Isolated estrogen receptor 1 IRES sequences

Abstract

The present disclosure relates to isolated Estrogen Receptor 1 (ESR1) internal ribosome entry sites (IRESes) of about 90 nucleic acids or less. These isolated IRESes have exceptionally high translation activity. Expression vectors comprising this IRES and methods of using such expression vectors are also disclosed.

Description

ISOLATED ESTROGEN RECEPTOR 1 IRES SEQUENCESFIELD[1] There are provided internal ribosome entry site (IRES) sequence isolated from the 5’ untranslated region (UTR) of the mRNA encoding estrogen receptor a (ERa / ESRl). Their use in a variety of applications, including expression vectors and screening assays, is also provided.CROSS-REFERENCE TO RELATED APPLICATIONS[2] This application claims the benefit of U.S. Provisional Application No. 63 / 584,678, filed on September 22, 2023, which is incorporated herein by reference.SEQUENCE LISTING[3] This application contains a sequence listing that has been submitted in ASCII format via Patent Center and incorporated herein by reference in its entirety. Said ASCII copy, created on September 19, 2024, is named “3312W01WO_Sequence Listing. xml” and is 18,124 bytes in size.BACKGROUND[4] About 70% to 80% of newly diagnosed breast cancers are hormone receptor-positive. Hormone receptor-positive breast cancer cells express either estrogen (ER) or progesterone (PR) receptors or both. Hormone receptor-positive cancers tend to grow more slowly than those that are hormone receptor-negative, and consequently, patients with hormone receptor-positive cancers often have a better outlook in the short-term.[5] Hormone therapies such as tamoxifen and toremifene and, for postmenopausal women, the antiestrogen fulvestranare are approved to treat metastatic or recurrent hormone-sensitive breast cancer.[6] ER-positive breast tumor cells can exist in two distinct phenotypic states which differ in the degree of differentiation and use of IRES-mediated translation. IRES- mediated translation has been shown to be critical for the maintenance of the undifferentiated state. IRES inhibition can force ER-positive breast tumor cells to terminally differentiate, especially in high-density tumor cell populations. Low-density tumor cells are particularly sensitive to forced differentiation through IRES inhibition because the undifferentiatedphenotype is essential for their survival. IRES inhibition may therefore be therapeutically relevant approach for treating ER-positive breast cancer. However, progress has been hampered by the absence of effective tools to study targeted inhibition of IRES-driven translation of the mRNA encoding estrogen receptor a (ERaZESRl).SUMMARY[7] The isolated ESRI internal ribosome entry site (IRES) sequences provided herein address the need in the art for a toolkit to study targeted inhibition of IRES-driven translation of the mRNA encoding estrogen receptor a (ERaZESRl) and open up new possibilities to identify novel therapies for ER-positive breast cancer. Among other things, a no more than 90 nucleic acid-long sequence within the 5’-UTR of the ESRI RNA has been discovered and is described herein that is capable of initiating translation of an operably linked protein coding sequence in a cap-independent manner. This isolated ESRI IRES of about 90 nucleic acids or less comprises the following nucleic acid sequence: 5’- CUUUUUCCAG -3’ (SEQ ID NO: 2).[8] The isolated ESRI IRES may comprise the nucleic acid sequence 5’- X1CUUUUUCCAGX2X3 -3’ (SEQ ID NO: 3), wherein Xi and X3 are nucleic acids other than A, e.g., Xi may be U and / or X3 may be U, and X2 is a nucleic acid other than C, e.g., X2 may be G. For example, the isolated ESRI IRES may comprise the nucleic acid sequence 5’- UCUUUUUCCAGGU -3’ (SEQ ID NO: 4).[9] Specifically, an about 20 nucleic acid-long sequence within the 5’- untranslated region (UTR) of the ESRI mRNA has been identified that is capable of initiating cap-independent, IRES-dependent translation of an operably linked protein coding sequence. This isolated ESRI IRES comprises or consists of a nucleic acid sequence at least 80%, 85%, 90%, 95% or 100% identical to the following nucleic acid sequence: 5’-CUGUGCUCUUUUUCCAGGUG-3’ (SEQ ID NO: 5). The isolated ESRI IRES may be capable of improving translation compared to a corresponding wild-type IRES-containing nucleic acid sequence (e.g., the 174 nucleic acid-long 5 ’-UTR sequence of SEQ ID NO: 1) by at least about 1.5-fold, about 2-fold, about 3-fold, or about 4-fold.

[0010] Beyond their use as a tool for the identification of IRES inhibitors for use in cancer therapy, such short IRES sequences are highly attractive for use in expressioncassettes, e.g., in therapeutic RNAs and viral vectors, especially as they also have higher translation activity than commonly used EMCV and CVB3 IRESes.

[0011] Accordingly, the present disclosure also provides an expression vector comprising an isolated ESRI IRES described herein, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0012] The peptide, polypeptide or protein may be a therapeutic peptide, polypeptide or protein. The therapeutic peptide, polypeptide or protein may be an immunogen or an enzyme.

[0013] The peptide, polypeptide or protein may be a reporter protein, e.g., a fluorescent protein or an enzyme, for example a luciferase.

[0014] The expression vector may be composed of deoxyribonucleotides or ribonucleotides. At least one of the ribonucleotides may be modified.

[0015] The expression vector may be a plasmid, a viral vector, a circular polyribonucleic acid, or a messenger RNA.

[0016] Also provided herein is a cell comprising an expression vector.

[0017] The present disclosure further provides a composition comprising an isolated ESRI IRES as and one or more excipients, e.g., the one or more excipients is one or more of water, a buffering agent and a salt.

[0018] Further provided is a method comprising: (a) providing a cell with an expression vector comprising the isolated ESRI IRES operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compounds; and (c) determining whether the one or more compound modulate(s) expression of the reporter protein.

[0019] The method may further comprise a step of determining a cytotoxic effect of the one or more compounds on the cell. Accordingly, the method may further comprise selecting the one or more compounds that have a cytotoxic effect on the cell to determine its anti -tumor activity in a relevant in vivo model.

[0020] The cell utilized in the method may be a cancer cell, e.g., a breast, ovarian, or endometrial cancer cell. The breast, ovarian or endometrial cancer cell may be resistant to endocrine therapy and / or may be metastatic.BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Further description, by way of example, is provided with reference to the following drawings.

[0022] FIG. 1 schematically illustrates a bicistronic reporter cassette that was used to assess the capability of various fragments of the 5’-UTR of the ESRI mRNA to initiate translation.

[0023] FIG. 2 schematically illustrates elements of the ESRI mRNA.

[0024] FIG. 3 A is a bar graph illustrating the translation activity of the isolated 5’- UTR of the ESRI mRNA compared to a commonly used EMCV IRES using the bicistronic reporter cassette of FIG. 1. FIG. 3B is an agarose gel illustrating that the insert of the bicistronic reporter cassette is not subject to splicing.

[0025] FIG. 4 is a bar graph illustrating the translation activity of various fragments of the ESRI mRNA 5’-UTR relative to a 174 nucleic acid-long 5’-UTR sequence of the native ESRI mRNA. Translation activity was assessed using the bicistronic reporter cassette of FIG. 1.

[0026] FIG. 5 is a bar graph illustrating that a 22-nucleotide portion consisting of nucleic acids 88-109 of the ESRI mRNA 5’-UTR (SEQ ID NO: 1) is sufficient to induce translation. Translation activity was assessed using the bicistronic reporter cassette of FIG. 1.

[0027] FIG. 6 is a bar graph illustrating a mutagenesis screen to determine the minimal sequence required for IRES function. Translation activity was assessed using the bicistronic reporter cassette of FIG. 1.

[0028] FIG. 7A is shows a linear regression model illustrating the fit of ESRI mRNA expression to ERa protein expression. FIG. 7B shows a linear regression analysis illustrating the fit of ESRI IRES activity to ERa protein expression.

[0029] FIG. 8A is a bar graph illustrating that expression of a protein operably linked to the ESRI IRES decreases in response to increasing concentration of IRES inhibitor DMA- 135. Translation activity was assessed using the bicistronic reporter cassette of FIG. 1. FIG. 8B shows the ratio of Flue to Rluc identified in FIG. 9 A.

[0030] FIG. 9A-C are western blots illustrating that expression of endogenous ERa protein (cited as “Endogenous (IRES)” or “ERa”) in breast cancer cells decreases in response to increasing concentration of IRES inhibitor DMA-135. MCF7 cells were used in FIG. 9A. FIG. 9A also illustrates that cap-dependent translation of exogenous ERa “ERa-dTag (cap)” is not affected by increasing concentration of DMA-135. T47D cell cells were used FIG. 9B. ZR-75-1 cells were used in FIG. 9C.DETAILED DESCRIPTION

[0031] In order for the following description to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0032] Unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Thus, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a ribonucleotide” is understood to represent one or more ribonucleotides. As such, the terms “a” (or “an”), “one or more”, and “at least one” can be used interchangeably herein.

[0033] The words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0034] “And / or” is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B”, “A or B”, “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to include “A and / or B and / or C” and to thus encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0035] It is understood that wherever aspects are described herein with the language “comprising”, otherwise analogous aspects described in terms of “consisting of’ and / or “consisting essentially of’ are also provided. In other words, if an aspect comprises A, B and C, aspects consisting essentially of A, B and C are also contemplated, as are aspects consisting of A, B and C.

[0036] The term “about” refers to an interval of accuracy that a person skilled in the art will understand to still ensure the technical effect of the feature in question. The term indicates a deviation from the indicated numerical value of ±10%, ±5%, or ±1%.

[0037] The phrase “capable of forming a stem-loop structure” refers to a singlestranded nucleic acid, a portion of which may form a region comprising a plurality of intrastrand base-pairs (stem) connected by an unpaired single-stranded region (loop). Whether a single-stranded nucleic acid forms a stem-loop structure can depend on various factors, for example pH, ionic strength and / or temperature.

[0038] The term “polyprotein” refers to two or more peptides, polypeptides or proteins that are encoded by a single coding sequence and translated as a single chain of amino acids. The individual peptides, polypeptide, or protein that form the polyprotein are typically linked by amino acid sequences that comprise a self-cleavage site. For example, the self-cleavage site can be a 2A peptide.

[0039] The term “expression cassette” refers to a nucleotide sequence comprising a first nucleic acid sequence capable of initiating translation and a second nucleic acid sequence capable of being translated into a peptide, polypeptide or protein, whereby the first and second nucleic acid sequences are operably linked. The first nucleic acid sequence may comprise one or more of the described IRESes or variants thereof. The second nucleic acid sequence may encode more than one peptide, polypeptide or protein, e.g., in form of a polyprotein. The term “reporter cassette” refers to an expression cassette in which the second nucleic acid sequence encodes a reporter protein.

[0040] The term “IRES tandem repeat” refers to two or more of the IRESes or variants thereof described herein, positioned one after the other to increase initiation of translation of an operably linked nucleic acid sequence encoding a peptide, polypeptide or protein. IRESes or variants positioned in this way are referred to herein as being “in tandem”.

[0041] The term “Ci-Cs alkyl” means a monovalent unsubstituted saturated straightchain or branched-chain hydrocarbon radical having from 1 to 8 carbon atoms. “C1-C2 alkyl”, “C1-C3 alkyl”, “C1-C4 alkyl”, “C1-C5 alkyl”, “Ci-C6alkyl”, and “C1-C7 alkyl” have analogous meanings.

[0042] The term “C3-C6 cycloalkyl” means a monovalent unsubstituted saturated cyclic hydrocarbon radical having from 3 to 6 carbon atoms.

[0043] The term “5- or 6-membered heteroaryl” means a monocyclic aromatic group with a total of 5 atoms in the ring wherein at least one of those atoms is independently selected from N, O and S; or a monocyclic aromatic group with a total of 6 atoms in the ring wherein wherein at least one of those atoms is independently selected from N, O and S.

[0044] The term “5- or 6-membered heterocyclyl” means a saturated monocyclic group with a total of 5 atoms in the ring wherein at least one of those atoms is independently selected from N, O and S; or a saturated monocyclic group with a total of 6 atoms in the ring wherein wherein at least one of those atoms is independently selected from N, O and S.

[0045] The term “halo” means a fluorine (which may be depicted as -F), chlorine (which may be depicted as -Cl), bromine (which may be depicted as -Br) or iodine (which may be depicted as -I) radical.

[0001] The term “aryl” means an aromatic carbocyclyl containing from 6 to 14 carbon ring atoms. An aryl may be monocyclic or polycyclic (i.e., may contain more than one ring). In the case of a polycyclic aryl, only one ring of the polycyclic system is required to be aromatic while the remaining ring(s) may be saturated, partially saturated or unsaturated.

[0002] The term “bicyclic heteroaryl” means a polycyclic aryl (i.e. may contain more than one ring), wherein the rings are aromatic, wherein at least one of the atoms in at least one of the aromatic rings is independently selected from N, O or S. Unless otherwise specified herein, the aryl groups can be substituted or unsubstituted. Thus, the hydrogen atoms of the aromatic rings may be optionally substituted by one or more substituents, including, but not limited to, acyl, alkenyl, alkoxy, alkyl, alkynyl, carboxy, haloalkyl, halogen, hydroxy, and hydroxyalkyl.

[0003] The term “DMA” means dimethylamiloride.

[0046] The term “pharmaceutically acceptable salt” means a salt such as those described in standard texts on salt formation, see for example: P. Stahl, et al., Handbook of Pharmaceutical Salts: Properties, Selection and Use (VCHA / Wiley-VCH, 2002), or S.M. Berge, et al., “Pharmaceutical Salts” (1977) Journal of Pharmaceutical Sciences, 66, 1-19.

[0047] The terms “therapy”, “treatment” and “treating” include both preventative and curative treatment of a condition, disease or disorder. It also includes slowing, interrupting, controlling or stopping the progression of a condition, disease or disorder. It also includespreventing, curing, slowing, interrupting, controlling or stopping the symptoms of a condition, disease or disorder.

[0048] Nucleic acid sequences described herein may be denoted with deoxyribonucleotides, i.e., as present in a vector used as a template for transcription of the encoded RNA or expression of an encoded peptide, polypeptide or protein. The skilled person understands that IRESes occur in mRNA. Accordingly, it will be understood that an IRES sequence denoting thymidines should be read as denoting uracils in the context of the nucleic sequence of an mRNA.

[0049] Unless otherwise defined herein, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs and as commonly used in the art to which this application belongs. In case of conflict, the present specification, including definitions, will control.

[0050] Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein.Isolated ESRI IRESes

[0051] Internal ribosome entry sites (IRESes) are genetic elements that can initiate translation of mRNAs in a 5 ’-cap-independent manner. IRESes were first discovered in viruses, where they were identified as RNA structural elements present in the 5’ untranslated regions (5’-UTRs) of viral mRNAs.

[0052] Some mammalian (e.g., human) cellular mRNAs also comprise IRESes. For example, the 174 nucleic acids that make up the 5’-UTR of the mammalian (e.g., human) ESRI mRNA comprises an IRES:TCACCGGACCCGCAGGCTCCCGGGGCAGGGCCGGGGCCAGAGCTCGCGTGTCGGCGGGACA TGCGCTGCGTCGCCTCTAACCTCGGGCTGTGCTCTTTTTCCAGGTGGCCCGCCGGTTTCTG AGCCTTCTGCCCTGCGGGGACACGGTCTGCACCCTGCCCGCGGCCACGGACC(SEQ ID NO: 1).

[0053] Among other things, a no more than 90 nucleic acid-long sequence within the 5’-UTR of the ESRI mRNA has been discovered and is described herein that is capable of initiating translation of an operably linked protein coding sequence in a cap-independent manner. This isolated ESRI IRES of about 90 nucleic acids or less comprising the following nucleic acid sequence: 5’- CUUUUUCCAG -3’ (SEQ ID NO: 2).

[0054] The isolated ESRI IRES may comprise the nucleic acid sequence 5’- X1CUUUUUCCAGX2X3 -3’ (SEQ ID NO: 3), wherein Xi and X3 are nucleic acids other than A, e.g., Xi may be U and / or X3 may be U, and X2 is a nucleic acid other than C, e.g., X2 may be G. For example, the isolated ESRI IRES may comprise the nucleic acid sequence 5’- UCUUUUUCCAGGU -3’ (SEQ ID NO: 4).

[0055] The isolated ESRI IRES typically comprises or consists of at least about 10 nucleic acids, for example about 10 to about 90 nucleic acids, about 10 to about 50 nucleic acids, or about 10 to about 30 nucleic acids.

[0056] The isolated ESRI IRES may comprise or consist of at least about 20 nucleic acids, for example, may consist of about 20 to about 90 nucleic acids or about 20 to about 50 nucleic acids.

[0057] The isolated ESRI IRES may consist of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 nucleic acids.

[0058] In particular, a minimal region comprising the 5’-UTR of the ESRI mRNA that can initiate translation when operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein is provided. In particular, it has been discovered that about 15-25 nucleic acids of the 5’-UTR of the ESRI mRNA are sufficient for initiating translation in a cap-independent manner. Accordingly, the isolated ESRI IRES may consist of about 15 to about 25 nucleic acids, e.g., about 18, 19, 20, 21, or 22 nucleic acids.

[0059] The isolated ESRI IRES may comprise or consist of a nucleic acid sequence at least 80%, 85%, 90%, 95% or 100% identical to the following nucleic acid sequence: 5’-CUGUGCUCUUUUUCCAGGUG-3’ (SEQ ID NO: 5).

[0060] The isolated ESRI IRES may desirably be capable of improving translation compared to a corresponding wild-type IRES-containing nucleic acid sequence (e.g., the 174 nucleic acid-long 5’-UTR sequence of SEQ ID NO: 1) by at least about 1.5-fold, about 2- fold, about 3-fold, or about 4-fold. Improved translation activity can be assessed using, e.g., a bicistronic reporter cassette as described in the examples (see, e.g., Example 1) using a suitable assay (see, e.g., Example 5).Uses

[0061] The isolated ESRI IRES can be operably linked to a nucleic acid sequence encoding a peptide, polypeptide, or protein to induce translation of the peptide, polypeptide or protein. This expression cassette may form part of an expression vector, which may include additional elements.

[0062] The isolated ESRI IRES may provide a benefit in applications where the number of nucleic acids in an expression vector is limited, but high translation of an operably linked peptide, polypeptide or protein is desired. Such isolated ESRI IRESes comprise fewer nucleic acids than a corresponding wild-type IRES-containing nucleic acid sequence (e.g., the 174 nucleic acid-long 5’-UTR sequence of SEQ ID NO: 1), and can have increased IRES- dependent translation activity.Therapeutic peptides, polypeptides, or proteins

[0063] The peptide, polypeptide or protein may be a therapeutic peptide, polypeptide or protein. The therapeutic peptide, polypeptide or protein may be an immunogen. The immunogen may be from a bacterium, a virus, or a fungus. The immunogen may be a surface glycoprotein, e.g., a viral spike glycoprotein, a bacterial adhesin, or a tumor antigen. The immunogen may be modified relative to a peptide, polypeptide, or protein as it naturally occurs in a bacterium, virus, or fungus, e.g., to improve surface expression or immunogenicity. The immunogen may be a fusion peptide or fusion protein.

[0064] The therapeutic peptide, polypeptide or protein may be a replacement peptide, polypeptide or protein of a peptide, polypeptide or protein deficient in a subject receiving an expression vector comprising the nucleic sequence encoding the therapeutic peptide, polypeptide or protein. For example, the peptide, polypeptide or protein is an enzyme (e.g., a metabolic enzyme) that is deficient in the subject receiving the expression vector. Thetherapeutic peptide, polypeptide or protein may be a hormone (e.g., insulin or a growth factor) that is deficient in the subject receiving the expression vector.

[0065] The therapeutic peptide, polypeptide or protein may be a cytokine, chimeric T cell receptor or an antibody or fragment thereof, or any other protein that can be used therapeutically.

[0066] Multiple hypoxia-regulated mRNAs are reported to contain an IRES (Young et al.

[2008] Journal of Biological Chemistry 283(24): 16309-16319). It is hypothesised that IRESes allow for translation of such mRNAs when cap-dependent translation is diminished, due to a decrease in O2. Therefore, an expression vector may be used to express a therapeutic polypeptide selectively in cells that are under stress conditions, e.g., hypoxia. For example, an expression vector comprising an isolated IRES or variant thereof operably linked to a nucleic acid sequence encoding a therapeutic peptide, polypeptide, or protein may be used for targeted expression of the therapeutic peptide, polypeptide, or protein in cells in a hypoxic environment (e.g., in a tumor or in ischemic tissue).Polyproteins

[0067] The peptide, polypeptide or protein can be a polyprotein. The polyprotein may comprise two or more (e.g., three, four five, six, seven eight, nine or ten) peptides, polypeptides or proteins. The two or more peptides, polypeptides or proteins may be linked by one or more amino acid sequences comprising a self-cleavage site, e.g., a 2A peptide.

[0068] Accordingly, the isolated ESRI IRES can initiate translation of two or more peptides, polypeptides or proteins, when the IRES is operably linked to a nucleic acid sequence encoding a polyprotein.

[0069] The two or more peptides may be cancer neoepitopes. The cancer neoepitopes may be capable of binding a major-histocompatibility complex (MHC).

[0070] The two or more polypeptides or proteins may assemble to form a complex (e.g., a heterodimer). Alternatively, the two or more polypeptides or proteins may not, assemble to form a complex.Reporter proteins

[0071] The peptide, polypeptide or protein may be a reporter protein, for example, a fluorescent protein (e.g., green fluorescent protein [GFP], or red fluorescent protein [RFP]).

[0072] The reporter protein may be an enzyme, for example, a luciferase (e.g., a firefly luciferase or Renilla luciferase), a beta-galactosidase, or an alkaline phosphatase.Expression vectors

[0073] An expression vector is provided that comprises the isolated ESRI IRES, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

[0074] An expression vector can be a DNA molecule composed of deoxyribonucleotides. The DNA molecule can be circular or linear. The expression vector may be a plasmid or viral DNA vector, e.g., a gene therapy vector such as an Adeno- associated virus (AAV) vector.

[0075] Alternatively, the expression vector can be an RNA molecule (i.e., a messenger RNA [mRNA]) composed of ribonucleotides. The ribonucleotides may comprise unmodified and modified ribonucleotides. At least one of the ribonucleotides may be modified, for example, the at least one modified ribonucleotide may be pseudouridine or a variant thereof, e.g., N1 -methylpseudouridine.

[0076] The RNA molecule may be circular or linear. A linear RNA molecule may comprise a 5 ’-cap. For example, the RNA may comprise in 5’— >3’ direction, a 5 ’-cap, a 5’- untranslated region (5’-UTR), a first nucleic acid sequence encoding a first peptide, polypeptide, or protein, the isolated IRES or variant, a second nucleic sequence encoding a second peptide, polypeptide, or protein and a 3’ untranslated region (3’-UTR), and a poly- A tail. In such examples, the 5 ’-cap drives translation of a first peptide, polypeptide, or protein encoded by the linear RNA molecule (e.g., an mRNA), and the isolated IRES or variant thereof drives translation of a second peptide, polypeptide, or protein encoded by the linear RNA molecule.

[0077] The RNA may be self-amplifying. Accordingly, the first peptide, polypeptide, or protein may be a viral polymerase, e.g., an alpha virus replicase. Furthermore, the second peptide, polypeptide, or protein may be an immunogen.

[0078] The addition of a 5 ’-cap to a linear RNA molecule during or after in vitro transcription typically requires additional process step and / or reagents and therefore is costly. Moreover, the process can be inefficient resulting in a mixture of capped and uncapped RNA molecules that may require further purification. IRESes can initiate translation in a Capindependent manner and may therefore obviate the need for a 5 ’-cap. Accordingly, the RNAmolecule may not comprise a 5’-cap. The 5’-cap structure is known to impart stability on linear RNA molecules (e.g., mRNA). Circularization of uncapped RNA molecules improves their stability. Accordingly, the RNA molecule may be circular.

[0079] A vector (e.g., a DNA plasmid or viral vector) is provided with the isolated ESRI IRES and a multiple cloning site arranged in such a manner that insertion of a nucleic acid sequence encoding a peptide, polypeptide, or protein operably links the nucleic acid to the IRES.

[0080] The isolated ESRI IRES may form part of a 5 ’-untranslated region (5’-UTR) of a nucleic acid sequence encoding a messenger RNA (mRNA) comprising a coding region for a peptide, polypeptide or protein.Multiple IRESes

[0081] Expression vectors may comprise multiple expression cassettes each comprising an isolated ESRI IRES, operably linked to a different nucleic acid sequence encoding a peptide, polypeptide, or protein.

[0082] The expression vector may comprise a first isolated ESRI IRES, operably linked to a first nucleic acid sequence encoding a first peptide, polypeptide or protein, and a second isolated ESRI IRES, operably linked to a second nucleic acid sequence encoding a second peptide, polypeptide or protein. The first and second IRESes may have the same nucleic acid sequence, or the first and second isolated IRESes may have different nucleic acid sequences. Furthermore, the first and second IRESes may differ in their translation activity. It may be desirable to express a first protein (e.g., a first component of a multimeric protein) and a second protein (e.g., a second component of a multimeric protein) in a particular ratio to enhance complex formation between the first and second proteins (e.g., to express the first and second components in the ratio present in the resulting multimeric protein). Accordingly, different IRESes may be used to express the first and second proteins at different molar ratios.

[0083] The expression vector may comprise three, four, five, six, seven, eight, nine or ten isolated ESRI IRESes, wherein each IRES is operably linked to a different nucleic acid sequence encoding a peptide, polypeptide or protein. Each of the three, four, five, six, seven, eight, nine or ten IRESes may have the same nucleic acid sequence. The three, four, five, six, seven, eight, nine or ten IRESes may each have different nucleic acid sequences.Each of the three, four, five, six, seven, eight, nine or ten nucleic acid sequences may encode a different peptide, polypeptide or protein, e.g., a different immunogenic peptide or T-cell epitope.

[0084] It may be desirable to arrange two or more isolated ESRI IRESes in tandem operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein to form an expression cassette in order to increase the translation of the nucleic sequence. It may be that the isolated ESRI IRESes bind to one or more IRES Trans-Acting Factors (ITAFs) to initiate translation. Therefore, arranging two or more IRESes in tandem may increase translation activity relative to a single IRES by recruiting a plurality of ITAFs to the expression cassette.

[0085] Accordingly, an expression vector may comprise an expression cassette comprising two or more isolated IRESes arranged in tandem (also referred to herein as an “IRES tandem repeat”) operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein. The expression vector may comprise multiple such expression cassettes, wherein the nucleic acid sequence in each expression cassette encodes a different peptide, polypeptide or protein.

[0086] The IRES tandem repeats in each of the expression cassettes may have the same nucleic acid sequence. The IRES tandem repeats in one or more of the expression cassettes may have different nucleic acid sequences. The IRES tandem repeats in all expression cassettes may have different nucleic acid sequences.

[0087] The different peptides, polypeptides or proteins may be different immunogenic peptides or different T-cell epitopes. The different peptides, polypeptides or proteins may be different reporter peptides, polypeptides or proteins.Host cells

[0088] A host cell comprising an expression cassette or vector including the isolated ESRI IRES is also provided. The host cell may be a bacterial cell, or an animal cell. The animal cell may be an insect cell or a mammalian cell (e.g., a human cell).Compositions and kits

[0089] An isolated ESRI IRES, an expression cassette or vector comprising the isolated ESRI IRES, or a cell comprising the expression cassette or vector are typicallyprovided in a composition with one or more excipients (e.g., water, a buffering agent or a salt).Kits

[0090] A kit is also provided that comprises a vector (e.g., a DNA plasmid or viral vector) comprising the isolated ESRI IRES and a multiple cloning site arranged in such a manner that insertion of a nucleic acid sequence encoding a peptide, polypeptide, or protein operably links the nucleic acid to the IRES. The kit may further comprise one or more reagents (e.g., restriction enzymes, ligases or polymerases) for forming a vector comprising the IRES operably linked to the nucleic acid sequence.

[0091] A kit may comprise a vector (e.g., a DNA plasmid or viral vector) comprising an isolated ESRI IRES operably linked to a reporter protein (e.g., a luciferase). The kit may further comprise one or more reagents (e.g., luciferin) to detect the activity of the reporter protein.

[0092] The vector may comprise a dual -luciferase expression cassette as in the Examples that can distinguish between cap-dependent and cap-independent reporter expression. An exemplary vector comprises a first nucleic acid sequence encoding a 5’-UTR, a second nucleic acid sequence encoding a first reporter protein (e.g., firefly luciferase), a third nucleic acid sequence encoding an isolated ESRI IRES, a fourth nucleic acid sequence encoding a second reporter protein (e.g., Renilla luciferase), and a fifth nucleic acid sequence encoding a 3’-UTR.Compositions

[0093] An expression vector comprising isolated ESRI IRES may be provided with a vehicle that enhances delivery of the expression vector to a cell of interest. Suitable delivery vectors include transfection agents (including cationic liposomes), lipid nanoparticles, viral or virus-like particles etc. The expression vector may be encapsulated in a lipid nanoparticle. A composition comprising the expression vector and a delivery vehicle may further comprise one or more pharmaceutically acceptable excipients, e.g., a buffering agent, salt, sugar etc.

[0094] A composition comprising the expression vector and a delivery vehicle (e.g., a vaccine comprising the expression vector encapsulated in a lipid nanoparticle) may be provided in a syringe for administration of the composition to a subject.Screening methods

[0095] The expression vectors, in particular the reporter cassettes, additionally find utility in methods to identify compounds or other factors that modulate the translation activity of the isolated ESRI IRES. Such compounds may be useful as therapeutic agents, e.g., because they inhibit initiation of translation of estrogen receptor (ER) a. Because of their greater translation activity, some of the isolated ESRI IRESes may be particularly useful in screening assays since they provide greater sensitivity due to greater signal to noise ratio. Of course, candidate compounds that modulate the translation activity against such an isolated ESRI IRES require further validation, e.g., in an estrogen-dependent cancer cell line such as MCF7, T47D, or ZR-75-1 as described in the Examples.

[0096] Accordingly, a method is provided that comprises (a) providing a cell with an expression vector comprising the isolated ESRI IRES operably linked to a nucleic acid sequence encoding a reporter protein; (b) contacting the cell with one or more compounds; and (c) determining whether the one or more compound modulate(s) expression of the reporter protein. The one or more compounds may be selected from IRES inhibitors, nucleotide synthesis inhibitors, and compounds that inhibit assembly or activity of a tRNA multisynthase complex (MSC), e.g., tRNA ligase inhibitors.

[0097] The reporter protein may be a fluorescent protein (e.g., GFP or RFP). The reporter protein may comprise an enzyme (e.g., a beta-galactosidase or alkaline phosphatase).

[0098] The enzyme may be a luciferase (e.g., the luciferase is a firefly luciferase or a Renilla luciferase).

[0099] The expression vector may comprise a dual-luciferase expression cassette as described herein.Method of treatment

[0100] The present disclosure also provides methods of treating cancer, e.g., an estrogen-dependent cancer, in a subject in need of such treatment.IRES inhibition

[0101] A method of treating cancer in a subject in need thereof is provided that comprises administering a therapeutically effective amount of an IRES inhibitor that prevents initiation of translation from an isolated ESRI IRES as described herein.

[0102] The cancer may be an estrogen-dependent cancer. The estrogen-dependent cancer may be breast cancer, ovarian cancer or endometrial cancer. The estrogen-dependent cancer may be breast cancer. The estrogen-dependent cancer may be resistant to endocrine therapy and / or may be metastatic.

[0103] Amiloride - a substituted (pyrazinecarbonyl) guanidine - and derivatives thereof have shown utility as IRES inhibitors. For example, WO 2022 / 120159 describes 2,6- diaminopyrazine derivatives and their use in the treatment of viral infections. Davila- Calderon et al. (Nat Commun. 2020; 11(1):4775) report a study in which a panel of RNA- targeted small molecules were screened against the native enterovirus 71 (EV71) SLII domain to assess binding affinity. The study identified DMA- 135, an amiloride derivative, as a promising IRES inhibitor. As demonstrated herein, such amiloride derivative and in particular 2,6-diaminopyrazine derivatives such as DMA-135 can be used to prevent initiation of translation from an isolated ESRI IRES and can inhibit ERa expression in cancer cell lines.

[0104] Accordingly, the IRES inhibitor may be a 2,6-diaminopyrazine derivative. The IRES inhibitor may be a compound of formula (I), or a pharmaceutically acceptable salt, hydrate, prodrug or derivative thereof:wherein Ri and R2 are independently selected from the group consisting of H, CH3, CH3CH2, CH(CH3)2, C(CH3)3. Preferably, both Ri and Rz are H;R3 and R4 are independently selected from the group consisting of hydrogenCi-C8alkyl,Ci-Cs alkyl substituted with at least one hydroxyl, halo, CH2CH2N(CH2Ph)2, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, a bicyclic aryl or bicyclic heteroaryl substituentCi-Cs alkenyl,Ci-Cs alkenyl substituted with hydroxyl, halo, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, or a bicyclic heteroaryl,C3-C6 cycloalkylC3-C6 cycloalkyl substituted with at least one hydroxyl, or halo substituent, or aryl; or R3 and R4 combine, together with the nitrogen atom to which they are attached to form a a C3-C6 cycloalkyl, a C3-C6 cycloalkyl substituted with at least one halo-, hydroxy-, Ci-Cs alkyl or methoxy-, a C3-C6 substituted cycloalkenyl, a C3-C6 cycloalkenyl, a heterocycle, substituted heterocycle or a C3-C24 heteroaromatic;Rs is selected from the group consisting of hydrogen haloCi-Cs alkyl substituted with at least one hydroxyl, halo, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, a bicyclic aryl, or bicyclic heteroaryl substituent,Ci-Cs alkyl,C3-C6 cycloalkyl substituted with at least one halo-, hydroxy-, Ci-Cs alkyl or methoxy-,C3-C6 cycloalkyl,heterocycle substituted heterocycle,C3-C24 aromatic,C3-C24 heteroaromatic,, wherein Re, R7, Rs, R9, Rio, R11, R12, R13, and R14 independently are H, Cl, Br, F, CF3, Ci-C6substituted alkyl, Ci-C6alkyl, OCH3, NH2, NHCH3, N(CH3)2, CN, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or phenyl; andX is O, S, or NH.

[0105] Rs and R4 may be independently selected from the group consisting of H,CH3, CH2CH2N(CH2Ph)2,

[0106] R3 and R4 may combine, together with the nitrogen atom to which they are attached to form a pyrrolidinyl ring.

[0107] Rs may be Cl,

[0108] may be independently selected from the group consisting of H, CH3, F, CF3, CN or phenyl.

[0109] X may be O.

[0110] Specific compounds of formula (I) are described below. The compounds listed below may be in free form or the form of a pharmaceutically acceptable salt, hydrate, prodrug or derivative thereof.DMA 132DMA- 155DMA- 176DMA- 185

[0111] DMA-135, DMA-155, DMA-169, DMA-178 and DMA-185 were previously identified as particularly effective IRES inhibitors by Davila-Calderon et al. (Nat Commun. 2020; 11(1):4775). Therefore, the IRES inhibitor may be selected from DMA-135, DMA- 155, DMA-169, DMA-178 and DMA-185. In particular, the IRES inhibitor may be DMA- 155.Numbered embodiments

[0112] Reference is further made to the following numbered embodiments:1. An isolated estrogen receptor 1 (ESRI) internal ribosome entry site (IRES) of about 90 nucleic acids or less comprising the following nucleic acid sequence:5’- CUUUUUCCAG -3’ (SEQ ID NO: 2).2. The isolated ESRI IRES of embodiment 1, comprising the nucleic acid sequence5’- X1CUUUUUCCAGX2X3 -3’ (SEQ ID NO: 3), wherein Xi and X3are nucleic acids other than A and X2 is a nucleic acid other than C.3. The isolated ESRI IRES of embodiment 2, wherein Xi is U, X2 is G, and / or X3 is U.4. The isolated ESRI IRES of any preceding embodiment, wherein the isolated ESRI IRES comprises or consists of a nucleic acid sequence at least 80%, 85%, 90% or 95% identical to, or identical to, the following nucleic acid sequence:5’-CUGUGCUCUUUUUCCAGGUG-3’ (SEQ ID NO: 5).5. The isolated ESRI IRES of any one of the preceding embodiments, wherein the isolated ESRI IRES is capable of improving translation compared to a corresponding wild-type IRES-containing nucleic acid sequence by at least about 1.5-fold, about 2- fold, about 3 -fold, or about 4-fold.6. An expression vector comprising the isolated ESRI IRES of any one of the preceding embodiments, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.7. The expression vector of embodiment 6, wherein the peptide, polypeptide or protein is a therapeutic peptide, polypeptide or protein.8. The expression vector of embodiment 7, wherein the therapeutic peptide, polypeptide or protein is an immunogen or an enzyme.The expression vector of embodiment 8, wherein the peptide, polypeptide or protein is a reporter protein. The expression vector of embodiment 9, wherein the reporter protein is a fluorescent protein. The expression vector of embodiment 10, wherein the reporter protein is an enzyme. The expression vector of embodiment 11, wherein the enzyme is a luciferase. The expression vector of any one of embodiments 6-12, composed of deoxy rib onucl eoti des. The expression vector of any one of embodiments 6-13, composed of ribonucleotides. The expression vector of embodiment 14, wherein at least one of the ribonucleotides is modified. The expression vector of any one of embodiments 6-15, wherein the expression vector is a plasmid, a viral vector, a circular polyribonucleic acid, or a messenger RNA. A cell comprising the expression vector of any one of embodiments 6-16. A composition comprising the isolated ESRI IRES of any one of embodiments 1-5, and one or more excipients. The composition of embodiment 18, wherein the one or more excipients is one or more of water, a buffering agent and a salt. A method comprising:(a) providing a cell with an expression vector comprising the isolated ESRI IRES of any one of embodiments 1-5 operably linked to a nucleic acid sequence encoding a reporter protein;(b) contacting the cell with one or more compounds; and(c) determining whether the one or more compound modulate(s) expression of the reporter protein. The method of embodiment 20, wherein the cell is a cancer cell. The method of embodiment 21, wherein the cancer cell is a breast, ovarian, or endometrial cancer cell. The method of embodiment 22, wherein the breast, ovarian or endometrial cancer cell is resistant to endocrine therapy and / or is metastatic. The method of any one of embodiments 20-23, further comprising a step of determining a cytotoxic effect of the one or more compounds on the cell. The method of embodiment 24, further comprising selecting the one or more compounds that have a cytotoxic effect on the cell to determine its anti-tumor activity in a relevant in vivo model. A method of treating cancer in a subject in need thereof, wherein the method comprises administering a therapeutically effective amount of an IRES inhibitor that prevents initiation of translation from the ESRI IRES of any one of embodiments 1-5. The method of embodiment 26, wherein the IRES inhibitor is a 2,6-diaminopyrazine derivative. The method of embodiment 27, wherein IRES inhibitor is a compound of formula (I)wherein Ri and R2 are independently selected from the group consisting of H, CH3, CH3CH2, CH(CH3)2, C(CH3)3 ;Rj and R4 are independently selected from the group consisting of hydrogenCi-C8alkyl,Ci-Cs alkyl substituted with at least one hydroxyl, halo, CH2CH2N(CH2Ph)2, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, a bicyclic aryl or bicyclic heteroaryl substituentCi-Cs alkenyl,Ci-Cs alkenyl substituted with hydroxyl, halo, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, or a bicyclic heteroaryl,C3-C6 cycloalkylC3-C6 cycloalkyl substituted with at least one hydroxyl, or halo substituent, or aryl or Rj and R4 combine, together with the nitrogen atom to which they are attached to form aC3-C6 cycloalkyl,C3-C6 cycloalkyl substituted with at least one halo-, hydroxy-, Ci-Cs alkyl or methoxy-,C3-C6 substituted cycloalkenyl,C3-C6 cycloalkenyl, a heterocycle, substituted heterocycle or a C3-C24 heteroaromatic;Rs is selected from the group consisting of hydrogen haloCi-Cs alkyl substituted with at least one hydroxyl, halo, C3-C6 cycloalkyl, phenyl, 5- or 6- membered heterocyclyl, 5- or 6- membered heteroaryl, a bicyclic aryl, or bicyclic heteroaryl substituent,Ci-Cs alkyl,C3-C6 cycloalkyl substituted with at least one halo-, hydroxy-, Ci-Cs alkyl or methoxy-,C3-C6 cycloalkyl, heterocycle, substituted heterocycle,C3-C24 aromatic,C3-C24 heteroaromatic,, wherein Re, R7, Rs, R9, Rio, R11, R12, R13, and R14 independently are H, Cl, Br, F, CF3, Ci-Ce substituted alkyl, Ci-Ce alkyl, OCH3, NH2, NHCH3, N(CH3)2, CN, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, or phenyl; andX is O, S, or NH. or a pharmaceutically acceptable salt, hydrate, prodrug or derivative thereof.29. The method of embodiment 28, wherein Ri and Rz are H, and X is O.30. The method of embodiment 28 or 29 wherein R3 and R4 independently selected from the group consisting of H, CH3, CH2CH2N(CH2Ph)2,or R3 and R4 combine, together with the nitrogen atom to which they are attached to form a pyrrolidinyl ringRs is Cl,R9, Rio, R11, R12, R13, and R14 are independently selected from the group consisting of H, CH3, F, CF3, CN or phenyl.31. The method of embodiment 30, wherein the IRES inhibitor is selected from the group consisting ofDMA-155;DMA- 178; orherein the IRES inhibitor is DMA-135.EXAMPLES

[0113] Although methods and materials similar or equivalent to those described herein can be used, suitable methods and materials are described below. The following examples are included for illustrative purposes only and are not intended to be limiting.Example 1. Construction of bicistronic reporter cassette

[0114] This example describes a bicistronic reporter cassette that can be used to assess Cap-independent, IRES-dependent translational activity relative to Cap-dependent, IRES-independent translational activity.

[0115] A general schematic of the bicistronic reporter cassette is shown in FIG. 1. It contained the following elements, in 5’ to 3’ direction: (1) a 5’ untranslated region (UTR) operable linked to a Renilla luciferase coding sequence; (2) a non-functional EMCV IRES sequence (AEMCV); (3) an insertion site for a test or control IRES sequence; and (4) a firefly luciferase coding sequence. The AEMCV IRES sequence prevents stop codon readthrough (see Carter and Sarnow, 2000, Journal of Biological Chemistry 8;275(36):28301-7). An EMCV IRES was placed at the insertion site to serve as a positive control of IRES function. A bicistronic reporter without a test or control IRES sequence was used as a negative control. The bicistronic reporter cassette was operably linked to a CMV promoter sequence in a pcDNA3-based plasmid backbone.

[0116] To construct lentivirus expression vectors, the bicistronic reporter cassette (Rluc-AEmcV-IRES-Fluc) was amplified by PCR and inserted into pLX313 vector at the Nhel and EcoRV cut sites using Gibson cloning. This vector includes long terminal repeats and a hygromycin resistance gene which are operably linked to an EFla promoter sequence. RNA transcribed from this promoter can be packaged into lentiviral particles as described in Example 2. Assembled plasmids were transformed into Stbl3 cells (catalog #C737303, Invitrogen) or DH5a cells (catalog #C3040H, New England Biolabs).Example 2. Production of cells stably expressing reporter constructs

[0117] This example describes the production of cells that stably express the bicistronic reporter cassettes generated in Example 1.

[0118] Lentivirus was produced for pLX313 with the desired reporter insert. 293 T cells were plated onto a 6-well plate (900,000 cells / well) and allowed to recover overnight. Subsequently, 1 pg of pLX313-based plasmid, 1 pg of A8.9, and 100 ng of VSV-G plasmidswere transiently transfected into cells using Lipofectamine 3000 per the manufacturer’s instructions. Medium was changed the following day to DMEM with 20% FBS. Media were serially harvested 24 and 48 hours later and passed through a 0.4 pm filter. The presence of lentivirus antigen was confirmed with Lenti-X GoStix Plus (catalog #631280, Takara Bio, Kusatsu, Japan).

[0119] In order to stably express reporters in 293T cells, 500,000 cells were plated in a single well of a 6-well plate. Immediately after plating, 500 pL - 1 mL of lentivirus- containing medium was added to medium containing cells for a total of 2 mL. Polybrene (catalog #sc- 134220, Santa Cruz Biotechnology, Dallas, TX) was used at a final concentration of 10 pg / mL. Cells were allowed to adhere overnight before being selected with hygromycin (500 pg / mL) for 5 days. The resulting stably transfected cells are referred to as 293T-SC2 cells.Example 3. Transient transfection of reporter cassette mRNAs

[0120] This example describes the production of in vitro transcribed mRNAs comprising the bicistronic reporter cassettes generated in Example 1.

[0121] DNA templates for in vitro transcription were created by cleavage of circular reporter plasmid DNA at the 5’ and 3’ ends at BtgZI restriction sites followed by gel purification of the digested product. In vitro transcription was performed with the Hi Scribe T7 ARCA mRNA kit (New England Biolabs catalog #E2060S) followed by poly(A) tail addition per the manufacturer’s instructions. Either methylated (functional in cap-dependent translation, catalog #S141 IS, New England Biolabs) or unmethylated (nonfunctional in capdependent translation, catalog #S1407S, New England Biolabs) cap structures were added to evaluate cap independence of each reporter translation activity. RNA cleanup was performed using the Monarch RNA Cleanup kit (catalog #T2040L, New England Biolabs). A portion of each reaction was analyzed via agarose gel to ensure the product was of the appropriate size. RNA was stored at -80°C until transfection.

[0122] Transient transfection of in vitro transcribed RNA was performed by adding 100 ng RNA to 293 T cells using Lipofectamine MessengerMAX (catalog #LMRNA003, Invitrogen) per the manufacturer’s instructions. Cells were then incubated for 24 hours prior.Example 4. Assessing reporter protein activity after transient plasmid transfection

[0123] This example describes how Cap-dependent and Cap-independent IRES- driven reporter gene expression can be assessed using the bicistronic reporter cassettes produced in Example 1.

[0124] 293T cells (25,000 cells / well) were seeded onto 96-well plates and allowed to adhere overnight. Plasmid encoding bicistronic reporter cassettes were prepared as described in Example 1. pcDNA3-based plasmid DNA (25 or 50 ng) was transiently transfected into the cells using Lipofectamine 3000 (catalog #L3000015, Invitrogen) per the manufacturer’s instructions. As described in Example 1, a plasmid with a bicistronic reporter cassette lacking a functional IRES served as a negative control, and a plasmid with a bicistronic reporter cassette comprising the EMCV IRES served as a positive control.

[0125] To determine IRES-driven cap-independent translation activity, Renilla and firefly luciferase activities were performed using the Dual-Glo Luciferase Assay system (catalog #E2920, Promega, Madison, WI). Media in the 96-well plates were removed. This was followed by the addition of 25 pL of Dual-Glo Luciferase Reagent directly to cells. Reactions were incubated for 10 minutes at room temperature before reading firefly luciferase activity with an EnVision 2103 Multilabel Reader (PerkinElmer, Waltham, MA). An equal volume of Stop & Gio Reagent was then added to each well, mixed by pipetting, and allowed to incubate at room temperature for 10 minutes, after which Renilla luciferase activities were read. Data are presented as either individual Renilla or firefly luciferase activities (arbitrary units) or as a ratio of firefly to Renilla activities, which represents a metric of relative IRES- vs. cap-dependent translation.

[0126] Data were scaled to experiment-appropriate controls. Pairwise comparisons were made between control and experimental groups using Students t-test. Multigroup comparisons were made with ANOVA with Tukey post hoc analysis. All significance levels were set at the a = 0.05 level.Example 5. ESRI IRES is more active than EMCV IRES

[0127] This example demonstrates that the IRES located in the 5’-UTR of the ESRI mRNA induces higher translation activity than the EMCV IRES.

[0128] The first 174 nucleotides (SEQ ID NO: 1) of the ESRI mRNA (GenBank Accession number MN908947.3) were placed into the insertion site of the bicistronic reporter cassette described in Example 1 :TCACCGGACCCGCAGGCTCCCGGGGCAGGGCCGGGGCCAGAGCTCGCGTGTCGGCGGGACA TGCGCTGCGTCGCCTCTAACCTCGGGCTGTGCTCTTTTTCCAGGTGGCCCGCCGGTTTCTG AGCCTTCTGCCCTGCGGGGACACGGTCTGCACCCTGCCCGCGGCCACGGACC(SEQ ID NO: 1).

[0129] Using the assay described in Example 4, the resulting plasmid comprising the 5’-UTR of the ESRI mRNA was compared to a corresponding plasmid that contained the full-length EMCV IRES instead. A plasmid without an IRES insert served as a control. The greater the translation activity, the greater is the ratio of Firefly luciferase (Flue) to Renilla luciferase (Rluc). FIG. 3 A summarizes the results of this experiment.

[0130] The EMCV IRES is commonly used in research application because of its Cap-independent translation activity, which is high relative to other IRESes known in the state of the art. Surprisingly, the 5’-UTR sequence of the ESRI mRNA (SEQ ID NO: 1) was found to induce almost 3 -fold greater Cap-independent translation activity than the EMCV IRES.

[0131] To evaluate for possible splicing of the reporter mRNAs, 293T-SC2 cells produced as described in Example 2 were harvested. RNA extraction was performed using Rneasy columns (Qiagen) per the manufacturer’ s instructions. One pg of total RNA was used for each reverse transcription reaction, which was performed using SuperScript IV kit (catalog #18091050, Invitrogen, Carlsbad, California) with either oligodT or random primers per the manufacturer’s instructions.

[0132] Separate PCR reactions were performed with primers designed to produce multiple overlapping amplicons encompassing the entirety of Renilla luciferase coding sequence, the AEMCV sequence, and the 5’ end of firefly luciferase. Primers amplifying the entirety of the reporter (Rluc-AEmcV-IRES-Fluc) were also used to verify the absence of aberrant splice products for bicistronic reporter cassettes comprising the ESRI 5’-UTR sequence or the EMCV IRES. PCR was performed using Q5 Hot Start High-Fidelity 2x Master Mix (catalog #M0494L, New England Biolabs). Amplification products were run on a 0.9% agarose gel with densitometric quantification of band intensity and / or evaluation ofproduct size, depending on the experiment. The results of this experiment are summarized in Figure 3B.

[0133] As can be seen from FIG. 3, the mRNA transcribed from the bicistronic reporter cassettes are not spliced to allow Cap-dependent expression of the firefly luciferase coding sequence, i.e., all expression is due to cap-independent expression.Example 6. Sequence elements important for ESRI IRES function

[0134] This example demonstrates that nucleic acids 88-174 of the 5’-UTR sequence of the ESRI mRNA, i.e. about 90 nucleic acids, comprise sequence elements important for IRES function.

[0135] Example 5 confirmed previous findings by others that the 5’-UTR of the ESRI mRNA includes a bona fide IRES that is capable of initiating translation when operably linked to a protein coding sequence such as a reporter gene. To determine the minimal nucleic acid sequence responsible for inducing translation, bicistronic reporter cassettes including fragments of the 174-nucleic acid long 5’-UTR sequence of the native ESRI mRNA (SEQ ID NO: 1) described in Example 5 were prepared as described in Example 1 and tested using the assay described in Example 4.

[0136] The nucleic acid sequences of the deletion variants placed at the insertion site of the bicistronic reporter cassette are listed in Table 1.Table 1. Fragments of the 5’-UTR of the ESRI mRNA

[0137] The results of the experiment in this example are summarized in FIG. 4. Reporter cassettes including inserts consisting of nucleic acids 88-174 and 88-131, respectively, of the ESRI mRNA 5’-UTR retained the capability to initiate cap-independent translation. As can also be seen from FIG. 4, a cassette including an insert consisting of nucleic acids 99-174 retained only residual cap-independent translation activity.

[0138] In light of these findings, further experiments focused on dissecting nucleic acids 88-131 of the ESRI mRNA 5 ’-UTR to identify a minimal sequence with IRES function.Example 7. Identification of a shorter sequence with IRES function

[0139] This example demonstrates that an about 20 nucleic acid-long sequence of the 5 ’-UTR of the ESRI mRNA is sufficient to initiate translation.

[0140] To determine whether nucleic acids 88-131 of the ESRI mRNA 5’-UTR are all required for IRES function, additional deletion mutants were prepared. Their nucleotide sequences are shown in Table 2. To study the impact of reducing the length of the insert sequence, control inserts of the same length were prepared, in which a sequence of the P-globin 5’-UTR served as a filler. The nucleotide sequences of these constructs are also listed in Table 2.

[0141] Each deletion mutant was placed in the insertion site of the bicistronic reporter cassette described in Example 1 and tested in the assay described in Example 4. The reporter cassette with the 174 nucleic acid-long 5 ’-UTR sequence of the native ESRI mRNA described in Example 5 and the reporter cassettes with the fragments consisting of nucleic acids 88-174 and 88-131, respectively, of the ESRI mRNA 5 ’-UTR described in Example 6 served as positive controls.Table 2. Additional ESRI mRNA 5’-UTR fragments with and without filler

[0142] The results of the experiment described in this example are summarized in FIG. 5. The shortest fragment which retained IRES function consisted of nucleic acids 88- 109 of the ESRI mRNA 5’-UTR. Surprisingly, this fragment was found to exhibit an about 3 -fold increase in IRES-initiated translation activity compared to the 174 nucleic acid-long 5’-UTR sequence of the native ESRI mRNA described in Example 5. The fragment consisting of nucleic acids 88-120 showed an almost 4-fold increase in translation activity relative to the 5’-UTR sequence described in Example 5. These findings indicate that the 174 nucleic acid-long 5’-UTR sequence of the ESRI mRNA described in Example 5 contains elements that do not contribute to translation activity and, indeed, may have inhibitory activity. A fragment consisting of nucleic acids 88-98 only did not have any measurable translation activity.

[0143] Interestingly, the increase in translation activity was not observed when a P- globin filler sequence was added between the fragments consisting of nucleic acids 88-120 and 88-109 and coding sequence of the downstream reporter gene. Constructs with the P- globin filler initiate translation at a level comparable to the 174 nucleic acid-long 5’-UTR sequence of the ESRI mRNA described in Example 5.

[0144] This example demonstrates that an about 20 nucleic acid-long sequence consisting of nucleic acids 88-109 of the ESRI mRNA 5’-UTR is sufficient to initiate translation. This isolated IRES sequence can be 3-fold more effective in initiating translation than the 174 nucleic acid-long 5’-UTR sequence of the native ESRI mRNA described in Example 5.Example 8. Mutational analysis of the minimal ESRI IRES

[0145] This example demonstrates that a region of about 10 nucleic acids in the ESRI 5’-UTR is critical for IRES initiated translation activity.

[0146] To further dissect the contribution of individual nucleic acids to IRES function, nucleic acids were individually mutated in an antisense manner. Starting from the the bicistronic reporter cassette described in Example 5 which includes the 174-nucleotide long 5’-UTR sequence of the ESRI mRNA, variants with individual antisense mutations of nucleic acids 94 to 108 were prepared and tested using the assay described in Example 4.

[0147] The results of the experiment described in this example are summarized in FIG. 6. Surprisingly, individually mutating each of nucleic acids 95 to 104, i.e., nucleic acids CUUUUUCCAG, to the antisense nucleotide resulted in ablation of IRES -initiated translation activity. Mutating either nucleic acid U94 or Gios resulted in significantly reduced IRES-initiated translation activity.

[0148] This example demonstrates that nucleic acids 95-104 in the ESRI 5’-UTR are critical for IRES-initiated translation activity.Example 9. IRES activity predicts ERa protein levels in cells better than mRNA

[0149] This example demonstrates that IRES activity, not mRNA expression, is dictates the majority of ERa protein levels.

[0150] ERa protein levels were determined in six ERa positive cancer cell lines including the breast cancer cell lines MCF7, T47D and ZR-75-1. ESRI mRNA levels were also determined in each of the six cell lines. In addition, ESRI IRES activity was assessed using the bicistronic reporter cassette described in Example 5.

[0151] Plotting ERa protein expression against ESRI mRNA expression in a linear regression model showed a poor fit of the data (R2= 0.3015), as can be seen from FIG. 7A. In contrast, plotting ERa protein expression against ESRI IRES activity demonstrated a good fit of the data (R2= 0.9405), as shown in FIG. 7B.

[0152] This example demonstrates that the level of ERa protein in a cell is reliably predicted by the activity of the ESRI IRES, and not simply by the amount of ERa mRNA. This indicates the importance of cap-independent regulation by the ESRI IRES of the ERa mRNA in ERa protein expression.Example 10. Inhibition of the ESRI IRES

[0153] This example demonstrates that a previously described small-molecule IRES inhibitor is capable of inhibiting translation activity of the ESRI IRES.

[0154] It was reported previously that an IRES-targeting small molecule can inhibit enterovirus 71 replication via allosteric stabilization of a ternary complex (Jesse Davila- Calderon et al., Nat Commun. 2020;l 1(1):4775). The bicistronic reporter cassette and the assay described in Example 4 were used to determine whether such IRES inhibitors are also effective in inhibiting translation activity of the ESRI IRES. 293 T cells transiently transfected with the bicistronic reporter cassette were incubated in the presence of the 2,6- diaminopyrazine derivative DMA-135 in DMSO at the following concentrations: 0 pM, 1 pM, 5 pM, 10 pM, 50 pM, or 100 pM. The results of this assay are shown in FIG. 8 A and the ratio of Flue to Rluc is shown in FIG. 8B.

[0155] To test the effect of blocking endogenous ESRI IRES-initiated translation of ERa protein in breast cancer cells, MCF7 breast cancer cells were treated with 1 pM, 5 pM, 10 pM or 15 pM DMA-135 in DMSO. DMSO-treated cells served as a control., The cells were stably transfected with a lentiviral rescue plasmid to express an exogenous ERa-dTag. The presence of native ERa expressed from the rescue plasmid served two purposes. Firstly, it guaranteed survival of the cells in the event of successful inhibition of expression from the native ESRI mRNA. Secondly, the mRNA encoding the ERa-dTag protein was capped and did not comprise an IRES and therefore could be used to confirm that only IRES-initiated translation was inhibited by the presence of DMA-135. At the end of the incubation period, the cells were lysed and endogenous ERa expression and ERa-dTag expression were assessed by Western blot. B-actin levels served as an internal control. The results of this experiment are summarized in Fig. 9A.

[0156] FIG. 9A shows that endogenous ERa levels correspondingly decreased to an increase in DMA-135 concentration. In contrast, the amount of exogenous, cap-driven ERa, “ERa-dTag”, was not reduced by addition of DMA-135.

[0157] These results could be reproduced in T47D and ZR-75-1 breast cancer cell lines. The cells were treated with 1 pM, 5 pM, 10 pM or 15 pM DMA-135 in DMSO. DMSO-treated cells served as a control. At the end of the incubation period, the cells were lysed and endogenous ERa expression was assessed by Western blot. GAPDH levels served as an internal control. The results of these experiments are summarized in FIG. 9B and FIG. 9C, respectively.

[0158] This example demonstrates that IRES inhibitors such as the tested 2,6- diaminopyrazine derivative DMA- 135 can be used effectively to inhibit IRES-initiatedtranslation of ERa mRNA. The example also shows that such IRES inhibitors can be used to control ERa levels in breast cancer cells without interfering with Cap-dependent translation of mRNA.

[0159] It should be understood that the particular embodiments described herein are given by way of illustration only, not limitation. Other features, objects, and advantages are apparent from the above detailed description, drawings and examples. Various changes and modifications will be apparent to those skilled in the art.

Claims

CLAIMS1. An isolated estrogen receptor 1 (ESRI) internal ribosome entry site (IRES) of about 90 nucleic acids or less comprising the following nucleic acid sequence:5’- CUUUUUCCAG -3’ (SEQ ID NO: 2).

2. The isolated ESRI IRES of claim 1, comprising the nucleic acid sequence5’- X1CUUUUUCCAGX2X3 -3’ (SEQ ID NO: 3), wherein Xi and X3are nucleic acids other than A and X2 is a nucleic acid other than C.

3. The isolated ESRI IRES of claim 2, wherein Xi is U, X2 is G, and / or X3 is U.

4. The isolated ESRI IRES of any preceding claim, wherein the isolated ESRI IRES comprises or consists of a nucleic acid sequence at least 80%, 85%, 90% or 95% identical to, or identical to, the following nucleic acid sequence:5’-CUGUGCUCUUUUUCCAGGUG-3’ (SEQ ID NO: 5).

5. The isolated ESRI IRES of any one of the preceding claims, wherein the isolated ESRI IRES is capable of improving translation compared to a corresponding wildtype IRES-containing nucleic acid sequence by at least about 1.5-fold, about 2-fold, about 3 -fold, or about 4-fold.

6. An expression vector comprising the isolated ESRI IRES of any one of the preceding claims, operably linked to a nucleic acid sequence encoding a peptide, polypeptide or protein.

7. The expression vector of claim 6, wherein the peptide, polypeptide or protein is a therapeutic peptide, polypeptide or protein, optionally an immunogen or an enzyme.

8. The expression vector of claim 6, wherein the peptide, polypeptide or protein is a reporter protein, optionally a fluorescent protein or an enzyme such as a luciferase.

9. The expression vector of any one of claims 6-8, composed of deoxyribonucleotides or ribonucleotides, optionally wherein at least one of the ribonucleotides is modified.

10. The expression vector of any one of claims 6-9, wherein the expression vector is a plasmid, a viral vector, a circular polyribonucleic acid, or a messenger RNA.

11. A cell comprising the expression vector of any one of claims 6-10.

12. A composition comprising the isolated ESRI IRES of any one of claims 1-5, and one or more excipients.

13. The composition of claim 12, wherein the one or more excipients is one or more of water, a buffering agent and a salt.

14. A method comprising:(a) providing a cell with an expression vector comprising the isolated ESRI IRES of any one of claims 1-5 operably linked to a nucleic acid sequence encoding a reporter protein;(b) contacting the cell with one or more compounds; and(c) determining whether the one or more compound modulate(s) expression of the reporter protein.

15. The method of claim 14, wherein the cell is a cancer cell.

16. The method of claim 15, wherein the cancer cell is a breast, ovarian, or endometrial cancer cell.

17. The method of claim 16, wherein the breast, ovarian or endometrial cancer cell is resistant to endocrine therapy and / or is metastatic.

18. The method of any one of claims 14-17, further comprising a step of determining a cytotoxic effect of the one or more compounds on the cell.

9. The method of claim 18, further comprising selecting the one or more compounds that have a cytotoxic effect on the cell to determine its anti-tumor activity in a relevant in vivo model.

Images