Engineered microbial monocultures and biocatalytic methods for producing purine alkaloids, including 7-methylxanthine

Abstract

Biocatalysts and methods in which at least one biocatalyst is used for producing purine alkaloids, including 7-methylxanthine and / or theobromine, from caffeine. The biocatalysts include recombinant cells, preferably recombinant bacterial cells or yeast cells, which contain a genetically engineered synthetic N-demethylation operon and a genetically engineered synthetic formate and formaldehyde operon and preferably also, containing a loss of function mutation in a glycerol repressor gene. In the methods, the biocatalysts may be used for converting high-concentrations of caffeine into theobromine and / or 7-methylxanthine.

Description

Engineered Microbial Monocultures and Biocatalytic Methods for Producing Purine Alkaloids, Including 7-Methylxanthine CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority from U.S. Provisional Patent Application 63 / 539,644 filed September 21, 2023, the entire disclosure of which is herein incorporated by reference in its entirety. REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on September 18, 2024, is named “6584_153664.xml” and is 192,315 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety. TECHNICAL FIELD

[0003] This disclosure relates to the field of biocatalytic methods and biocatalysts for producing purine alkaloids, including 7-methylxanthine and theobromine. BACKGROUND

[0004] 7-methylxantine may have a significant pharmacological value, including several studies which report that 7-methylxanthine may prevent myopia and eye elongation in children. However, 7-methylxantine is not readily available in nature.

[0005] Chemical methods to synthesize 7-methylxanthine have been attempted to overcome the lack of its natural availability, but these processes require various hazardous chemicals, such as for example as tetrahydrofuran (THF) and N, N- dimethylformamide (DMF). Attempts at direct N-substitution of xanthine are further complicated by the lack of selectivity resulting from a high similarity in the acidity of N3-H and N7-H, closely followed by N1-H. The Traube purine synthesis, a classical technique for chemically synthesizing substituted purines, is a lengthy process which is constrained by harsh conditions and poor specificity, even with recent updates and modification.

[0006] In the alternative to a chemical synthesis, some bacteria are capable of decomposing caffeine to 7-methylxanthine. Research revealed two distinct catabolic pathways which some bacteria may use to degrade caffeine: N-demethylation and C-8 oxidation (Summers RM, Mohanty SK, Gopishetty S, Subramanian M. Genetic characterization of caffeine degradation by bacteria and its potential applications. Microb Biotechnol.2015;8(3):369-378).The N-demethylation pathway, encoding enzymes in the Rieske oxygenase family, is found in a gene fragment of Pseudomonas putida CBB5 (Quandt EM, Summers RM, Subramanian M V., Barrick JE. Draft genome sequence of the bacterium Pseudomonas putida CBB5, which can utilize caffeine as a sole carbon and nitrogen source. Genome Announc.2015;3(3):5-6). Pseudomonas putida CBB5 was isolated from waste tea containing soil samples, and it can grow on caffeine as a sole carbon source.

[0007] Several recent studies reported on producing 7-methylxanthine and related methylxanthines using bacterial strains. Conversion of caffeine toparaxanthine and 7-methylxanthine using Escherichia coli strain MBM013 (Mock MB, Mills SB, Cyrus A, et al. Biocatalytic Production and Purification of the High- value Biochemical Paraxanthine. Biotechnol Bioprocess Eng.2022;27(4):640-651), biocatalytic production of 7-methylxanthine from caffeine using Escherichia coli strain MBM019 (Mock MB, Cyrus A, Summers RM. Biocatalytic production of 7- methylxanthine by a caffeine-degrading. 2022;119(11):3326-3331), and mixed culture system composed of engineered Escherichia coli strains (Mock MB, Summers RM. Mixed Culture Biocatalytic Production of the High- Value Biochemical 7- Methylxanthine. Published online 2022:1-15) are the most recent works reported. Mock and coworkers have produced 2.120  mM 7-methylxanthine (~50% yield mol / mol) and 0.552 mM paraxanthine from 4.331 mM of caffeine, followed by a preparatory scale HPLC for purification, resulting in 177.3 mg 7-methylxanthine and 48.1 mg paraxanthine (Mock MB, Cyrus A, Summers RM. Biocatalytic production of 7-methylxanthine by a caffeine-degrading.2022;119(11):3326-3331). This mixed culture approach converted 2.293 mM caffeine to 0.061 mM theobromine and 2.233 mM 7-methylxanthine in five hours when cells were grown at the high cell density (OD600=50) (Mock MB, Summers RM. Mixed Culture Biocatalytic Production of the High- Value Biochemical 7-Methylxanthine. Published online 2022:1-15). However, the amount of caffeine converted to 7-methylxanthine was limited, resulting in a low yield of the product.

[0008] At least two other useful purine alkaloids: theobromine (3,7- dimethylxanthine) and paraxanthine (1,7-dimethylxanthine) can be produced from a caffeine or tea feedstock.

[0009] However, caffeine is reported to be toxic to bacterial cells. Thus, only low concentrations of caffeine can be used as a substrate and only a combination of cells with different mutations have been used, rendering this process difficult to commercialize. Recently, Mock and Summer have engineered a consortia of E. coli with ndmABD to produce 7-methylxantine. The maximum titer of the consortia-based production was 1.2 mM of 7-MX within 6 hours in bioreactors, and the yield was 85.6% (mol / mol). Notably, a high-cell density (OD600=50) was used to achieve the yield.

[0010] Thus, there remains the need in the field for methods and recombinant caffeine-degrading cells that may be tolerant to caffeine toxicity and which are capable of converting caffeine selectively to one or more of purine alkaloids, including specifically and efficiently to 7-methylxantine such that a process can be scaled up for commercial production. SUMMARY

[0011] Aiming at addressing these and other unmet needs, this disclosure provides in a first aspect a biocatalyst for producing 7-methylxantine, wherein the biocatalyst is a recombinant bacterial or yeast cell which comprises: a) a genetically engineered synthetic N-demethylation operon encoding and expressing enzymes which demethylate caffeine and theobromine into 7-methylxantine; and b) a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; andwherein the genetically engineered synthetic N-demethylation operon comprises ndmA, ndmB, and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA, ndmB, and ndmD genes operably linked to a promoter, and wherein the N-demethylation operon does not comprise ndmC gene; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

[0012] In a second aspect, this disclosure provides a biocatalyst for producing theobromine, wherein the biocatalyst is a recombinant bacterial or yeast cell which comprises: a) a genetically engineered synthetic N-demethylation operon encoding and expressing enzymes which demethylate caffeine into theobromine; and b) a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; and wherein the genetically engineered synthetic N-demethylation operon comprises ndmA and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity tondmA and ndmD genes operably linked to a promoter, and wherein the N- demethylation operon does not comprise ndmB and ndmC genes; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

[0013] In embodiments of the first aspect or the second aspect, the recombinant bacterial or yeast cell may further comprise a loss-of-function mutation for glycerol repressor glpR gene, wherein the mutation eliminates production of GlpR protein.

[0014] Preferably, the biocatalyst may be a monoculture comprising two or more cells, wherein each cell from the two or more cells comprises the N- demethylation operon and the formate and formaldehyde operon.

[0015] In particularly preferred embodiments of the first or second aspect, the first N-demethylation operon or the second N-demethylation operon, and the formate and formaldehyde operon may are integrated into a genome of the recombinant bacterial or yeast cell. Preferred embodiments of recombinant caffeine-degrading cells may include P. putida, P. putida KT2440 and / or P. putida EM42 carrying the genetically engineered synthetic N-demethylation operon according to the first aspect or to the second aspect, and the formate and formaldehyde operon.

[0016] In some embodiments of the biocatalyst according to this disclosure, - tac promoter (Ptac) may drive expression in the N-demethylation operon and / or in the formate and formaldehyde operon.

[0017] The biocatalysts according to this disclosure include the recombinant bacterial or yeast cell which may tolerate growth conditions in a medium comprising up to 50 mM caffeine, e.g. from about 5 mM to about 50mM or up about 45 mM or up to about 40 mM or up to about 30mM, which is a significant improvement over previous cultures comprising a consortium of cells.

[0018] In certain embodiments, the biocatalyst according to this disclosure may be further characterized by one or more of the following features: - a synthetic ribosome binding site (RBS) located upstream of the translation start codon in the N-demethylation operon and / or a ribosome binding site (RBS) located upstream of the translation start codon in the formate and formaldehyde operon; - a soxR terminator located at the 3’ end of the N-demethylation operon and / or a soxR terminator located at the 3’ end of the formate and formaldehyde operon; and / or - a tonB terminator located at the 5’ end of the N-demethylation operon and / or a tonB terminator located at the 3’ end of the formate and formaldehyde operon.

[0019] Biocatalysts according to this disclosure may have a capacity for producing at least 5 mM of 7-methylxantine, preferably at about 100% yield mol / mol, in a 12-hour period when cultured at the initial cell density of OD600=1.

[0020] In another aspect, this disclosure relates to a method for producing 7- methylxantine, the method comprising:a) culturing the recombinant bacterial or yeast cell of claim 1 in a liquid growth medium which comprises caffeine; and b) centrifuging the culture of step a) to precipitate 7-methylxantine as a pellet separated from the recombinant bacterial or yeast cell and the liquid growth medium and collecting the 7-methylxantine pellet.

[0021] In embodiments of the method, the liquid growth medium may further comprise theobromine. In particularly preferred embodiments, caffeine in step a) may be sourced from waste green tea and / or coffee. In certain embodiments, the waste green tea or coffee may be supplemented as an oxidative hydrothermal dissolution (OHD) substrate which was processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

[0022] In embodiments, the method may further comprise a step of oxidative hydrothermal dissolution (OHD), wherein waste green tea or coffee is processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

[0023] In particularly preferred method embodiments according to this disclosure, the liquid growth medium may comprise glycerol as a carbon source and / or the liquid growth medium does not comprise glucose. In some embodiments of the method, step a) may be performed for about 6 to about 24 hours.

[0024] In certain method embodiments, the method further comprises removing lipopolysaccharides (LPSs) from the 7-methylxanthine pellet and / or drying 7- methylxanthine pellet.

[0025] In certain method embodiments, the method may further include passing the liquid growth medium through a high-pressure liquid column (HPLC) and eluting 7-methylxantine with a mixture of water, methanol, and acetic acid.

[0026] Particularly preferred embodiments include those in which the method may be further characterized by one or more of the following features: - in step a), a caffeine concentration in the liquid growth medium is in the range from about 1 mM to about 50 mM; - in step a) a glycerol concentration in the liquid growth medium is in the range from about 10 mM to about 1 M; and - in step a), the culture has the initial optical density at 600 nm in the range from about 0.1 to about 100.

[0027] In some embodiments of the method, caffeine and glycerol may be continuously fed into the liquid growth medium, or in other embodiments, caffeine may be fed in batches.

[0028] In yet another aspect, this disclosure relates to a recombinant construct which comprises at least one of the following two operons: - a genetically engineered synthetic first N-demethylation operon encoding and expressing enzymes which demethylate caffeine and theobromine into 7-methylxantine; - a genetically engineered synthetic second N-demethylation operon encoding and expressing enzymes which demethylate caffeine into theobromine; and / or- a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; and wherein the genetically engineered synthetic first N-demethylation operon comprises ndmA, ndmB, and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA, ndmB, and ndmD genes operably linked to a promoter, and wherein the N-demethylation operon does not comprise ndmC gene; wherein the genetically engineered synthetic second N-demethylation operon comprises ndmA and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA and ndmD genes operably linked to a promoter, and wherein the N-demethylation operon does not comprise ndmB and ndmC genes; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

[0029] Preferably, the recombinant construct may be a plasmid, bacterial chromosome or yeast chromosome.

[0030] In yet another aspect, this disclosure relates to a composition useful for treating myopia and comprising 7-methylxantine obtained from caffeine with one or more biocatalysts according to this disclosure.

[0031] In yet another aspect, this disclosure relates to a method for bioprocessing waste green tea. The method may comprise reacting waste green tea with the biocatalyst according to this disclosure.

[0032] In yet another aspect, this disclosure relates to a method for producing theobromine, the method comprising: a) culturing the recombinant bacterial or yeast cell of claim 2 in a liquid growth medium which comprises caffeine; and b) purifying theobromine.

[0033] Embodiments of the method include those, wherein caffeine in step a) is sourced from waste green tea and / or coffee. In some embodiments, the waste green tea or coffee may be sourced as an oxidative hydrothermal dissolution (OHD) substrate which was processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a). In some embodiments, the method may further comprise a step of oxidative hydrothermal dissolution (OHD), wherein waste green tea or coffee is processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

[0034] In some embodiments of the method, the liquid growth medium may comprise glycerol as a carbon source and / or the liquid growth medium may not comprise glucose. In some embodiments, step a) may be performed for about 6 to about 24 hours.

[0035] In particular preferred embodiments, the method may be further characterized by one or more of the following features: - in step a), a caffeine concentration in the liquid growth medium is in the range from about 1 mM to about 50 mM; - in step a) a glycerol concentration in the liquid growth medium is in the range from about 10 mM to about 1M; and - in step a), the culture has the initial optical density at 600 nm in the range from about 0.1 to about 100.

[0036] In particularly preferred embodiments, caffeine may be continuously fed into the liquid growth medium, or caffeine is fed in batches. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figs.1A-1C report conversion of caffeine to 7-methylexanthine by engineered P. putida KT2440, wherein Fig.1A is a schematic of a synthetic operon for converting caffeine to 7-methylexanthine in which genes were driven under the high strength tac promotor and synthetic ribosomal binding site (RBS) with transition initial rate of 11053.97; Fig.1B reports utilization of caffeine by P. putida KT 2440+pBLT-2-Ptac-ndmABCD (KT ABCD); and Fig.1C reports 7-methylexanthine production by KT ABCD strain.

[0038] Fig.2 reports production of 7-methylxanthine from caffeine by P. putida KT2440 harboring the ndmABCD plasmid.

[0039] Figs.3A-3B compare growth rate (Fig.3A) and caffeine utilization (Fig.3B) by P. putida KT2440 versus P. putida EM42 containing the pBLT-2- ndmABD plasmid.

[0040] Figs.4A-4B report enhanced tolerance of P. putida EM42 to a caffeine substrate. Fig.4A is a schematic of genetic modifications for alleviating formaldehyde toxicity and enhancing the redox balance. Fig.4B reports caffeine utilization and growth of the strain engineered according to Fig.4A and grown with 10 mM caffeine in M9 medium supplemented with 40 mM glycerol. The level of statistical significance is indicated for differences between the two strains (**p < 0.01)

[0041] Figs.5A-5B report that the redox coupling enhances a conversion rate of caffeine to 7-methylxanthine (7MX). Fig.5A is a graph measuring caffeine utilization and Fig.5B is a graph measuring 7MX production. The level of statistical significance is indicated for differences between the two strains (**p < 0.01)

[0042] Figs.6A-6C report production of 7-methylexanthine using P. putida EM42. Fig.6A is a schematic of a gene cassette integrated into a genome. Fig.6B is a graph measuring growth and Fig.6C is a graph measuring caffeine utilization and 7- methylexanthine production by the strain carrying the gene cassette depicted in Fig. 6A.

[0043] Figs.7A-7B report growth and caffeine utilization by P. putida EM42 expressing ndmABD and fmdEFGH-fdhA (P. putida EM42::Ptac-ndmABD + pBLT-2- lac-fmdEFGH-fdhA). Fig.7A reports an experiment conducted in a batch culture with initial caffeine concentration of 10 mM. Fig.7B reports an experiment conducted in afed-batch culture with 5 mM caffeine concentration at 0 and 6 h in shake flask cultures at an initial OD600 of 1.0, and 40 mM of glycerol.

[0044] Figs.8A-8B report that the glpR knockout reduces growth lag-phase on a glycerol substrate. Fig.8A compares growth of P. putida EM42 versus P. putida EM42::ΔglpR and their utilization of glycerol in M9 medium. Fig.8B studies caffeine conversion by P. putida EM42::ΔglpR expressing ndmABD and fmdEFGH- fdhA (P. putida EM42::ΔglpR::Ptac-ndmABD + pBLT-2-lac-fmdEFGH-fdhA).

[0045] Figs.9A-9C report results of a shake flask test for cultures with different cell densities. Fig.9A reports culture titers; Fig.9B reports growth rates; and Fig.9C reports 7-methylexanthine yield for different cultures.

[0046] Figs.10A-10B report shake flask tests for two different substrates: coffee (Fig.10A) or waste green tea (Fig.10B).

[0047] Fig.11 is a schematic of N-demethylation catabolic pathway for converting caffeine into 7-methylexanthine.

[0048] Fig.12 is a plasmid map of pBLT-2-Ptac-ndmABCD plasmid.

[0049] Fig.13 is the DNA sequence of thePtac-ndmABCD 5-3’ region (SEQ ID NO: 23) in the plasmid of Fig.12.

[0050] Fig.14 is a plasmid map of pBLT-2-Ptac-fmdEFGH-fldA plasmid.

[0051] Fig.15 is the DNA sequence of the Ptac-fmdEFGH-fldA 5’-3’ region (SEQ ID NO: 24) in the plasmid of Fig.14.

[0052] Fig.16 is a plasmid map of pBLT-2-Ptac-ndmABD plasmid.

[0053] Fig.17 is the DNA sequence of the Ptac-ndmABD 5’-3’ region (SEQ ID NO: 25) in the plasmid of Fig.16.

[0054] Fig.18 is a plasmid map of SK18-sb-ndmABD plasmid.

[0055] Fig.19 is the DNA sequence of the sb-ndmABD 5’-3’ region (SEQ ID NO: 26) in the plasmid of Fig.18.

[0056] Fig.20 is a plasmid map of Sk18-sb-glpRΔ plasmid.

[0057] Fig.21 is the DNA sequence of sb-glpRΔ plasmid 5-3’ region (SEQ ID NO: 27) in the plasmid of Fig.20.

[0058] Fig.22 is Table 2 listing plasmids according to this disclosure.

[0059] Fig.23 is Table 3 listing oligonucleotide primers used for producing biocatalysts according to this disclosure.

[0060] Figs.24A-24B report conversion of caffeine to 7-methylxanthine in glycerol-supplemented media. Fig.24A reports the glpR deletion strain enables the reduction of the lag phase of growth in the glycerol medium. Fig.24B reports the conversion of caffeine to the 7-MX by the NdmABD expressing strain. Error bars denote the standard deviations among the concentration measurements (n=3).

[0061] Fig.25 is Table S1, listing plasmid construction details of the gene expression and integration plasmids, including PCR primer sequences (SEQ ID NOs: 34-67).

[0062] Fig.26 is Table S2, reporting genotype and description for strains with integrated plasmids.

[0063] Figs.27A-27C report that a genome integration of tac promoter-driven ndmABD and fdhA enables the efficient conversion of caffeine to 7-MX. Fig.27A reports caffeine consumption. Fig.27B reports 7-MX production and Fig.27C reports redox cofactor balance (NAD+ / NADH ratio), and measured using thecommercially available quantified by NAD+ / NADH GloTMassay kit and following the manufacture protocol (Promega, USA). A significantly higher NAD+level was observed when LJBJ502 (EM42:ABD) was grown with caffeine due to the demethylation of caffeine to 7MX. Elevated levels of both NAD+and NADH were observed in redox engineered strain (LJBJ600). However, the NAD+ / NADH ratio was significantly lower in LJBJ602 compared to its non-redox-engineered version (LJBJ502). Significantly lower level of NAD+in LJBJ602 in the absence of caffeine compared to P. putida EM42 could be due to the increased activity of FdhA, on NAD+produced by other metabolic pathways and glycerol metabolism, as fdhA is being constitutively transcribed by the tac promoter. Error bars represent standard deviation (n=3), and bars labeled with different letters indicate significant differences in sample means (p < 0.05). The values were calculated using ANOVA followed by Tukey’s post hoc test.

[0064] Figs.28A-28B report that a fed-batch process and high initial cell density enhanced a product titer of 7-MX when using the LJBJ600. Fig.28A reports Caffeine utilization and 7-MX production with initial cell density of OD600=100. Fig. 28B reports the maximum product titer with different initial cell densities. The same fed-batch process (Fig.28A) was followed to evaluate cell density on the product titer. Error bars represent standard deviation (n=2), and bars labeled with different letters indicate significant differences in sample means (p < 0.05). The values were calculated using ANOVA followed by Tukey’s post hoc test.

[0065] Figs.29A-29C report the fed-batch process enables the high titer production of 7-MX using the LJBJ600. Fig.29A reports caffeine utilization, 5 mMof caffeine was fed every 6 hours after the culture started with 5 mM initial caffeine concentration (blue circle), where 10 mM of caffeine was added 24, 36, and 42 hours to the culture began with 20 mM caffeine (brown circle). Fig.29B reports 7-MX production. Fig.29C reports live cell percentage in the culture at a given time. Error bars represent standard deviation (n=3), and significant differences between the control and the tested sample indicate * p < 0.05 and ** p < 0.01). The values were calculated using T-test.

[0066] Figs.30A-30E report efficient separation of 7-MX from the culture broth. Fig.30A depicts bioreactor cultivation and production of the 7MX, 3L culture; Fig.30B depicts separation of cells and the 7-MX after cols treatment and centrifugation; Fig.30C reports the HPLC profile of the 7-MX; Fig.30D is a picture of purified and dried 7-MX; and Fig.30E reports a NMR profile of the purified 7- MX.

[0067] Figs.31A-31B report production of theobromine at high-titer. Fig.31A reports caffeine utilization and theobromine production using fed-batch culture, the culture was supplemented with 10 mM of caffeine and 10 mM of glycerol at 24, 30, and 48 hours. Fig.31B reports bioreactor production of theobromine 3-L volume.

[0068] Fig.32 is a map and sequence of Ptac-ndmABD region (SEQ ID NO: 28).

[0069] Fig.33 is a map and sequence of Ptac-ndmAD region (SEQ ID NO: 29).

[0070] Fig.34 is a map and sequence of Ptac-fdhA region (SEQ ID NO: 30).

[0071] Fig.35 is a map and sequence of sK18Sb:Ptac:ndmABD plasmid (SEQ ID NO: 31) used for genome integration.

[0072] Fig.36 is a map and sequence of sK18Sb:Ptac:ndmAD plasmid (SEQ ID NO: 32) used for genome integration.

[0073] Fig.37 is a map and sequence of sK18Sb:Ptac:fdhA plasmid (SEQ ID NO: 33) used for genome integration. DETAILED DESCRIPTION

[0074] In one aspect, this disclosure relates to biocatalysts and methods in which at least one biocatalyst is used for producing 7-methylxanthine from purine alkaloids, preferably from caffeine and / or caffeine-related methylxanthines, including theobromine.

[0075] In another aspect, this disclosure relates to biocatalysts and methods in which at least one biocatalyst is used for producing theobromine from purine alkaloids, preferably from caffeine and / or caffeine-related methylxanthines.

[0076] The biocatalysts according to this disclosure include recombinant cells which are genetically modified in order to tolerate caffeine toxicity and to degrade caffeine efficiently into theobromine and / or 7-methylxanthine.

[0077] Caffeine and its intermediate metabolites, such as formaldehyde, may be highly toxic to most of bacteria. Unexpectedly, this disclosure provides genetically modified bacterial cells which tolerate caffeine in high concentrations and are capable of growing in a liquid growth medium containing caffeine in higher concentrations.

[0078] In particularly preferred embodiments, the caffeine-degrading cells according to this disclosure may grow in a medium containing up to 50 mM of caffeine, such as for example a liquid growth medium containing from about 1 mM toabout 50 mM of caffeine, and preferably from about 5 mM to about 45 mM of caffeine and more preferably from about 7 mM to about 40 mM of caffeine.

[0079] Even more unexpectedly, the recombinant caffeine-degrading cells according to this disclosure are capable of converting caffeine into 7-methylxanthine at a high efficiency level, including some embodiments in which a nearly 100% caffeine conversion has been achieved even when the recombinant caffeine-degrading cells were seeded at a low starting density. In some embodiments, the recombinant caffeine-degrading cells according to this disclosure may be seeded at the initial optical density OD600in the range from about 0.1 to 10, or from about 0.1 to about 50 and more preferably, in the range from about 1 to about 50 and most preferably, in the range from about 20 to about 70, or in the range from about 0.1 to about 100.

[0080] In this disclosure, 7-methylxanthine may be abbreviated as “7MX” or “7-MX.” The chemical formula for 7-methylxantine is shown below as formula (I).Formula (I)

[0081] In this disclosure, caffeine refers to a chemical compound having the following chemical formula (II):Formula (II)

[0082] In this disclosure, theobromine refers to a chemical compound having the following chemical Formula (III):Formula (III)

[0083] In this disclosure, the term “about” means ±5% of the value. For example, about 100 means 100±5 and about 200 means 200±10.

[0084] In this disclosure, Pseudomonas Putida bacterium may be referred to interchangeably as P. Putida.

[0085] In this disclosure, Escherichia coli bacterium may be referred to interchangeably as E. coli.

[0086] In this disclosure, the recombinant caffeine-degrading cells may be referred interchangeably as recombinant 7MX producing cells, or simply as 7MX producing cells, or as a biocatalyst.

[0087] In this disclosure, the tac-promoter may be abbreviated as “Ptac” and it refers to a synthetic DNA promoter produced from the combination of promoters from the trp and lac operons of E. coli, as was initially reported in de Boer et al. “The tac promoter: a functional hybrid derived from the trp and lac promoters.” PNAS.1983; V.80 (1): 21-25

[0088] In this disclosure, all sequences are listed starting from the 5´ end to the 3´ prime end.

[0089] In this disclosure, “synthetic operon” refers to any operon which comprises one or more elements, including but not limited to, promotors, RBS and / orterminators, which were introduced into the operon and / or were mutagenized in the operon by recombinant DNA technologies.

[0090] In this disclosure, a ribosome binding site may be referred to as “RBS” or the Shine-Dalgarno sequence. Preferably, the RBS is a region upstream of the translation start codon in mRNA encoded by an operon and having the consensus 5´- AGGAGG-3´ or synthetic variants (GAGGAATCTTAC, SEQ ID NO: 19).

[0091] In this disclosure, the term “tonB terminator” refers to an E. coli DNA sequence 5´-AGTCAAAAGCCTCCGGTCGGAGGCTTTTGACT-3´ (SEQ ID NO: 20) which terminates transcription from an operon, as was initially reported by Postle and Good “DNA sequence of the Escherichia coli tonB gene.” PNAS. 1983 Sep; 80(17):5235-5239

[0092] In this disclosure, the term soxR terminator refers to a DNA sequence 5´-AAAACAAACTAAAGCGCCCTTGTGGCGCTTTAGTTTT-3´ (SEQ ID NO: 21) which terminates transcription from an operon.

[0093] In this disclosure, the term “biocatalyst” refers to a recombinant cell, preferably a recombinant bacterial or yeast cell, and most preferably P. putida bacterial cell, which carries a genetically engineered synthetic N-demethylation operon and a genetically engineered synthetic formate and formaldehyde operon, rendering the recombinant cell capable of utilizing and tolerating caffeine and converting caffeine with high efficiency to 7MX. In preferred embodiments, the biocatalysts according to this disclosure also carry a loss-of-function mutation in glycerol repressor glpR gene, rendering the biocatalytic cells capable of utilizing glycerol as a carbon source instead of glucose.

[0094] In this disclosure, the term “monoculture” refers to a bacterial or yeast liquid culture comprising two or more cells and each of the cells in the liquid culture comprising the N-demethylation operon and the formate and formaldehyde operon.

[0095] In this disclosure the term “consortium” refers to a bacterial or yeast culture in which different cells have different genetically engineered synthetic mutations, but no one cell has all mutations necessary for degrading caffeine to 7MX.

[0096] The biocatalyst according to this disclosure may be a monoculture of caffeine-degrading cells in which each cell has all genetically engineered synthetic operons necessary for converting caffeine to theobromine and / or 7MX. Furthermore, the caffeine-degrading cells according to this disclosure have improved tolerance to caffeine even when caffeine is used in higher concentrations.

[0097] The 7MX producing cells according to this disclosure may comprise a genetically engineered synthetic N-demethylation operon which encodes enzymes that demethylate caffeine and theobromine into 7MX, as shown in the schematic of Fig. 11. This N-demethylation operon may contain at least the following three genes operably linked to a promoter such that mRNA is produced from the genes. First, a gene which encodes NdmA enzyme which is a Rieske nonheme iron monooxygenase with N1-specific N-demethylation activity, preferably NdmA enzyme having the amino acid sequence with SEQ ID NO.2, or a functional variant thereof that has the same or similar enzymatic monooxygenase function as NdmA enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the NdmA enzyme. Second, a gene which encodes NdmB enzyme which is a Rieske nonheme iron monooxygenase with N3-specific N-demethylation activity,preferably NdmB enzyme having the amino acid sequence with SEQ ID NO.4, or a functional variant thereof that has the same or similar enzymatic monooxygenase function as NdmB enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the NdmB enzyme. Third, a gene which encodes NdmD protein which is a redox-center-dense Rieske reductase, preferably NdmD enzyme having the amino acid sequence with SEQ ID NO.8, or a functional variant thereof that has the same or similar enzymatic reductase function as NdmD enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the NdmD enzyme.

[0098] The theobromine producing cells according to this disclosure may comprise a genetically engineered synthetic N-demethylation operon which encodes enzymes that demethylate caffeine into theobromine. This N-demethylation operon may contain the same NdmA and NdmD genes as in an 7MX-producing N- demethylation operon, but it does not comprise the NdmB gene.

[0099] In some preferred embodiments, the NdmA enzyme may be encoded by Ndma gene having the nucleic acid sequence with SEQ ID NO: 1 or a functional variant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.1. [000100] In some preferred embodiments, the NdmB enzyme may be encoded by Ndmb gene having the nucleic acid sequence with SEQ ID NO: 3 or a functional variant thereof, having at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.3.[000101] In some preferred embodiments, the NdmD enzyme may be encoded by Ndmd gene having the nucleic acid sequence with SEQ ID NO: 7 or a functional variant thereof, having at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.7. [000102] Preferably, the N-demethylation operon does not comprise ndmC gene such as having the nucleic acid sequence with SEQ ID NO: 5 and which encodes N7- specific N-demethylase NdmC having SEQ ID NO: 6 that converts 7MX to paraxanthine. The N-demethylation operon does not comprise a functional variant of the ndmC gene encoding N7-specific N-demethylase having SEQ ID NO: 6 that converts 7MX to paraxanthine. [000103] In some embodiments, the expression of genes in the N-demethylation operon may be under control of Ptacpromoter. Other promoters conventionally used for driving expression in bacterial or yeast cells may be also used. The N- demethylation operon may further comprise the RBS site positioned upstream of the translation initiation site, a tonB terminator positioned upstream of the promoter and a soxR terminator positioned at the 3’ end of the N-demethylation operon and after the last of the gene in the N-demethylation operon. In some preferred embodiments, the genes in the N-demethylation operon may be arranged as shown in Fig.4A. In other embodiments, the genes may be arranged in a different order, relative the 5’ end of the N-demethylation operon. [000104] In some preferred embodiments, the N-demethylation operon may have the nucleic acid sequence with SEQ ID NO: 25 or a functional variant thereof havingat least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO. 25. [000105] The 7MX producing cells according to this disclosure further comprise a genetically engineered synthetic formate and formaldehyde operon that expresses enzymes which convert formaldehyde into carbon dioxide as shown in schematic of Fig.11. [000106] The genetically engineered synthetic formate and formaldehyde operon may contain at least the following genes operably linked to a promoter such that mRNA is produced from the genes. First, a gene which encodes FdhA formaldehyde dehydrogenase for converting formaldehyde to formate, preferably FdhA enzyme having the amino acid sequence with SEQ ID NO.18, or a functional variant thereof that has the same reductase function as FdhA enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the FdhA enzyme with SEQ ID NO: 18. [000107] Second, the formate and formaldehyde operon further comprises fmdEFGH genes encoding subunits of formate dehydrogenase for neutralizing formate into carbon dioxide as shown in Fig.11. Preferably, the formate and formaldehyde operon may encode and express FmdE, FmdF, FmdG, and FmdH subunits of a formate dehydrogenase. [000108] Preferably, the FmdE subunit which is formate dehydrogenase gamma subunit may have the amino acid sequence with SEQ ID NO.10, or a functional variant thereof that has the same enzymatic function as the FmdE enzyme and thefunctional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the FmdE enzyme subunit with SEQ ID NO: 10. [000109] Preferably, the FmdF subunit which is formate dehydrogenase beta subunit may have the amino acid sequence with SEQ ID NO.12, or a functional variant thereof that has the same enzymatic function as the FmdF enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the FmdF enzyme subunit with SEQ ID NO: 12. [000110] Preferably, the FmdG subunit which is formate dehydrogenase alpha subunit may have the amino acid sequence with SEQ ID NO.14, or a functional variant thereof that has the same enzymatic function as the FmdG enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the FmdG enzyme subunit with SEQ ID NO: 14. [000111] Preferably, the FmdH subunit which is formate dehydrogenase delta subunit may have the amino acid sequence with SEQ ID NO.16, or a functional variant thereof that has the same enzymatic function as the FmdH enzyme and the functional variant having at least 70%, 80%, 90% or 95% overall amino acid sequence identity to the FmdH enzyme subunit with SEQ ID NO: 16. [000112] In some preferred embodiments, the FdhA enzyme may be encoded by fmdA gene having the nucleic acid sequence with SEQ ID NO: 17 or a functional variant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.17. [000113] In some preferred embodiments, the FmdE subunit may be encoded by fmdE gene having the nucleic acid sequence with SEQ ID NO: 9 or a functionalvariant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.9. [000114] In some preferred embodiments, the FmdF subunit may be encoded by fmdF gene having the nucleic acid sequence with SEQ ID NO: 11 or a functional variant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.11. [000115] In some preferred embodiments, the FmdG subunit may be encoded by fmdG gene having the nucleic acid sequence with SEQ ID NO: 13 or a functional variant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.13. [000116] In some preferred embodiments, the FmdH subunit may be encoded by fmdH gene having the nucleic acid sequence with SEQ ID NO: 15 or a functional variant thereof which has at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.15. [000117] In some embodiments, the expression of genes in the formate and formaldehyde operon may be under control of Ptacpromoter. Other promoters conventionally used for driving expression in bacterial or yeast cells may be also used. The formate and formaldehyde operon may further comprise the RBS site positioned upstream of the translation initiation site, a TonB terminator positioned upstream of the promoter and a SoxR terminator positioned at the 3’ end of the formate and formaldehyde operon and after the last of the gene in the formate and formaldehyde operon. In some preferred embodiments, the genes in the formate and formaldehyde operon may be arranged as shown in Fig.4A. In other embodiments, the genes maybe arranged in a different order, relative the 5´ end of the formate and formaldehyde operon. [000118] In some preferred embodiments, the formate and formaldehyde operon may contain the nucleic acid sequence with SEQ ID NO: 24 or a functional variant thereof having at least 70%, 80%, 90% or 95% overall nucleotide sequence identity with SEQ ID NO.24. [000119] The inventors have unexpectedly found that the combination of the two operons improves significantly the tolerance of caffeine-degrading cells to caffeine and increases a conversion rate to 7MX, as reported in connection with Figs.4A and 4B. [000120] The inventors have further report that the conversion rate and tolerability to caffeine may be further increased if the 7MX producing cells further include a loss-of-function mutation a glycerol suppressor gene, glpR such that the cells can be grown in a liquid growth medium comprising glycerol as carbon source. [000121] Thus, in some preferred embodiments, the caffeine-degrading cells according to this disclosure in the addition to the two operons described above, further comprise a loss-of-function mutation in glycerol repressor gene glpR which may have SEQ ID NO: 22. Preferably, the loss-of-function mutation may be introduced by causing a deletion or a frame shift in the genomic copy of glycerol repressor gene glpR, such as glpR having SEQ ID NO: 22 for example with the help of a plasmid shown in Fig.20 and as described in details in examples. [000122] In some embodiments, the operons according to this disclosure may be expressed from a plasmid, for example from plasmids shown in Figs.14 and 16, butpreferably at least one of the operons and more preferably both, the N-demethylation operon and the formaldehyde and formate operon are integrated into the genome of the caffein-degrading cells according to this disclosure. [000123] As shown in Fig.11, conversion of caffeine to 7-methylxanthine releases two molecules of formaldehyde. Formaldehyde is highly toxic to bacterial cells, and the effective concentration to inhibit 50% growth of P. putida KT2440 may be as low as about 1.5 mM. P. putida natively uses formaldehyde and formate dehydrogenases to detoxify formaldehyde by converting it to CO2 via formate. The reaction uses nicotinamide adenine dinucleotide (NAD+) as a cofactor and produces NADH. [000124] In one particularly preferred embodiment, the inventors have leveraged this reaction to enable the redox balance of caffeine to a 7-methylxanthine response. Given that P. putida EM42, the genome reduces strain for the P. putida KT2440 has high tolerance, ATP, and redox cofactors relative to the parental strain; the inventors developed the P. putida EM42 for production of 7-methylexanthine from caffeine. [000125] First, the inventors genome-integrated the synthetic gene cassette that enables the constitute expression of ndmABD genes. Second, the inventors overexpressed the formaldehyde detoxifying genes, including fdhA and fmdEFGH, to adopt the redox coupling reaction and demonstrated efficient conversion of caffeine to 7-methylxanthine using the engineered monoculture approach. [000126] In yet another aspect, this disclosure relates to methods in which the genetically engineered synthetic 7MX producing cells according to this disclosure are utilized in order to convert caffeine into 7MX. In the methods, the cells may begrown in a liquid growth medium comprising caffeine. Unexpectedly, caffeine can be used in high concentrations, such as for example as up to 50 mM in some embodiments. Furthermore, it has been discovered that growing cells in a bioreactor wherein cells are supplied with caffeine continuously, increases the amount of 7MX produced. Furthermore, the present methods may be conducted for a shorter period of time, for example, from about 5 hours to about 24 hours, and more preferably from about 10 hours to about 20 hours and most preferably from about 5 hours to about 12 hours. Very advantageously, the cells according to this disclosure may be seeded at lower concentrations. In some embodiments, the starting optical density at 600 nM may be as low as about 0.1 and preferably in the range from about 0.1 to about 100, and more preferably, in the range from about 1 to about 50. In preferred embodiments of the method, the cells should be grown at a temperature in the range from about 24 to about 37°C, and most preferably at about 30°C. [000127] Preferably, the 7MX producing cells according to this disclosure may be grown in a liquid growth medium that comprises glycerol as carbon source. In certain embodiments, a concentration of glycerol in the liquid growth medium may be in the range from about 10 mM to about 1 M and preferably from about 20 mM to about 500 mM and most preferably from about 30 mM to about 100 mM. [000128] In some particularly preferred embodiments, the liquid growth medium may comprise glycerol and caffeine, but the medium is not supplemented with glucose. Various growth media may be used. Preferably, the 7MX producing cells according to this disclosure may be cultured in a minimal liquid culture medium, comprising caffeine and preferably further comprising glycerol and further preferablynot being supplemented with glucose. Suitable minimal growth medium may be M9 minimal medium which is a buffered minimal bacterial medium which contains only salts and nitrogen. [000129] Caffeine can be sourced from different sources. For example, synthetic caffeine can be used in some embodiments. However, in particularly preferred embodiments, waste green tea and coffee may be used as a source of caffeine. In particularly preferred embodiments, waste green tea and coffee may be pre-processed by hydrothermal dissolution for example, following a procedure and using a reactor described in WO 2012 / 167252. [000130] In the methods according to this disclosure, 7MX may be purified from the liquid growth medium through solvent extraction and / or by chromatography. If a solvent extraction is used, then various solvents may be suitable, including those shown in Table 1. [000131] In some embodiments, 7MX may be purified by chromatography and in particular by high-pressure liquid chromatography. Various solvents can be used. Preferably, the elution solvent is an aqueous mixture of at least one alcohol, e.g., ethanol or methanol, and at least one acid, e.g., acetic or formic acid. Similar purification methods may be also used for purification of theobromine. [000132] In some preferred embodiments, 7MX may be purified by centrifuging a culture, e.g. at about 3,000 rpm to about 6 rpm in order to pellet 7MX from liquid medium. It was found that a 7MX pellet is easily distinguishable because of its yellowish color from cell debris. Additional purification techniques may includeremoval of lipopolysaccharides, for example with a resin designed for removal of endotoxins. [000133] In further embodiments, this disclosure relates to pharmaceutical compositions comprising 7MX obtained by the methods according to this disclosure. The compositions may be useful for treating a variety of disorders, including myopia. [000134] The pharmaceutical compositions may comprise one or more pharmaceutically acceptable excipients and 7MX, preferably 7MX may be in a concentration ranging from about 0.1 wt% to about 99 wt% of the pharmaceutical composition. Example 1 - Materials and Methods 1.1 Plasmid Construction [000135] Oligos and constructed plasmids are listed in Figs.12-21 and Tables 2 and 3 (Figs.22-23). 1.1.1 Construction of pBLT2-ndmABCD plasmid [000136] Genomic DNA from P. putida CBB5 was extracted using GeneJETTMGenomic Purification Kit (Thermo Fisher Scientific, USA) according to manufacturer’s instructions. All genes were amplified using Q5 High-Fidelity 2X Master Mix (NEW ENGLAND BioLabs). Plasmids were constructed in pBLT-2 vector backbone such that the genes are under control of the tac promoter. [000137] Gene fragments ndmA, ndmB, ndmC and ndmD were amplified from P. putida CBB5 according to sequence information available in GenBank. ndmA and ndmB were amplified separately with 15-20 bp regions upstream to include the original ribosomal binding sites while ndmC and ndmD were amplified together. NEBHi-Fi DNA assembly was performed using plasmid assembly kit (NEB) in a thermal cycler for 1 hour. [000138] A sample of 2.5 µL from the plasmid assembly mixture was transformed to 50 µL of DH5α-Iq competent cells and kept on ice for 30 min. Then a heat shock at 42 °C was given for exactly 30 s on a heat block and the mixture was kept immediately on ice for another 1-2 min. [000139] 500 µL of SOC liquid growth medium was added to this cell suspension and kept at 37 °C for 1 hour for recovery. Cells were then harvested by centrifuging for 1 min at 14000 rpm followed by the removal of SOC medium and addition of 1 mL of LB broth with 1 µL of kanamycin. [000140] A volume of 200 µL was plated on a LB-kan plate and incubated at 37 °C overnight. On the following day morning, individual colonies were screened for the presence of ndmABCD gene fragment using PCR. Two confirmed colonies were picked and cultures in a 5 mL LB broth with 5 µL of kanamycin as the antibiotic selection. Plasmid extraction was done in the following day using the GeneJetTMmini- prep kit (Thermo Fisher Scientific, USA) and sent out for sequencing. 1.1.2 Construction of pBLT2-ndmABD plasmid [000141] The pBLT-2-ndmABCD plasmid was subjected to Q5 mutagenesis with mutagenesis primers designed using the NEBaseChanger available at nebasechanger.neb.com. A mutagenesis reaction was carried out in a SimpliAmp™ Thermal Cycler (Applied Biosystems™, Thermo Fisher Scientific, USA). The obtained reaction mixture was then subjected to a KLD digestion using KLD enzymemixture (NEW ENGLAND BioLabs Inc., USA) according to manufacturer’s instructions. [000142] In brief, 1 µL from the PCR mix, 5 µL of KLD reaction buffer (2×), 1 µL of KLD reaction mix (10×) and 3 µL of nuclease free water was mixed together by pipetting several times. The mixture was then incubated at 30 °C for 5 min.5 µL of KLD digested plasmid mixture was then transformed to DH5α-Iq competent cells. A colony PCR using MyTaq™ Mixture was done to confirm the removal of ndmC gene fragment (855 bp) in a thermal cycler (SimpliAmp™ Thermal Cycler, Applied Biosystems™, Thermo Fisher Scientific, USA), followed by agarose gel electrophoresis. Two confirmed colonies were cultured in 5 mL LB broth with 5µL of kanamycin and sent out for sequencing after plasmid extraction (GeneJETTMPlasmid Miniprep Kit, Thermo Fisher Scientific, USA). 1.1.3 Construction of pBLT2-fdhA, pBLT2-fmdEFGH and pBLT2-fdhA- fmdEFGH [000143] The pBLT2-fdhA and pBLT2-fdhA-fmdEFGH plasmids were constructed in a pBLT2 vector with chloramphenicol antibiotic selection whereas pBLT2-fmdEFGH plasmid was constructed in a pBLT2 vector with kanamycin antibiotic selection marker. The vector fragments were amplified using LJ671 and LJ672 primers. [000144] Each gene fragment, fdhA and fmdEFGH, was amplified using respective primers with Q5 PCR master mixture (Q5 High-Fidelity 2X Master Mix, NEW ENGLAND BioLabs, USA) according to manufacturer’s instructions using P.putida KT2440 genome (GeneBank accession NC_002947 NZ_AE016774- NZ_AE016794) as a template. [000145] The amplified fragments were confirmed using agarose gel electrophoresis and were followed by a gel extraction using Thermo Fisher Scientific GeneJETTMGel Extraction Kit (Thermo Fisher Scientific, USA). A plasmid assembly was done using In-FusionTMSnap Assembly Master Mixture (Takara Bio USA, Inc.) and the assembled plasmid mixture was transformed to DH5α-Iq competent cells with respective antibiotic selections. Colony PCR was done to confirm presence of gene fragments in newly formed colonies. Two selected colonies from each transformation were sent out for sequence confirmation. 1.2 Strain Construction 1.2.1. Construction of strains with pBLT2-ndmABCD and pBLT2-ndmABD plasmids [000146] Sequence-verified plasmids were transformed into P. putida KT2440 and P. putida EM42 transformation competent cells by adding 2.5 µL of a plasmid to 50 µL of competent cells. The plasmid added competent cells were kept for 10 min on ice followed by electroporation in an electroporation cuvette (Bull Dog Bio, USA) using an electroporator (Eppendorf Operator, Hamburg, Germany). [000147] 500 µL SOC growth medium was added, mixed and the mixture was incubated for 1 hour at 30 °C shaking at 225 rpm. The cells were then harvested by centrifuging at 14,000 rpm for 1 min (ThermoTMSorvallTMLegend Micro 21, Thermo Fisher Scientific, USA). SOC medium was removed by centrifugation at 13,000 rpm for 2 min and cells were re-suspended in 1 mL of LB broth with 1µL of Kanamycin. Nearly 200 µL of the culture was plated on a LB agar plate with kanamycin and keptovernight in an incubator at 30 °C. Individual colonies were obtained and cultured in LB broth in the following day to be used in the culture reactions. [000148] Similarly, for construction of P. putida KT2440 and P. putida EM42 strains with pBLT-2-ndmABD plasmid, 2.5 µL from pBLT-2-ndmABD sequence- verified plasmid was added instead of the pBLT-2-ndmABCD plasmid during transformation. 1.2.2. Construction of strains with pBLT2-ndmABD, pBLT2-fmdEFGH-fdhA plasmids [000149] The pBLT-2-fmdEFGH-fdhA plasmid with chloramphenicol resistance was transformed into P. putida EM42-ndmABD competent cells in order to form the strain P. putida EM42-ndmABD-fmdEFGH-fdhA. Further, control strain P. putida EM42-fmdEFGH-fdhA was constructed by transforming pBLT-2-fmdEFGH-fdhA plasmid and pBLT-2 plasmid with kanamycin resistance to P. putida EM42 competent cells. [000150] To form a double-control strain, pBLT-2 plasmid with kanamycin resistance and pBLT-2 plasmid with chloramphenicol resistance were transformed into P. putida EM42 competent cells. 1.2.3. Genome integration of ndmABD genes into P. putida EM42 genome [000151] sK18sb plasmid was selected as the suicide vector (containing sacB) for genome integration. The intergenic region between PP_3735 and vanA locus was selected to integrate ndmABD with Ptac promotor and a synthetic ribosome binding site (RBS), and the tonB and soxR terminators were added to insulate the gene cassette. sK18Sb plasmid was digested with XbaI and SalI restriction enzymes, 1000bp up and down homologous arms were amplified by PCR using P. putida KT2440 genome, and ndmABD region along with promotor and terminator was amplified from pBLT-2-ndmABD plasmid by PCR. The fragments were gel-purified and assembled using an infusion cloning assembly mix following the manufacture protocol (TAKARA Bio USA Inc). A 2.5 µL sample from the assembly mix was transformed to SteellarTMcompetent cells following the protocol provided by the vendor (see supplementary material). Eight colonies were screened by a colony PCR to confirm the presence of the constructed sK18-ndmABD plasmid. Two positive colonies were selected, and plasmids were extracted using a Thermo Fisher Scientific plasmid isolation kit. The selected plasmids were transformed into P. putida EM42 competent cells. The culture was plated on an LB plate with kanamycin. Isolated colonies were then streaked for isolation in two sucrose plates for two consecutive days. [000152] A colony PCR was done using primers that specifically bind to ndmABD gene fragments to confirm the existence of caffeine metabolizing genes for colonies in the second sucrose plate. Two patch plates, one with LB and the other with LB + kanamycin, were streaked. The colonies that grew on the LB plate but not on LB + kanamycin plate were selected and cultured in 5 mL LB broth. These cells were separately cultured in 2X M9 minimal medium + (2 mM) caffeine to test for the phenotype. Strains (The Strain GI- P. putida EM42::Ptac-ndmABD) that utilized caffeine in the culture after 24 h were selected as successfully genome integrated. A test for phenotype was carried out in duplicates.1.3 Shake flask test for caffeine metabolism and 7-methyl xanthine production by P. putida-ndmABCD [000153] Preliminary tests for P. putida KT2440 containing ndmABCD plasmid were carried out in 250 mL flasks at a volume of 10 mL with P. putida KT2440 with pBLT-2 plasmid as the control strain. Cells were first grown overnight in LB broth and harvested by centrifugation on the following day. The harvested cells were then re-suspended in 2X M9, containing 40 mM of glycerol. The cells were re-harvested after 10 hours and were cultured in flasks containing 2X M9 minimal salt medium, 40 mM of glycerol and 5 mM / 10 mM of caffeine. Initial OD600 was adjusted to 1.00. Kanamycin was added to all the cultures containing pBLT-2 plasmid. Reactions were carried out at 30 °C and shaking at 260 rpm / h. Samples (1 mL) collected soon after setting up the culture (0 h) and at regular intervals were analyzed for OD600 and for methylxanthine contents in HPLC instrument equipped with a PDA detector. 1.4 Shake flask test to evaluate the effect of pBLT2-fmdEFGH-fdhA plasmid in P. putida EM42-ndmABD [000154] Shake flask cultures of EM42-ndmABD-fmdEFGH-fdhA, P. putida EM42-ndmABD, P. putida EM42-fmdEFGH-fdhA and P. putida EM42 with kanamycin and chloramphenicol resistance were carried out in 250 mL flasks at a volume of 10 mL. P. putida EM42-fmdEFGH-fdhA and P. putida EM42 with kanamycin and chloramphenicol resistance were cultured as the control strains. Cells were first grown overnight in LB broth and harvested by centrifugation (5000 rpm) in the following day. The harvested cells were then re-suspended in 2X M9 containing 40 mM of glycerol. The cells were re-harvested after 10 hours and were cultured in 250 mL flasks containing 2X M9 minimal salt medium, 40 mM of glycerol and 5mM / 10mM of caffeine.[000155] The initial OD600 was adjusted to 1.00. Kanamycin and chloramphenicol were added to all the cultures. Reactions were carried out at 30 °C and shaking at 260 rpm. Samples (1 mL) collected soon after setting up the culture (0h) and at 3h intervals. Samples were then centrifuged (14000 rpm for 15 min), filtered (0.22 µm) and analyzed for methylxanthine contents in HPLC instrument after OD600 measurement. 1.5 Shake flask test to evaluate the effect of ndmABD genome integrated strain as compared to ndmABD plasmid bearing strain. [000156] Shake flask experiment of the genome integrated P. putida EM42::Ptac- ndmABD with pBLT-2 empty plasmid with kanamycin resistance (GI) and P. putida EM42 plasmid bearing strain (P. putida EM42 + pBLT-2-Ptac-ndmABD) were carried out in 250 mL flasks at a culture volume of 10 mL. Cells were first grown overnight in LB broth and harvested by centrifugation (5000 rpm) on the following day. The harvested cells were then re-suspended in 2X M9 containing 40 mM of glycerol (carbon source for growth). The cells were re-harvested after 10 hours and were cultured in 250 mL flasks containing 2X M9 minimal salt medium, 40 mM of glycerol and 5 mM of caffeine. Initial OD600was adjusted to 1.00. Kanamycin was added to all the cultures. Reactions were carried out at 30 °C, shaking at 260 rpm. Samples (1 mL) collected soon after setting up the culture (0 h) and at 3 h intervals up to 12 h. Samples were then centrifuged (14000 rpm for 15 min), filtered (0.22 µm) and analyzed for methylxanthine contents in HPLC instrument after OD600measurement. [000157] Similarly, 90% (v / v) green tea or coffee OHD culture tests were carried out by adding 9 mL of OHD-Green tea or coffee, 2X M9 minimal salt medium, and 40 mM of glycerol. Bacterial cultures included P. putida containing EM42::ΔglpR::Ptac-ndmABD + pBLT-2-Plac-fmdEFGH-fdhA and control strain which did not contain the two operons were prepared as described above. The initial OD600of all cultures was adjusted to 1.00. [000158] Preparation of Oxidative Hydrothermal Dissolution (OHD) waste green tea or coffee was performed as follows. The OHD of waste green tea obtained from Ito En LCC, USA was prepared by wet milling (automated mortar and pestle) to pass an 18-mesh sieve and then diluted to ~1-2% (w / v) with deionized water. A laboratory-scale OHD reactor was operated at about 220-350oC, 2000 psi, O2 ~ loading 0.5-0.8, and retention time ~ 15 s; the OHD substrate was concentrated up to 8 g / L of total organic carbon (TOC) using a laboratory scale RO unit. The pH of the OHD slurry was adjusted to 7 using NaOH and filtered with 0.22 µm filter to sterilize the substrates. 1.6 Identification and quantification of caffeine and related methylxanthines. [000159] Identification of caffeine and related methylxanthines such as 7- methylxanthine, theobromine and paraxanthine, and their quantification was done using a high-pressure liquid chromatography (HPLC) system (Shimadzu LC-2050 series, Shimadzu Corporation) on a Shim-pack Velox C18 column (2.7µm, 4.6 × 100 mm). An isocratic elusion program with a mobile phase composition of Water: Methanol: Acetic Acid in the ratio 85:15:0.5 was used for the caffeine analysis whereas the same elution with a slight change in mobile phase composition to 92.5:7.5:0.5 was used for quantification of all other methylxanthines. [000160] The mobile phase flow rate was maintained at 0.4 mL / min and the column temperature was maintained at 40°C. Identification of all methylxanthineswas based on the retention time using a photo-diode array (PDA) detector coupled to an HPLC system. For quantification, matrix matched calibration curves were prepared with authentic standards for each analyte in M9 solution. 1.7 HPLC-Based Separation of 7-methylexanthine [000161] Separation was carried out in a HPLC system (Shimadzu LC-2050 series, Shimadzu Corporation) on a Shim-pack Velox C18 column (2.7µm, 4.6 × 100mm). An isocratic elution program was used with water: methanol: acetic acid in the ratio 92.5: 7.5:0.5. [000162] A sample containing 7-methylxanthine was injected (20 μL) and fractions were collected following the 7-methylxanthine retention time. The collected sample was re-analyzed in the same HPLC system and back calculated for extraction efficiency. Extraction and analysis were carried out in duplicates. Example 2 - Conversion of Caffeine to 7-Methylexanthine by Engineered P. putida KT2440 [000163] The ndmABCD operon from P. putida CBB5 was PCR amplified and added to pBLT-2 vector containing the tac promotor and a synthetic ribosomal binding site (RBS syn) (Fig.1A). The sequence-verified plasmid was transferred into P. putida KT2440 and developed into a strain referred in this disclosure as the KT ABCD strain. [000164] The KT ABCD strain converts caffeine to 7-methylxanthine with nearly 100% yield in a minimal salt media (M9) supplemented with 40 mM of glycerol as shown in Figs.1B and 1C, wherein the KT ABCD strain was grown in a 50-mL shake flask containing 10 mL of 2X M9 supplemented with 1 mM caffeine and 40 mMglycerol. The initial OD600of the culture was set at 0.1. The culture was incubated at 30oC with shaking at 225 rpm / h. Figs.1B and 1C represent a value average of n=3. [000165] The inventors observed that the KT ABCD strain was growing very slowly in M9 medium supplemented with 20 mM glucose and was unable to convert caffeine to 7-methylxanthine completely (data not shown). [000166] As the alternative substrate for culturing the KT ABCD strain, the inventors used biodiesel byproduct glycerol as the sole carbon source. Unlike glucose, the KT ABCD strain grows in glycerol without significant growth delays and converts caffeine to 7-methylxanthine effectively, as reported in Figs.1B and 1C. [000167] Next, the inventors increased the initial cell density to OD600=1.0 and performed a reaction in a 250-L shake flask (scale-up), demonstrating nearly complete conversion of 5 mM of caffeine to 7-methylxanthine within 12 hours (Fig.2). This experiment was performed in a 250-mL shake flask containing 25 mL of 2X M9 supplemented with 5 mM caffeine and 40 mM glycerol. The initial OD600of the culture was set at 0.8. The culture was incubated at 30oC with shaking at 225 rpm / h. The reported data is a value average of n=2. [000168] Nearly 95% of produced 7-methylxanthine was recovered from the culture broth by chromatography, using HPLC system (Shimadzu LC-2050 series, Shimadzu Corporation) equipped with a Shim-pack Velox C18 column (2.7µm, 4.6 × 100 mm). [000169] As the alternative to HPLC purification, a solvent-based purification of 7-methylxanthine was also performed. Various solvents were tested as listed in Table 1, but the yield was lower in comparison to purification by HPLC.Table 1: Solvent-Based Extraction of 7-methylxanthineExample 3 - Redox coupling to enhance caffeine conversion to 7MX by engineered P. putida [000170] The P. putida EM42 is a robust genome-reduced strain of P. putida KT2440 and has a high ATP and redox content relative to wild-type strains. c) The inventors have found that genome-reduced P. putida EM42 harboring ndmABD (Caffeine to 7MX) can grow better and has a higher rate of caffeine conversion relative to its parental strain P. putida KT2440 (Figs.3A and 3B). The inventors also removed ndmC from the original construct (Fig.1A) in order to improve conversion of caffeine to 7-methylxanthine. [000171] Next, the inventors used an innovative approach of coupling N- demethylation with redox cofactor engineering (redox balance) in order to produce a robust microbial platform for making 7MX. As shown in Figs.4A and 4B, the inventors overexpressed formaldehyde dehydrogenase and formate dehydrogenase in order to remove formaldehyde which was generated during conversion reactions of caffeine to 7MX. As shown in Fig.4A, this reaction can use NAD+generated in the caffeine-to-7MX reaction and produces NADH. Co-expression of the N- demethylation operon (ndmABD) and the formate and formaldehyde operon (fmdEFGH-fdhA) further enhanced growth in caffeine-containing medium andenabled rapid utilization of 10 mM caffeine within 12 hours (Figs.4A-4B). In contrast, the parent strain expressing only ndmABD (without fmdEFGH-fdhA operon) took 24 hours to use caffeine and exhibited a long lag-phase of growth. This data unveiled that the new redox coupling reaction alleviates chemical toxicity of caffeine catabolic reaction. [000172] The inventors tested this strain capability for producting 7MX. As shown in Figs.5A and 5B, a strain co-expressing ndmABD and fmdEFGH-fdhA enables complete conversion of caffeine to 7MX more efficiently relative to the control strain expressing only ndmABD. The rate of caffeine utilization is statistically significantly higher in the strain that has the redox coupling capability relative to the control strain which does not have this capability (0.001< p). The new strain achieved nearly a 100% caffeine-to-7MX conversion (mol / mol) within 9 hours, and the highest conversion rate was reported to date. Indeed, the rate of caffeine to 7-methylxanthine conversion was statistically significantly enhanced by overexpressing genes necessary for formaldehyde convertion to carbon dioxide (Fig.5A and 5B). Example 4 – Genome-Engineered P. Putida EM42 to Produce 7-Methylxanthine [000173] In order to engineer an industrially relevant production strain without an antibiotic marker and to achieve a more stable expression than expression which can be achieved with plasmids, the inventors have successfully integrated the synthetic gene cassette containing ndmABD under the tac promotor into P. putida EM42 genome (P. putida EM42::Ptac-ndmABD). d) The strain grew in the presence of caffeine. An HPLC analysis confirmed conversion of caffeine to targeted 7-methylxanthine. Like a plasmid-based expressionstrain, the genome-integrated strain utilizes 5 mM caffeine within 12 h and converts it to 7-methylxanthine (Figs.6A-6C, reporting a nearly 100% mol / mol yield). Notably, a strain in which the N-demethylation operon is integrated into a bacterial genome grows and consumes caffeine better than a strain in which the N-demethylation operon is expressed from a plasmid. Example 5 - Fed-Batch Process Enhances 7-Methylexanthine Production [000174] As reported in connection with Figs.5A and 5B, strain P. putida EM42 expressing ndmABD and fmdEFGH-fdhA converts 5 mM caffeine to 5 mM 7-MX at nearly 100% yield (mol / mol). [000175] However, some preliminary data suggests that when growth medium is supplemented with 10 mM caffeine (substrate), the yield of 7-MX may drop down to 55%. The inventors tested the ability of strains to produce 7-MX with a fed-batch approach in a shake-flask experiment. They determined that engineered P. putida EM42 (ndmABD genome integrated and plasmid-based expression of fmdEFGH-fdhA, P. putida EM42:: Ptac-ndmABD + pBLT-2-Plac-fmdEFGH-fdhA) produces 30% more 7-MX in the fed-batch process within 12 h when supplemented with 10 mM caffeine at the beginning of the growth cycle (Figs.7A and 7B). [000176] The inventors’ engineered monoculture approach enables production of 7.61 mM of 7-MX from caffeine (9.2 mM) within 12 h in a shake-flask, when the starting culture has OD600=1, which is a 6-fold improvement in a titer relative to E. coli consortia.Example 6. Deletion of glycerol repressor, glpR to enhance the P. putida EM42 growth on glycerol. [000177] In this experiment, glycerol was used as the sole source of carbon for growing the strain for 7-methylxanthine production. However, P. putida shows a long lag in growth when grown on glycerol. [000178] Hence, the inventors knocked out glycerol repressor, glpR, in P. putida EM42. The strain showed a faster growth on glycerol relative to the parental strain (Fig.8A). Next, the inventors successfully knocked out glycerol repressor glpR gene in P. putida EM42 containing gnomically integrated ndmABD and inserted the pBLT- 2-Plac-fmdEFGH-fdhA. As shown in Fig.8B, this strain can grow faster on glycerol and converts caffeine to 7-methylxanthine more efficiently (Fig.8B). Example 7 – The Effect of Culture Initial OD on caffeine conversion yield and rate [000179] Experimental data reported in this disclosure show that a high concentration of caffeine inhibits growth of P. putida EM42. It is also reported in this disclosure that the EC50 value is around 10 mM (EC50-effective concentration inhibits 50% growth). [000180] The inventors have determined that the high initial concentration of caffeine-degrading cells could enhance a tolerance of the monoculture and increase the conversion rate for caffeine into 7MX. The inventors tested the effect of different initial cell concentrations of engineered P. putida EM42::ΔglpR::Ptac-ndmABD + pBLT-2-Plac-fmdEFGH-fdhA on the conversion rate of caffeine into 7-methylxanthine. The data revealed that the high cell density can enhance the reaction's titer, yield, and rate. Indeed, at OD=5, the titer of 7-methylxanthine was 9.34 ± 0.09 mM and had a rate of 0.97 ± 0.03 mM / h, which was statistically significantly higher (p < 0.05) thanthe rate at OD=1 or 2, and the highest yield 98.33± 2.35 was observed at OD=5 relative to the other tested condition. Example 8 - Demonstration of conversion of caffeine in waste green tea and coffee OHD samples to 7-methylexanthine [000181] An HPLC analysis revealed that the waste Green Tea and the coffee OHD samples contain caffeine and theobromine (about 1.6 mM). We demonstrated that genetically engineered strain (P. putida EM42::ΔglpR::Ptac-ndmABD + pBLT-2- Plac-fmdEFGH-fdh) enables conversion of caffeine and theobromine from OHD samples to 7-methylxanthine within 24 hours, with nearly a 100% yield. Conversion of caffeine in waste streams provides an additional income source to the beverage industry and enables establishing a zero-waste process strategy. Example 9 - Conversion Of Caffeine To Methylated Xanthine In Glycerol Supplemented Media [000182] Method: For the experiment, the engineered P. putida EM42 with plasmid (LJBJ120) were placed in 5 mL of LB liquid medium supplemented with antibiotics (50 mg / L Kanamycin) were added for plasmid-based selection and incubated overnight at 30 °C, shaking at 250 rpm. The antibiotic was not added to the culture containing the wild-type or genome-edited strain without plasmid. The cells were harvested in the following day by centrifugation at 4500 rpm. The cell pellet was washed with 2X M9 solution and inoculated in 50 mL cultures of 2X M9 supplemented with 40 mM glycerol for 12h at 30 °C, shaking at 250 rpm (respective antibiotic added). The cultures were again centrifuged, pelleted, and resuspended in 2X M9. The cultures incubated in glycerol were then added into 10 mL test cultures (in 250 mL shake flask) with caffeine supplemented with 40 mM glycerol andantibiotics. Genome-integrated strains were cultured similarly without antibiotics unless resistant plasmids were added. [000183] Results: We observed the NdmABD expressing P. putida EM42 unable to convert the 5 mM of caffeine to 7-MX in M9 medium supplemented with 20 mM glucose. Given that caffeine might inhibit glucose utilization and catabolically repress the caffeine to methylated xanthine conversion, we used glycerol as an alternative substrate and as the sole source for cells' growth and energy production. The wild-type P. putida EM42 exhibits a long lag (24 h) to grow in glycerol media; we successfully knocked out the glpR, a glycerol repressor, and developed the LJBJ120 strain. The strain enables shortening the strain lag phase in M9 media containing glycerol (Fig. 24A). The overexpression of the NdmABD in LJBJ120 enables the conversion of 5 mM caffeine to 7-methylxanthine, nearly 100% yield, in M9 containing 40 mM glycerol media (Fig.24B). Notably, we observed the accumulation of theobromine and paraxanthine (0.23 mM at 6 h) during the reaction (Fig.24B). Given that expression of loop-swapped double mutant NdmA (N282Q and F286L), we envisioned that the developed process can be used to manufacture the high-value paraxanthine. Example 10 – Obtaining a high titer of 7-MX, using a robust genome engineered strain and process optimization. [000184] Plasmid construction: Q5 HotStart High-Fidelity2×MasterMix (NewEnglandBiolabs) and primers synthesized by Integrated DNA Technologies (IDT) were used in all PCR amplification. Plasmids were constructed using Hi-Fi DNA assembly (New England Biolabs) according to the manufacturer's instructions.Primers used for PCR amplification are listed in Table S1 (Fig.25). Gene integrations were done by plasmids constructed in sK18sB which is unable to replicate in P. putida EM42 and contains the kanamycin-resistant marker to select for integration of the plasmid into the genome by homologous recombination and sacB to counter-select for a second recombination event to remove the plasmid backbone from the genome subsequently. [000185] Strain construction: Gene replacements were made using the sacB system of selection and counter-selection. Briefly, cultures were grown overnight in LB broth and incubated at 30 °C, shaking at 250 rpm. The next day, cells were centrifuged at 4500 rpm for 5 min at room temperature and washed three times in 300 mM sucrose in half the original volume. Finally, the cells were resuspended in 1 / 50thof the culture's original volume in 300 mM sucrose. Plasmid transformation was done by introducing 5 μL (200 ng – 1 μg) of plasmid DNA to 50 μL of the electrocompetent cells, transferred to a chilled 0.1 cm electroporation cuvette, and electroporated at 1.6 kV, 25 μF, 200 Ω. Subsequently, 950 μL SOC (NEB) was added and the cells were incubated shaking at 250 rpm, 30 °C, for 1.5 h.200 mL of transformation mix was plated on an LB agar plate containing appropriate antibiotics and incubated at 30 °C overnight. [000186] For sucrose counter-selection, clonal transformants were streaked on YT plates containing 30% (YT+30%; w / v) sucrose (10 g / L yeast extract, 20 g / L tryptone, 250 g / L sucrose, 18 g / L agar), and incubated at 30 °C overnight. P. putida EM42 containing the sacB gene can grow slowly on YT+30% sucrose media. Therefore, single colonies presumed to have lost the sacB gene via homologous recombination,indicated by larger colonies, were picked, and re-streaked on fresh YT+30% sucrose plates and incubated at 30 °C overnight to finally obtain clonal sucrose-resistant and antibiotic-sensitive strains. [000187] To integrate the tac-driven ndmABD into the intergenic region of vanAB (LJBJ500), the plasmid Sk18:: Ptac-ndmABD was utilized. Additionally, an extra copy of fdhA under the tac promoter was integrated into the glpR locus using the Sk18::Ptac- fdhA plasmid. This plasmid also facilitated the simultaneous knockdown of glpR in the P. putida EM42 strain. The obtained strain was named as LJBJ600. Several strains with plasmids (with pBLT-2 as a vector) were constructed for systematic testing of redox cofactor engineering under the ndmABD genome integration background, LJBJ500 (refer to Table S2 in Fig.26). Example 11. Production of 7-MX and Culture Conditions [000188] The developed strains for the 7- methylexanthine production was cultured in 5 mL of LB liquid medium and incubated overnight at 30 °C, shaking at 250 rpm, of the strain carry the plasmid the respective antibiotic was added to the culture medium (50 mg / L Kanamycin and / or 25 mg / L chloramphenicol). The cells were harvested in the following day by centrifugation at 4500 rpm. The cell pellet was washed with 2X M9 solution and inoculated in 50 mL cultures of 2X M9 supplemented with 40 mM glycerol for 12h at 30 °C, shaking at 250 rpm (respective antibiotic added). The cultures were again centrifuged, pelleted, and resuspended in 2X M9. The cultures incubated in glycerol were then added into 10 mL test cultures (in 250 mL shake flask) with caffeine supplemented with 40 mM glycerol. Samples were collected at definite time intervals, centrifuged, filtered, and analyzed in HPLCsystem (Shimadzu LC-2050 series, Shimadzu Corporation) on a Shim-pack Velox C18 column (2.7µm, 4.6 × 100 mm), equipped with PDA detector at 254 nm for the quantification of caffeine and theobromine. Example 12. Scale up 7-methylxanthine production using the bioreactor [000189] Distek, Bione 1250 (Distek, Inc, NJ, USA) bioprocess control station BiOne with 5-L glass vessel was used for the bench-scale bioreactor production of 7- methylxanthine. LJBJ600 was pre-cultured in LB broth overnight, and the cells were pelleted by centrifugation at 4500 rpm for 10 min. The cell pellets were washed with 2X M9 and inoculated in 2 L of 2X M9 supplemented with 40 mM glycerol in the bioreactor to an initial cell density of (OD600= 0.5). The cells were allowed to grow in 2XM9 media for 24 h, OD600= 5, and 10 mM of caffeine was fed to the culture along with spikes of 40 mM glycerol at 0, 6, and 12 h time points. The bioreactor was maintained at 300C with agitation at 400 rpm, and the O2 was maintained at saturation level. Samples were collected and analyzed in HPLC periodically to monitor caffeine utilization and glycerol content (Fig.27A-27C). Another 10 mM of caffeine dissolved in 2X M9 was added at 12 h. The pH, temperature, and dissolved oxygen (DO%) were monitored and controlled using the BiOne control station and in- build software. [000190] Result: First we confirmed the phenotype of the LJBJ 550 strain (P. putida EM42::glpRΔ:PtacndmABD + pBLT2-Plac-fdhA-fmdEFGH ) that contains the genome integrated tac promotor driven ndmABD and plasmid-based expression of formaldehyde detoxification / redox balancing pathway enable the conversion of 5 mM of caffeine to the 7-methylexanthine within 6 hours at 100% yield (data not shown).We found that the plasmid expression of fdhA under tac promoter (LJBJ551) is sufficient to enable the redox balance and efficient conversion of 10 mM caffeine to the product. Hence, we developed the LJBJ600 (P. putida EM42::glpRΔ:PtacndmABD::Ptac-fdhA) strain by adding the extra copy of tac-driven fdhA into the genome of LJBJ 500 strain (P. putida EM42::glpRΔ:PtacndmABD). The strain enables compete conversion of 10 mM of caffeine to 7-MX (Figs.27A and 27B) and exhibits a better redox balance relative the LJBJ 502 strain that only express ndmABD (Fig.27C). [000191] Next, we tested the strain capability to convert the high concentration of caffeine (> 10 mM) to 7-MX, in batch culture and initial OD600=1, but the strain unable to convert all the caffeine to 7-MX the concentration > 10 mM (data not shown). We observed the both caffeine and 7-MX impose severe chemical toxicity to the cells (data not shown). Hence, we hypothesized that the increasing cell density in the reaction would improve the rate, yield, and titer. As shown in the Fig.28A, the high initial cell density (OD600=100) enabled the conversion of high concentration of caffeine to 7-MX, and fed-batch process (feeding caffeine at different interval) enhanced the 7-MX titer upto 45 mM. We investigated the cell density effect of the final titer and found that increase the initial cell density statistically significantly enhanced the titer (Fig.28B, p < 0.05). Notably, we found that yield remained unchanged with tested different initial ODs, and the rate was high at initial OD 20, 50, and 100 and relative to the lower ODs (Data not shown). The rate was not significant different between the OD600=20 or OD600=100. Hence, we decided to optimize the process parameters (e.g., feeding rate) with the initial OD600=20.[000192] Our data on methylxanthine toxicity for P. putida EM42 revealed that the initial high concentration of caffeine inhibited cell growth and increased cell death (Figs.29A-29C). In addition, a comparison of rates of caffeine utilization and 7- methylexanthine production hampered by the high concentration of caffeine. We hypothesize that lowering the initial caffeine concentration and feeding at sub lethal concentration via the fed-batch process (below the EC50 value of caffeine, 10 mM) enable us to enhance the caffeine utilization and final titer (Figs.29A and 29B). Our data suggest that the fed-batch process started with 5 mM of caffeine and fed caffeine at 5 mM, obtaining about 56 mM of 7- methylexanthine (9.3 g / L) with initial OD600=20 cell density. The cell survival during the process is statistically significantly higher than the batch feeding starting with 20 mM of caffeine (p < 0.01). To our knowledge, we produced the highest 7- methylexanthine titer using the antibiotic / plasmid-free, industrially applicable, robust LJJL600 strain. Example 13. Purification of 7-methylxanthine from the culture broth. [000193] Method: The culture was cooled down below 40C by stored in the cold room or refrigerator to precipitate 7-methylxanthine. Then the culture broth was centrifuged in 50 mL falcon tubes at 5000 rpm for 10 min to separate media, cells, and 7-methylxanthine, which was accumulated in the bottom (S22 A). The cells and the media were then removed while the 7-methylxanthine pellets were pooled and dried in a vacuum evaporator at 600C for 6 h, alternatively the freeze drying can be adopted to lyophilize the compound. The powder was then weighed and stored in an air-tied container.[000194] Detection and quantification of methylxanthines. Caffeine and related methylxanthines (7-methylxanthine, theobromine, and paraxanthine) identification and quantification were done using an HPLC system (Shimadzu LC- 2050 series, Shimadzu Corporation) on a Shim-pack Velox C18 column (2.7µm, 4.6 × 100 mm). An isocratic elution program with mobile phase composition of Water: Methanol: Acetic acid in the ratio 85: 15: 0.5. The Mobile phase flow rate was maintained at 0.36 mL / min and the column temperature was maintained at 40°C. Identification of all the methylxanthines was based on the retention times using the photo Diode Array (PDA:260 nm) detector coupled to the HPLC system. For quantification, matrix-matched calibration curves were prepared with authentic standards for each analyte in M9 solution. The analytical method was partially validated according to European Medicines agency’s guidelines on the validation of analytical procedures. See supplementary materials for validation parameters and method performance. [000195] Glycerol was quantified in the same HPLC system in an Rezex TM ROA-Organic acid H+ (8%) Column (300 mm 7.8 mm, Phenomenex, USA) using an isocratic elution of 0.005 N H2SO4 in water. The column oven was maintained at 30 °C. Quantification was based on the RID detector coupled to the Shimadzu HPLC. A matrix-matched calibration curve was obtained in M9 minimal media using standard glycerol at varying concentrations. Example 14. Analytical characterization of methylxanthines. [000196] Caffeine, 7-methylxanthine, and intermediate products (theobromine and paraxanthine) were quantified by HPLC coupled to PDA detector as describedabove.7-methylxanthine produced in bacterial cultures was first confirmed by Liquid chromatography separation coupled to time-of-flight mass spectrometry (LC / TOF / MS) using a Waters Q-TOF operated in Electrospray ionization positive mode (ES+). The resulting ion chromatograph is found in the supplementary material. [000197] Purity of the 7-methylxanthine was confirmed using HPLC and NMR. The NMR results were obtained from the NMR facility in Department of Chemistry, Southern Illinois University Carbondale. The spectrum was recorded in DMSO-d6 with a Bruker DRX 500 NMR spectrometer at 299 K. The chemical shifts were relative to DMSO-d6 using the standard δ notation in parts per million. [000198] Quantification of endotoxin content in extracted 7-methylxanthine powder. Endotoxin and lipopolysaccharides (LPS) detection and quantification were done using Genscript ToxinSensor™ Chromogenic LAL Endotoxin Assay Kit detected at a concentration of < 20 EU / mg (Genscript Biotech Corp., Piscataway, NJ, USA) designed to quantify In Vitro end-point endotoxin test for human and animal parenteral drugs, biological products, and medical devices according to manufacturer’s instructions. In brief, nearly 1 mg of extracted 7-methylxanthine powder was dissolved in 1 mL of LAL reagent water, in endotoxin free vials in triplicates. Calibration standards, blank and test samples were processed as instructed by the vendor and the absorbance at 545 nm was measured in Tecan Infinite M PLEX microplate reader. The endotoxin concentrations were then calculated using the calibration curve and expressed in EU / mL. [000199] Removal of lipopolysaccharides (LPS) from the extracted 7- methylxanthine. Removal of LPS was carried out using GenScript ToxinEraser™(Genscript Biotech Corp., Piscataway, NJ, USA), according to manufacturer instructions. ToxinEraser™ is a high-efficiency endotoxin removal resin based on the affinity matrix of modified polymyxin B, which allows highly efficient endotoxin removal. In brief, 10 mg of extracted 7- methylexanthine powder was first dissolved in 5 mL of DMSO and then volume up to 50 mL with water with vigorous vertexing. The ToxinEraser™ eraser column was prepared and equilibrated using the reagents provided in the kit.7- methylexanthine solution was then passed through the column at a rate of 10 drops per minute. Once 50 mL was completely filtered, the column was again re-generated and equilibrated using the regenerating reagent and equilibrating reagent provided. The sample was filtered through the column for the second time at the same rate and the filtered solution (collected in pre-weighed falcon tubes) was evaporated in a vacuum evaporator at 60 °C for 8 h. [000200] Results: LJBJ600 P. putida EM42::glpRΔ:PtacndmABD::Ptac-fdhA [000201] We scaled up the production and demonstrated the 7- methylexanthine can be produced at the 5-L Bentchtop bioreactor (Fig.30A). The most common method of extraction of methylxanthines from culture broth is the use of Prep-scale HPLC [3-5]. Due to the difficulties in scaling up and cost constraints, we investigated other alternatives which can readily be scalable and cost effective. Low temperature storage precipitated 7-methylxanthine as clumps in the bottom of the glass bottles containing spent culture broth. Centrifugation enabled separation of liquid media and cells from the 7-methylxanthine pallet which was distinguishable (Fig.30B). The obtained pale yellowish powder was then dried and used to measure purity and, subjected to analytical characterization. The initial production of 7-methylxanthine inbacterial cultures was confirmed by LC-TOF-MS / MS analysis of the filtered culture sample. The separated 7- methylexanthine confirmed with the HPLC analysis and further validated with LC-MS analysis (Fig.30C). The data showed the dried powder (Fig.30D) dissolved in water has a very similar Total ion current (TIC) profile compared to the TIC profile of the commercial 7 methylexanthine standard. Additionally, 1H-NMR and 13C-NMR spectra further confirmed the purity and the structure of biochemically produced and dried 7MX (Fig.30E). We found that the separated 7-MX contained 9.60±0.04 EU / mg LPS in the samples. We used a commercially applicable resin-based method to remove the LPS, which removed 99.5 % of the LPS. The purified samples contain about 0.052±0.003 EU / mg. Once the LPS was removed, we dried the filtered liquid and did an ethyl acetate extraction to get rid of the salts (e.g., NaCl), followed by vacuumed drying. The recovery of 7- methylexanthine was 82 +6.1%, and it the purified 7- methylexanthine is within the FDA-approved level of LPS in the final product. Example 15. Theobromine production [000202] Plasmid construction for genome integration. Q5® Site-Directed Mutagenesis Kit (NewEnglandBiolabs) and primers synthesized by Integrated DNA Technologies (IDT) were used in mutagenesis of sK18Sb-Ptac-ndmAD plasmid (constructed for 7-methylxanthine production) to remove ndmB to obtain sK18sb-Ptac- ndmAD plasmid. The plasmid was used to integrate the synthetic gene cassette at the vanAB intergenic locus to obtain the strain for producing theobromine. [000203] Strain of construction. P. putida EM42 strain knockout the glpR and integrated the one copy of tac promotor driven fdhA was used as the base strain tointroduce tac promotor-driven ndmAD, and gene replacements were made using the sacB system of selection and counter-selection. Briefly, cultures were grown overnight in LB broth and incubated at 30 °C, shaking at 250 rpm. The next day, cells were centrifuged at 4500 rpm for 5 min at room temperature and washed three times in 300 mM sucrose in half the original volume. Finally, the cells were resuspended in 1 / 50th of the culture's original volume in 300 mM sucrose. Plasmid transformation was done by introducing 5 μL (200 ng – 1 μg) of plasmid DNA to 50 μL of the electrocompetent cells, transferred to a chilled 0.1 cm electroporation cuvette, and electroporated at 1.6 kV, 25 μF, 200 Ω. Subsequently, 950 μL SOC (NEB) was added and the cells were incubated shaking at 250 rpm, 30 °C, for 1.5 h.200 mL of transformation mix was plated on an LB agar plate containing appropriate antibiotics and incubated at 30 °C overnight. For sucrose counter-selection, clonal transformants were streaked on YT plates containing 30% (YT+30%; w / v) sucrose (10 g / L yeast extract, 20 g / L tryptone, 250 g / L sucrose, 18 g / L agar), and incubated at 30 °C overnight. P. putida EM42 containing the sacB gene can grow slowly on YT+30% (w / v) sucrose media. Therefore, single colonies presumed to have lost the sacB gene via homologous recombination, indicated by larger colonies, were picked, and re- streaked on fresh YT+30% (w / v) sucrose plates and incubated at 30 °C overnight to finally obtain clonal sucrose-resistant and antibiotic-sensitive strains. The genome integration of tac promotor-driven ndmAD was confirmed by performing a colony PCR at the site of integration. The resulted strain was named as LJBJ 701. [000204] Production of theobromine and Culture conditions. The developed LJBJ701 strain for the theobromine production was cultured in 5 mL of LB liquidmedium and incubated overnight at 30 °C, shaking at 250 rpm. The cells were harvested in the following day by centrifugation at 4500 rpm. The cell pellet was washed with 2X M9 solution and inoculated in 50 mL cultures of 2X M9 supplemented with 40 mM glycerol for 12h at 30 °C, shaking at 250 rpm (respective antibiotic added). The cultures were again centrifuged, pelleted, and resuspended in 2´M9. The cultures incubated in glycerol were then added into 10 mL test cultures (in 250 mL shake flask) with caffeine supplemented with 40 mM glycerol. Samples were collected at definite time intervals, centrifuged, filtered, and analyzed in HPLC system (Shimadzu LC-2050 series, Shimadzu Corporation) on a Shim-pack Velox C18 column (2.7µm, 4.6 × 100 mm), equipped with PDA detector at 254 nm for the quantification of caffeine and theobromine. [000205] We found that the strain expressing NdmAD and FdhA, LJBJ 701, can convert 100% of 20 mM caffeine into 20 mM theobromine in a 10 mL shake flask experiment within 24 hours (data not shown). However, the strain was unable to utilize all the caffeine if the reaction started with a high concentration of caffeine at 30 mM or 40 mM. At 40 mM, the theobromine content was only 20.23±0.84. Therefore, we followed the fed-batch culture method used to optimize 7-methylxanthine production and achieved a 40.51 mM titer after 48 hours (Fig.31A). The process was scaled up in the bioreactor and demonstrated production in 3 L (Fig.31B). Theobromine can be separated using the method described for 7-methylxanthine purification from the culture broth. The production and purity of theobromine were confirmed using LC-MS and NMR.SEQ ID NO: 25 pBLT-2-Ptac-ndmABD 5’-3’ generated in the labSEQ ID NO: 26 SK18-sb-ndmABD 5’-3’ generated in the labSEQ ID NO: 27 Sk18-sb-glpR∆ 5’-3’ generated in the labSk18-sb-glpR∆ plasmid 5-3’ ttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacca actctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaact ctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaag acgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaact gagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaa caggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgcctcacacaggaaacagctatgacatgattacgaattcgagctcggtaccccg ctggtcttcattctgcagaatgtaggcatgttcgccttcatacaggcgcggcacgataatgtggctgccctggatcaggcggatgccgtaagg cgcatcgagcttgaggtcgtccttgatgaagctggccacccacgggccggcggcgttgaccagcgcgcgggcatggatcgtctggaggctgc catcggcgtgctgtagctctacctgccacaagccctctacacgttcggcgcgcaagcagcgggtgcgggtgcggatatgggcgccaagctca cgggccgccatggcgttgagtactaccaggcgggcgtcatcgacagcgcagtcggcgtattcgaagccgcgggtgattgccggcttcagcgg gtagcccgggccaaagcgcaggctgcgcgaggcgccaaggcgcttgcgcttgcccaggtggtcgtagaggaacaggccggcgcggatcat ccatgcagggcgcaggtgcgggcggtgcggaagcacgaagcgcataggtttgacgatgtggggcgccttcgccagcagcacttcgcgttca gccagggcctcgcgtacaagacgaaattcgtagtgctccaggtagcgcaggccaccgtgaatcagtttgctgctggctgacgacgtgtgttg ggccaggtcgtctttttcgcaaaggaagaccttcaagccgcgaccagcggcgtcggcagcgatgcccacgccattgatgccaccgccgatta cggcaaggtcatagcagttggctgttgggggctgggacgaaactggctgggacacgggcaaggcctcctgaggctgttcacatcgaatgtg aacattgatgttcgtttgcgaaaatattagcgcaacagaacgccggtcgccagtcagtctctatagaaaaaactgatcaaatgacaatgaag tgaacatttacgaaaattcagggggtacggcttgggtgagggggcgcttgctcacgcagacaccaaaagtctggcggcatggtcgacacta gtctcgagctgccggacaaattctgcaatgatgccgtaggaaggggatgacggccagtagacgattggggccgcatggcggccccaacagc tatcatgcctcgtgatcttcccagtcacgggtacgctcgaccgccttcttccagccggcatacagcttttctttctgcgtttcgtccagttgcggg ctgaactcacgctcgatgatcgccttgtcgcgcagctcgtccaggccactccagaagccacaggccaggcctgccagataggcggcgccca gcgccgtggtttcgcgcatctgcggccgctccacgcaggtgccgaggatgtcggcctggaactgcatgaggaagttgttggccacggcacca ccgtccacgcgcagctcggacaggcgctggccacagtcctgctgcatggcgtcgaggacatcgcgggtctggtaggcgatggactccagtgc ggcgcggatgatgtggtctaccttcacgccacgtgtcaggccgaacaacgcaccacgggcatacgggtcccagtacggggcacccaggccg gtaaaggctggcaccaggtacacgccattgctgtccttgaccttgctggcgaaatactcggtatccagggcgtcgttgacgatcttcagttcgt cacgcagccattgcacggtagagccaccattgaataccgcgccttccagtgcataggccacctcaccacgcgggccgcaggcaatggtcgtg agcaggccgtgggacgacttcaccgcctggtcgcccgtgttcatcaacaggaagcagccagtgccgtaggtattcttggcttggcccggctcc acgcacatctggccgaacagtgccgattgctggtcgccggcgataccggcgatggctatgccgctcttggtgtggccgtacacttccgaggat gggcgcacctcaggcagcatctgccgcgggatgcccaggatttccagcagcttgtcgtcccactgcaggctgtggatgttgaacctgcaggc atgcaagcttggcactggccgtcgttttacaacgtcgtgaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaac aggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggc acaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgc cctgaatgaactccaagacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaag cgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctg atgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatg gaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcggatgc ccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtgg ccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcct cgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgacgatgaacatcaaaaagt ttgcaaaacaagcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaagcc atataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagtttctg aatttgattcgtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaaacgctgacggcactgtcg caaactatcacggctaccacatcgtctttgcattagccggagatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaaagtcg gcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgatgcaaatgattctatcctaaaagaccaa acacaagaatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaacaa acactgacaactgcacaagttaacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgac ggaaaaacgtatcaaaatgtacagcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtag aagataaaggccacaaatacttagtatttgaagcaaacactggaactgaagatggctaccaaggcgaagaatctttatttaacaaagcata ctatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataaaaaacgcacggctgagttagcaaacggcgct ctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgSEQ ID NO: 28 Ptac-ndmABD 5’-3’ generated in the labSEQ ID NO: 29 Ptac-ndmAD generated in the labSEQ ID NO: 30 Ptac-fdhA generated in the labSEQ ID 31 sK18Sb:Ptac:ndmABD generated in the labSEQ ID NO.32 sK18Sb:Ptac:ndmAD generated in the labSEQ ID NO: 33 sK18Sb:Ptac:fdhA – generated in the labSEQ ID NO: 34 PCR forward primer for cloningndmA from P. putida CBB5gaggaatcttactacatggaacaggcaatcattaatgatgaacSEQ ID NO: 35 PCR reverse primer for cloning ndmA from P. putida CBB5 ttctaaaccaaaattatatgtagctcctatcgctttcaatgact SEQ ID NO: 36 PCR forward primer for cloning ndmB from P. putida CBB5 ttcagcttatctaaccagacatctcaaaatacgcgt SEQ ID NO: 37 PCR reverse primer for cloning ndmB from P. putida CBB5 agctacatataattttggtttagaacaataagaccagcaatcc SEQ ID NO: 38 PCR forward primer for cloning ndmCD from P. putida CBB5 cctgaatgatatcatctcttcaaatgtagcacctgaagtcag SEQ ID NO: 39 PCR reverse primer for cloning ndmCD from P. putida CBB5 gagatgtctggttagataagctgaaaggccagaggggattataatgt SEQ ID NO: 40 PCR forward primer for cloning pBLT-2-vector fragment with tac promoter atttgaagagatgatatcattcaggacgagcctcagac SEQ ID NO: 41 PCR reverse primer for cloning pBLT-2-vector fragment with tac promoter cctgttccatgtagtaagattcctcctctagagtgtgaaattg SEQ ID NO: 42 PCR forward primer for cloning fmdEFGH fragment from P. putida EM42 gaggaggaatcttacatgcctgatgaattgctcc SEQ ID NO: 43 PCR reverse primer for cloning fmdEFGH fragment from P.putida EM42atttttatctagaccaacgcctcccseq id no: 44 PCR forward primer for cloning fdhA fragment from P. putida EM42 gaggaggaatcttacataaaaatcaagcgaggtaagagc seq id no: 45 PCR reverse primer for cloning fdhA fragment from P. putida EM42 ggtctagataaaaatcaagcgaggtaagag SEQ ID NO: 46 PCR forward primer for cloning pBLT-2-vector fragment with tac promoter gatatcattcaggacgagcc SEQ ID NO: 47 PCR reverse primer for cloning pBLT-2-vector fragment with tac promoter gtaagattcctcctctagagtgt SEQ ID NO: 48 PCR forward primer for cloning pK18-mobsac vector gagcctcaggatatcattcaggacgagcc SEQ ID NO: 49 PCR reverse primer for cloning pK18-mobsac vector ctctagagtgtgtaagattcctcctctagagtgtg SEQ ID NO: 50 PCR forward primer for ndmABD fragment from pBLT-2-Ptac- ndmABD plasmid ggaatcttacacactctagaggaggaatcttac SEQ ID NO: 51 PCR reverse primer for ndmABD fragment from pBLT-2-Ptac- ndmABD plasmid gaatgatatcctgaggctcgtcctgaaSEQ ID NO: 52 PCR forward primer for Homologous arm 1 (up arm) acgaattcgagctcggtacccggggatcctaagccgaatgtcgatgatat SEQ ID NO: 53 PCR reverse primer for Homologous arm 1 (up arm) ggcttttgacttgagaaaaaaccgcacctgg SEQ ID NO: 54 PCR forward primer for Homologous arm 2 (down arm)tgttccgcggccacccatggatgcctgaaaggSEQ ID NO: 55 PCR reverse primer for Homologous arm 2 (down arm) cggccagtgccaagcttgcatgcctgcagggcccctctggagaatcg SEQ ID NO: 56 PCR forward primer for Upper homologous arm to glpR locus cgaattcgagctcggtaccccgctggtcttcattctgc SEQ ID NO: 57 PCR reverse primer for Upper homologous arm to glpR locus tgtccggcagctcgagactagtgtcgaccatgccgccagacttttg SEQ ID NO: 58 PCR forward primer for Down homologous arm to glpR locus tagtctcgagctgccggacaaattctgc SEQ ID NO: 59 PCR reverse primer for Down homologous arm to glpR locus caagcttgcatgcctgcaggttcaacatccacagcctg SEQ ID NO: 60 PCR forward primer for PCR amplify pBLT2-tac vector gcctcaggaggaggaatcttacataaaaatcaag SEQ ID NO: 61 PCR reverse primer for PCR amplify pBLT2-tac vector gtcctgaatgatatcttacgccgcaccccSEQ ID NO: 62 PCR forward primer for fdhA gene from P. putida EM42 gatatcattcaggacgagcc SEQ ID NO: 63 PCR reverse primer for fdhA gene from P. putida EM42 gtaagattcctcctctagagtgt SEQ ID NO: 64 PCR forward primer for tac-fdhA fragment from pBLT2-Ptac-fdhA aatttgtccggcagcgccagccggtggccgcg SEQ ID NO: 65 PCR reverse primer for tac-fdhA fragment from pBLT2-Ptac-fdhA gtcctgaatgatatcttacgccgcacccc SEQ ID NO: 66 PCR forward primer to add Native P51(drive sacB) promoter amplified from P. putida EM42 tttacaacgtcgtgaccggtagcaaatgggg SEQ ID NO: 67 PCR reverse primer to add Native P51(drive sacB) promoter amplified from P. putida EM42 cgatcctcatcctgtgattcaatccttattcagcttgc SEQ ID NO: 68 PCR forward primer for pBLT2-ndmABCD vector_F TGCATAGATACGTAACTGGACTGAAAACAAAC SEQ ID NO: 69 PCR reverse primer for pBLT2-ndmABCD vector_R GCCTCACAGGCTCGTCCTGAATGA SEQ ID NO: 70 PCR forward primer for ndmE gene_F TCCAGTTACGTATCTATGCACTCACCCGTCGSEQ ID NO: 71 PCR reverse primer for ndmE gene_R ACGAGCCTGTGAGGCCTAAAACCGT SEQ ID NO: 72 PCR forward primer for ndmC mutagenesis TAACAAGAATTGCTAAGAGGTATG SEQ ID NO: 73 PCR reverse primer for ndmC mutagenesis ATAATCCCCTCTGGCCTT SEQ ID NO: 74 PCR forward primer for Down arm for glpR locus_F tagtctcgagCTGCCGGACAAATTCTGC SEQ ID NO: 75 PCR reverse primer for Down arm for glpR locus_R caagcttgcatgcctgcaggTTCAACATCCACAGCCTG References: [1] S.B. Mills, M.B. Mock, R.M. Summers, Rational protein engineering of bacterial N- demethylases to create biocatalysts for the production of methylxanthines, Biorxiv, DOI (2021) 2021.2012.2017.472166. [2] L.N. Jayakody, C.W. Johnson, J.M. Whitham, R.J. Giannone, B.A. Black, N.S. Cleveland, D.M. Klingeman, W.E. Michener, J.L. Olstad, D.R. Vardon, Thermochemical wastewater valorization via enhanced microbial toxicity tolerance, Energy & Environmental Science, 11 (2018) 1625-1638. [3] M.B. Mock, A. Cyrus, R.M. Summers, Biocatalytic production of 7‐methylxanthine by a caffeine‐degrading Escherichia coli strain, Biotechnology and Bioengineering, 119 (2022) 3326-3331. [4] M.B. Mock, S.B. Mills, A. Cyrus, H. Campo, T. Dreischarf, S. Strock, R.M. Summers, Biocatalytic production and purification of the high-value biochemical paraxanthine, Biotechnology and Bioprocess Engineering, 27 (2022) 640-651. [5] M.B. Mock, R.M. Summers, Mixed culture biocatalytic production of the high-value biochemical 7-methylxanthine, Journal of Biological Engineering, 17 (2023) 2.

Claims

Claims We claim:

1. A biocatalyst for producing 7-methylxantine, wherein the biocatalyst is a recombinant bacterial or yeast cell which comprises: a) a genetically engineered synthetic N-demethylation operon encoding and expressing enzymes which demethylate caffeine and theobromine into 7-methylxantine; and b) a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; and wherein the genetically engineered synthetic N-demethylation operon comprises ndmA, ndmB and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA, ndmB, and ndmD genes operably linked to a promoter, and wherein the N- demethylation operon does not comprise ndmC gene; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

2. A biocatalyst for producing theobromine, wherein the biocatalyst is a recombinant bacterial or yeast cell which comprises:a) a genetically engineered synthetic N-demethylation operon encoding and expressing enzymes which demethylate caffeine into theobromine; and b) a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; and wherein the genetically engineered synthetic N-demethylation operon comprises ndmA and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA and ndmD genes operably linked to a promoter, and wherein the N- demethylation operon does not comprise ndmB and ndmC genes; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

3. The biocatalyst of claim 1 or 2, wherein the recombinant bacterial or yeast cell further comprises a loss-of-function mutation in glycerol repressor glpR gene, wherein the mutation eliminates production of GlpR protein.

4. The biocatalyst of claim 1 or 2, wherein the biocatalyst is a monoculture comprising two or more cells and wherein each cell comprises the N- demethylation operon and the formate and formaldehyde operon.

5. The biocatalyst of claim 1 or 2, wherein the N-demethylation operon and the formate and formaldehyde operon are integrated into a genome of the recombinant bacterial or yeast cell.

6. The biocatalyst of claim 1 or 2, wherein the recombinant cell is P. putida, P. putida KT2440 and / or P. putida EM42.

7. The biocatalyst of claim 1 or 2, wherein tac promoter (Ptac) drives expression in the N-demethylation operon and / or in the formate and formaldehyde operon.

8. The biocatalyst of claim 1 or 2, wherein the recombinant bacterial or yeast cell tolerates growth conditions in a medium comprising up to 50 mM caffeine.

9. The biocatalyst of claim 1 or 2, wherein the biocatalyst is further characterized by one or more of the following features: - a synthetic ribosome binding site (RBS) located upstream of the translation start codon in the N-demethylation operon and / or a ribosome binding site (RBS) located upstream of the translation start codon in the formate and formaldehyde operon; - a soxR terminator located at the 3’ end of the N-demethylation operon and / or a soxR terminator located at the 3’ end of the formate and formaldehyde operon; and / or - a tonB terminator located at the 5’ end of the N-demethylation operon and / or a tonB terminator located at the 3’ end of the formate and formaldehyde operon.

10. The biocatalyst of claim 1, wherein the biocatalyst has a capacity for producing at least 5 mM of 7-methylxantine in a 12-hour period when cultured at the initial cell density of OD600=1.

11. A method for producing 7-methylxantine, the method comprising: a) culturing the recombinant bacterial or yeast cell of claim 1 in a liquid growth medium which comprises caffeine; and b) centrifuging the culture of step a) to precipitate 7-methylxantine as a pellet separated from the recombinant bacterial or yeast cell and the liquid growth medium and collecting the 7-methylxantine pellet.

12. The method of claim 11, wherein the liquid growth medium further comprises theobromine.

13. The method of claim 11, wherein caffeine in step a) is sourced from waste green tea and / or coffee.

14. The method of claim 13, wherein the waste green tea or coffee is sourced as an oxidative hydrothermal dissolution (OHD) substrate which was processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

15. The method of claim 11, wherein the method further comprises a step of oxidative hydrothermal dissolution (OHD), wherein waste green tea or coffee is processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

16. The method of claim 11, wherein the liquid growth medium comprises glycerol as a carbon source and / or the liquid growth medium does not comprise glucose.

17. The method of claim 11, wherein step a) is performed for about 6 to about 24 hours.

18. The method of claim 11, wherein the method further comprises removing lipopolysaccharides (LPSs) from the 7-methylxanthine pellet and / or drying 7- methylxanthine pellet.

19. The method of claim 11, wherein the method further includes passing the liquid growth medium through a high-pressure liquid column (HPLC) and eluting 7- methylxantine with a mixture of water, methanol, and acetic acid.

20. The method of claim 11, wherein the method is further characterized by one or more of the following features: - in step a), a caffeine concentration in the liquid growth medium is in the range from about 1 mM to about 50 mM; - in step a) a glycerol concentration in the liquid growth medium is in the range from about 10 mM to about 1 M; and - in step a), the culture has the initial optical density at 600 nm in the range from about 0.1 to about 100.

21. The method of claim 11, wherein caffeine and glycerol are continuously fed into the liquid growth medium, or caffeine and glycerol is fed in batches.

22. A recombinant construct comprising at least one of the following three operons: - a genetically engineered synthetic first N-demethylation operon encoding and expressing enzymes which demethylate caffeine and theobromine into 7-methylxantine;- a genetically engineered synthetic second N-demethylation operon encoding and expressing enzymes which demethylate caffeine into theobromine; and / or - a genetically engineered synthetic formate and formaldehyde operon encoding and expressing enzymes which convert formaldehyde into carbon dioxide; and wherein the genetically engineered synthetic first N-demethylation operon comprises ndmA, ndmB, and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA, ndmB, and ndmD genes operably linked to a promoter, and wherein the first N-demethylation operon does not comprise ndmC gene; wherein the genetically engineered synthetic second N-demethylation operon comprises ndmA and ndmD genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to ndmA and ndmD genes operably linked to a promoter, and wherein the second N- demethylation operon does not comprise ndmB and ndmC genes; and wherein the genetically engineered synthetic formate and formaldehyde operon comprises fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter, or their functional variants having at least 90% overall nucleotide sequence identity to fmdE, fmdF, fmdG, fmdG, and fdhA genes operably linked to a promoter.

23. The recombinant construct of claim 22, wherein the construct is a plasmid, bacterial chromosome or yeast chromosome.

24. A composition useful for treating myopia and comprising 7-methylxantine obtained from caffeine with one or more biocatalysts according to claim 1.

25. A method for bioprocessing waste green tea, the method comprising reacting waste green tea with the biocatalyst according to claim 1 or 2.

26. A method for producing theobromine, the method comprising: a) culturing the recombinant bacterial or yeast cell of claim 2 in a liquid growth medium which comprises caffeine; and b) purifying theobromine.

27. The method of claim 26, wherein caffeine in step a) is sourced from waste green tea and / or coffee.

28. The method of claim 27, wherein the waste green tea or coffee is sourced as an oxidative hydrothermal dissolution (OHD) substrate which was processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

29. The method of claim 27, wherein the method further comprises a step of oxidative hydrothermal dissolution (OHD), wherein waste green tea or coffee is processed in an Oxidative Hydrothermal Dissolution (OHD) reactor prior to step a).

30. The method of claim 26, wherein the liquid growth medium comprises glycerol as a carbon source and / or the liquid growth medium does not comprise glucose.

31. The method of claim 26, wherein step a) is performed for about 6 to about 24 hours.

32. The method of claim 26, wherein the method is further characterized by one or more of the following features:- in step a), a caffeine concentration in the liquid growth medium is in the range from about 1 mM to about 50 mM; - in step a) a glycerol concentration in the liquid growth medium is in the range from about 10 mM to about 1 M; and - in step a), the culture has the initial optical density at 600 nm in the range from about 0.1 to about 100.

33. The method of claim 26, wherein caffeine is continuously fed into the liquid growth medium, or caffeine is fed in batches.

Images