Restoring tim4 in liver macrophages to treat non-alcoholic steatohepatitis (NASH)

Abstract

Compositions and methods for treating or preventing nonalcoholic steatohepatitis (NASH). In one aspect, the disclosed methods relate to targeting a macrophage receptor called cell immunoglobulin and mucin domain containing 4 (TIM4). The compositions and methods disclosed herein can be used as disease modifying therapies to enable treatment of NASH and related disorders earlier in disease progression and improve clinical outcomes.

Description

RESTORING TIM4 IN LIVER MACROPHAGES TO TREAT NON-ALCOHOLIC STEATOHEPATITIS (NASH)

[0001] This International Patent Application claims the benefit of and priority to U.S. Provisional Application No. 63 / 584,805, filed September 22, 2023, entitled “RESTORING TIM4 IN LIVER MACROPHAGES TO TREAT NONACOHOLIC STEATOHEPATITIS (NASH)”, the contents of which is hereby incorporated by reference in its entirety.

[0002] All patents, patent applications and publications, and other literature references cited herein are hereby incorporated by reference in their entirety. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art as known to those skilled therein as of the date of the invention described and claimed herein.

[0003] This patent disclosure contains material that is subject to copyright protection. The copyright owner has no objection to the facsimile reproduction by anyone of the patent document or the patent disclosure as it appears in the U.S. Patent and Trademark Office patent file or records, but otherwise reserves any and all copyright rights.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under HL 127464, and DK137021 awarded by the National Institutes of Health. The government has certain rights in the invention.BACKGROUND

[0005] Nonalcoholic liver disease, specifically nonalcoholic steatohepatitis (NASH), is the leading cause of chronic liver disease worldwide; however, there are limited treatments for NASH due to a poor understanding of NASH pathology. More specifically, there is limited understanding of the conversion of the relatively benign steatosis to NASH. Recent genetic evidence has shown that NASH liver macrophages have a marked decrease in T cell immunoglobulin and mucin domain containing 4 (TIM4) expression. However, the role of TIM4 in efferocytosis and liver fibrosis in NASH remain unknown.SUMMARY OF THE INVENTION

[0006] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising administering to said subject a composition that increases the expression level of a macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0007] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising: (i) identifying the subject as having a decreased expression level of a macrophage receptor, and (ii) administering to said subject a composition that increases the expression level of the macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0008] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising: (i) identifying the subject as having an increased ratio of a macrophage-associated apoptotic cell to a free apoptotic cell, and (ii) administering to said subject a composition that increases the expression level of the macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0009] In some embodiments, the subject has a decreased expression level of a macrophage receptor as compared to a subject not suffering from NASH or a subject suffering from early NASH. In some embodiments, the subject has an increased ratio of a macrophage-associated apoptotic cell to a free apoptotic cell as compared to a subject not suffering from NASH or a subject suffering from early NASH. In some embodiments, the composition increases the macrophage receptor expression compared to a subject suffering from NASH or compared to the expression before administering the composition. In some embodiments, the composition reduces the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition.

[0010] In some embodiments, administration of the composition results in inhibition or reduction of liver fibrosis. In some embodiments, administration of the composition results in inhibition or reduction of hepatic stellate cell (HSC) activation. In some embodiments, administration of the composition results in inhibition or reduction of bile ductular reaction. In some embodiments, administration of the composition results in inhibition or reduction of hepatic crown-like structure formation. In some embodiments, administration of the composition does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

[0011] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0012] In some embodiments, the composition comprises a nucleic acid sequence encoding the macrophage receptor. In some embodiments, the composition comprises a nucleic acid sequence capable of increasing the expression level of the macrophage receptor. In some embodiments, the composition comprises an expression vector comprising the nucleic acid sequence. In some embodiments, the composition comprises a viral vector comprising the expression vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV8. In some embodiments, the composition increases the expression level of the macrophage receptor in macrophages. In some embodiments, the composition increases the expression level of the macrophage receptor in liver macrophages.

[0013] In certain aspects, described herein is a composition for treating or preventing NASH comprising a nucleic acid encoding a macrophage receptor. In certain aspects, described herein is a composition for treating or preventing NASH comprising a nucleic acid sequence capable of increasing the expression level of a macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4). In some embodiments, administration of the composition to a subject in need thereof results in inhibition or reduction of liver fibrosis. In some embodiments, administration of the composition to a subject in need thereof results in inhibition of collagen lai expression. In some embodiments, administration of the composition to a subject in need thereof results in inhibition or reduction of hepatic stellate cell (HSC) activation. In some embodiments, administration of the composition to a subject in need thereof results in inhibition orreduction of bile ductular reaction. In some embodiments, administration of the composition to a subject in need thereof does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

[0014] In some embodiments, the composition comprises an expression vector comprising the nucleic acid sequence. In some embodiments, the composition comprises a viral vector comprising the expression vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV8.

[0015] In some embodiments, the composition increases the expression level of the macrophage receptor in macrophages. In some embodiments, the composition increases the expression level of the macrophage receptor in liver macrophages. In some embodiments, the composition increases the expression level of the macrophage receptor in bone marrow derived macrophages.

[0016] In certain aspects, described herein is a method of diagnosing nonalcoholic steatohepatitis (NASH) in a subject comprising: (i) determining the expression level of cell immunoglobulin and mucin domain containing 4 (TIM4) in the subject; and (ii) diagnosing the subject with NASH if the expression level of TIM4 in the subject is decreased as compared to a subject not suffering from NASH.

[0017] In some embodiments, the subject is diagnosed with fibrotic NASH. In some embodiments, the expression level of TIM4 is determined using an antibody. In some embodiments, the expression level of TIM4 is determined by immunoblotting. In some embodiments, the expression level of TIM4 is determined by quantitative RT-qPCR. In some embodiments, the method further comprises administering the composition described herein to a subject diagnosed with NASH.

[0018] In certain aspects, described herein is a composition comprising a nucleic acid encoding a macrophage receptor. In certain aspects, described herein is a composition comprising an expression vector comprising a nucleic acid encoding a macrophage receptor. In certain aspects, described herein is a composition comprising a viral vector comprising a nucleic acid encoding a macrophage receptor. In some embodiments, the macrophage receptor is TIM4. In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV8.BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0020] FIGs. 1A-D show that efferocytosis by liver macrophages and the efferocytosis receptor TIM4 are decreased in human and experimental NASH. FIG.1A Immunostaining of human liver sections from subjects with a NAS score of 0-2 or 3-6 using TUNEL (cell death) and anti-CD68 (macrophage, M<|)). Arrows indicate macrophage-associated TUNEL+cells, while arrowheads indicate macrophage-free TUNEL+ cells. Efferocytosis was determined by calculating the ratio of macrophage-associated: free TUNEL+cells and total TUNEL+cells per field (n = 4 in the NAS 0-2 group and 16 in the NAS 3-6 group). FIG. IB Livers from mice fed the HF-CDAA diet for the indicated weeks were assayed for efferocytosis, using anti-cleaved caspase-3 (cl-Casp3) to mark apoptotic cells and anti-Mac2 to stain macrophages (n=3-9 mice per group. Examples of images at 3 and 12 weeks of diet feeding are shown. Bar, 100 pm. White arrows indicate macrophage-associated apoptotic cells, and yellow arrowheads indicate macrophage free apoptotic cells. FIG. 1C Immunoblots of TIM4 in another cohort of human normal and NASH liver, with data quantification (n = 7 / group). Fig. ID Immunostaining of human normal and NASH liver sections from panel A using anti- TIM4 (red) and anti-CD68 (green). Bar, 50 pm. Data were quantified as TIM4 MFI in CD68+macrophages relative to normal liver (n = 5 in normal group and n = 7 in NASH group). For immunofluorescence images, nuclei are stained with DAPI (blue). All data are means ± SEM. *p <0.05, **p <0.01, ***p <0.001 by Student's t-test (panels A, C, and D) or one-way ANOVA (panel B).

[0021] FIGs. 2A-I show that anti-TIM4 reduces efferocytosis and accelerates liver fibrosis in early NASH. FIG. 2A Images of primary human KCs stained for F-actin (red) after exposure to apoptotic human hepatocytes (apHCs, green) for 6 h in the presence of IgG or anti-TIM4. Bar, 10 pm. The data were quantified as both the average volume of engulfed cargo and the MFI of internalized apHCs (n = 7 biological replicate cells / group). FIG. 2B Quantification of efferocytosis by primary mouse KCs after exposure to PKH67-labaled apoptotic mouse hepatocytes (n = 4 biological replicate cells / group). FIGs. 2C-I Mice were fed the HF-CDAA NASH diet for 4 weeks and treated with IgG or anti-TIM4 during weeks 3-4 (n = 5 mice / group). FIG. 2C Images of liver sections immunostained with anti-Mac2(green) and anti-cl-Casp3 (red). Bar, 25 pm. Yellow arrows depict efferocytic macrophages and white arrows depict macrophage-free apoptotic cells. Efferocytosis was quantified as in Fig. IB. FIG. 2D Staining and quantification of picrosirius red-positive area. Bar, 200 pm. FIG. 2E Immunostaining and quantification of collagen lai (COLlAl)-positive area. Bar, 200 pm. FIG. 2F Immunostaining and quantification of a-SMA-positive area . Bar, 50 pm. FIG. 2G Immunostaining and quantification of osteopontin (OPN)-positive area. Bar, 200 pm. FIG. 2H Immunostaining and quantification of cytokeratin 19 (CK19)-positive area. Bar, 200 pm. FIG. 21 Immunostaining of F4 / 80, with quantification of F4 / 80+hepatic crownlike structures (hCLS) / field. Bar, 200 pm. For immunofluorescence images, nuclei are stained with DAPI (blue). All data are means ± SEM. *p <0.05, **p <0.01 by Student's t-test.

[0022] FIGs. 3A-L show that Knockdown of Kupffer cell TIM4 decreases efferocytosis and accelerates liver fibrosis in early HF-CDAA diet-induced NASH. For Figs. A-H, Timd4n n(control, Ctr) and Timd4!,J,(4ec4f-(4re ^ (knockdown, KD) male mice were fed the HF-CDAA diet for 4 weeks (n = 8-10 mice / group). FIG. 3A Immunostaining of liver sections using anti-TIM4 (red) and anti-F4 / 80 (green). Data were quantified as macrophage TIM4 MFI relative to control mice (n = 4 mice / group). Bar, 50 um. FIG. 3B Images of liver sections immunostained with anti-Mac2 (green) and anti-cl-Casp3 (red). Bar, 50 pm. Yellow arrows depict efferocytic macrophages and white arrows depict macrophage-free apoptotic cells. Efferocytosis was quantified as in Fig. IB. FIG. 3C Staining and quantification of picrosirius red-positive area (arrows). Bar, 200 pm. FIG. 3D Immunostaining and quantification of collagen lai -positive area. Bar, 200 pm. FIG. 3E Immunostaining and quantification of a-SMA-positive area. Bar, 50 pm. FIG. 3F Immunostaining and quantification of OPN-positive area. Bar, 200 pm. FIG. 3G Immunostaining and quantification of CK19-positive area. Bar, 200 pm. FIG. 3H Immunostaining of F4 / 80, with quantification of F4 / 80+hepatic crown-like structures / field. Bar, 200 pm. For FIGs. 3I-L, Timd^ (control, Ctr) and Timd4,! ,!X4ec4f-(4re ^ (knockdown, KD) mice were fed the HF- CDAA diet for 8 weeks (n = 13 mice / group). FIG. 31 Images of liver sections immunostained with anti-Mac2 (green) and anti-cl-Casp3 (red). Bar, 100 pm. The arrows depicts an efferocytic macrophage, and the arrowheads depict macrophage-free apoptotic cells. Efferocytosis was quantified as in Fig. IB. FIG. 3J Staining and quantification of picrosirius red-positive area (arrows). Bar, 200 pm. FIG. 3K Immunostaining and quantification of collagen lai -positive area. Bar, 200 pm. FIG. 3L Immunostaining and quantification of OPN-positive area. Bar, 200 pm. For immunofluorescence images, nucleiare stained with DAPI (blue). All data are means ± SEM. *p <0.05, **p <0.01 by Student's t- test.

[0023] FIGs. 4A-I show that knockdown of Kupffer cell TIM4 decreases efferocytosis and accelerates liver fibrosis in early FPC diet-induced NASH. Timd4" " (control, Ctr) and Timd4 ,Clec4f-Cre (knockdown, KD) male mice were fed the FPC diet for 16 weeks (n = 8- 9 mice / group). FIG. 4A Immunostaining of liver sections using anti-TIM4 (red) and anti- F4 / 80 (green). Data were quantified as macrophage TIM4 MFI relative to control mice (n = 5 mice / group). Bar, 50 um. FIG. 4B Images of liver sections immunostained with anti-Mac2 (green) and anti-cl-Casp3 (red). Bar, 50 pm. The arrow depicts an efferocytic macrophage, and the arrowheads arrows depict macrophage-free apoptotic cells. Efferocytosis was quantified as in Fig. IB. FIG. 4C Staining and quantification of picrosirius red-positive area (arrows). Bar, 50 pm. FIG. 4D Immunostaining and quantification of COLlAl-positive area. Bar, 200 pm. FIG. 4E Immunostaining and quantification of a-SMA-positive area. Bar, 50 pm. FIG. 4F Immunostaining and quantification of OPN-positive area. Bar, 200 pm. FIG. 4G Liver mRNAs for the indicated fibrogenic genes, expressed as relative to the values for control mice. FIG. 4H Immunostaining and quantification of CK 19-positive area. Bar, 200 pm. FIG. 41. Immunostaining of F4 / 80, with quantification of hepatic crown-like structures / field. Bar, 200 pm. All data are means ± SEM. *p <0.05, **p <0.01, ***p <0.001 by Student's t-test.

[0024] FIGs. 5A-H show that TIM4 restoration in liver macrophages in HF-CDAA diet- induced NASH promotes efferocytosis and lowers liver fibrosis. Control mice (TRE-TIMD4 and CD68rtTA; Ctr; n = 15) and inducible CD68rtTA:TRE-TIMD4 transgenic mice (iTg, n = 13) were fed the HF-CDAA diet for 10 weeks, with 75 pg / ml doxycycline (Dox) added to the drinking water during weeks 6-10. FIG. 5A Immunostaining of liver sections using anti- TIM4 (red) and anti-Mac2 (green). Data were quantified as macrophage TIM4 MFI relative to control mice. Bar, 50 um. FIG. 5B Images of liver sections immunostained with anti-Mac2 (green) and anti-cl-Casp3 (red). Bar, 25 pm. Arrows depict macrophage-free apoptotic cells. Efferocytosis was quantified as in Fig. IB. FIG. 5C Staining and quantification of picrosirius red-positive area (arrows). Bar, 200 pm. FIG. 5D Immunostaining and quantification of COLlAl-positive area. Bar, 200 pm. FIG. 5E Immunostaining and quantification of a-SMA-positive area. Bar, 100 pm. FIG. 5F Immunostaining and quantification of OPN-positive area. Bar, 100 pm. FIG. 5G Immunostaining andquantification of CK19-positive area. Bar, 200 pm. FIG. 5H Immunostaining of F4 / 80, with quantification of hepatic crown-like structures / field. Bar, 200 pm. All data are means ± SEM. *p <0.05, **p <0.01, ***p <0.001 by Student's t-test.

[0025] FIGs. 6A-I show that TIM4 restoration in liver macrophages in FPC diet-induced NASH promotes efferocytosis and lowers liver fibrosis. FIGs. 6A-H Control mice (TRE- TIMD4 and CD68rtTA; Ctr; n = 17) and inducible CD68rtTA:TRE-TIMD4 transgenic mice (iTg, n = 8) were fed the FPC diet for 16 weeks, with 75 pg / ml doxycycline (Dox) added to the drinking water during weeks 9-16. FIG. 6A Immunostaining of liver sections using anti- TIM4 (red) and anti-Mac2 (green). Data were quantified as macrophage TIM4 MFI relative to control mice (n = 3 mice / group). Bar, 50 um. FIG. 6B Images of liver sections immunostained with anti-Mac2 (green) and anti-cl-Casp3 (red). Bar, 100 pm. Arrows depict efferocytic macrophages, and the arrowhead depicts a macrophage-free apoptotic cell.Efferocytosis was quantified as in Fig. IB. FIG. 6C Staining and quantification of picrosirius red-positive area (arrows). Bar, 100 pm. FIG. 6D Immunostaining and quantification of COL 1 Al -positive area. Bar, 200 pm. FIG. 6E Immunostaining and quantification of a-SMA- positive area. Bar, 50 pm. FIG. 6F Immunostaining and quantification of OPN-positive area. Bar, 200 pm. FIG. 6G Liver mRNAs for the indicated fibrogenic genes, expressed as relative to the values for control mice. FIG. 6H Immunostaining and quantification of CK 19-positive area. Bar, 200 pm. FIG. 61 Immunostaining of F4 / 80, with quantification of F4 / 80+crownlike structures / field. Bar, 200 pm. All data are means ± SEM. *p <0.05, **p <0.01, ***p <0.001 by Student's t-test.

[0026] FIGs. 7A-J show additional data documenting decreased liver macrophage TIM4 and efferocytosis in mouse NASH liver. Related to Fig. 1. FIG. 7A Mice were fed chow diet or the HF-CDAA diet for the indicated times, and liver tissues were stained with picrosirius red and H&E. Bar, 50 pm for picrosirius red and 200 pm for H&E staining. FIG. 7B The livers of mice fed chow diet or the HF-CDAA diet for 12 weeks were assayed for mRNAs encoding the indicated efferocytosis receptors (n = 6 mice / group). FIG. 7C Livers from Merlkn nand Merlknyz2-Cre ~ mice fed the HF-CDAA diet for 4 weeks were assayed for efferocytosis as in Fig. IB (n = 5 mice / group). FIG. 7D The livers of mice fed chow diet or the HF-CDAA diet for the indicated number of weeks were assayed for Timd4 mRNA and expressed relative to the chow value (n = 4-6 mice / group). FIG. 7E Immunoblot of TIM4 in the livers of mice fed chow diet or the HF-CDAA diet for 12 weeks, with data quantificationexpressed relative to the chow value (n =3 mice / group). FIG. 7F Immunostaining of liver sections using anti-TIM4 (red) and anti-Clec4f (Kupffer cells, green) in the livers of mice fed chow diet or the HF-CDAA diet for 12 weeks, with the data expressed relative to the chow value (n = 5 mice per group). Bar, 50 pm. FIGs. 7G-H Timd4 mRNA and TIM4 protein in the livers of mice fed chow diet or the FPC diet for 16 weeks, expressed relative to the chow value (n = 3-5 mice / group). FIG. 71 The liver sections from mice fed chow diet or the FPC diet for 16 weeks were immunostained with anti-TIM4 (red) and anti-Clec4f (green), with data quantification expressed relative to the chow value (n = 4 mice / group). Bar, 50 pm. FIG. 7J The liver sections from mice fed chow diet or the FPC diet for 8 weeks were immunostained with anti-TIM4 (red) and anti-Clec4f (green), with data quantification expressed relative to the chow value (n = 3-4 mice / group). Bar, 50 pm. All data are means ± SEM. *p <0.05, **p <0.01, ***p <0.001 by Student's t-test for all panels except panel D, which used one-way ANOVA.

[0027] FIGs. 8A-L show additional data documenting that blocking or genetic targeting of TIM4 decreases liver macrophage efferocytosis and accelerates liver fibrosis in early NASH. Related to Figs. 2-3. FIGs. 8A-D The IgG- and anti-TIM4-treated HF-CDAA early NASH mice described in Fig. 2 (n = 5 mice / group) were assayed for the following: FIG. 8A Body and liver weight; FIG. 8B H&E staining of liver sections and lipid droplet area quantification. Bar, 250 pm; FIG. 8C Plasma ALT activity; and FIG. 8D Liver Adgrel mRNA, expressed relative to the IgG value. FIG. 8E Strategy for generation of Timd4^ mice. FIGs. 8F-H The livers of 8-week chow-fed Timd4n n(control, Ctr) and TimdR,-Clec4f-Cre+l' (knockdown, KD) mice were assayed as follows (n=4-5 mice / group): FIG. 8F mRNAs encoding the indicated efferocytosis receptors; FIG. 8G TIM4 MFI in macrophages (M(|)s); and FIG. 8H Clec4f MFI in macrophages. All data are expressed relative to the control values. Bars, 50 ppm. (I-L) HF-CDAA diet-fed control and TIM4-KD male mice described in Fig. 3 A-H (n = 8-11 mice / group) were assayed for the following: FIG. 81 Body and liver weight; FIG. 8J Fasting blood glucose; FIG. 8K H&E staining of liver sections and lipid droplet area quantification. Bar, 250 pm; and (L) Plasma ALT activity. All data are means ± SEM. *p <0.05 by Student's t-test.

[0028] FIGs. 9A-H show additional data documenting that genetic targeting of TIM4 decreases liver macrophage efferocytosis and accelerates liver fibrosis in early NASH. Related to Figs. 3-4. FIGs. 9A-C HF-CDAA diet-fed control (Ctr) and TIM4-KD femalemice described in Fig. 3I-K (n = 13 mice / group) were assayed for the following: FIG. 9A Body and liver weight; and FIG. 9B Fasting blood glucose. FIG. 9C H&E staining of liver sections and lipid droplet area quantification. Bar, 200 pm. FIGs. 9D-H FPC diet-fed control (Ctr) and TIM4-KD mice described in Fig. 4 (n = 8-9 mice / group) were assayed for the following: FIG. 9D Body and liver weight; FIG. 9E Fasting blood glucose; FIG. 9F H&E staining of liver sections and lipid droplet area quantification. Bar, 250 pm; and FIG. 9G Plasma ALT activity. FIG. 9H Liver mRNAs encoding the indicated inflammation-related genes, expressed relative to the control values. All data are means ± SEM.

[0029] FIGs. 10A-I show additional data documenting that macrophage TIM4 restoration promotes efferocytosis and lowers liver fibrosis in experimental NASH, Related to Figs. 5-6. (A-D) The HF-CDAA-fed control and inducible TIM4 transgenic mice described in Fig. 5 (n = 13-15 mice / group) were assayed for the following: FIG. 10A Body and liver weight; FIG. 10B Fasting blood glucose; FIG. 10C H&E staining of liver sections and lipid droplet area quantification. Bar, 250 pm; and FIG. 10D Plasma ALT activity. FIGs. 10E-H The FPC-fed control and inducible TIM4 transgenic mice described in Fig. 6 (n = 8-9 mice / group) were assayed for the following: FIG. 10E Body and liver weight; FIG. 10F Fasting blood glucose; FIG. 10G H&E staining of liver sections and lipid droplet area quantification. Bar, 250 pm; FIG. 10H Plasma ALT activity; and FIG. 101 Liver mRNAs encoding the indicated inflammation-related genes, expressed relative to the control values. All data are means ± SEM.

[0030] FIG. 11 shows a list of human liver samples

[0031] FIG. 12 shows a list of mouse primer sequences used for qPCR.

[0032] FIG. 13 shows an experimental design to demonstrate that genetically overexpressed efferocytosis receptor TIM4 in bone marrow-derived macrophage (BMDM) reduces experimental MASH. 10-week-old male C57BL / 6J mice are fed a high fat choline deficient amino acid (HFCDAA) defined diet, a recognized model of NASH / MASH, for 6 weeks. After four weeks, control or genetically overexpressing TIM4 BMDMs are administered to the mice. Mice are sacrificed 2 weeks post macrophage administration. N=5 mice per condition.

[0033] FIG. 14 shows that genetically overexpressed efferocytosis receptor TIM4 in BMDMs reduces liver fibrosis in experimental MASH. Sirius red staining indicates collagenstaining. Administration of TIM4 overexpressing BMDMs decreased Sirius red staining area compared to administration of control BMDMs, indicating a decrease in liver fibrosis. N=5. Scale bar is 200 pm.

[0034] FIG. 15 shows that genetically overexpressed efferocytosis receptor TIM4 in BMDMs reduces collagen lai deposition in experimental MASH. Col lai immunohistochemistry (IHC) shows that administration of TIM4 overexpressing BMDMs decreased Col lal+ area compared to administration of control BMDMs. N=5. Scale bar is 200 pm.

[0035] FIG. 16 shows that genetically overexpressed efferocytosis receptor TIM4 in BMDMs reduces hepatic stellate cells activation in experimental MASH. Immunofluorescence of alpha smooth muscle actin (a-SMA, red) and nuclei (DAP I, blue) shows activated hepatic stellate cells. Administration of TIM4 overexpressing BMDMs decreased a-SMA+ area compared to administration of control BMDMs. N=5. Scale bar is 100 pm.

[0036] FIG. 17 shows that genetically overexpressed efferocytosis receptor TIM4 in BMDMs does not affect liver steatosis in experimental MASH. H&E staining shows the presence of lipid droplets (white, circular). Administration of TIM4 overexpressing BMDMs did not show significant difference in lipid droplet area compared to administration of control BMDMs. N=5. Scale bar is 200 pm.

[0037] FIG. 18 shows amino acid and nucleic acid sequences of TIM4.DETAILED DESCRIPTION

[0038] All patent applications, published patent applications, issued and granted patents, texts, and literature references cited in this specification are hereby incorporated herein by reference in their entirety to more fully describe the state of the art to which the present disclosed subject matter pertains.

[0039] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. Allpublications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0040] The present disclosure provides compositions and methods for treating and / or preventing nonalcoholic liver disease. Nonalcoholic liver disease, specifically nonalcoholic steatohepatitis (NASH), is the leading cause of chronic liver disease worldwide; however, there are limited treatments for NASH due to a poor understanding of NASH pathology. More specifically, there is limited understanding of the conversion of the relatively benign steatosis to NASH. Recent genetic evidence has shown that NASH liver macrophages have a marked decrease in T cell immunoglobulin and mucin domain containing 4 (TIM4) expression. Nonalcoholic steatohepatitis (NASH) is emerging as the leading cause of liver disease, but the processes leading to liver fibrosis in NASH, which determines clinical outcome, are incompletely understood. Described herein is evidence that impaired clearance of dead liver cells by liver macrophages in NASH, which is due to loss of a macrophage receptor called TIM4, contributes to liver fibrosis. Knowledge of this process may suggest new ways to bolster the clearance of dead liver cells in NASH and thereby prevent the progression to liver fibrosis and subsequent liver disease.

[0041] Hepatocyte apoptosis is a key feature of non-alcoholic steatohepatitis (NASH), but the fate of apoptotic hepatocytes in NASH is poorly understood. Described herein are studies exploring whether impaired TIM4-mediated clearance of dead hepatocytes by liver macrophages (efferocytosis) is impaired in NASH and drives the progression to liver fibrosis.

[0042] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in the application including, but not limited to, patents, patent applications, articles, books, manuals, and treatises are hereby expressly incorporated by reference in their entirety for any purpose.

[0043] The term “contacting” or “contact” as used herein in connection with contacting a population of cells, e.g. a population of hepatic cells includes, subjecting the cells to an appropriate culture media which comprises the indicated compound or agent. Where the cell population is in vivo, “contacting” or “contact” includes administering the compound oragent in a pharmaceutical composition to a subject via an appropriate administration route such that the compound or agent contacts the cell population in vivo.

[0044] For in vivo methods, a therapeutically effective amount of a compound or agent described herein can be administered to a subject. Methods of administering compounds or agents to a subject are known in the art and are available to one of skill in the art.

[0045] The terms “treatment,” “treating,” “treat,” “therapy,” “therapeutic,” and the like are used herein to refer generally to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. “Treatment” as used herein covers any treatment of a disease in a subject, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom, may or may not be diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.

[0046] The expression “therapeutically effective amount” refers to an amount of a compound or agent disclosed herein, that is effective for preventing, ameliorating, treating or delaying the onset of a disease or condition.

[0047] As used herein the term “variant” covers nucleotide or amino acid sequence variants which have about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 85%, about 80%, about 75%, about 70%, or about 65% nucleotide identity, or about 99%, about 98%, about 97%, about 96%, about 95%, about 94%, about 93%, about 92%, about 91%, about 90%, about 85%, about 80%, about 75%, about 70%, or about 65% amino acid identity, including but not limited to variants comprising conservative, or non-conservative substitutions, deletions, insertions, duplications, or any other modification.

[0048] As used herein MASH refers to metabolic dysfunction-associated steatohepatitis. MASH was previously referred to as NASH. References to MASH herein are intended to refer to MASH as well as the prior nomenclature of NASH and references to NASH are intended to refer to MASH.

[0049] The pharmaceutical compositions of the inventions can be administered to any animal that can experience the beneficial effects of the agents or compounds of the invention. Such animals include humans and non-humans such as primates, pets and farm animals.

[0050] The present invention also comprises pharmaceutical compositions comprising the agents or compounds disclosed herein. Routes of administration and dosages of effective amounts of the pharmaceutical compositions comprising the agents or compounds are also disclosed. The agents or compounds of the present invention can be administered in combination with other pharmaceutical agents in a variety of protocols for effective treatment of disease.

[0051] Pharmaceutical compositions of the present invention are administered to a subject in a manner known in the art. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired. One may administer the viral vectors, nucleic acids, or related compounds in a local rather than systemic manner, for example, via injection of directly into the desired target site, often in a depot or sustained release formulation. Furthermore, one may administer the composition in a targeted drug delivery system, for example, in a liposome coated with a tissue-specific antibody, targeting, for example, the liver, and more specifically hepatocytes. The liposomes will be targeted to and taken up selectively by the desired tissue. Also included in a drug delivery system is nanoparticle delivery of the viral vectors, nucleic acids, or compounds, alone or in combination with similar compounds. A summary of various delivery methods and techniques of siRNA administration in ongoing clinical trials is provided in Zuckerman and Davis 2015; Nature Rev. Drug Discovery, Vol. 14: 843-856, Dec. 2015.

[0052] One of ordinary skill in the art will appreciate that a method of administering pharmaceutically effective amounts of the pharmaceutical compositions of the invention to a patient in need thereof, can be determined empirically, or by standards currently recognized in the medical arts. The agents can be administered to a patient as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents of the pharmaceutical compositions of the present invention will be decided within the scope of sound medical judgment by the attending physician. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the typeand degree of the cellular response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, gender and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. It is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.

[0053] Dosaging can also be administered in a patient-specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art.Methods of treating and / or preventing nonalcoholic steatohepatitis (NASH)

[0054] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising administering to said subject a composition that increases the expression level of a macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0055] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising: (i) identifying the subject as having a decreased expression level of a macrophage receptor, and (ii) administering to said subject a composition that increases the expression level of the macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0056] In certain aspects, described herein is a method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising: (i) identifying the subject as having an increased ratio of a macrophage-associated apoptotic cell to a free apoptotic cell, and (ii) administering to said subject a composition that increases the expression level of the macrophage receptor. In some embodiments, the macrophage receptoris an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

[0057] In some embodiments, the subject has a decreased expression level of a macrophage receptor as compared to a subject not suffering from NASH or a subject suffering from early NASH. In some embodiments, the subject has an increased ratio of a macrophage-associated apoptotic cell to a free apoptotic cell as compared to a subject not suffering from NASH or a subject suffering from early NASH. In some embodiments, the composition increases the macrophage receptor expression compared to a subject suffering from NASH or compared to the expression before administering the composition. In some embodiments, the composition reduces the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition.

[0058] In some embodiments, administration of the composition results in inhibition or reduction of liver fibrosis. In some embodiments, administration of the composition results in inhibition or reduction of hepatic stellate cell (HSC) activation. In some embodiments, administration of the composition results in inhibition or reduction of bile ductular reaction. In some embodiments, administration of the composition results in inhibition or reduction of hepatic crown-like structure formation. In some embodiments, administration of the composition does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

[0059] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0060] In some embodiments, the composition comprises a nucleic acid sequence capable of increasing the expression level of the macrophage receptor. In some embodiments, the composition comprises a nucleic acid sequence encoding the macrophage receptor. In some embodiments, the composition comprises an expression vector comprising the nucleic acid sequence of the macrophage receptor. In some embodiments, the composition comprises a viral vector comprising the expression vector. In some embodiments, the viral vector is an AAV vector. In various embodiments, the AAV is AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the viral vector is AAV8. In some embodiments, the viral vector is a macrophage-targeted AAV. In some embodiments, the viral vector is liver macrophage-targeted AAV. In various embodiments the patient is a mammal. In various embodiments, the mammal is a human. In some embodiments, the composition increases the expression level of the macrophage receptor in macrophages. In some embodiments, the composition increases the expression level of the macrophage receptor in liver macrophages. In some embodiments, the composition comprises a nucleic acid sequence encoding the macrophage receptor. In some embodiments, the composition comprises a nucleic acid sequence capable of increasing the expression level of a macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is TIMA Methods of delivering nucleic acids are known in the art, including nanoparticles. In various embodiments, the composition comprises a nucleic acid (e.g., DNA, RNA, mRNA) nanoparticle. Various nanoparticle are known in the art and include lipid nanoparticle (LNP), including LNPs comprising an ionizable cationic lipid (pKa in the range of 6.0-6.5), PEG-lipid, or GM3-LNP. In various embodiments, the nucleic acid nanoparticle comprises TIM4 encoding nucleic acid (e.g. DNA, RNA, mRNA).

[0061] In some embodiments, the composition increases the expression level of a macrophage receptor. In some embodiments, the composition increases the expression level of an efferocytosis receptor. In some embodiments, the composition increases TIM4 mRNA expression, TIM4 protein expression, or both TIM4 mRNA expression and TIM4 protein expression when compared to untreated subjects or to expression level of TIM4 mRNA, level of TIM4 protein, or both levels TIM4 mRNA and TIM4 protein in the subject pre-treatment. The expression of TIM4 mRNA, TIM4 protein, or both TIM4 mRNA and TIM4 protein may be increased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding expression of TIM4 in a subject suffering from NASH. The expression of TIM4 may be increased relative to corresponding to expression level of TIM4 mRNA, level of TIM4 protein, or both levels TIM4 mRNA and TIM4 protein in a subject suffering from NASH. In various embodiments, TIM4 is encoded by any nucleic acid sequence known in the art. In various embodiments, the composition is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of TIM4. In some embodiments, the expression of a macrophage receptor, an efferocytosis receptor or TIM4 is increased in macrophages or liver macrophages of the subject.

[0062] In some embodiments, the composition increases expression of a macrophage receptor. In some embodiments, the composition increases expression of an efferocytosis receptor. In some embodiments, the composition increases expression of TIM4. The expression of TIM4 may be increased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding expression of TIM4 in a subject suffering from NASH.

[0063] In some embodiments, the composition increases the expression level of a macrophage receptor. In some embodiments, the composition increases the expression level of an efferocytosis receptor. In some embodiments, the composition increases TIM4 mRNA expression, TIM4 protein expression, or both TIM4 mRNA expression and TIM4 protein expression when compared to untreated subjects or to expression level of TIM4 mRNA, level of TIM4 protein, or both levels TIM4 mRNA and TIM4 protein in the subject pre-treatment. The expression of TIM4 mRNA, TIM4 protein, or both TIM4 mRNA and TIM4 protein may be increased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding expression of TIM4 in a subject suffering from NASH. The expression of TIM4 may be increased relative to corresponding to expression level of TIM4 mRNA, level of TIM4 protein, or both levels TIM4 mRNA and TIM4 protein in a subject suffering from NASH. In various embodiments, TIM4 is encoded by any nucleic acid sequence known in the art. In various embodiments, the composition is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of TIM4. In some embodiments, the expression of a macrophage receptor, an efferocytosis receptor or TIM4 is increased in macrophages or liver macrophages of the subject.

[0064] In some embodiments, the composition reduces the ratio of a macrophage- associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition. The ratio of a macrophage- associated apoptotic cell to a free apoptotic cell may be reduced by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding ratio of a macrophage-associated apoptotic cell to a free apoptotic cell in a subject suffering from NASH. The ratio of a macrophage-associated apoptotic cell to a free apoptotic cell may be reduced relative to corresponding to the ratioof a macrophage-associated apoptotic cell to a free apoptotic cell in a subject suffering from NASH.

[0065] In some embodiments, the composition increases expression of a macrophage receptor when compared to untreated subjects or to the expression level of a macrophage receptor in the subject pre-treatment. In some embodiments, the composition increases expression of an efferocytosis receptor when compared to untreated subjects or to the expression level of an efferocytosis receptor in the subject pre-treatment. In some embodiments, the composition increases expression of TIM4 when compared to untreated subjects or to expression level of TIM4 in the subject pre-treatment. The expression of TIM4 may be increased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding expression of TIM4 in a subject suffering from NASH. In some embodiments, the expression of a macrophage receptor, an efferocytosis receptor or TIM4 is increased in macrophages or liver macrophages of the subject.

[0066] In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human. In some embodiments, the composition is delivered systemically.

[0067] In some embodiments, a population of cells can be contacted with a compound or agent which, for example, includes subjecting the cells to an appropriate culture media which comprises the indicated compound or agent. Where the cell population is in vivo, contacting the cell population includes administering the compound or agent in a pharmaceutical composition to a subject via an appropriate administration route such that the compound or agent contacts the cell population in vivo.

[0068] For in vivo methods, a therapeutically effective amount of a compound described herein can be administered to a subject. Methods of administering compounds to a subject are known in the art and are available to one of skill in the art.

[0069] As described herein, the methods of treatment described herein refer generally to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. Methods described herein covers any treatment of a disease in a subject, and includes: (a) preventing the disease or symptom fromoccurring in a subject which may be predisposed to the disease or symptom, may or may not be diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.

[0070] A therapeutically effective amount of an agent or composition disclosed herein, for example, is one that is effective for preventing, ameliorating, treating or delaying the onset of a disease or condition.

[0071] In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases macrophage receptor expression. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases efferocytosis receptor expression. In some embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases TIM4 expression. In some embodiments, the TIM4 expression level is increased in the subject as compared to an untreated subject suffering from NASH. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases TIM4 expression compared to the TIM4 expression before administration of the composition. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases TIM4 expression. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases macrophage receptor expression compared to macrophage receptor expression before administration of the composition. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases efferocytosis receptor expression compared to efferocytosis receptor expression before administration of the composition. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases TIM4 expression compared to TIM4 expression before administration of the composition. In various embodiments, the present application discloses methods for treatingor preventing NASH in a subject in need thereof, comprising administering to said subject a composition that reduces the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition.

[0072] In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that reduces the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition. In some embodiments, the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell is reduced in the subject as compared to an untreated subject suffering from NASH.

[0073] In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases efferocytosis receptor expression compared to efferocytosis receptor expression before administration of the composition. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that increases TIM4 expression compared to TIM4 expression before administration of the composition. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering to said subject a composition that reduces the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition.

[0074] In some embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering a composition that reduces or inhibits liver fibrosis, hepatic stellate cell activation, bile ductular reaction and / or hepatic crown-like structure formation by increasing macrophage receptor, efferocytosis receptor or TIM4 expression. In some embodiments, the expression of a macrophage receptor, an efferocytosis receptor or TIM4 is increased in macrophages or liver macrophages. In some embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering a composition that reduces or inhibits liver fibrosis, hepatic stellate cell activation, bile ductular reaction and / orhepatic crown-like structure formation by reducing the ratio of a macrophage associated apoptotic cell to a free apoptotic cell. In some embodiments, administration of the composition does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity. In some embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering a composition that reduces or inhibits hepatic stellate cell activation, bile ductular reaction and / or hepatic crown-like structure by increasing macrophage receptor, efferocytosis receptor or TIM4 expression using any known method in the art. In some embodiments, the expression of a macrophage receptor, an efferocytosis receptor or TIM4 is increased in macrophages or liver macrophages. For example, in various embodiments the composition comprises a nucleic acid sequence capable of increasing the expression level of a macrophage receptor, an efferocytosis receptor or TIM4. In various embodiments, the composition comprises a nucleic acid sequence encoding the macrophage receptor, efferocytosis receptor or TIM4. In various embodiments, the nucleic acid comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the macrophage receptor, efferocytosis receptor or TIM4 sequences (e.g., Fig. 18) known in the art. In various embodiments the composition is a vector encoding a nucleic acid sequence wherein the nucleic acid sequence comprises the macrophage receptor sequences known in the art. In various embodiments the composition is a vector encoding a nucleic acid sequence wherein the nucleic acid sequence comprises the efferocytosis receptor sequences known in the art. In various embodiments the composition is a vector encoding a nucleic acid sequence wherein the nucleic acid sequence comprises the TIM4 sequences (e.g., Fig. 18) known in the art. In various embodiments, the vector is a viral vector containing a nucleic acid encoding a macrophage receptor, an efferocytosis receptor or TIM4. In various embodiments, the viral vector is an AAV vector. In various embodiments, the AAV is AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or variant thereof. In various embodiments, the AAV is AAV8 or variant thereof. In some embodiments, the viral vector is a macrophage-targeted AAV. In some embodiments, the viral vector is liver macrophage- targeted AAV. In various embodiments the subject is a mammal. In various embodiments, the mammal is a human. In various embodiments, the human has decreased expression of a macrophage receptor compared to a human not suffering from NASH. In various embodiments, the human has decreased expression of an efferocytosis receptor compared to a human not suffering from NASH. In various embodiments, the mammal is a human. In various embodiments, the human has decreased expression of TIM4 compared to a human not suffering from NASH. In various embodiments the composition comprises a nucleic acid(e.g., DNA, RNA, mRNA) nanoparticle. In various embodiments, the nucleic acid nanoparticle comprises TIM4 encoding nucleic acid (e.g. DNA, RNA, mRNA).

[0075] In some embodiments, a subject has decreased expression of a macrophage receptor compared to a subject not suffering from NASH. In some embodiments, a subject has decreased expression of an efferocytosis receptor compared to a subject not suffering from NASH. In some embodiments, a subject has decreased expression of TIM4 compared to a subject not suffering from MASH. For example, expression of TIM4 of a subject may be decreased by at least 1.5 times lower than expression of TIM4 of a subject not suffering from NASH. Expression of TIM4 of a subject may be decreased by at least 3 times lower than expression of TIM4 of a subject not suffering from NASH. Expression of TIM4 of a subject may be decreased by at least 5 times lower than expression of TIM4 of a subject not suffering from NASH. Expression of TIM4 of a subject may be decreased by at least 10 times lower than expression of TIM4 of a subject not suffering from NASH.

[0076] In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering a composition that reduces or inhibits hepatic stellate cell activation, bile ductular reaction and / or hepatic crownlike structure by increasing a macrophage receptor, an efferocytosis receptor or TIM4 expression. In various embodiments, the present application discloses methods for treating or preventing NASH in a subject in need thereof, comprising administering a composition that reduces or inhibits hepatic stellate cell activation, bile ductular reaction and / or hepatic crownlike structure by reducing the ratio of a macrophage-associated apoptotic cell to a free apoptotic cell. The expression of a macrophage receptor, an efferocytosis receptor or TIM4 may be increased by at least about 5% to about 95%, e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, relative to corresponding expression of the macrophage receptor, the efferocytosis receptor or TIM4 in a subject suffering from NASH. In some embodiments, administration of the composition does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

[0077] In various embodiments, the present application discloses methods for treating or preventing MASH in a subject in need thereof, comprising administering to said patient a composition that targets a macrophage receptor, a efferocytosis receptor or TIM4. In various embodiments, the method involves administering a composition that increases expression of a macrophage receptor, an efferocytosis receptor or TIM4 expressions using any knownmethod in the art. For example, in various embodiments the composition comprises a nucleic acid sequence capable of increasing the expression level of a macrophage receptor. In some embodiment the macrophage receptor is efferocytosis receptor. In some embodiments, the macrophage receptor is TIM4. For example, in various embodiments the composition is a vector encoding a nucleic acid wherein the nucleic acid comprises the macrophage receptor, efferocytosis receptor or TIM4 sequences (e.g., Fig. 18) known in the art. In various embodiments, the composition comprises a nucleic acid sequence encoding the macrophage receptor, efferocytosis receptor or TIM4. In various embodiments, the nucleic acid sequence comprises at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the macrophage receptor, efferocytosis receptor or TIM4 sequences (e.g., Fig. 18). In various embodiments, the vector is a viral vector containing a nucleic acid encoding macrophage receptor, efferocytosis receptor or TIM4 sequences (e.g., Fig. 18). In various embodiments, the viral vector is an AAV vector. In various embodiments the AAV is AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or variants thereof. In various embodiments, the AAV is AAV8 or variant thereof. In some embodiments, the viral vector is a macrophage-targeted AAV. In some embodiments, the viral vector is liver macrophage-targeted AAV. In various embodiments, the subject is a mammal. In various embodiments, the mammal is a human.

[0078] In certain aspects, described herein is a composition for treating or preventing NASH comprising a nucleic acid sequence capable of increasing the expression level of a macrophage receptor. In some embodiments, the macrophage receptor is an efferocytosis receptor. In some embodiments, the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4). In some embodiments, administration of the composition to a subject in need thereof results in inhibition or reduction of liver fibrosis. In some embodiments, administration of the composition to a subject in need thereof results in inhibition or reduction of hepatic stellate cell (HSC) activation. In some embodiments, administration of the composition to a subject in need thereof results in inhibition or reduction of bile ductular reaction. In some embodiments, administration of the composition to a subject in need thereof does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

[0079] In some embodiments, the composition comprises an expression vector comprising the nucleic acid sequence. In some embodiments, the composition comprises aviral vector comprising the expression vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV8.

[0080] In some embodiments, the composition increases the expression level of the macrophage receptor in macrophages. In some embodiments, the composition increases the expression level of the macrophage receptor in liver macrophages.

[0081] In certain aspects, described herein is a method of diagnosing nonalcoholic steatohepatitis (NASH) in a subject comprising: (i) determining the expression level of cell immunoglobulin and mucin domain containing 4 (TIM4) in the subject; and (ii) diagnosing the subject with NASH if the expression level of TIM4 in the subject is decreased as compared to a subject not suffering from NASH.

[0082] In some embodiments, the subject is diagnosed with fibrotic NASH. In some embodiments, the expression level of TIM4 is determined using an antibody. In some embodiments, the expression level of TIM4 is determined by immunoblotting. In some embodiments, the expression level of TIM4 is determined by quantitative RT-qPCR. In some embodiments, the method further comprises administering the composition described herein to a subject diagnosed with NASH.

[0083] In some embodiments, NASH is diagnosed in the subject by determining the expression level of a macrophage receptor, an efferocytosis receptor or TIM4. In some embodiments, NASH is diagnosed in the subject by determining TIM4 mRNA levels, TIM4 protein levels, or both TIM4 =mRNA levels and TIM4 protein levels in a sample from the subject. In some embodiments, the subject has decreased levels of TIM4 mRNA, TIM4 protein, or both TIM4 mRNA and TIM4 protein as compared to a sample from a healthy subject. In some embodiments, the subject is determined to have fibrotic NASH if the sample levels of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of the subject are decreased by a 4 to 5 fold compared to the expression of TIM4 mRNA and / or TIM4 protein of a subject (or cohort of subjects) not suffering from NASH. In various embodiments, expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject may be decreased by at least 1.5 times lower than expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels, TIM4 protein levels, or bothTIM4 mRNA levels and TIM4 protein levels of a subject may be decreased by at least 3 times lower than expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject may be decreased by at least 5 times lower than expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject may be decreased by at least 10 times lower than expression of TIM4 mRNA levels, TIM4 protein levels, or both TIM4 mRNA levels and TIM4 protein levels of a subject (or cohort of subjects) not suffering from NASH.

[0084] In some embodiments, the subject is determined to have fibrotic NASH if the expression level of a macrophage receptor, an efferocytosis receptor or TIM4 is decreased. In some embodiments, the subject is determined to have fibrotic NASH if the sample levels of TIM4 mRNA levels are decreased by a 4 to 5 fold compared to the expression of METRN mRNA of a subject (or cohort of subjects) not suffering from NASH. In various embodiments, expression of TIM4 mRNA levels of a subject may be decreased by at least 1.5 times lower than expression of TIM4 mRNA levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels of a subject may be decreased by at least 3 times lower than expression of TIM4 mRNA levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels of a subject may be decreased by at least 5 times lower than expression of TIM4 mRNA levels of a subject (or cohort of subjects) not suffering from NASH. Expression of TIM4 mRNA levels of a subject may be decreased by at least 10 times lower than expression of TIM4 mRNA levels of a subject (or cohort of subjects) not suffering from NASH.

[0085] In some embodiments, the subject is determined to have fibrotic NASH if the subject has an increased ratio of macrophage-associated apoptotic cell to a free apoptotic cell. In some embodiments, the subject is determined to have fibrotic NASH if the sample level of a macrophage-associated apoptotic cell is increased by a 2 to 6 fold compared to the level of a free apoptotic cell of a subject (or cohort of subjects) not suffering from NASH. In various embodiments, the level of a macrophage-associated apoptotic cell of a subject may be increased by at least 1.5 times higher than the level of a free apoptotic cell of a subject(or cohort of subjects) not suffering from NASH. In various embodiments, the level of a macrophage-associated apoptotic cell of a subject may be increased by at least 3 times higher than the level of a free apoptotic cell of a subject (or cohort of subjects) not suffering from NASH. In various embodiments, the level of a macrophage-associated apoptotic cell of a subject may be increased by at least 5 times higher than the level of a free apoptotic cell of a subject (or cohort of subjects) not suffering from NASH. In various embodiments, the level of a macrophage-associated apoptotic cell of a subject may be increased by at least 10 times higher than the level of a free apoptotic cell of a subject (or cohort of subjects) not suffering from NASH.

[0086] In certain aspects, described herein is a composition comprising a nucleic acid encoding a macrophage receptor. In certain aspects, described herein is a composition comprising an expression vector comprising a nucleic acid encoding a macrophage receptor. In certain aspects, described herein is a composition comprising a viral vector comprising a nucleic acid encoding a macrophage receptor. In some embodiments, the macrophage receptor is TIMA In some embodiments, the viral vector is an AAV vector. In some embodiments, the viral vector is AAV8.

[0087] Efferocytosis comprises a multi-step process in which professional phagocytes, notably macrophages, and other types of cells bind, internalize, and digest dead cells. (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620). Macrophages bind apoptotic cells through efferocytosis receptors, such as TAM and TIM family members, leading to dead cell engulfment and degradation. The primary function of efferocytosis is to prevent dead cell accumulation and promote tissue resolution, and impaired efferocytosis contributes to many human chronic inflammatory diseases.

[0088] T cell immunoglobulin and mucin domain containing 4 (TIM4, encoded by Timd4 gene), is a protein belonging to the TIM family and is primarily expressed in macrophages and dendritic cells (Kuchroo VK, Dardalhon V, Xiao S, Anderson AC. Nat Rev Immunol 2008;8:577-580). TIM4 can function as an efferocytosis receptor and is expressed by liver resident Kupffer cells (KCs), and previous studies have shown that NASH liver macrophages have a marked decrease in TIM4 expression (Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H, et al. Immunity 2020; Lefere S, Degroote H, Van Vlierberghe H, Devisscher L. J Hepatol 2019;71 :631-633; Tran S, Baba I, Poupel L, Dussaud S, Moreau M,Gelineau A, et al. Immunity 2020;53:627-640. e625; Daemen S, Gainullina A, Kalugotla G, He L, Chan MM, Beals JW, et al. Cell Rep 2021;34: 108626.)

[0089] As described herein, the term “TIM4” includes a full length TIM4 protein, any TIM4 protein fragment, TIM4 isoforms, or TIM4 protein variant thereof. TIM4 as described herein has the GeneBank Gene ID: 91937. The nucleotide and amino acid sequences can be readily obtained by one of ordinary skill in the art using the listed accession numbers and are hereby incorporated by reference in their entireties.

[0090] In some embodiments, described herein includes TIM4 variants. As used herein the term “variant” covers nucleotide or amino acid sequence variants which have about 95%, about 90%, about 85%, about 80%, about 85%, about 80%, about 75%, about 70%, or about 65% nucleotide identity, or about 95%, about 90%, about 85%, about 80%, about 85%, about 80%, about 75%, or about 70% amino acid identity, including but not limited to variants comprising conservative, or non-conservative substitutions, deletions, insertions, duplications, or any other modification. The term variant as used herein includes functional and non-functional variants, and variants with reduced or altered activity.

[0091] In certain embodiments, the methods of the invention can determine changes in the expression, associated with changes in the localization, processing, trafficking, posttranslational modification, or any other cellular modification of TIM4. Determining expression of TIM4 can be carried out by any suitable method as described herein, or known in the art.

[0092] In certain embodiments, determining comprises quantitative determination of the level of expression. In other embodiments, determining comprises quantitative determination of the stability or turnover of TIM4. Methods for determining expression of a DNA, a RNA or a protein, including quantitative and / or qualitative determinations, are described herein and well known in the art. In certain embodiments, the methods of the invention determine an increase in the expression. In other embodiments, the methods of the invention determine a decrease in the expression. The expression of a gene can be readily detected, e.g., by quantifying the protein and / or RNA encoded by the gene. Many methods standard in the art can be thus employed, including, but not limited to, immunoassays to detect and / or visualize protein expression, nonlimiting examples include western blot, immunoprecipitation followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE),immunocytochemistry, etc., and / or hybridization assays to detect gene expression by detecting and / or visualizing respectively RNA, including but not limited to mRNA encoding a gene (a quantitative RT-qPCR system, PCR, northern assays, dot blots, in situ hybridization, etc.). Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incorporated by reference herein in its entirety). Non-limiting exemplary assays are described herein.Methods of diagnosis

[0093] In certain aspects, described herein is a method of diagnosing NASH in a subject comprising: determining expression level of a macrophage receptor; and diagnosing the subject with NASH if the expression of a macrophage receptor in the subject is decreased compared to a subject not suffering from NASH. In certain aspects, described herein is a method of diagnosing NASH in a subject comprising: determining expression level of an efferocytosis receptor; and diagnosing the subject with NASH if the expression of an efferocytosis receptor in the subject is decreased compared to a subject not suffering from NASH. In certain aspects, described herein is a method of diagnosing NASH in a subject comprising: determining expression level of cell immunoglobulin and mucin domain containing 4 (TIM4) in the subject; and diagnosing the subject with NASH if the expression of TIM4 in the subject is decreased compared to a subject not suffering from NASH. In some embodiments, the subject is diagnosed with fibrotic NASH.

[0094] In some embodiments, the sample is blood or blood plasma, macrophages or liver macrophages.

[0095] In some embodiments, the level of a macrophage receptor, an efferocytosis receptor or TIM4 is determined using an antibody. In some embodiments, the level of a macrophage receptor, an efferocytosis receptor or TIM4 is determined by immunoblotting. In some embodiments, the level of mRNA is determined using RT-qPCR or RNA-seq.

[0096] In some embodiments, the invention comprises detecting in a biological sample whether there is a decrease in an mRNA encoding a macrophage receptor, an efferocytosis receptor or TIM4. Methods for detecting and quantifying macrophage receptor, efferocytosis receptor or TIM4 molecules in biological samples are known the art. For example, protocols for detecting and measuring a macrophage receptor, efferocytosis receptoror TIM4 protein molecule using either polyclonal or monoclonal antibodies specific for the polypeptide are well established. Non-limiting examples include Western blot, enzyme- linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS).

[0097] In one aspect, the invention provides a device for determining whether a sample from a subject contains a macrophage receptor, efferocytosis receptor or TIM4 protein or a combination thereof, the device comprising at least one antibody that specifically binds to a macrophage receptor, efferocytosis receptor or TIM4 protein, or a fragment thereof. In another aspect, the invention provides a device for determining whether a sample from a subject contains macrophage receptor, efferocytosis receptor or TIM4 nucleic acid, or a combination thereof, the device comprising at least one primer, primer pair, or nucleic acid probe, that specifically binds to macrophage receptor, efferocytosis receptor or TIM4 nucleic acid, or a fragment thereof.

[0098] In one embodiment, a biological sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). The methods of detecting or quantifying a macrophage receptor, efferocytosis receptor or TIM4 molecule include, but are not limited to, amplification-based assays with (signal amplification) hybridization based assays and combination amplification-hybridization assays. For detecting and quantifying a macrophage receptor, efferocytosis receptor or TIM4 molecule, an exemplary method is an immunoassay that utilizes an antibody or other binding agents that specifically bind to an macrophage receptor, efferocytosis receptor or TIM4 protein or epitope of such, for example, Western blot or ELISA assays. In some embodiments, the level of mRNA is determined using RT-qPCR or RNA-seq.Expression Vectors and Viral Vectors

[0099] Another aspect of the present invention provides vectors that comprise one or more of the nucleic acid molecules of the present invention.

[0100] The vectors can be used, inter alia, for propagating the nucleic acid molecules of the present invention in host cells (cloning vectors), for shuttling the nucleic acid molecules of the present invention between host cells derived from disparate organisms (shuttlevectors), for inserting the nucleic acid molecules of the present invention into host cell chromosomes (insertion vectors), for expressing sense or antisense RNA transcripts of the nucleic acid molecules of the present invention in vitro or within a host cell, and for expressing polypeptides encoded by the nucleic acid molecules of the present invention, alone or as fusion proteins with heterologous polypeptides (expression vectors). Vectors are by now well known in the art, and are described, inter alia, in Jones et al. (eds.), Vectors: Cloning Applications: Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd. (1998); Jones et al. (eds.), Vectors: Expression Systems: Essential Techniques (Essential Techniques Series), John Wiley & Son Ltd. (1998); Gacesa et al., Vectors: Essential Data, John Wiley & Sons Ltd. (1995); Cid-Arregui (eds.), Viral Vectors: Basic Science and Gene Therapy, Eaton Publishing Co. (2000); Sambrook (2001), supra; Ausubel (1999), supra. Furthermore, a variety of vectors are available commercially. Use of existing vectors and modifications thereof are well within the skill in the art.

[0101] Nucleic acid sequences can be expressed by operatively linking them to an expression control sequence in an appropriate expression vector and employing that expression vector to transform an appropriate unicellular host. Expression control sequences are sequences that control the transcription, post-transcriptional events and translation of nucleic acid sequences. Such operative linking of a nucleic sequence of this invention to an expression control sequence, of course, includes, if not already part of the nucleic acid sequence, the provision of a translation initiation codon, ATG or GTG, in the correct reading frame upstream of the nucleic acid sequence.

[0102] A wide variety of host / expression vector combinations can be employed in expressing the nucleic acid sequences of this invention. Useful expression vectors, for example, can consist of segments of chromosomal, non-chromosomal and synthetic nucleic acid sequences.

[0103] Expression in mammalian cells can be achieved using a variety of plasmids, including pSV2, pBC12BI, and p91023, as well as lytic virus vectors (e.g., vaccinia virus, adeno virus, and baculovirus), episomal virus vectors (e.g., bovine papillomavirus), and retroviral vectors (e.g., murine retroviruses). Useful vectors for insect cells include baculoviral vectors and pVL 941. In various embodiments, the vector is a viral vector. In various embodiments, the viral vector is an AAV vector. In various embodiments the AAVis AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or variants thereof. In various embodiments, the AAV is AAV8 or a variant thereof.

[0104] Any of a wide variety of expression control sequences can be used in these vectors to express the nucleic acid molecules of this invention. Such useful expression control sequences include the expression control sequences associated with structural genes of the foregoing expression vectors. Expression control sequences that control transcription include, e.g., promoters, enhancers and transcription termination sites. Expression control sequences in eukaryotic cells that control post-transcriptional events include splice donor and acceptor sites and sequences that modify the half-life of the transcribed RNA, e.g., sequences that direct poly(A) addition or binding sites for RNA-binding proteins. Expression control sequences that control translation include ribosome binding sites, sequences which direct targeted expression of the polypeptide to or within cellular compartments, and sequences in the 5' and 3' untranslated regions that modify the rate or efficiency of translation.

[0105] For in vivo methods, a therapeutically effective amount of a compound described herein can be administered to a subject. Methods of administering compounds to a subject are known in the art and easily available to one of skill in the art.

[0106] As described herein, the methods of treatment described herein refer generally to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and / or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and / or adverse effect attributable to the disease. Methods described herein covers any treatment of a disease in a subject, and includes: (a) preventing the disease or symptom from occurring in a subject which may be predisposed to the disease or symptom, may or may not be diagnosed as having it; (b) inhibiting the disease symptom, i.e., arresting its development; or (c) relieving the disease symptom, i.e., causing regression of the disease or symptom.

[0107] A therapeutically effective amount of an agent or composition disclosed herein, for example, is one that is effective for preventing, ameliorating, treating or delaying the onset of a disease or condition.

[0108] The pharmaceutical compositions of the inventions can be administered to any animal that can experience the beneficial effects of the agents of the invention. Such animals include humans and non-humans such as primates, pets and farm animals.

[0109] The present invention also comprises pharmaceutical compositions comprising the agents disclosed herein. Routes of administration and dosages of effective amounts of the pharmaceutical compositions comprising the agents are also disclosed. The agents of the present invention can be administered in combination with other pharmaceutical agents in a variety of protocols for effective treatment of disease.

[0110] One of ordinary skill in the art will appreciate that a method of administering pharmaceutically effective amounts of the pharmaceutical compositions of the invention to a patient in need thereof, can be determined empirically, or by standards currently recognized in the medical arts. The agents can be administered to a patient as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents of the pharmaceutical compositions of the present invention will be decided within the scope of sound medical judgment by the attending physician. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, gender and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. It is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.

[0111] Dosaging can also be administered in a patient-specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art.

[0112] In one embodiment, a biological sample comprises, a blood sample, serum, cells (including whole cells, cell fractions, cell extracts, and cultured cells or cell lines), tissues (including tissues obtained by biopsy), body fluids (e.g., urine, sputum, amniotic fluid, synovial fluid), or from media (from cultured cells or cell lines). The methods of detecting or quantifying a TIM4 molecule include, but are not limited to, amplification-based assays with (signal amplification) hybridization based assays and combination amplificationhybridization assays. For detecting and quantifying a TIM4 molecule, an exemplary methodis an immunoassay that utilizes an antibody or other binding agents that specifically bind to an TIM5 protein or epitope of such, for example, Western blot or ELISA assays. Another exemplary method is measuring mRNA expression levels with a quantitative RT-qPCR system.EXAMPLES

[0113] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield similar results.Example 1 - Loss of TIM4-Dependent Efferocytosis in Kupffer Cells Promotes Liver Fibrosis in Nonalcoholic Steatohepatitis

[0114] Nonalcoholic steatohepatitis (NASH) is emerging as the leading cause of liver disease, but the processes leading to liver fibrosis in NASH, which determines clinical outcome, are incompletely understood. Described herein is evidence that impaired clearance of dead liver cells by liver macrophages in NASH, which is due to loss of a macrophage receptor called TIM4, contributes to liver fibrosis. Knowledge of this process may suggest new ways to bolster the clearance of dead liver cells in NASH and thereby prevent the progression to liver fibrosis and subsequent liver disease.

[0115] Hepatocyte apoptosis is a key feature of non-alcoholic steatohepatitis (NASH), but the fate of apoptotic hepatocytes in NASH is poorly understood. Described herein explores whether impaired TIM4-mediated clearance of dead hepatocytes by liver macrophages (efferocytosis) is impaired in NASH and drives the progression to liver fibrosis.

[0116] Kupffer cell (KC)-TIM4 expression and efferocytosis were assayed in normal and NASH liver from humans and diet-induced NASH mice. The engulfment of human and mouse apoptotic hepatocytes by primary human and mouse liver KCs was assayed ex vivo. Causation was assessed in NASH mice using anti-TIM4 antibodies, KC-TIM4-knockout, orinducible KC-TIM4 expression, with analyses focused on efferocytosis of apoptotic hepatocytes by liver macrophages and liver fibrosis.

[0117] In human and mouse NASH liver, apoptotic hepatocytes accumulated and was associated with the loss of the KC efferocytosis receptor TIM4. Anti-TIM4 inhibited the engulfment of apoptotic hepatocytes by primary human and mouse liver KCs ex vivo, and anti-TIM4 administration to early NASH mice worsened liver macrophage efferocytosis and accelerated the progression to fibrotic NASH. A similar result was obtained by genetically deleting TIM4 in KCs in NASH mice. Most importantly, genetic restoration of macrophage TIM4 in NASH mice enhanced the clearance of apoptotic hepatocytes by liver macrophages and decreased liver fibrosis.

[0118] The loss of macrophage TIM4 that occurs during NASH progression impairs the clearance of apoptotic hepatocytes by liver macrophages, which subsequently promotes the progression to fibrotic NASH. This pathogenic sequence of events can be prevented by restoring macrophage TIM4, suggesting that future therapeutic approaches designed to boost TIM4 expression in liver macrophages could represent a novel strategy to prevent fibrotic NASH progression.

[0119] The incidence of nonalcoholic fatty liver disease (NAFLD) is increasing to epidemic levels (Younossi ZM, Paik JM, Henry L, Yang J, Fernandes G, Stepanova M, et al. J Clin Exp Hepatol 2023;13:454-467). Among those with NAFLD, 10% to 30% will progress to nonalcoholic steatohepatitis (NASH), which is characterized by liver injury, hepatic steatosis, necroinflammation, and, most importantly, liver fibrosis due to activation of hepatic stellate cells (HSCs) (Loomba R, Friedman SL, Shulman GI. Cell 2021;184:2537-2564).NASH can lead to advanced liver cirrhosis, hepatocellular carcinoma, and liver failure, which significantly contributes to mortality in end-stage liver disease and a higher demand for liver transplantation. However, there are currently no FDA / EMA-approved drugs for NASH treatment (Harrison SA, Allen AM, Dubourg J, Noureddin M, Alkhouri N. Nat Med 2023).

[0120] Previous studies have shown that multiple factors contribute to NASH pathogenesis, including fat accumulation in hepatocytes, oxidative stress, inflammasome activation, lipotoxicity, endoplasmic reticulum stress, and others (Loomba R, Friedman SL, Shulman GI. Cell 2021;184:2537-2564.). These factors can cause hepatocyte death, notably apoptosis and necroptosis, which contributes to NASH progression, but the mechanismslinking hepatocyte death to HSC activation and NASH fibrosis remain poorly understood (Schwabe RF, Luedde T. Nat Rev Gastroenterol Hepatol 2018;15:738-752; Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, et al. Gastroenterology 2003;125:437-443). While there is evidence that apoptotic hepatocytes can release HSC activators (Zhang B, Lapenta K, Wang Q, Nam JH, Chung D, Robert ME, et al. J Biol Chem 2021;297: 100887; Mederacke I, Filliol A, Affo S, Nair A, Hernandez C, Sun Q, et al. Sci Transl Med 2022;14:eabe5795), clinical evidence that blocking apoptosis mitigates NASH is lacking. For example, the pan-caspase inhibitor emricasan failed to improve liver histology and paradoxically increased liver fibrosis in NASH patients (Harrison SA, Goodman Z, Jabbar A, Vemulapalli R, Younes ZH, Freilich B, et al. J Hepatol 2020;72:816-827).

[0121] The accumulation of dead cells in disease settings implies that the process of dead cell clearance by phagocytic cells, or efferocytosis, is impaired (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620). Efferocytosis comprises a multi-step process in which "professional" phagocytes, notably macrophages, and other types of cells bind, internalize, and digest dead cells (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620). Macrophages bind apoptotic cells through efferocytosis receptors, such as TAM and TIM family members, leading to dead cell engulfment and degradation. The primary function of efferocytosis is to prevent dead cell accumulation and promote tissue resolution, and impaired efferocytosis contributes to many human chronic inflammatory diseases (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620). Little is known about dead cell clearance in NASH. Examples of the few reports in this area include reports that genetically induced knockout of macrophage TREM2, which can mediated apoptotic cell binding, impairs efferocytosis ex vivo and exacerbates experimental NASH in some studies but not others (Wang X, He Q, Zhou C, Xu Y, Liu D, Fujiwara N, et al. Immunity 2022; Liebold I, Meyer S, Heine M, Kuhl A, Witt J, Eissing L, et al. Cells 2023;12:341; Lee KJ, An S, Kim MY, Kim SM, Jeong WI, Ko HJ, et al. Immunol Cell Biol 2022; Hendrikx T, Porsch F, Kiss MG, Rajcic D, Papac- Milicevic N, Hoebinger C, et al. J Hepatol 2022) and that necroptotic hepatocyte clearance is impaired in NASH owing to upregulation of CD47 on necroptotic hepatocytes and its receptor SIRPa on NASH macrophages, leading to NASH progression (Shi H, Wang X, Li F, Gerlach BD, Yurdagul A, Jr., Moore MP, et al. Sci Transl Med 2022;14:eabp8309).

[0122] T cell immunoglobulin and mucin domain containing 4 (TIM4, encoded by Timd4 gene), is a protein belonging to the TIM family and is primarily expressed in macrophages and dendritic cells (Kuchroo VK, Dardalhon V, Xiao S, Anderson AC. Nat Rev Immunol 2008;8:577-580). TIM4 can function as an efferocytosis receptor and is expressed by liver resident Kupffer cells (KCs), and previous studies have shown that NASH liver macrophages have a marked decrease in TIM4 expression (Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H, et al. Immunity 2020; Lefere S, Degroote H, Van Vlierberghe H, Devisscher L. J Hepatol 2019;71 :631-633; Tran S, Baba I, Poupel L, Dussaud S, Moreau M, Gelineau A, et al. Immunity 2020;53:627-640. e625; Daemen S, Gainullina A, Kalugotla G, He L, Chan MM, Beals JW, et al. Cell Rep 2021;34: 108626.). Although in vitro studies have shown that TIM4 functions in efferocytosis in isolated KCs (Yanagihashi Y, Segawa K, Maeda R, Nabeshima YI, Nagata S. Proc Natl Acad Sci U S A 2017; 114:8800-8805;Miyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T, Nagata S. Nature 2007;450:435- 439; Ni M, Zhang J, Sosa R, Zhang H, Wang H, Jin D, et al. Hepatology 2021;74:2118- 2132), its role in efferocytosis and liver fibrosis in NASH remain unknown.

[0123] Using analyses of human and mouse NASH liver, ex vivo and NASH liver efferocytosis assays, and causation studies in mouse NASH models, described herein provides evidence that the loss of macrophage TIM4 expression contributes to defective efferocytosis and apoptotic hepatocyte accumulation in NASH liver and, most importantly, fibrotic NASH progression. These findings provide new mechanistic insight into NASH progression, which can inform future studies investigating new therapeutic strategies to block NASH fibrosis.Materials and MethodsAnimal studies

[0124] Male wildtype C57 / BL6J mice (10-12 weeks old, #000664) were obtained from Jackson Laboratory (Bar Harbor, ME) and were allowed to adjust to the housing environment in the Columbia University Irving Medical Center for 1 week before starting experiments. The mice were fed a fructose-palmitate-cholesterol diet (FPC, Envigo, #TD. 160785 PWD) for 8 or 16 weeks to develop simple steatosis and fibrotic NASH, respectively; a choline- deficient, L-amino acid-defined, high-fat diet (HF-CDAA, Research Diets, #A06071302) for 4 or 10 weeks to induce early or advanced NASH, respectively. Age-matched male mice were fed a control diet (PicoLab Rodent Diet 20, #5053). All the mice were randomlyassigned to experimental groups by investigators, who were blinded in terms of group assignment. For the anti-TIM4 experiments, the mice were fed the HF-CDAA diet for 4 weeks, with anti-TIM4 antibody treatment (Bio-X-Cell, #BE0225, RRID:AB_2687708, 200 pg / mouse) or isotype control IgG treatment (Bio-X-Cell, #BE0225, #BE0089, RRID:AB 1107769, 200 pg / mouse) during weeks 3-4.

[0125] To generate Timd4" " mice, a Loxp-Neo-Loxp (LNL) cassette was inserted in the intron upstream of the exon 2 of Timd4 on a Bacterial Artificial Chromosome (BAC clone ID: RP23-646F6). The Neo cassette was removed by Cre recombinase to leave behind the first Loxp site L83, and a Frt-Neo-Frt-Loxp (FNFL) cassette was inserted in the intron downstream of the exon 2 of Timd4 gene. The Neo cassette was removed by Cre recombinase to leave behind the loxP site at L83. A gene targeting vector was constructed by retrieving the 2kb left homology arm (5’ to L83), the L83-exon2-FNFL cassette, and the 4kb right homology arm (end of FNFL cassette to 3’) into pMCS-DTA vector carrying a DTA (Diphtheria Toxin Alpha chain) negative selection marker. The FNFL cassette confers G418 resistance during gene targeting in FL19 (C57BL / 6N) ES cells, and the DTA cassette provides an autonomous negative selection to reduce random integration during gene targeting. Several targeted ES cell clones were identified using PCR (primer sequences: F : ggaagcaattcccacctctatt; R: ctcccaaatcaagagaccagac) and injected into C57BL / 6J blastocysts to generate chimeric mice. Male chimeras were bred to homozygous ACTB:FLPe female mice (Rodriguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, et al. Nat Genet 2000;25: 139-140) (Jackson Laboratory, #005703, C57BL / 6J background) to transmit the floxed Timd4 allele. Timd4riJimice were crossed with Clec4f-Cre mice (Sakai M, Troutman TD, Seidman JS, Ouyang Z, Spann NJ, Abe Y, et al. Immunity 2019;51 :655-670. e658) (Jackson Laboratory, #033296) to generate \<J -Timd4 knockdown mice (KD); Timd1mice were used as the wild-type control (WT).

[0126] To restore TIM4 expression in macrophages, a Tet-On system was adopted for doxycycline-inducible gene expression. A TRE (7 tetO+ minimal CMV promoter) — Timd4 — bGHpA cassette was synthesized by GenScrip and injected into the pronuclei of fertilized C57BL / 6J eggs to generate TRE- Timd4 transgenic mice; PCR identified the transgenic founders using the TRE- Timd4 primer sequences: F: ctcgtttagtgaaccgtcagat; R: CTGTCACCTCGATTGGTGTT. TRE- Timd4 mice were crossed with Cd68rtTA mice (Jackson Laboratory, #032044, C57BL / 6J background) to generate inducible macrophageTIM4 mice; TRE-Z / / - / mice or Cd68rtTA mice were used as controls. These mice, when they reached 10-12 weeks of age, were fed a HF-CDAA diet for 10 weeks, with doxycycline added to the drinking water (75 pg / ml) during weeks 6-10. Another group of these mice were fed the FPC diet for 16 weeks, with doxycycline (50 pg / ml) added to the drinking water (50 pg / ml) during weeks 9-16.

[0127] All mice were housed in standard cages at 22 °C in a 12-12-h light-dark cycle in a barrier facility, and experiments were conducted by following the Guidelines for the Care and Use of Laboratory Animals at Columbia University. Animal protocol AABL5573 for these studies was approved by the Institutional Animal Care and Use Committee at Columbia University.Human liver specimens

[0128] The de-identified FFPE human liver sections used for the in-situ efferocytosis assay in Fig. 1 A were acquired from Virginia Commonwealth University and the Fondazione IRCCS Ca’ Granda Ospedale Policlinico, Universita' degli Studi di Milano. Phenotypic and pathological characterizations were conducted by experienced medical physicians and pathologists associated with Virginia Commonwealth University and the Fondazione. The Fondazione patients underwent liver biopsy for suspected fibrotic NASH within a spontaneous observational study to investigate the role of genetic predisposition on the natural history of NAFLD. Patients gave informed consent at the time of recruitment, and their records were anonymized and de-identified. The de-identified human liver specimens used for Fig. 1C,D were acquired from the Liver Tissue Cell Distribution System at the University of Minnesota. The specimens were collected on the date of liver transplantation and preserved as frozen samples. Phenotypic and pathological characterizations were conducted by medical physicians and pathologists associated with the Liver Tissue Cell Distribution System. The diagnostic information for all samples is included in FIG. 11. All protocols were approved by the Institutional Review Board (IRB) at the Columbia University Irving Medical CenterLiver primary cell isolation

[0129] Livers of 8-10 weeks old of male C57BL / 6J mice were perfused with HBSS perfusion buffer (Corning, #21-022-CV) containing HEPES (Sigma, #H0887, 25 mM) and EDTA (Invitrogen, #15575-038, 0.5 mM), followed by HBSS digestion buffer (Gibco,#14025-092) containing collagenase D (4.4 U / mouse, Roche, #11088882001). The digested livers were gently ruptured to release cells, which were then centrifuged at 50 g for 1 min at 4 °C to pellet hepatocytes. Next, the hepatocytes were plated on collagen-coated cell culture dishes in DMEM / F12 medium with 10% FBS and 1% penicillin-streptomycin. The supernate fractions from the 50-g spin were used for KC isolation by centrifuging at 50 g for 1 min to remove residual hepatocytes. Then non-parenchymal cells were pelleted at 800 g for 7 min. KCs were isolated with anti-F4 / 80 beads (Miltenyi Biotec, #130-110-443) and cultured in DMEM medium containing 10% FBS and 1% penicillin-streptomycin. Primary human Kupffer cells (#HK1000.H15) and hepatocytes (#H1000.H15-3) were obtained from Sekisui XenoTech Company.Liver histology and plasma ALT activity measurement

[0130] Livers were fixed in 10% formalin for at least 24 hours at room temperature and then paraffin embedded and sectioned (8 pm thick) for histological analysis, including hematoxylin and eosin (HE) and Picrosirius Red staining (Polysciences, #24901) according to the manufacturer’s protocol. Plasma alanine transaminase (ALT) activity was measured using a commercial kit (Teco Diagnostics, #A526). Liver steatosis was calculated in HE staining sections by measuring lipid droplet area using Image J.Liver immunohistochemistry

[0131] Liver paraffin sections were deparaffinized with xylene, hydrated, and then subjected to antigen retrieval using citrate sodium (Vector laboratory, #H-3300, 1 : 100 dilution) in a high-pressure cooker for 10 min. Next, the liver sections were incubated with 3% hydrogen peroxide (Sigma, #H1009) for 10 min at room temperature to block endogenous peroxidase activity, blocked with 5% donkey serum in PBS with 0.1% Triton X- 100 (Sigma, #X100) for 1 hour at room temperature, and incubated at 4°C overnight with anti-mouse collagen lai (Collal, Cell signaling technology, #72026S, RRID:AB_2904565, 1 : 200 dilution), osteopontin (Opn, RD, #AF808, RRID:AB_2194992, 1 : 1000 dilution), and cytokeratin 19 (CK19, DSHB, TROMA-III, RRID:AB_2133570, 1 :500 dilution) in PBS containing 1% donkey serum. The sections were then incubated with Signal Stain® Boost IHC detection reagent from Cell Signaling Technology (HRP, Rabbit, #8114; HRP, Rat, #72838; HRP, Goat, #63707), followed by color development using a DAB substrate kit (Cell signaling technology, #8059). Finally, the sections were counterstained with hematoxylin,dehydrated, and mounted. The images were captured using a Nikon microscope, and the data were analyzed using Image J software.Liver immunofluorescence staining and in-situ efferocytosis assay

[0132] Liver paraffin sections were deparaffinized, hydrated, and blocked with 5% donkey serum in PBS with 0.1% Triton X-100 for 1 hour at room temperature. For immunofluorescence experiments, human liver sections were incubated at 4 °C overnight with anti-human TIM4 (Cell signaling technology, #75484T, RRID:AB_2799871, 1 :200 dilution), anti-CD68 (Agilent, #GA60961-2, RRID:AB_2661840, 1 :500 dilution), and anticleaved caspase3 (Cell signaling technology, # 9661, RRID:AB_2341188, 1 : 100 dilution) in PBS containing 1% donkey serum. Mouse liver sections were incubated at 4 °C overnight with anti-mouse TIM4 (RD, #AF2826, RRID:AB_2201844, 1 :200 dilution), anti-Clec4f (RD, #MAB2784, RRID:AB_2081338, 1 :250 dilution), anti-Mac2 (Cedarlane, #CL8942AP, RRID:AB_10060357, 1 :500 dilution), anti-F4 / 80 (Cell signaling technology, #70076s, RRID:AB_2799771, 1 :200), anti-osteopontin (Opn, RD, #AF808, RRID:AB_2194992, 1 : 100 dilution), anti- a-smooth muscle actin (Sigma, #C6198, RRID:AB_476856, 1 : 100 dilution) and anti-cleaved caspase3 (Cell signaling technology, # 9661, RRID:AB_2341188, 1 : 100 dilution) in PBS containing 1% donkey serum. The sections were incubated with fluorescent dye-conjugated secondary antibodies (1 :250 dilution) for 1 hour at room temperature, followed by nuclei staining with DAPI. For the in-situ efferocytosis assessment, human and mouse liver sections were incubated at 4 °C overnight with the pan-macrophage marker anti- Mac2 and either anti-cleaved caspase3 or In Situ Cell Death Detection Kit, TMR red kit (Sigma, # 12156792910) in PBS containing 1% donkey serum, followed by fluorescent dye- conjugated secondary antibodies administration. The ratio of macrophage-associated apoptotic cells to free apoptotic cells was quantified as a measure of efferocytosis, as described previously (Ampomah PB, Cai B, Sukka SR, Gerlach BD, Yurdagul A, Jr., Wang X, et al. Nat Metab 2022). The images were captured using a Leica DMI 6000B fluorescence microscope, and the data were analyzed using Image J software.Immunoblotting

[0133] Liver protein was extracted using RIPA lysis buffer (Thermo, #89901) with a proteinase and phosphatase inhibitor cocktail (Thermo, #78445), followed by measurement of protein concentration using a BCA kit (Thermo, #23227). Each lane of 4-20% Tris-gels (Lifetechnologies, EC60285) was loaded with 20 pg protein. After electrophoresis, the gels were transferred to nitrocellulose membranes (Bio-Rad, #1620115). The membranes were blocked with 5% non-fat milk in Tris-buffered saline with 0.1% Tween 20 (TBST) for 1 hour at room temperature and then incubated overnight at 4°C with antibodies recognizing human TIM4 (Cell signaling technology, #75484T, RRID:AB_2799871, 1 : 1000 dilution), mouse TIM4 (RD, #AF2826, RRID:AB_2201844, 1 : 1000 dilution), and GAPDH (Cell signaling technology, #3683, RRID:AB_1642205, 1 :5000 dilution). The membranes were then incubated with HRP-conjugated second antibodies (Jackson ImmunoResearch , #711-035- 152, RRID:AB_10015282, 1 :5000 dilution, or #705-035-003, RRID:AB_2340390, 1 :5000 dilution) for 1 hour at room temperature, and bands were detected with SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo, #34580).Quantitative RT-qPCR

[0134] Total liver mRNA was extracted using TRIzol Reagent (Thermo, #15596026) and purified using PureLink™ RNA mini kit (Thermo, #12183025) according to the manufacture’s instruction. The mRNA concentration was measured using a nano-drop spectrophotometer, and cDNA was synthesized from 1 pg mRNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems, #4368813). mRNA expression levels were measured with a 7500 Real-time PCR system (Applied Biosystems) using SYBR green dye (Life Technologies, #4367659). Primer sequences are listed in FIG. 12.Ex vivo efferocytosis assay

[0135] Primary mouse KCs were isolated, seeded in an 8-well chamber slide, and cultured at 37°C overnight. To induce apoptotic hepatocytes, mice were given Fas ligand (Jo2, BD Biosciences, # 554254, RRID:AB_395326, 100 pg / kg body weight) via intravenous injection for 2 hours. The hepatocytes were then isolated from the livers of these mice, cultured for 6 hours, and labeled with PKH67 (Sigma, #MINI67) according to the manufacturer’s protocol. PKH67-labeled apoptotic hepatocytes were incubated with KCs in the presence of anti-TIM4 antibody (20 pg / ml) or isotype IgG control for 6 hours. The KCs were then fixed in 4% paraformaldehyde, and F-actin was labeled with phalloidin-iFluor 594 reagent (Abeam, #abl76757). The images were captured using a Leica DMI 6000B fluorescence microscope, and the data were analyzed using Image J software. Primary human hepatocytes were treated with tumor necrosis factor-related apoptosis-inducing ligand(TRAIL, 200 ng / ml, Sigma, #T9701) for 6 hours to induce apoptosis. Apoptotic human hepatocytes were labeled with PKH67 and incubated with primary human KCs for 6 hours in the presence of anti-TIM4 or isotype control IgG. The KCs were then fixed in 4% paraformaldehyde, and F-actin was labeled with phalloidin-iFluor 594 reagent (Abeam, #abl76757). Images were captured using a green spinning-disk confocal microscope (Nikon Ti), and the data were analyzed using Imaris 9.5 quantification software.Statistical Analysis

[0136] All quantitative data are presented as mean ± SEM. Statistical significance was determined using GraphPad Prism software (version 9.3). The Shapiro-Wilk test was used to test normality. Statistical significance between the two groups was analyzed using the Student’ s t-test, and multiple groups were analyzed using one-way ANOVA with Tukey post- hoc testing. P values less than 0.05 were considered statistically significant.ResultsEfferocytosis by liver macrophages is decreased in human and experimental NASH and is correlated with the loss of macrophage TIM4

[0137] Apoptosis in hepatocytes is a key feature of NASH, and accumulation of apoptotic hepatocytes has been reported in NASH liver (Schwabe RF, Luedde T. Nat Rev Gastroenterol Hepatol 2018;15:738-752; Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, et al. Gastroenterology 2003;125:437-443). As macrophage efferocytosis is crucial in clearing dead cells and maintaining tissue homeostasis, the effects of the efferocytosis ability in liver macrophages impairment in advanced NASH vs. early NASH were tested. Human liver biopsy specimens with various non-alcoholic fatty liver disease activity scores (NAS) and an in situ efferocytosis assay, as described previously (Ampomah PB, Cai B, Sukka SR, Gerlach BD, Yurdagul A, Jr., Wang X, et al. Nat Metab 2022), were utilized. Based on measurements of the ratio of macrophage-associated:free TUNEL+cells, efferocytosis by liver macrophages was markedly decreased in advanced NASH liver (NAS score 3-6) compared with early NASH liver (NAS score 0-2). In addition, the decrease in efferocytosis in NASH was accompanied by an increase in the total number of TUNEL+cells (Fig. 1A). To further explore the potential mechanism underlying impaired efferocytosis in a mouse NASH model, mice were fed with the HF-CDAA diet for 2, 3, 4, 8, or 12 weeks. These mice developed hepatic steatosis at 2 weeks, early liver fibrosis at 4weeks, and advanced liver fibrosis at 8 and 12 weeks of diet feeding (Fig. 7A). Based on the ratio of macrophage-associated: free cl-caspase 3+cells, efferocytosis by liver macrophages was markedly decreased at the 8-and 12-week time points, accompanied by an increase in cl- caspase 3+cells (Fig. IB).

[0138] One mechanism of impaired efferocytosis is loss of macrophage receptors that recognize apoptotic cells. Therefore, mRNAs encoding efferocytosis receptors in 12 weeks HF-CDAA-fed mice vs. chow-fed mice were measured. The mRNAs encoding MerTK, BAI1, and AXL actually increased in NASH vs. control liver (Fig. 7B, first 3 groups). The finding with Mertk is consistent with the previous demonstration that liver macrophage efferocytosis in 16-week FPC-fed NASH mice was not impaired by deletion of macrophage MerTK (Cai B, Dongiovanni P, Corey KE, Wang X, Shmarakov IO, Zheng Z, et al. Cell Metab 2020;31 :406-421. e407), and described herein shows similar results using the HD- CDAA NASH model (Fig. 7C). However, consistent with previous reports in NASH mice (Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H, et al. Immunity 2020; Lefere S, Degroote H, Van Vlierberghe H, Devisscher L. J Hepatol 2019;71 :631-633; Tran S, Baba I, Poupel L, Dussaud S, Moreau M, Gelineau A, et al. Immunity 2020;53:627-640. e625; Daemen S, Gainullina A, Kalugotla G, He L, Chan MM, Beals JW, et al. Cell Rep 2021;34: 108626), the mRNA encoding the efferocytosis receptor TIM4 (Timd4) and TIM4 protein were decreased in the livers of both FPC- and HF-CDAA-induced NASH mice (Fig. 7B, 4thgroup, and Figs. 7C-I). In particular, a decrease in Timd4 expression was observed after 8 weeks of HF-CDAA feeding (Fig. 7D), which coincides with the point at which impaired liver macrophage efferocytosis occurs (above). In addition, both liver TIM4 protein by immunoblot and TIM4 expression in Clec4E KCs by immunofluorescence microscopy were decreased after 12 weeks of HF-CDAA feeding (Figs. 7E, F). Similar results were found in the livers of mice fed the FPC diet for 16 week (Figs. 7G-I). Consistent with the HF-CDAA time course data above, KC TIM4 expression was not decreased in 8-week FPC- fed mice (Fig. 7 J), which have steatosis but not NASH (Wang X, Zheng Z, Caviglia JM, Corey KE, Herfel TM, Cai B, et al. Cell Metab 2016;24:848-862). Most importantly, as the expression TIM4 in human NASH had not been previously reported, described herein shows that TIM4 protein as measured by immunoblot was decreased in human NASH liver compared with normal liver (Fig. 1C). Further, immunofluorescence staining of human liver showed that the expression of TIM4 in liver CD68+macrophages was decreased in NASH (Fig. ID). In summary, mouse and human NASH show evidence of impaired efferocytosis,and this is associated with a decrease in TIM4 expression on liver macrophages. Based on these findings, described herein focuses on the decrease of macrophage TIM4 in NASH which is a key mechanism for impaired efferocytosis and, as a consequence, progression to fibrotic NASH.Antibody-mediated TIM4 blockade and genetic deletion of KC TIM4 reduces efferocytosis and accelerates liver fibrosis in experimental NASH

[0139] To investigate the role of TIM4 in the clearance apoptotic hepatocytes by human KCs ex vivo, primary human KCs were incubated with fluorescently labeled Fas-induced apoptotic hepatocytes in the presence of anti-TIM4 vs. IgG control. Anti-TIM4 decreased efferocytosis as measured by either volume or mean fluorescence intensity (MFI) of engulfed apoptotic hepatocytes (Fig. 2A). Similar results were found using primary mouse liver KCs (Fig. 2B). To evaluate the role of TIM4 in early NASH, mice were fed a HF-CDAA diet for 4 weeks, with anti-TIM4 or IgG administered during weeks 3 and 4. The two groups of mice had similar body and liver weights (Fig. 8A). Anti-TIM4 administration decreased the ratio of macrophage-associatedTree cl-caspase-3+(apoptotic) cells, indicating impaired efferocytosis (Fig. 2C). Most importantly, anti-TIM4 increased liver fibrosis as assessed by both picrosirius red and collagen 1A1 (COL1A1) staining (Fig. 2D,E). Hepatic stellate cell activation was also increased by anti-TIM4 administration, as indicated by higher a-SMA+and Opn+areas (Fig. 2G,H). The livers of the anti-TIM4 cohort also showed increased CK19+area, indicating the presence of bile ductular reaction (Fig. 2H), which is associated with NASH pathogenesis (Zhao L, Westerhoff M, Pai RK, Choi W-T, Gao Z-H, Hart J. Mod Pathol 2018;31 : 150-159; Lee SJ, Park JB, Kim KH, Lee WR, Kim JY, An HJ, et al. Int J Clin Exp Pathol 2014;7:4076-4085). Finally, anti-TIM4 administration increased the number of hepatic F4 / 80+macrophage crown-like structures (hCLS) in the liver, which is a characteristic feature of mouse and human NASH associated with liver fibrosis (Itoh M, Kato H, Suganami T, Konuma K, Marumoto Y, Terai S, et al. PLoS One 2013;8:e82163). In contrast, anti-TIM4 did not affect hepatosteatosis, plasma ALT activity, or liver macrophage as assessed by Adgrel mRNA level (Fig. 8B-D).

[0140] To investigate the role of KC TIM4 in liver efferocytosis and NASH progression, Timd4n nmice were generated (Fig. 8E) and crossed them KC-specific with Clec4f-Cre mice (Sakai M, Troutman TD, Seidman JS, Ouyang Z, Spann NJ, Abe Y, et al. Immunity 2019;51 :655-670. e658) to knockdown TIM4 in KCs (KC-TIM4-KD). i'imd4n nmice wereused as the control mice. Chow-fed mice were first characterized. Liver Timd4 mRNA expression was markedly decreased in KC-TIM4-KD mice, while the liver mRNAs of other efferocytosis receptors were similar between KD and control mice (Fig. 8F). Consistent with the Timd4 data, immunofluorescence analysis showed markedly decreased TIM4 expression in liver macrophages in the KD cohort (Fig. 8G), while the expression of Clec4f was similar in control and KD liver (Fig. 8H). The mice were then fed the HF-CDAA diet for 4 weeks and a decreased KC -TIM4 in the KD livers was verified (Fig. 3A). The two cohorts had similar body and liver weights and fasting blood glucose (Fig. 81, J), but KC-TIM4-KD was associated with defective efferocytosis by liver macrophages, indicated by a reduced ratio of macrophage-associatedTree cl-caspase3+cells and increased total cl-caspase3+number per field (Fig. 3B). Most importantly, the KD mice had increased liver fibrosis based on picrosirius red and C0L1A1 staining (Fig. 3C,D) and evidence of increased HSC activation based on higher a-SMA+and Opn+areas (Fig. 3E,F). As with the anti-TIM4 experiment, the KD mice had increased CK19+ area and hepatic crown-like structure (Fig. 3G,H). These changes occurred despite no change in hepatosteatosis and only a modest decrease in plasma ALT activity (Fig. 8K, L). KC-TIM4-KD also lowered efferocytosis and fibrosis in HF- CDAA-fed female mice without affect hepatosteatosis (Fig. 3I-L and Fig. 9A-C).

[0141] To test the effect of KC-TIM4-KD in another NASH model, KD and control mice were fed the FPC diet for 16 weeks. As with the HF-CDAA model, robust KD of KC-TIM4 (Fig. 4A) was acheived, and there were no significant differences between the two cohorts in body and liver weight, fasting blood glucose, hepatosteatosis, and plasma ALT (Fig. 9D-G). Most importantly, KC-TIM4-KD caused a decease in efferocytosis by liver macrophages (Fig. 4B) and increases in liver fibrosis (Fig. 4C,D), a-SMA+and Opn+areas (Fig. 4E,F), and mRNAs associated with HSC activation, i.e., Col lai, Colla2, Col3al, Sppl, and Timpl (Fig. 4G). The livers of the KD mice also had increases in CK19+area (Fig. 4H) and hepatic crown-like structures (Fig. 41). In contrast, mRNAs encoding proteins associated with inflammation were similar between the two cohorts (Fig. 9H). Thus, when KC-TIM4 is genetically lowered in early NASH, i.e., before it is naturally lowered in later NASH, the progression to NASH fibrosis is accelerated.Macrophage TIM4 restoration after the development of steatosis promotes efferocytosis and suppresses the progression to liver fibrosis in NASH mice

[0142] The most important causation question related to TIM4, efferocytosis, and NASH is whether the restoration of macrophage TIM4 during the transition from early to advanced NASH would dampen the progression to liver fibrosis. To achieve this goal, a transgenic (Tg) model in which Timd4 could be expressed in macrophages in a doxycycline (Dox)-inducible manner (iTg mice) was created. In particular, mice transgenic for TRE (7 tetO+ minimal CMV promoter)- Lzzzzt / 4-bGHp A were crossed with macrophage-specific Cd68rtTA mice, using mice with TRE-Zzmt / 4-bGHpa alone and Cd68rtTA as controls. The iTg and control mice were fed the HF-CDAA diet for 10 weeks, with Dox was administered in the drinking water between weeks 6 and 10. This protocol successfully restored TIM4 in liver macrophages (Fig. 5A). Restoration of macrophage TIM4 did not exert any influence on body weight, liver weight, and fasting blood glucose levels (Fig. 10A,B) Most importantly, the TIM4-restored NASH mice showed improved efferocytosis (Fig. 5B) and decreases in liver fibrosis (Fig. 5C,D), HSC activation (Fig. 5E,F), bile ductular reaction (Fig. 5G), and hepatic crown-like structures (Fig. 5H). These improvements occurred without any changes in hepatic steatosis or plasma ALT (Fig. 10C,D).

[0143] Then, a similar experiment was conducted with 16-week FPC-fed mice, intervening with Dox between weeks 9-16 so that macrophage TIM4 would be restored during steatosis-to-NASH progression, which is the period during TIM4 expression and efferocytosis decrease (above) and liver fibrosis increases (Wang X, Zheng Z, Caviglia JM, Corey KE, Herfel TM, Cai B, et al. Cell Metab 2016;24:848-862). The results were similar to those with the HF-CDAA model. There was clear restoration of liver macrophage TIM4 in the Dox-treated cohort (Fig. 6A), and this led to improvements in liver macrophage efferocytosis (Fig. 6B) and decreases in liver fibrosis (Fig. 6C,D), a-SMA+and OPN+areas (Fig. 6E,F), mRNAs associated with HSC activation (Collal, Colla2, Colla3, Tgfbl, and limpl) (Fig. 6G), CK19+areas (Fig. 6H), and hepatic crown-like structures (Fig. 61) — all without changes in body weight, liver weight, fasting blood glucose, hepatic steatosis, or plasma ALT (Fig. 10E-H). In contrast, mRNAs encoding proteins associated with inflammation were similar between the two cohorts (Fig. 101). The findings, within the context of the previous data in this report, provide strong evidence that the decrease in TIM4in liver macrophages during NASH progression contributes to impaired efferocytosis and the progression of liver fibrosis.Discussion

[0144] A key feature of NASH is hepatocyte apoptosis, which correlates with the clinically most important feature of the disease, liver fibrosis (Schwabe RF, Luedde T. Nat Rev Gastroenterol Hepatol 2018;15:738-752; Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, et al. Gastroenterology 2003;125:437-443). Therefore, a key area in NASH research is to understand the fate of apoptotic hepatocytes and how hepatocyte apoptosis might be linked to liver fibrogenesis. Addressing these fundamental issues may suggest novel strategies to prevent fibrosis progression in NASH. In terms of apoptotic hepatocyte fate, the finding that they increase in advance human and experimental NASH indicates that there is a defect in their clearance, as apoptotic cells in tissues do not accumulate if efferocytosis is intact unless massive apoptosis occurs, which is not the case in NASH. Although a recent report showed that apoptotic hepatocytes accumulate in liver when another macrophage efferocytosis receptor was deleted (Wang X, He Q, Zhou C, Xu Y, Liu D, Fujiwara N, et al. Immunity 2022), there has been no previous report directly measuring efferocytosis in liver, z.e., macrophage-associated vs. free apoptotic cells, during NASH progression in mice or humans. The previous findings that TIM4 expression is decreased in mouse NASH are consistent with its possible protective role, and described herein provides a new finding that liver macrophage TIM4 is decreased and correlates with defective efferocytosis in human NASH bolsters the central concept herein. Moreover, TIM4 was shown to mediate apoptotic hepatocyte uptake by KCs ex vivo (Yanagihashi Y, Segawa K, Maeda R, Nabeshima YI, Nagata S. Proc Natl Acad Sci U S A 2017; 114:8800-8805;Miyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T, Nagata S. Nature 2007;450:435- 439; Ni M, Zhang J, Sosa R, Zhang H, Wang H, Jin D, et al. Hepatology 2021;74:2118- 2132), but its role in efferocytosis by liver macrophages and liver fibrosis in NASH has remained unknown. There has been recent interest in TREM2, which is expressed on liver macrophages and can mediate efferocytosis ex vivo (Wang X, He Q, Zhou C, Xu Y, Liu D, Fujiwara N, et al. Immunity 2022). However, although there is some evidence that TREM2 may mediate efferocytosis in experimental NASH, the expression levels and roles of TREM2 in efferocytosis and liver fibrosis in NASH remain controversial (Wang X, He Q, Zhou C, Xu Y, Liu D, Fujiwara N, et al. Immunity 2022; Liebold I, Meyer S, Heine M, Kuhl A, Witt J,Eissing L, et al. Cells 2023;12:341; Lee KJ, An S, Kim MY, Kim SM, Jeong WI, Ko HJ, et al. Immunol Cell Biol 2022; Hendrikx T, Porsch F, Kiss MG, Rajcic D, Papac-Milicevic N, Hoebinger C, et al. J Hepatol 2022). Finally, previous study showed that the clearance of necroptotic hepatocytes is defective in NASH owing to increases in SIRPa on NASH liver macrophages and CD47 on necroptotic hepatocytes (Shi H, Wang X, Li F, Gerlach BD, Yurdagul A, Jr., Moore MP, et al. Sci Transl Med 2022;14:eabp8309). While blocking either SIRPa or CD47 improved necroptotic hepatocyte uptake and dampened NASH progression, these manipulations did not lower apoptotic hepatocytes (Shi H, Wang X, Li F, Gerlach BD, Yurdagul A, Jr., Moore MP, et al. Sci Transl Med 2022;14:eabp8309). Therefore, defective clearance of both necroptotic and apoptotic hepatocytes, which is caused by distinct mechanisms, both contribute to NASH progression.

[0145] The major mechanistic question arising from the new findings herein is why defective clearance of apoptotic hepatocytes in NASH promotes liver fibrosis. Interestingly, the effect was specific for fibrosis, as steatosis, inflammation, and plasma ALT were not affected in any of the models. In theory, the accumulation of apoptotic hepatocytes could directly contribute to fibrosis, e.g., via their release of fibrogenic factors (Zhang B, Lapenta K, Wang Q, Nam JH, Chung D, Robert ME, et al. J Biol Chem 2021;297: 100887; Mederacke I, Filliol A, Affo S, Nair A, Hernandez C, Sun Q, et al. Sci Transl Med 2022;14:eabe5795). However, the failure of apoptosis inhibitors to block NASH fibrosis in humans (Harrison SA, Goodman Z, Jabbar A, Vemulapalli R, Younes ZH, Freilich B, et al. J Hepatol 2020;72:816- 827) suggests the possibility of alternative mechanisms. For example, efferocytosis reprograms macrophages to promote tissue resolution (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620), and it is possible that efferocytosis-mediated re-programming promotes liver macrophage secretion of pro-fibrogenic factors and / or dampens the secretion of anti- fibrogenic factors. Of note, two known efferocytosis-induced mediators are interleukin- 10 (Zhang S, Weinberg S, DeBerge M, Gainullina A, Schipma M, Kinchen JM, et al. Cell Metab 2019;29:443-456. e445) and insulin-like growth factor-1 (Han CZ, Juncadella IJ, Kinchen JM, Buckley MW, Klibanov AL, Dryden K, et al. Nature 2016;539:570-574), both of which can inhibit HSC activation and reduce fibrogenesis (Nga HT, Moon JS, Tian J, Lee HY, Kim SH, Lee YS, et al. Front Med (Lausanne) 2021;8:672658; Sobrevals L, Rodriguez C, Romero- Trevejo JL, Gondi G, Monreal I, Paneda A, et al. Hepatology 2010;51 :912-921; Sanz S, Pucilowska JB, Liu S, Rodriguez-Ortigosa CM, Lund PK, Brenner DA, et al. Gut2005;54: 134-141). As efferocytosis in other settings can promote fibrosis as part of the healing process, e.g., via transforming growth factor-^ (TGF[3) (Doran AC, Yurdagul A, Jr., Tabas I. Nat Rev Immunol 2019; Mehrotra P, Ravichandran KS. Nature Reviews Drug Discovery 2022;21 :601-620), efferocytosis-induced macrophage re-programming may be distinct in the unique setting of NASH (Kim KH, Cheng N, Lau LF. Hepatol Commun 2022.). Indeed, we showed that restoration of TIM4-mediated efferocytosis in NASH decreased liver Tgfbl (Fig. 61). Future studies will be needed to further investigate this issue.

[0146] The new insights gained from this study could have translational impact. The decreased expression of TIM4 in advanced NASH may be attributed to the loss of Timd4 expression in KCs and / or the loss of KCs themselves (Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H, et al. Immunity 2020; Lefere S, Degroote H, Van Vlierberghe H, Devisscher L. J Hepatol 2019;71 :631-633; Tran S, Baba I, Poupel L, Dussaud S, Moreau M, Gelineau A, et al. Immunity 2020;53:627-640. e625; Daemen S, Gainullina A, Kalugotla G, He L, Chan MM, Beals JW, et al. Cell Rep 2021;34: 108626). A previous study showed that infusion of KCs mitigates liver fibrosis in a mouse liver injury model. It may also be possible to genetically restore macrophage TIM4, e.g., by using macrophage-targeted nanoparticles containing Tim4 mRNA. Another approach might lie in pharmacologically preventing TIM4 down-regulation in NASH. Although the mechanism in NASH is not known, P38 mitogen-activated protein kinase activation mediates the age-related decrease in Timd4 expression in blister monocytes / macrophages, resulting in defective efferocytosis and inflammation resolution (De Maeyer RPH, van de Merwe RC, Louie R, Bracken OV, Devine OP, Goldstein DR, et al. Blocking elevated p38 MAPK restores efferocytosis andinflammatory resolution in the elderly. Nat Immunol 2020;21 :615-625). Moreover, deleting myeloid P38a or P38y / 8 improves diet induced NAFLD / NASH (Zhang X, Fan L, Wu J, Xu H, Leung WY, Fu K, et al. J Hepatol 2019;71 : 163-174; Gonzalez-Teran B, Matesanz N, Nikolic I, Verdugo MA, Sreeramkumar V, Hemandez-Cosido L, et al. Embo j 2016;35:536-552). Although the mechanism of this effect was not linked to TIM4 or efferocytosis, it is possible that liver macrophage-targeted inhibition or silencing of P38 or a key downstream mediator could prevent TIM4 down-regulation and thereby improve efferocytosis and decrease liver fibrosis in NASH. Additionally, understanding the epigenetic signals that regulate Timd4 expression may afford other opportunities for therapeutic intervention (Yang B, Li LJ, Xu LZ, Liu JQ, Zhang HP, Geng XR, et al. Sci Rep2016,6 :21336). More generally, the evidence herein that macrophage TIM4 down-regulationin NASH is not simply a biomarker of NASH macrophages but rather actively promotes liver fibrosis provides the impetus for future studies on the mechanism of Timd4 regulation and how it may be amenable to therapeutic intervention.Example 2- Genetically overexpressed efferocytosis receptor TIM4 in bone marrow- derived macrophage (BMDM) reduces experimental MASHMaterials and MethodsAnimal studies

[0147] Male wildtype C57 / BL6J mice (10-12 weeks old, #000664) were obtained from Jackson Laboratory (Bar Harbor, ME) and were allowed to adjust to the housing environment in the Columbia University Irving Medical Center for 1 week before starting experiments. The mice were fed a choline-deficient, L-amino acid-defined, high-fat diet (HF-CDAA, Research Diets, #A06071302) for 6 weeks to induce early or advanced NASH, respectively. All the mice were randomly assigned to experimental groups by investigators, who were blinded in terms of group assignment. The mice were fed the HF-CDAA diet for 6 weeks, with administration of control bone marrow derived macrophages (BMDMs) or BMDMs genetically overexpressing TIM4 during week 4.

[0148] All mice were housed in standard cages at 22 °C in a 12-12-h light-dark cycle in a barrier facility, and experiments were conducted by following the Guidelines for the Care and Use of Laboratory Animals at Columbia University. Animal protocol AABL5573 for these studies was approved by the Institutional Animal Care and Use Committee at Columbia University.ResultsTo evaluate the role of TIM4 in NASH, mice were fed a HF-CDAA diet for 6 weeks, with control BMDM’s or BMDM’ s genetically overexpressing TIM4 (Fig. 13). Overexpression of TIM4 in BMDMs decreased liver fibrosis as assessed by both picrosirius red and collagen 1 Al (COL1 Al) staining (Figs. 14, 15). Hepatic stellate cell activation was also decreased by administration of TIM4 overexpressed BMDMs, as indicated by lower a-SMA+areas (Fig. 16). Lipid droplet area was not significantly affected by administration of TIM4 overexpressed BMDMs, indicating no significant effect to liver steatosis (Fig. 17).References:

[0149] Younossi ZM, Paik JM, Henry L, Yang J, Fernandes G, Stepanova M, et al. The growing economic and clinical burden of nonalcoholic steatohepatitis (NASH) in the United States. J Clin Exp Hepatol 2023;13:454-467.

[0150] Loomba R, Friedman SL, Shulman GI. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021;184:2537-2564.

[0151] Harrison SA, Allen AM, Dubourg J, Noureddin M, Alkhouri N. Challenges and opportunities in NASH drug development. Nat Med 2023.

[0152] Schwabe RF, Luedde T. Apoptosis and necroptosis in the liver: a matter of life and death. Nat Rev Gastroenterol Hepatol 2018;15:738-752.

[0153] Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD, et al. Hepatocyte apoptosis and fas expression are prominent features of human nonalcoholic steatohepatitis. Gastroenterology 2003;125:437-443.

[0154] Zhang B, Lapenta K, Wang Q, Nam JH, Chung D, Robert ME, et al. Trefoil factor 2 secreted from damaged hepatocytes activates hepatic stellate cells to induce fibrogenesis. J Biol Chem 2021;297: 100887.

[0155] Mederacke I, Filliol A, Affo S, Nair A, Hernandez C, Sun Q, et al. The purinergic P2Y14 receptor links hepatocyte death to hepatic stellate cell activation and fibrogenesis in the liver. Sci Transl Med 2022;14:eabe5795.

[0156] Harrison SA, Goodman Z, Jabbar A, Vemulapalli R, Younes ZH, Freilich B, et al. A randomized, placebo-controlled trial of emricasan in patients with NASH and F1-F3 fibrosis. J Hepatol 2020;72:816-827.

[0157] Doran AC, Yurdagul A, Jr., Tabas I. Efferocytosis in health and disease. Nat Rev Immunol 2019.

[0158] Mehrotra P, Ravichandran KS. Drugging the efferocytosis process: concepts and opportunities. Nature Reviews Drug Discovery 2022;21 :601-620.

[0159] Wang X, He Q, Zhou C, Xu Y, Liu D, Fujiwara N, et al. Prolonged hypernutrition impairs TREM2-dependent efferocytosis to license chronic liver inflammation and NASH development. Immunity 2022.

[0160] Liebold I, Meyer S, Heine M, Kuhl A, Witt J, Eissing L, et al. TREM2 regulates the removal of apoptotic cells and inflammatory processes during the progression of NAFLD. Cells 2023;12:341.

[0161] Lee KJ, An S, Kim MY, Kim SM, Jeong WI, Ko HJ, et al. Hepatic TREM2(+) macrophages express matrix metalloproteinases to control fibrotic scar formation. Immunol Cell Biol 2022.

[0162] Hendrikx T, Porsch F, Kiss MG, Rajcic D, Papac-Milicevic N, Hoebinger C, et al. Soluble TREM2 levels reflect the recruitment and expansion of TREM2(+) macrophages that localize to fibrotic areas and limit NASH. J Hepatol 2022.

[0163] Shi H, Wang X, Li F, Gerlach BD, Yurdagul A, Jr., Moore MP, et al. CD47- SIRPalpha axis blockade in NASH promotes necroptotic hepatocyte clearance by liver macrophages and decreases hepatic fibrosis. Sci Transl Med 2022;14:eabp8309.

[0164] Kuchroo VK, Dardalhon V, Xiao S, Anderson AC. New roles for TIM family members in immune regulation. Nat Rev Immunol 2008;8:577-580.

[0165] Seidman JS, Troutman TD, Sakai M, Gola A, Spann NJ, Bennett H, et al. Nichespecific reprogramming of epigenetic landscapes drives myeloid cell diversity in nonalcoholic steatohepatitis. Immunity 2020.

[0166] Lefere S, Degroote H, Van Vlierberghe H, Devisscher L. Unveiling the depletion of Kupffer cells in experimental hepatocarcinogenesis through liver macrophage subtypespecific markers. J Hepatol 2019;71 :631-633.

[0167] Tran S, Baba I, Poupel L, Dussaud S, Moreau M, Gelineau A, et al. Impaired Kupffer cell self-renewal alters the liver response to lipid overload during non-alcoholic steatohepatitis. Immunity 2020;53:627-640. e625.

[0168] Daemen S, Gainullina A, Kalugotla G, He L, Chan MM, Beals JW, et al. Dynamic shifts in the composition of resident and recruited macrophages influence tissue remodeling in NASH. Cell Rep 2021;34:108626.

[0169] Yanagihashi Y, Segawa K, Maeda R, Nabeshima YI, Nagata S. Mouse macrophages show different requirements for phosphatidylserine receptor Tim4 in efferocytosis. Proc Natl Acad Sci U S A 2017; 114:8800-8805.

[0170] Miyanishi M, Tada K, Koike M, Uchiyama Y, Kitamura T, Nagata S. Identification of Tim4 as a phosphatidylserine receptor. Nature 2007;450:435-439.

[0171] Ni M, Zhang J, Sosa R, Zhang H, Wang H, Jin D, et al. T-cell immunoglobulin and mucin domain-containing protein-4 is critical for Kupffer Cell homeostatic function in the activation and resolution of liver ischemia reperfusion injury. Hepatology 2021;74:2118- 2132.

[0172] Rodriguez CI, Buchholz F, Galloway J, Sequerra R, Kasper J, Ayala R, et al. High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat Genet 2000;25: 139-140.

[0173] Sakai M, Troutman TD, Seidman JS, Ouyang Z, Spann NJ, Abe Y, et al. Liver- derived signals sequentially reprogram myeloid enhancers to initiate and maintain kupffer cell identity. Immunity 2019;51 :655-670. e658.

[0174] Ampomah PB, Cai B, Sukka SR, Gerlach BD, Yurdagul A, Jr., Wang X, et al. Macrophages use apoptotic cell-derived methionine and DNMT3 A during efferocytosis to promote tissue resolution. Nat Metab 2022.

[0175] Cai B, Dongiovanni P, Corey KE, Wang X, Shmarakov IO, Zheng Z, et al. Macrophage MerTK promotes liver fibrosis in nonalcoholic steatohepatitis. Cell Metab 2020;31 :406-421. e407.

[0176] Wang X, Zheng Z, Caviglia JM, Corey KE, Herfel TM, Cai B, et al. Hepatocyte TAZ / WWTR1 promotes inflammation and fibrosis in nonalcoholic steatohepatitis. Cell Metab 2016;24:848-862.

[0177] Zhao L, Westerhoff M, Pai RK, Choi W-T, Gao Z-H, Hart J. Centrilobular ductular reaction correlates with fibrosis stage and fibrosis progression in non-alcoholic steatohepatitis. Mod Pathol 2018;31 : 150-159.

[0178] Lee SJ, Park JB, Kim KH, Lee WR, Kim JY, An HJ, et al. Immunohistochemical study for the origin of ductular reaction in chronic liver disease. Int J Clin Exp Pathol 2014;7:4076-4085.

[0179] Itoh M, Kato H, Suganami T, Konuma K, Marumoto Y, Terai S, et al. Hepatic crown-like structure: a unique histological feature in non-alcoholic steatohepatitis in mice and humans. PLoS One 2013;8:e82163.

[0180] Zhang S, Weinberg S, DeBerge M, Gainullina A, Schipma M, Kinchen JM, et al. Efferocytosis fuels requirements of fatty acid oxidation and the electron transport chain to polarize macrophages for tissue repair. Cell Metab 2019;29:443-456. e445.

[0181] Han CZ, Juncadella IJ, Kinchen JM, Buckley MW, Klibanov AL, Dryden K, et al. Macrophages redirect phagocytosis by non-professional phagocytes and influence inflammation. Nature 2016;539:570-574.

[0182] Nga HT, Moon JS, Tian J, Lee HY, Kim SH, Lee YS, et al. Interleukin- 10 attenuates liver fibrosis exacerbated by thermoneutrality. Front Med (Lausanne) 2021;8:672658.

[0183] Sobrevals L, Rodriguez C, Romero-Trevejo JL, Gondi G, Monreal I, Paneda A, et al. Insulin-like growth factor I gene transfer to cirrhotic liver induces fibrolysis and reduces fibrogenesis leading to cirrhosis reversion in rats. Hepatology 2010;51 :912-921.

[0184] Sanz S, Pucilowska JB, Liu S, Rodriguez-Ortigosa CM, Lund PK, Brenner DA, et al. Expression of insulin-like growth factor I by activated hepatic stellate cells reduces fibrogenesis and enhances regeneration after liver injury. Gut 2005;54: 134-141.

[0185] Kim KH, Cheng N, Lau LF. Cellular communication network factor 1 -stimulated liver macrophage efferocytosis drives hepatic stellate cell activation and liver fibrosis. Hepatol Commun 2022.

[0186] De Maeyer RPH, van de Merwe RC, Louie R, Bracken OV, Devine OP, Goldstein DR, et al. Blocking elevated p38 MAPK restores efferocytosis andinflammatory resolution in the elderly. Nat Immunol 2020;21 :615-625.

[0187] Zhang X, Fan L, Wu J, Xu H, Leung WY, Fu K, et al. Macrophage p38a promotes nutritional steatohepatitis through Ml polarization. J Hepatol 2019;71 : 163-174.

[0188] Gonzalez-Teran B, Matesanz N, Nikolic I, Verdugo MA, Sreeramkumar V, Hernandez-Cosido L, et al. p38y and p385 reprogram liver metabolism by modulating neutrophil infiltration. Embo j 2016;35:536-552.

[0189] Yang B, Li LJ, Xu LZ, Liu JQ, Zhang HP, Geng XR, et al. Histone acetyltransferease p300 modulates TIM4 expression in dendritic cells. Sci Rep 2016;6:21336.

Claims

CLAIMSWhat is claimed is:

1. A method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising administering to said subject a composition that increases the expression level of a macrophage receptor.

2. A method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising:(i) identifying the subject as having a decreased expression level of a macrophage receptor, and(ii) administering to said subject a composition that increases the expression level of the macrophage receptor.

3. A method of treating or preventing nonalcoholic steatohepatitis (NASH) in a subject in need thereof, comprising:(i) identifying the subject as having an increased ratio of a macrophage-associated apoptotic cell to a free apoptotic cell, and(ii) administering to said subject a composition that increases the expression level of the macrophage receptor.

4. The method of claim 2, wherein the subject has a decreased expression level of a macrophage receptor as compared to a subject not suffering from NASH or a subject suffering from early NASH.

5. The method of claim 3, wherein the subject has an increased ratio of a macrophage- associated apoptotic cell to a free apoptotic cell as compared to a subject not suffering from NASH or a subject suffering from early NASH.

6. The method of any one of claims 1-3, wherein the composition increases the macrophage receptor expression compared to a subject suffering from NASH or compared to the expression before administering the composition.

7. The method of claim 3, wherein the composition reduces the ratio of a macrophage- associated apoptotic cell to a free apoptotic cell compared to a subject suffering from NASH or compared to the ratio before administering the composition.

8. The method of any one of claims 1-7, wherein the macrophage receptor is an efferocytosis receptor.

9. The method of any one of claims 1-8, wherein the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

10. The method of any one of claims 1-9, wherein administration of the composition results in inhibition or reduction of liver fibrosis.

11. The method of any one of claims 1-9, wherein administration of the composition results in inhibition or reduction of hepatic stellate cell (HSC) activation.

12. The method of any one of claims 1-9, wherein administration of the composition results in inhibition or reduction of bile ductular reaction.

13. The method of any one of claims 1-9, wherein administration of the composition results in inhibition or reduction of hepatic crown-like structure formation.

14. The method of any one of claims 1-13, wherein administration of the composition does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

15. The method of any one of claims 1-14, wherein the subject is a mammal.

16. The method of claim 15, wherein the mammal is a human.

17. The method of claims 1-16, wherein the composition increases the expression level of the macrophage receptor in macrophages.

18. The method of claim 17, wherein the composition increases the expression level of the macrophage receptor in liver macrophages.

19. The method of claims 1-18, wherein the composition comprises a nucleic acid encoding TIM4.

20. A composition for treating or preventing NASH comprising a nucleic acid sequence encoding a macrophage receptor.

21. A composition for treating or preventing NASH comprising a nucleic acid sequence capable of increasing the expression level of a macrophage receptor.

22. The composition of claims 20-21, wherein the macrophage receptor is an efferocytosis receptor.

23. The composition of claims 20-22, wherein the macrophage receptor is T cell immunoglobulin and mucin domain containing 4 (TIM4).

24. The composition of any one of claims 20-23, wherein administration of the composition to a subject in need thereof results in inhibition or reduction of liver fibrosis.

25. The composition of any one of claims 20-23, wherein administration of the composition to a subject in need thereof results in inhibition or reduction of hepatic stellate cell (HSC) activation.

26. The composition of any one of claims 20-23, wherein administration of the composition to a subject in need thereof results in inhibition or reduction of bile ductular reaction.

27. The composition of any one of claims 20-23, wherein administration of the composition to a subject in need thereof does not result in a change to hepatic steatosis or plasma alanine transaminase (ALT) activity.

28. The composition of any one of claims 20-27, wherein the composition comprises an expression vector comprising the nucleic acid sequence.

29. The composition of claim 28, wherein the composition comprises a viral vector comprising the expression vector.

30. The composition of claim 29, wherein the viral vector is an AAV vector.

31. The composition of claim 30, wherein the viral vector is AAV8.

32. The composition of claims 20-31, wherein the composition increases the expression level of the macrophage receptor in macrophages.

33. The composition of claim 32, wherein the composition increases the expression level of the macrophage receptor in liver macrophages.

34. A method of diagnosing nonalcoholic steatohepatitis (NASH) in a subject comprising:(i) determining the expression level of cell immunoglobulin and mucin domain containing 4 (TIM4) in the subject; and(ii) diagnosing the subject with NASH if the expression level of TIM4 in the subject is decreased as compared to a subject not suffering from NASH.

35. The method of claim 34, wherein the subject is diagnosed with fibrotic NASH.

36. The method of claims 34 or 35, wherein the expression level of TIM4 is determined using an antibody.

37. The method of claim 36, wherein the expression level of TIM4 is determined by immunoblotting.

38. The method of claim 34 or 35, wherein the expression level of TIM4 is determined by quantitative RT-qPCR.

39. The method of claims 34-38, further comprising administering the composition of any one of claims 19-31 to a subject diagnosed with NASH.

40. A composition comprising a nucleic acid encoding a macrophage receptor.

41. A composition comprising an expression vector comprising a nucleic acid encoding a macrophage receptor.

42. A composition comprising a viral vector comprising a nucleic acid encoding a macrophage receptor43. The composition of any one of claims 40-42, wherein the macrophage receptor is TIM4.

44. The composition of claim 42, wherein the viral vector is an AAV vector.

45. The composition of claim 44, wherein the viral vector is AAV8.

46. The method of any one of claims 1-19, wherein the composition comprises a nucleic acid sequence capable of increasing the expression level of the macrophage receptor.

47. The method of claim 46, wherein the composition comprises an expression vector comprising the nucleic acid sequence.

48. The composition of claim 42, wherein the composition comprises a viral vector comprising the expression vector.

49. The composition of claim 48, wherein the viral vector is an AAV vector.

50. The composition of claim 49, wherein the viral vector is AAV8

Images