration is ceased.

[0493] In some embodiments, the dosage of the immune suppressant is decreased to less than 60 mg / dose, less than 55 mg / dose, less than 50 mg / dose, less than 45 mg / dose, less than 40 mg / dose, less than 35 mg / dose, less than 30 mg / dose, less than 25 mg / dose, less than 20 mg / dose, less than 15 mg / dose, less than 10 mg / dose, or less than 5 mg / dose, (e.g., when administering daily) or administration is ceased.

[0494] In some embodiments, the dosage of the immune suppressant is reduced by 5 mg / day every 7 days until cessation, following an initial 2 week administration period.

[0495] In some embodiments, the initial dosage of the immune suppressant is decreased by about 5 mg / dose or by about 10 mg / dose over multiple intervals of time (e.g., 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, and / or 14 days). In some embodiments, the initial dosage of the immune suppressant is about 70 mg / dose, about 65 mg / dose, about 60 mg / dose, about 55 mg / dose, about 50 mg / dose, about 45 mg / dose, or about 40 mg / dose.

[0496] In some embodiments, the dosage of the immune suppressant is decreased at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administering of the rAAV vector or pharmaceutical composition. In some embodiments, the administering of the immune suppressant is ceased at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administering of the rAAV vector or pharmaceutical composition.

[0497] In some embodiments, the frequency of the administering of the immune su...

Claims

CLAIMS1. A recombinant adeno-associated vims (rAAV) vector, comprising in its genome:(a) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; and(b) located between the 5’ ITR and 3’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising:(i) a nucleotide sequence encoding a BM40 signal peptide; and(ii) a nucleotide sequence encoding an alpha-glucosidase (GAA) polypeptide; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

2. The rAAV vector of claim 1, wherein the GAA polypeptide comprises SEQ ID NO: 1, or an amino acid sequence at least 80%, at least 85%, or at least 90% identical thereto.

3. The rAAV vector of claim 1, wherein the GAA polypeptide comprises SEQ ID NO: 312, or an amino acid sequence at least 80%, at least 85%, or at least 90% identical thereto.

4. The rAAV vector of any one of claims 1 - 3, wherein the GAA polypeptide has an N-terminus that corresponds to an N-terminal truncation of a full-length native GAA protein.

5. The rAAV vector of claim 1 or 4, wherein the GAA polypeptide comprises:(a) residues 28-952 of SEQ ID NO: 1;(b) residues 57-952 of SEQ ID NO: 1;(c) SEQ ID NO: 1 lacking 1 or more amino acid from its N-terminus;(d) SEQ ID NO: 1 lacking 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more amino acids from its N-terminus;(e) SEQ ID NO: 1 lacking 56 or more amino acids from its N-terminus;(f) a polypeptide from Table 1;(g) an amino acid sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or(h) a functional fragment of (a), (b), (c), (d), (e), (f), or (g).

6. The rAAV vector of claim 1 or 4, wherein the GAA polypeptide comprises:(a) residues 28-952 of SEQ ID NO: 312;(b) residues 57-952 of SEQ ID NO: 312;(c) SEQ ID NO: 312 lacking 1 or more amino acid from its N-terminus;(d) SEQ ID NO: 312 lacking 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 or more amino acids from its N-terminus;(e) SEQ ID NO: 312 lacking 56 or more amino acids from its N-terminus;(f) a polypeptide from Table 1A;(g) an amino acid sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or(h) a functional fragment of (a), (b), (c), (d), (e), (f), or (g).

7. The rAAV vector of any one of claims 1-6, wherein the GAA polypeptide lacks an endogenous GAA signal peptide comprising SEQ ID NO: 269.

8. The rAAV vector of any one of claims 1-7, wherein the nucleotide sequence encoding the GAA polypeptide comprises:(a) SEQ ID NO: 313;(b) SEQ ID NO: 314;(c) nucleotides 169-2859 of SEQ ID NO: 313;(d) nucleotides 82-2859 of SEQ ID NO: 313;(e) nucleotides 82-2859 of SEQ ID NO: 314;(f) nucleotides 169-2859 of SEQ ID NO: 314;(g) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or(h) a functional fragment of (a), (b), (c), (d), (e), (f) or (g).

9. The rAAV vector of any one of claims 1-8, wherein the nucleotide sequence encoding the GAA polypeptide comprises:(a) SEQ ID NO: 315;(b) SEQ ID NO: 316;(c) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) or (b); or(d) a functional fragment of (a), (b) or (c).

10. The rAAV vector of any one of claims 1-8, wherein the nucleotide sequence encoding the GAA polypeptide comprises: a) SEQ ID NO: 28; b) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to a) or b); or c) a functional fragment of a) or b).

11. The rAAV vector of any one of the above claims, wherein the nucleotide sequence encoding the GAA polypeptide is codon optimized.

12. The rAAV vector of claim 11, wherein the codon optimized nucleotide sequence encoding the GAA polypeptide comprises:(a) one of SEQ ID NOs: 2-18;(b) nucleotides 169-2859 of one of SEQ ID NOs: 2-18;(c) nucleotides 82-2859 of one of SEQ ID NOs: 2-18;(d) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b) or (c); or(e) a functional fragment of (a), (b), (c) or (d).

13. The rAAV vector of any one of claims 1-12, wherein the nucleotide sequence encoding the BM40 signal peptide comprises:(a) SEQ ID NO: 27;(b) a codon optimized version of SEQ ID NO: 27;(c) a nucleotide sequence that is at least 80%, at least 85%, or at least 90% identical to SEQ ID NO: 27; or(d) a fragment of (a), (b), or (c) which encodes a polypeptide with signal peptide activity.

14. The rAAV vector of any one of claims 1-13, wherein the BM40 signal peptide comprises:(a) SEQ ID NO: 33;(b) an amino acid sequence that has at least 80% sequence identity to SEQ ID NO: 33; or(c) a fragment of (a) or (b) with signal peptide activity.

15. The rAAV vector of any one of claims 1-14, wherein the nucleic acid has a nucleotide sequence comprising:(a) SEQ ID NO: 26;(b) a nucleotide sequence having at least 80%, or at least 85%, or at least 90% sequence identity to SEQ ID NO: 26; or(c) a functional fragment of (a) or (b).

16. The rAAV vector of any one of claims 1-15, wherein the nucleic acid is codon-optimized.

17. The rAAV vector of any one of claims 1-16, wherein the genome further comprises at least one un- translated region (UTR).

18. The rAAV vector of claim 17, wherein the at least one UTR is a 5’ UTR and / or a 3’ UTR.

19. The rAAV vector of claim 18, wherein the 5’ UTR comprises a nucleotide sequence of one of SEQ ID NOs: 28, 34, or 35, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

20. The rAAV vector of claim 18 or 19, wherein the 5’ UTR is located:(a) 5 ’ of the nucleic acid; and(b) 3 ’ of the 5 ’ ITR and the liver-specific promoter.

21. The rAAV vector of claim 18 or 19, wherein the 5’ UTR further comprises at least one intron.

22. The rAAV vector of claim 21, wherein the at least one intron comprises SEQ ID NO: 250, 251, 252, 253, and / or 254, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

23. The rAAV vector of claim 18, wherein the 3’ UTR comprises a nucleotide sequence of SEQ ID NO: 29 or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

24. The rAAV vector of any one of claims 18-23, wherein:(a) the 3’ UTR is located:(i) 3 ’ of the nucleic acid; and(ii) 5 ’ of the 3 ’ ITR; and / or (a) the 3’ UTR is located between:(i) the nucleic acid; and(ii) a polyA signal sequence or an RNA pol II terminator sequence.

25. The rAAV vector of any one of claims 1-24, wherein the genome further comprises at least one polyA signal sequence.

26. The rAAV vector of claim 25, wherein the polyA signal sequence comprises a full-length human growth hormone (hGH) polyA signal sequence.

27. The rAAV vector of claim 25 or 26, wherein the polyA signal sequence comprises a nucleotide sequence of SEQ ID NO: 30, 36, 37, or 38, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

28. The rAAV vector of any one of claims 25-27, wherein the polyA signal sequence is located:(a) 3 ’ of the nucleic acid; and(b) 5’ of the 3’ ITR.

29. The rAAV vector of any one of claims 1-28, wherein the genome further comprises a reverse RNA polll terminator sequence.

30. The rAAV vector of claim 29, wherein the reverse RNA polll terminator sequence comprises SEQ ID NO: 39, SEQ ID NO: 255, or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

31. The rAAV vector of claim 29 or 30, wherein the reverse RNA polll terminator sequence is located:(a) 3 ’ of the nucleic acid;(b) 3’ of a polyA signal sequence; and(c) 5’ of the 3’ ITR.

32. The rAAV vector of any one of claims 1-31, wherein the 5’ ITR and / or the 3’ ITR comprises a native ITR or a synthetic ITR (e.g., in Table 4) with an insertion, deletion or substitution.

33. The rAAV vector of any one of claims 1-32, wherein the 5’ ITR comprises a nucleotide sequence of SEQ ID NO: 23 or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

34. The rAAV vector of any one of claims 1-33, wherein the 3’ ITR comprises a nucleotide sequence of SEQ ID NO: 31 or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

35. The rAAV vector of any one of claims 1-34, wherein the 5’ or 3’ ITR is a native ITR or a synthetic ITR (e.g., in Table 4) with one or more CpG removed.

36. The rAAV vector of any one of claims 1-35, wherein the liver specific promoter comprises a nucleotide sequence of one of SEQ ID NOs: 24, 60-78, 84-249, or 256-258, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

37. The rAAV vector of any one of claims 1-36, wherein the liver specific promoter comprises a nucleotide sequence of SEQ ID NO: 24, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

38. The rAAV vector of any one of claims 1-37, wherein the genome comprises a nucleotide sequence of SEQ ID NO: 22, or a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, or a functional fragment thereof.

39. The rAAV vector of any one of claims 1-38, wherein the BM40 signal peptide is directly fused to the GAA polypeptide.

40. The rAAV vector of any one of claims 1-39, wherein the genome comprises, in the 5’ to 3’ direction:(a) the 5’ ITR;(b) the liver-specific promoter;(c) a 5’ UTR;(d) the nucleic acid, comprising, from 5’ to 3’:(i) the nucleotide sequence encoding the BM40 signal peptide;(ii) the nucleotide sequence encoding the alpha-glucosidase (GAA) polypeptide, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1;(e) a polyA signal sequence;(f) a reverse RNA pol II terminator sequence; and(g) the 3’ ITR.

41. The rAAV vector of any one of claims 1-39, wherein the genome comprises, in the 5’ to 3’ direction:(a) the 5’ ITR;(b) the liver-specific promoter;(c) a 5’ UTR, optionally further comprising an intron of SEQ ID NO: 250, 251, 252, 253, or 254;(d) a nucleic acid comprising, from 5 ’ to 3 ’ :(i) the nucleotide sequence encoding the BM40 signal peptide;(ii) the nucleotide sequence encoding the GAA polypeptide, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1;(e) a 3’ UTR;(f) a polyA signal sequence;(g) optionally a reverse RNA pol II terminator sequence; and(h) the 3’ ITR.

42. The rAAV vector of any one of claims 1-41, wherein the GAA polypeptide has an amino acid sequence of residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

43. The rAAV vector of any one of claims 1-42, wherein the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 313 or 314, or is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, and the encoded GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

44. The rAAV vector of any one of claims 1-42, wherein the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 2, or is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto, and the encoded GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

45. The rAAV vector of any of claims 1-42, wherein the nucleotide sequence encoding the GAA polypeptide comprises 169-2859 of SEQ ID NO: 315 or 316 or is at least 80%, or at least 85%, or at least 90% identical thereto and in the encoded GAA polypeptide comprises amino acid residues 57- 952 of SEQ ID NO: 1, or an amino acid sequence at least 80% identical thereto, where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

46. The rAAV vector of any one of claims 1-45, wherein the nucleic acid further comprises a nucleotide sequence encoding an endogenous GAA signal peptide and / or a nucleotide sequence encoding a heterologous signal peptide that is not the BM40 signal peptide.

47. The rAAV vector of claim 46, wherein the endogenous GAA signal peptide comprises an amino acid sequence of residues SEQ ID NO: 269 or a sequence at least 80%, at least 85%, or at least 90% identical thereto.

48. The rAAV vector of claim 46, wherein the heterologous signal peptide comprises one of: a 201 IgG signal peptide (SEQ ID NO: 270), an IL2 wild type signal peptide (SEQ ID NO: 271), a modified IL2 signal peptide (SEQ ID NO: 272), an A2M signal peptide (SEQ ID NO: 273), a PZP signal peptide (SEQ ID NO: 274), an artificial signal peptide (SEQ ID NO: 275), a cathepsin L signal peptide (SEQ ID NO: 276), or a signal peptide with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 270- 276.

49. The rAAV vector of any one of claims 46-48, wherein the nucleotide sequence encoding the endogenous GAA signal peptide and / or the nucleotide sequence encoding the heterologous signal peptide is / are located:(a) 5’ or 3’ of the nucleotide sequence encoding the BM40 signal peptide; and(b) 5’ of the nucleotide sequence encoding the GAA polypeptide.

50. The rAAV vector of any one of claims 1-49, wherein the GAA polypeptide has a C-terminus that corresponds to a C-terminal truncation of a full-length native GAA protein.

51. The rAAV vector of claim 50, wherein the C-terminus ends at a position that corresponds to that of residue 779, 790, 791, 792, 793, or 796 of SEQ ID NO: 1.

52. The rAAV vector of any one of claims 1-51, wherein the GAA polypeptide comprises residues 35- 952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, or 796-952 of SEQ ID NO: 1, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

53. The rAAV vector of any one of claims 1-51, wherein the GAA polypeptide comprises residues 35- 952, 40-952, 50-952, 57-952, 60-952, 68-952, 69-952, 70-952, 72-952, 74-952, 779-952, 790-952, 791-952, 792-952, 793-952, or 796-952 of SEQ ID NO: 312, or an amino acid sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical thereto.

54. The rAAV vector any one of claims 1-53, which is a virus particle.

55. The rAAV vector of any one of claims 1-54, which is manufactured from a plasmid template comprising a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

56. The rAAV vector of any one of claims 1-54, which is manufactured from a covalently-closed circular or linear DNA (neDNA) template, which is not a plasmid, comprising a nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

57. The rAAV vector of any one of claims 1-56, which is a chimeric AAV vector, haploid AAV vector, a hybrid AAV vector or rational polyploid AAV vector.

58. The rAAV vector of any one of claims 1-57, which is a rational haploid vector, a mosaic AAV vector, a chemically modified AAV vector, or a AAV vector with a capsid of any AAV serotype (e.g., a serotype in Table 5).

59. The rAAV vector of any one of claims 1-58, which has a capsid from serotype AAV843 / XL32.1.

60. The rAAV vector of any one of claims 1-58, which has a XL32 capsid.

61. The rAAV vector of any one of claims 1-60, which has a liver specific capsid comprising a capsid protein encoded by: SEQ ID NO: 306 or SEQ ID NO: 307 or a nucleotide sequence at least 80%, at least 85%, or at least 90% identical thereto.

62. The rAAV vector of any one of claims 1-61, which has a liver specific capsid comprising a capsid protein with an amino acid sequence of SEQ ID NO: 308 or SEQ ID NO: 309 or at least 80%, at least 85%, or at least 90% identical thereto that confers liver specificity to the capsid.

63. The rAAV vector of any one of claims 1-62, which increases GAA activity and / or decreases glycogen level in a GAA activity target tissue of a subject following administration of the rAAV vector to the subject.

64. The rAAV vector of claim 63, wherein the administration to the subject is by intramuscular, sub-cutaneous, intraspinal, intracistemal, intrathecal, or intravenous administration.

65. The rAAV vector of claim 63, wherein the GAA activity target tissue is muscle tissue.

66. The rAAV vector of claim 63, wherein the GAA activity target tissue is cardiac muscle tissue and / or skeletal muscle tissue.

67. A nucleic acid construct comprising a nucleotide sequence that encodes a BM40 signal peptide and a nucleotide sequence that encodes a GAA polypeptide, wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

68. The nucleic acid construct of claim 67, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 1 or an amino sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical thereto, optionally where amino acid residue 199 is R (199R), amino acid residue 223 is H (223H), and amino acid residue 780 is I (7801).

69. The nucleic acid construct of claim 67, wherein the GAA polypeptide comprises amino acid residues 57-952 of SEQ ID NO: 312 or an amino sequence at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identical thereto.

70. The nucleic acid construct of claim 67 or 69, wherein the GAA polypeptide comprises an R at position 199, a H at position 223, and an I at position 780 (corresponding to positions in SEQ ID NO: 312).

71. The nucleic acid construct of any one of claims 67-70, wherein the nucleotide sequence encoding the GAA polypeptide comprises:(a) SEQ ID NO: 313;(b) SEQ ID NO: 314;(c) 169-2859 of SEQ ID NO: 313;(d) 169-2859 of SEQ ID NO: 314;(e) nucleotides 82-2858 of SEQ ID NO: 313;(f) nucleotides 82-2859 of SEQ ID NO: 314;(g) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a), (b), (c), (d), (e), or (f); or(h) a functional fragment of (a), (b), (c), (d), (e), (f) or (g).

72. The nucleic acid construct of any one of claims 67-70, wherein the nucleotide sequence encoding the GAA polypeptide comprises:(a) SEQ ID NO: 315;(b) SEQ ID NO: 316;(c) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) or (b); or(d) a functional fragment of (a), (b) or (c).

73. The nucleic acid construct of any one of claims 67-70, wherein the nucleotide sequence encoding the GAA polypeptide comprises:a) SEQ ID NO: 28; b) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a); or c) a functional fragment of (a) or (b).

74. The nucleic acid construct of any one of claims 67-73, wherein the nucleotide sequence encoding the GAA polypeptide is codon optimized.

75. The nucleic acid construct of claim 74, wherein the codon optimized nucleotide sequence encoding the GAA polypeptide comprises:(a) one of SEQ ID NOs: 2-18;(b) nucleotides 169-2859 of one of SEQ ID NOs: 2-18;(c) nucleotides 82-2859 of one of SEQ ID NOs: 2-18;(d) a nucleotide sequence with at least 80%, at least 85%, or at least 90% sequence identity to (a) (b) or (c); or(e) a functional fragment of (a), (b), (c) or (d).

76. The nucleic acid construct of any one of claims 67-75, wherein the nucleotide sequences comprise SEQ ID NO: 26 or a sequence at least 80%, at least 85%, or at least 90% identical thereto.

77. The nucleic acid construct of any one of claims 67-76, comprising a nucleotide sequence of SEQ ID NO: 22 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

78. The nucleic acid construct of any one of claims 67-77, that is in the context of a plasmid backbone.

79. The nucleic acid construct of claim 78, comprising a nucleotide sequence of SEQ ID NO: 20 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

80. The nucleic acid construct of any one of claims 67-77, that is in the context of an neDNA backbone.

81. The nucleic acid construct of claim 80, comprising a nucleotide sequence of SEQ ID NO: 21 or a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% sequence identity thereto.

82. A recombinant AAV (rAAV) comprising the nucleic acid construct of any one of claims 67-81.

83. A pharmaceutical composition comprising the rAAV vector of any one of claims 1-66 or 82 in a pharmaceutically acceptable carrier.

84. The rAAV vector of any one of claims 1-66 or 82, or the pharmaceutical composition of claim 83, for use in treating a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide.

85. A recombinant adeno-associated virus (rAAV) vector for use in treating a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, wherein the rAAV vector has a capsid from serotype AAV843 / XL32.1 and comprises in its genome:(a) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; and(b) located between the 5’ ITR and 3’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising:(i) a nucleotide sequence encoding a BM40 signal peptide; and(ii) a nucleotide sequence encoding an alpha-glucosidase (GAA) polypeptide comprising residues 57-952 of SEQ ID NO: 1; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

86. A method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising administering a therapeutically effective amount of the rAAV vector of any one of claims 1-66 or 82, or the pharmaceutical composition of claim 83, to the subject.

87. A method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising administering to the subject a therapeutically effective amount of a recombinant adeno-associated virus (rAAV) vector, which has a capsid from serotype AAV843 / XL32. 1 and comprises in its genome:(a) a 5’ inverted terminal repeat (ITR) and a 3’ ITR; and(b) located between the 5 ’ ITR and 3 ’ ITR, a liver-specific promoter operably linked to a nucleic acid, comprising:(i) a nucleotide sequence encoding a BM40 signal peptide; and(ii) a nucleotide sequence encoding an alpha-glucosidase (GAA) polypeptide comprising residues 57-952 of SEQ ID NO: 1; wherein the BM40 signal peptide and the GAA polypeptide are expressed in a single fusion protein.

88. The use or method of any one of claims 84-87, wherein the administering results in secretion of a functional GAA polypeptide from the subject’s liver, and uptake of the secreted GAA polypeptide by at least one different target tissue (GAA uptake target tissue).

89. The use or method of any one of claims 84-88, wherein the GAA uptake target tissue is skeletal muscle tissue, cardiac muscle tissue, diaphragm muscle tissue, or any combination thereof.

90. The use or method of any one of claims 84-89, wherein uptake of the secreted GAA polypeptide results in a reduction of lysosomal glycogen stores in the at least one GAA uptake target tissue.

91. The use or method of any one of claims 84-90, wherein the administering is by intramuscular, sub- cutaneous, intraspinal, intracistemal, intrathecal, or intravenous administration.

92. The use or method of any one of claims 84-91, where the rAAV vector is administered at a dosage of from 1.0E11 viral genomes per kilogram of the subject (vg / kg) to 5.0E13 vg / kg.

93. The use or method of any one of claims 84-92, where the rAAV vector is administered at a dosage of from 5.0E12 vg / kg to 2.0E13 vg / kg.

94. The use or method of any one of claims 84-93, where the rAAV vector is administered at a dosage of 5.0el2 vg / kg.

95. The use or method of any one of claims 84-94, further comprising periodically administering GAA protein enzyme replacement therapy (ERT) prior to the administering of the rAAV vector or pharmaceutical composition, and withdrawing the GAA protein ERT at least one month prior to the administering of the rAAV vector or pharmaceutical composition.

96. The use or method of any one of claims 84-95, further comprising periodically administering GAA protein enzyme replacement therapy (ERT) prior to the administering of the rAAV vector or pharmaceutical composition, and withdrawing the GAA protein ERT on the same day, a day after or, any time between day 1 and 26 weeks after administering the rAAV vector or pharmaceutical composition.

97. The use or method of any one of claims 84-96, further comprising periodically administering an immune suppressant in a dosage and a frequency to provide an effective amount, beginning prior to, or at the same time as administering the rAAV vector or pharmaceutical composition.

98. The use or method of claim 97, wherein the immune suppressant is begun 24 hours prior to the administering the rAAV vector or pharmaceutical composition.

99. The use or method of claim 97, further comprising decreasing the dosage or frequency and / or ceasing the administration of the immune suppressant on the same day, a day after, any time between day 1 and 26 weeks, or later, after administering the rAAV vector or pharmaceutical composition.

100. The use or method of claim 98, wherein the initial dosage is 60 mg / day or is 1 mg / kg.

101. The use or method of any one of claims 98 - 100, wherein the dosage is decreased to ≤ 60 mg / dose, ≤ 55 mg / dose, ≤ 50 mg / dose, ≤ 45 mg / dose, ≤ 40 mg / dose, ≤ 35 mg / dose, ≤ 30 mg / dose, ≤ 25 mg / dose, ≤ 20 mg / dose, ≤ 15 mg / dose, ≤ 10 mg / dose, or ≤ 5 mg / dose, or administration is ceased.

102. The use or method of any one of claims 98-101, wherein the dosage is reduced by 5 mg / day every 7 days until cessation, following an initial 2 week administration period.

103. The use or method of any one of claims 99-101, wherein the dosage is decreased or the administering of the immune suppressant is ceased at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administering of the rAAV vector or pharmaceutical composition.

104. The use or method of any one of claims 99-103, wherein the frequency of the administering of the immune suppressant remains the same and the dosage is decreased in periodic intervals until a final reduced dosage is maintained or the administering of an immune suppressant is ceased entirely.

105. The use or method of claim 104, wherein the periodic intervals begin after about 2 weeks after the administering the rAAV vector or pharmaceutical composition.

106. The use or method of claim 104 or 105, wherein the periodic interval is about 2 weeks, 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day.

107. The use or method of claim any one of claims 84-106, wherein the subject is not administered an immune suppressant prior to, after, or neither prior to or after the administering of the rAAV vector or pharmaceutical composition.

108. The use or method of any one of claims 84-107, wherein the immune suppressant is selected from the group consisting of prednisone, methyl prednisone, prednisolone, methyl prednisolone, tacrolimus, sirolimus, methotrexate, azathioprine, and combinations thereof.

109. The use or method of any one of claims 84-108, wherein the immune suppressant is prednisone.

110. A method to treat a subject with Pompe Disease, a glycogen storage disease type II (GSD II, Acid Maltase Deficiency), or a deficiency in alpha-glucosidase (GAA) polypeptide, the method comprising the steps:(a) administering the rAAV vector of any one of claims 1-66 or 82 or the pharmaceutical composition of claim 83 to the subject;(b) administering an immune suppressant periodically, at a dosage and frequency that delivers an effective amount to the subject, beginning prior to, at the same time as, or after administering step (a); and(c) decreasing the dosage or frequency of administration and / or ceasing the administration of the immune suppressant at a time following the administration of the rAAV vector or pharmaceutical composition.

111. The method of claim 110, wherein administering step b) begins 24 hours prior to administering step a).

112. The method of claim 110 or 111, wherein initial dosage is 60 mg / day, and the dosage is decreased to less than 60 mg / dose, ≤ 55 mg / dose, ≤ 50 mg / dose, ≤ 45 mg / dose, ≤ 40 mg / dose, ≤ 35 mg / dose, ≤ 30 mg / dose, ≤ 25 mg / dose, ≤ 20 mg / dose, ≤ 15 mg / dose, ≤ 10 mg / dose, or ≤ 5 mg / dose, or the administering of the immune suppressant is ceased.

113. The method of any one of claims 110-112, wherein the dosage is reduced by 5 mg / day every 7 days until cessation, following an initial 2 week administration period.

114. The method of any one of claims 110 -113, wherein the dosage and / or frequency of administration is decreased, or the dosage is ceased, on the same day, a day after, or any time between day 1 and 26 weeks, or more after the administrating of the rAAV vector or pharmaceutical composition.

115. The method of any one of claims 110 - 114, wherein the dosage and / or frequency of administration is decreased, or the dosage is ceased, at about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 weeks after, or at about 5, 4, 3, 2 or 1 days after the administrating of the rAAV vector or pharmaceutical composition.

116. The method of any one of claims 110-115, wherein the frequency of the administering of the immune suppressant remains the same and the dosage is decreased in periodic intervals, until a final reduced dosage is maintained, or the administering of an immune suppressant is ceased entirely.

117. The method of claim 116, wherein the periodic intervals begin after about 2 weeks after the administering the rAAV vector or pharmaceutical composition.

118. The method of claim 116 or 117, wherein the periodic interval is about 2 weeks, 1 week, 6 days, 5 days, 4 days, 3 days, 2 days, or 1 day.

119. The method of any one of claims 110-118, wherein the immune suppressant is selected from the group consisting of prednisone, methyl prednisolone, tacrolimus, sirolimus, methotrexate, azathioprine, and combinations thereof.

120. The method of any one of claims 110-119, wherein the immune suppressant is prednisone.

121. The use or method of any one of claims 84-120, wherein at least one determination of liver toxicity in the subject remains within a normal range over an extended period of time following the administering of the rAAV vector.

122. The use or method of claim 121, wherein the determination of liver toxicity is alanine aminotransferase (ALT) or aspartate aminotransferase (AST) levels in the subject’s serum.

123. The use or method of claim 122, wherein the ALT level in the subject’s serum is ≤ 50, 60, 70, 80, 90, or 100 lU / mL over baseline following the administering of the rAAV vector.

124. The use or method of any one of claims 121-123, wherein the extended period of time is at least 10 days, at least 50 days, at least 100 days, at least 300 days, at least 1 year.

125. The use or method of any one of claims 84-124, wherein the subject fails to mount a substantial immune response specific to the rAAV vector or the GAA polypeptide following the administering of the rAAV vector.

126. The use or method of claim 125, wherein the subject fails to mount a substantial immune response to the rAAV vector or the GAA polypeptide for a period of from 10 to 1000 days following the administering of the rAAV vector.

127. The use or method of any one of claims 84-126, wherein the subject has a serum GAA concentration of at least 0.3 pmol / L / hr, at least 0.4 pmol / L / hr, at least 0.5 pmol / L / hr, at least 0.6 pmol / L / hr, at least 0.7 pmol / L / hr, at least 0.8 pmol / L / hr, at least 0.9 pmol / L / hr, at least 1 pmol / L / hr, at least 2 pmol / L / hr, at least 3 pmol / L / hr, at least 4 pmol / L / hr, at least 5 pmol / L / hr, at least 6 pmol / L / hr, at least 7 pmol / L / hr, at least 8 pmol / L / hr, at least 9 pmol / L / hr, at least 10 pmol / L / hr, at least 11 pmol / L / hr, at least 12 pmol / L / hr, at least 13 pmol / L / hr, at least 14 pmol / L / hr, or at least 15 pmol / L / hr, following the administering of the rAAV vector.

128. The use or method of claim 127, wherein the serum GAA concentration is detected 10 to 1000 days after the administering of the rAAV vector.

Images