Method for constructing a porcine bone marrow macrophage cell line that expresses cre gene and use thereof

Abstract

The present invention relates to the technical field of biology, in particular to a method for constructing a porcine bone marrow macrophage cell line that expresses a Cre gene and the use of the cell line. The method comprises a method of introducing an SV40LT gene into primary porcine bone marrow macrophages by means of electroporation to immortalize the macrophages, a method of continuously constructing a porcine bone marrow macrophage cell line that stably expresses the Cre gene on the basis of the macrophages, and a method of removing a selectable marker gene from a gene-deleted recombinant virus using the cell line. The used method comprises introducing a transposon system containing a SV40LT gene into primary porcine bone marrow macrophages by means of electroporation, and screening out high-quality immortalized porcine bone marrow macrophages. Continuous introduction of a Cre gene into the immortalized porcine bone marrow macrophages by means of electroporation enables the macrophages to stably express the Cre protein, which can be used for removing a selectable marker gene in the process of constructing a gene-deleted vaccine.

Description

Construction method and application of porcine bone marrow macrophage cell line expressing Cre gene Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for constructing a Cre gene-expressing pig bone marrow macrophage cell line and applications thereof. Background Art

[0002] Gene-deficient vaccines make it possible to clinically differentiate between natural infection with wild-type viruses and vaccine immunity, and are an effective tool for achieving the eradication of infectious diseases. In the development or production of vaccines, it is generally necessary to infect susceptible cells with the gene-deficient virus.

[0003] Susceptible cells: Macrophages are susceptible cells to many pathogens of swine-borne infectious diseases, such as African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine epidemic diarrhea virus (PEDV) and pseudorabies virus (PRV). However, the preparation of primary macrophages is time-consuming and expensive, and batches are unstable and contamination may occur. Therefore, large-scale vaccine production using primary cells is impractical and ethically challenging. At the same time, one of the important obstacles limiting the development of safe and effective vaccines is the lack of suitable stable cell lines for virus isolation and propagation. In order to solve this problem, scientists around the world are continuously working to establish immortalized porcine macrophage cell lines for the study of viral biological characteristics, such as viral replication cycle, host immune regulation and pathogenesis, in order to design more efficient diagnostic systems, antiviral drugs and vaccine candidates.

[0004] The SV40 virus large T antigen (SV40LT) is a common immortalizing gene. Currently, six porcine macrophage cell lines immortalized using the SV40LT gene have been reported domestically and internationally: (1) IPAM, established by the Vaccine and Infectious Diseases Organization (VIDO) of Canada, is a continuously passaged porcine alveolar macrophage cell line. Primary porcine alveolar macrophages (PAM) were chemically transfected with the vector pSV3-neo carrying the SV40LT gene. Three monoclonal cell lines, 3D4 / 2, 3D4 / 21, and 3D4 / 31, were obtained by screening in a selective medium containing geneticin. Compared with primary cells PAM, IPAM only expresses low levels of CD14 and SW3, and CD163 and SLAII are almost undetectable. Therefore, IPAM is not a mature macrophage (Weingartl HM et al., Continuous porcine cell lines developed from alveolar macrophages: partial characterization and virus susceptibility. Journal of virological methods. 2002 Jul; 104(2): 203-16). (ii) The IPKM constructed by the National Agriculture and Food Research Organization (NARO) of Japan is a porcine kidney-derived macrophage. The cell line was obtained by infecting primary porcine kidney-derived macrophages (PKM) with a recombinant lentivirus carrying the SV40LT gene and porcine telomerase reverse transcriptase (pTERT) and screening with a selection medium containing geneticin. IPKM has a similar morphology to primary renal macrophages (PKM) and expresses macrophage-specific surface markers Iba1, KT022, and CD172a (Takenouchi T et al., Immortalization and characterization of porcine macrophages that had been transduced with lentiviral vectors encoding the SV40 large T antigen and porcine telomerase reverse transcriptase. Frontiers in veterinary science. 2017 Aug 21; 4:132). (III) NARO published in 2022 the construction of IPIM, a porcine intestinal-derived macrophage. The immortalization method is similar to that of IPKM, with the expression of SV40LT and pTERT via recombinant lentiviral transfection.IPIM express macrophage-specific surface molecules Iba-1, CD172a, CD204, CD203a, and CD16, and some cells express CD163, CD169, and MHC-II (Takenouchi T et al., Isolation and immortalization of macrophages derived from fetal porcine small intestine and their susceptibility to porcine viral pathogen infections. Frontiers in veterinary science. 2022 Jul 18; 9: 919077). (IV) The domestic patent application published with publication number CN 105793416 A, “Immortalized Porcine Alveolar Macrophages,” is an immortalized cell line that was transfected with the SV40LT-carrying transposon vectors pPB-CAG-SV40 T Ag and pPB-CMV-hyPBase into primary porcine alveolar macrophages (PAMs). Flow cytometry analysis showed that the cell line expressed the macrophage surface molecules CD163 and sialoadhesin P210. As of the time of publication of the patent, the cell line had been cultured for 8 months (50-60 generations). (5) Patent application publication number CN 113528453 A, "An Immortalized Porcine Macrophage Cell Line, Its Construction Method, and Application," describes a cell line obtained by infecting primary porcine bone marrow macrophages (BMDM) with a recombinant lentivirus carrying the SV40LT gene and the human telomerase reverse transcriptase (hTERT) gene. The lentiviral vector GLV2-CMV-MCS-PGK-puro expresses a puromycin resistance gene, and flow cytometry analysis demonstrates that the cell line expresses CD14. (6) Patent application publication number CN 114292873 A, "Immortalized Porcine Bone Marrow Macrophages, Its Construction Method, and Application," describes a cell line obtained by transfecting primary porcine bone marrow macrophages (BMDM) with the plasmid pIED-Neo-SV40TAg carrying the SV40LT gene and screening using a selective medium containing geneticin.

[0005] Therefore, while current literature reports that SV40LT can immortalize porcine macrophages, no complete experimental data has been found to demonstrate whether these SV40LT-immortalized porcine macrophages are fully mature or tumorigenic. Furthermore, the six cell lines screened above all used drug-resistant genes, and it is unknown whether these resistance genes will affect downstream applications.

[0006] Methods for constructing gene-deleted viruses: Currently, the mainstream technologies for constructing gene-deleted viruses include three categories: traditional marker-assisted site-directed mutagenesis, viral gene deletion based on constructed viral vectors (e.g., bacterial artificial chromosome technology, recombinant cosmid system, influenza virus 8-plasmid virus rescue system, and replication-defective adenovirus vectors), and CRISPR / Cas9-mediated gene editing technology. The construction process of viral vectors is time-consuming and labor-intensive, and the experimental operation is relatively difficult, requiring mature background technology and long-term verification. CRISPR / Cas9 technology has been very popular in recent years. The principle of its site recognition is that a single guide RNA (sgRNA) recruits the nuclease Cas9 and binds to the target site located upstream of the protospacer adjacent motif (PAM). Therefore, target selection is limited by the sequence characteristics of the PAM, and there is a risk of off-target effects, which may cause unwanted mutations. Therefore, although the traditional marker-assisted site-directed mutagenesis technology has the disadvantage of low efficiency, it is not restricted in site sequence selection and is highly conserved. The construction of gene-deficient recombinant viruses in eukaryotic cells usually uses a combination of selection markers and homologous recombination. The conventional process can be divided into three steps: the first step is to transfect the transfer vector and the viral genome in cells susceptible to the virus (or to infect the virus after transfection), so that the homologous arm sequences on the transfer vector and the homologous sequences on the viral genome recombine, and the selection marker gene on the transfer vector (such as a fluorescent gene and / or a drug-resistant gene) is introduced into the viral genome; the second step is to use the characteristics of the selection marker gene to separate and purify the recombinant virus from the mixture of wild-type and recombinant viruses; the third step is to remove the selection marker gene from the recombinant virus. The early method of removing the selection marker gene can reuse the recombinant plasmid with only the homologous arm sequences on both sides but without the selection marker gene for homologous recombination to replace the selection marker gene. This step is equivalent to repeating the first two steps, but there will be no selection marker gene to assist in the purification of the virus this time, making the virus purification extremely difficult and labor-intensive. Therefore, in practice, people prefer to use site-specific recombination systems. The most widely used systems are Cre / LoxP and FLP / FRT. Cre and FLP are both specific recombinases belonging to the λ integrase family of recombinases. The reaction types, target sites, and recombination mechanisms they catalyze are very similar. LoxP and FRT are specific sites and have similar structures. Therefore, when designing transfer vectors, specific sites are placed in the same orientation on both sides of the selection marker gene. Then, by expressing the specific recombinase in virus-susceptible cells and transfecting the recombinant viral genome (or infecting the recombinant virus), the selection marker gene can be accurately and efficiently removed. However, the only factor that determines the efficiency of virus purification is the proportion of cells expressing the specific recombinase.Conventional transfection methods, however, are limited by cellular characteristics, particularly macrophages, which are generally considered difficult to transfect. Therefore, achieving 100% expression efficiency is impossible with conventional transfection, and the viral purification step required to remove the selectable marker gene is unavoidable. However, the availability of a macrophage cell line expressing a specific recombinase could easily address the challenge of removing the selectable marker gene, eliminating the viral purification step required to remove the selectable marker gene.

[0007] As can be seen from the above, constructing a gene-deleted vaccine for a macrophage-tropic virus involves both a gene-deleted recombinant virus and susceptible cells. However, there is still a lack of mature, high-quality susceptible cells. Furthermore, the process of constructing a gene-deleted vaccine often involves the addition of a selection marker gene to aid in the selection of positive strains. However, vaccine approval requirements prohibit the inclusion of such selection markers, and the labor-intensive reverse screening of negative strains remains a pressing issue. While the Cre / LoxP recombinase system is commonly used to remove a single selection marker gene, in the development of porcine macrophage-tropic porcine viral vaccines, this presents challenges due to transfection difficulties.

[0008] Summary of the Invention

[0009] In order to overcome the current difficulty in efficiently removing the selection marker gene in the process of constructing a macrophage-tropic virus gene-deleted vaccine, the present invention provides a method for constructing immortalized porcine macrophages using the SV40LT gene, which can obtain mature immortalized porcine bone marrow macrophages that are non-tumorigenic, have normal chromosomal karyotype, and have no drug-resistant genes. The Cre gene is further introduced into the cells to obtain a stably expressed cell line, providing convenient conditions for removing the selection marker gene in the process of constructing a gene-deleted recombinant virus.

[0010] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0011] An immortalized porcine bone marrow macrophage, characterized in that the immortalized porcine bone marrow macrophage is

[0012] Porcine bone marrow macrophages IPBM 14w3 were deposited in China Center for Type Culture Collection, Wuhan University, Wuhan, China on June 7, 2023, with the deposit number CCTCC NO: C2023157;

[0013] Or porcine bone marrow macrophages IPBM14w3-Cre were deposited in China Center for Type Culture Collection on June 20, 2023, with the deposit address: Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C2023178.

[0014] A method for constructing the immortalized porcine bone marrow macrophages is characterized by comprising the following steps:

[0015] (1) Obtain the femur and tibia of the pig, isolate the bone marrow cells, induce them into macrophages in vitro, and then digest and collect them;

[0016] (2) introducing the transposon vector and transposase vector containing the SV40LT gene into primary porcine bone marrow macrophages by electroporation;

[0017] The transposon vector of the SV40LT gene includes the nucleotide sequence shown in the CDS region of the "large T antigen" gene in GenBank accession number NC_001669.1;

[0018] (3) The surviving cells were subjected to limiting dilution method to select monoclonal cell lines, and were serially subcultured to obtain immortalized porcine bone marrow cells IPBM 14w3.

[0019] (4) The Cre gene was introduced into pig bone marrow macrophages IPBM14w3-Cre.

[0020] The method is characterized in that in step (4), the pig bone marrow macrophage IPBM14w3-Cre is prepared by the following steps:

[0021] A transposon vector and transposase vector containing the Cre gene were introduced into immortalized porcine bone marrow macrophages (IPBM14w3) by electroporation; the Cre gene transposon vector included the nucleotide sequence represented by the CDS region of the "Cre" gene in GenBank accession number NC_005856.1. After electroporation, positive clones were selected using G418 selective medium to obtain porcine bone marrow macrophages (IPBM14w3-Cre) stably expressing Cre. The present invention also provides a method for using the porcine bone marrow cell line stably expressing Cre, constructed using the method described in the aforementioned technical solution, to remove the red fluorescent gene, a selectable marker, from a recombinant virus lacking the gE gene of a pseudorabies virus.

[0022] Application of the immortalized pig bone marrow macrophages in vaccine preparation

[0023] Porcine bone marrow macrophages IPBM 14w3 were deposited in China Center for Type Culture Collection on June 7, 2023, at Wuhan University, Wuhan, China, with the deposit number CCTCC NO: C2023157.

[0024] Porcine bone marrow macrophages IPBM14w3-Cre were deposited in the China Center for Type Culture Collection on June 20, 2023, with the deposit number CCTCC NO: C2023178. Beneficial effects:

[0025] Pig bone marrow macrophages are difficult to spontaneously immortalize. Common cell immortalization strategies require the use of lentiviral vectors to introduce immortalization genes such as SV40LT into primary cells. At the same time, selection marker genes are introduced for the convenience of screening. However, whether the above-mentioned lentiviral vectors, exogenous immortalization genes and selection marker genes can be used for production has become a focus now.

[0026] The present invention provides a high-quality immortalized porcine bone marrow macrophage, which introduces a transposon system carrying the SV40LT gene into primary porcine bone marrow macrophages by electroporation. This strategy not only avoids the integration of irrelevant sequences on the vector into the cell genome, but also has high efficiency, does not require the assistance of drug-resistant genes, and has little side effect on cells. After a large number of screenings, the inventors found that the cell chromosome karyotype provided by the present invention is normal, does not have tumorigenicity, has no drug-resistant genes, and highly expresses 6 macrophage-specific surface molecules (CD14, CD16, CD163, CD169, CD172a and CD203a). After 70 generations of passage, it can be seen that IPBM 14w3 still maintains a cell morphology similar to that of primary porcine bone marrow macrophages, and is a mature porcine bone marrow macrophage cell line. At the same time, the porcine bone marrow macrophage cell line stably expressing Cre constructed on this cell line can conveniently and efficiently remove the screening tag in the gene-deleted recombinant virus.

[0027] Specifically:

[0028] The present invention provides a method for constructing immortalized porcine bone marrow macrophages. Normal porcine bone marrow cells are isolated from pig bones, induced to differentiate into macrophages, and immortalized using a transposon system containing the SV40LT gene and electroporation to obtain immortalized porcine bone marrow macrophages. The immortalized porcine bone marrow macrophages obtained by this method have significant advantages, such as normal karyotype, lack of tumorigenicity, absence of drug resistance genes, and high expression of macrophage-specific cell surface molecules. The present invention also provides a method for constructing a porcine bone marrow macrophage cell line stably expressing the Cre gene, which can be used to remove the selection marker of recombinant viruses with deletions. As shown in the examples of the present invention, the porcine bone marrow cell line expressing the Cre gene can effectively remove the selection marker—the red fluorescent gene—from a recombinant porcine pseudorabies virus with a gE gene deletion. This cell line can also be used to remove selection marker genes from other cell-adaptive viral gene-deleted recombinant viruses.

[0029] The specific analysis is as follows: First, SV40LT, a commonly used immortalization gene, has been a persistent problem in the development of immortalized porcine macrophages, with the resulting cell lines failing to express specific macrophage-specific surface molecules. Furthermore, no experimental data have been reported on whether these cell lines have normal karyotypes or tumorigenicity. Second, compared to other mammalian cells, macrophages are generally considered difficult to transfect. This is partly because primary macrophages are largely non-proliferating in vitro, reducing the likelihood of exogenous nucleic acids reaching the nucleus during nuclear membrane breakdown during mitosis. Furthermore, this near-non-proliferative nature makes primary macrophages difficult to culture long-term in vitro, making spontaneous immortalization difficult. Furthermore, macrophages are innate immune cells with natural mechanisms to recognize exogenous nucleic acids and initiate an immune response to eliminate these "foreign" substances. Commonly used viral vector transfection methods, such as lentiviral and retroviral vectors, not only integrate viral genes, such as large terminal repeats (LTRs), into the cellular genome, but also require complex processes such as viral packaging and infection, placing high demands on experimental equipment and biosafety levels. Another conventional transfection method, chemical transfection, will cause macrophage activation and adverse reactions while introducing exogenous nucleic acids. Therefore, compared with other transfection methods, electroporation is simple and efficient, without biological and chemical side effects, but electroporation is not perfect. If only ordinary vectors are electroporated, the efficiency of integrating the target gene into the cell genome is extremely low, and it will be lost after several passages. Third, transposons are natural DNA transfer tools, similar to integrating viruses, which can effectively integrate exogenous genes into the genome and express them stably for a long time. Not only is it efficient, but it also only integrates the target gene, avoiding integration into other unrelated sequences on the vector, but transposon transfer is not perfect. For example, transposons cause genomic instability. Therefore,

[0030] As shown in the examples of the present invention, the immortalized porcine bone marrow macrophages constructed by the method of the present invention are high-quality porcine macrophages. The cells are "fried egg-shaped" with clear cell contours and intact cells, and have typical morphological characteristics similar to primary porcine bone marrow macrophages. The cell line is stable in passages and has been passaged more than 70 times. The cell line does not form tumors in nude mice, and cells at passage 63 still retain a staining karyotype similar to that of primary porcine cells. Flow cytometry analysis showed that the cell line can express high levels of mature macrophage-specific surface molecules: CD14, CD16, CD163, CD169, CD172a, and CD203a.

[0031] The Cre / LoxP recombinase system in this invention is fully functional, and the Cre protein in the cell line successfully removes the red fluorescent protein gene, the selection marker, from the gE-deficient recombinant virus. Therefore, the cell line IPBM14w3-Cre-1, which stably expresses the Cre gene, only requires a single infection with the deletion virus to successfully remove the selection marker gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 shows the transposon vector maps of SV40LT (A) and Cre (B)

[0033] FIG2 is a cell morphology diagram of the primary porcine bone marrow cells and immortalized porcine bone marrow macrophages isolated and cultured in Example 1 at passages 10, 20, 30, 40, 50, 60, and 70;

[0034] FIG3 is a flow cytometry graph showing the detection of macrophage-specific cell surface molecules expressed by immortalized porcine bone marrow macrophages in Example 1;

[0035] FIG4 is the tumorigenicity test results (A) and the cell chromosome karyotype diagram (B) of immortalized porcine bone marrow macrophages in nude mice in Example 1;

[0036] FIG5 is a diagram showing the WB identification results of three immortalized porcine bone marrow macrophages expressing Cre screened in Example 2;

[0037] FIG6 is a diagram showing the effect of using porcine bone marrow macrophages expressing the Cre gene to remove the selection marker in the recombinant virus lacking the gE gene of pseudorabies virus in Example 3, wherein A is a fluorescence microscope photograph and B is the result of nucleic acid electrophoresis;

[0038] FIG7 is a comparison of the efficiency of removing the gene-deleted recombinant virus selection marker by transient transfection and stable expression of Cre protein in Comparative Example 3. DETAILED DESCRIPTION

[0039] The following examples are provided to better illustrate the technical solutions of the present invention, but are not intended to limit the scope of protection of the present invention.

[0040] Example 1 Construction of Immortalized Porcine Bone Marrow Macrophages

[0041] 1.1 Isolation and culture of primary porcine bone marrow macrophages

[0042] 1) Remove the femur and tibia of the pig and transfer them to a biosafety cabinet under low temperature and sterile conditions;

[0043] 2) After removing the meat, spray the bone surface with 75% alcohol to disinfect it, and saw it in the center to expose the cross section;

[0044] 3) Flush out the bone marrow with a syringe filled with bone marrow flushing fluid and filter to obtain a bone marrow cell suspension;

[0045] 4) Transfer the suspension into a centrifuge tube, centrifuge at 1500 rpm, 4°C for 5 minutes, and discard the supernatant;

[0046] 5) Resuspend the cells in 3-5 volumes of red blood cell lysis buffer, let stand for 2 minutes, terminate the reaction with 20 mL of cell wash buffer, centrifuge at 1500 rpm, 4°C for 5 minutes, and discard the supernatant;

[0047] 6) Resuspend in cell washing solution, centrifuge at 1500 rpm, 4°C for 5 minutes, discard the supernatant, and repeat washing three times to obtain the precipitate of porcine bone marrow cells;

[0048] 7) Resuspend the cells in growth medium (RPMI-1640 medium + 10% FBS + 10 ng / mL pGM-CSF + 1% double antibody), transfer to a 10 cm culture dish, and incubate at 37°C, 5% CO2, changing the medium every three and a half days. Incubate for 7 days to obtain porcine bone marrow macrophages.

[0049] As shown in Figure 2, the upper left corner shows porcine bone marrow macrophages (BMDM) differentiated from porcine bone marrow cells induced by GM-CSF. The cells are shaped like fried eggs, with clear cell outlines and adherent growth. This shows that the cells isolated and cultured in the present invention are normal porcine bone marrow macrophages.

[0050] 1.2 Electroporation of porcine bone marrow macrophages

[0051] 1) Take the primary porcine bone marrow macrophages from step 1.1, digest and collect them, resuspend them in an appropriate volume of electroporation solution, count the cells, and dispense them into centrifuge tubes, 10 per tube. 6 cells;

[0052] 2) Add plasmids pTEG-SV40LT and pSB16 to each tube of cells. The pTEG-SV40LT vector map is shown in Figure 1.

[0053] 3) After the cells and plasmid are mixed, transfer them into a 2 mm electroporation cuvette;

[0054] 4) Set the parameters on the electroporator: select exponential decay pulse, capacitance of 940 μF, voltage between 150 V and 300 V, and duration of 1 ms to 10 ms;

[0055] 5) Immediately after the electric pulse, transfer the cells to a 12-well plate containing growth medium and gently pipette to mix.

[0056] 6) Incubate at 37°C, 5% CO2 for 3 days.

[0057] 1.3 Screening of immortalized porcine bone marrow macrophages

[0058] 1) Take the electroporated porcine bone marrow macrophages obtained in step 1.2, dilute them into single cells by limiting dilution method and inoculate them into 96-well plates;

[0059] 2) Incubate at 37°C, 5% CO2, changing the medium every five days. Once the cells have filled a single well, transfer them to a 24-well plate after digestion and continue culturing.

[0060] 3) After the bottom of the 24-well plate is fully grown, transfer the cells to a 6-well plate; after the 6-well plate is fully grown, transfer the cells to a 6-cm cell dish; after the 6-cm cell dish is fully grown, transfer the cells to a 10-cm cell dish for subculture;

[0061] 4) Gradually expand the culture to screen for monoclonal cell lines with uniform morphology and stable growth. Ultimately, the optimal cell line was identified and named IPBM 14w3.

[0062] As shown in Figure 2, the cell morphology of primary porcine bone marrow macrophages (BMDM) and immortalized porcine bone marrow macrophages (IPBM 14w3) at different passages is compared. The first image in the upper left corner shows the cell morphology of isolated bone marrow cells after 7 days of in vitro induction with porcine GM-CSF. The subsequent images show immortalized porcine bone marrow macrophages at passages 10, 20, 30, 40, 50, 60, and 70, respectively. It can be seen that IPBM 14w3 still maintains a cell morphology similar to that of primary porcine bone marrow macrophages. RNA extracted from IPBM 14w3 cells at different passages and detected by RT-PCR showed that all expressed SV40LT.

[0063] Immortalized porcine bone marrow IPBM 14w3 cells were used to detect macrophage-specific cell surface molecules: CD14, CD16, CD163, CD172a, CD203a, and CD169. Primary antibodies were obtained from BIO-RAD (CD14 Catalog No. MCA1218GA, CD16 Catalog No. MCA1971GA, CD163 Catalog No. MCA2311GA, CD172a Catalog No. MCA2312GA, CD203a Catalog No. MCA1973GA, and CD169 Catalog No. MCA2316GA). FITC-labeled secondary antibodies were obtained from Invitrogen (Catalog No. A11001). The flow cytometry results are shown in Figure 3 . All porcine bone marrow cells IPBM 14w3 expressed CD14, CD16, CD163, CD172a, CD203a, and CD169, indicating that IPBM 14w3 is a mature macrophage.

[0064] Immortalized porcine bone marrow cells IPBM 14w3 were subcutaneously inoculated into 4-week-old balb / c nude mice, with 10 7The researchers observed the nude mice for two months. As shown in Figure 4A, no tumors formed on the nude mice after inoculation with IPBM 14w3 cells, and no abnormalities were observed after autopsy. In contrast, the positive control group, inoculated with mouse myeloma SP2 / 0 cells, developed distinct tumor nodules 13 days after inoculation; the negative control group, inoculated with primary chicken embryo fibroblasts (CEFs), did not form tumors. Therefore, IPBM 14w3 cells are not tumorigenic.

[0065] Immortalized porcine bone marrow cells (IPBM) 14w3 at passage 63 were prepared using standard chromosome preparation techniques. Following colchicine pretreatment, fixation, staining, preparation, microscopic examination, and photography, clear images containing metaphase chromosomes were obtained, as shown in Figure 4B. Images with high cell dispersion and clear chromosome numbers were selected, and chromosomes from 50 cells containing clear mitotic metaphases were counted. Chromosome count analysis revealed that the chromosome number of IPBM 14w3 cells, 2n ≈ 38, is similar to that of normal porcine somatic cells. Therefore, IPBM 14w3 cells possess a normal karyotype.

[0066] Example 2 Construction of a porcine bone marrow macrophage cell line stably expressing Cre protein

[0067] 1) Immortalized porcine bone marrow macrophages (IPBM) 14w3 obtained in step 1.3 of Example 1 were electroporated using the same procedure as in step 1.2 of Example 1. Each tube of cells was electroporated with pTEG-Cre-IRES2-NeoR and pSB16 (the map of the pTEG-Cre-IRES2-NeoR vector is shown in Figure 1). Immediately after the electroporation, the cells were transferred to a 12-well plate containing growth medium and gently pipetted to mix.

[0068] 2) Incubate at 37°C, 5% CO2 for 24 hours, add selection medium containing G418 (100 μg / mL), and continue incubation;

[0069] 3) Observe cell survival every day and replace the screening medium every 3 days;

[0070] 4) Maintaining the culture until cells with good survival are obtained, performing limiting dilution of cells in the surviving wells to obtain cell clones, and gradually expanding the culture, as in step 1.3 of Example 1;

[0071] 5) RT-PCR detection was used to identify the expression of the Cre gene in each cloned cell, and a porcine macrophage cell line stably expressing the Cre gene was obtained.

[0072] Results: Three porcine bone marrow cell lines stably expressing Cre were obtained, named IPBM14w3-Cre-1, IPBM14w3-Cre-2, and IPBM14w3-Cre-3. As shown in Figure 5, Western blot analysis showed that all three cell lines could express exogenous proteins of approximately 38 kDa, indicating that all three cell lines could effectively express Cre protein.

[0073] Note: IPBM14w3-Cre-1 is porcine bone marrow macrophage IPBM14w3-Cre, and its accession number is CCTCC NO: C2023178.

[0074] Example 3 Removal of the selection marker in pseudorabies virus gene-deleted recombinant virus by expressing Cre protein

[0075] 3.1 Construction of recombinant pseudorabies virus gE gene deletion virus

[0076] The porcine pseudorabies virus gE gene-deficient recombinant strain JSY7ΔgE-LoxP-RFP used in this patent is a JSY7 strain (JSY7 genome sequence GeneBank accession number MT150583.1) that lacks a portion of the gE encoding gene (nucleotide sequences 124465 to 125483 of sequence number MT150583.1). It also carries the selectable marker gene, the red fluorescent gene TurboRFP, and carries the DNA sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT, with co-oriented LoxP sites at either end. The gE gene-deficient recombinant virus is constructed using conventional methods for constructing viral gene-deficient recombinant viruses, such as those disclosed in patent documents CN114657151A, CN113249341A, or CN104830810A.

[0077] 3.2 Removal of selection marker genes from gene-deleted recombinant viruses

[0078] 1) Cell inoculation: The Cre gene-expressing pig bone marrow macrophages IPBM14w3-Cre-1 obtained in Example 2 were inoculated into 6-well plates, with 10 cells per well. 6 cells, cultured overnight at 37°C in 5% CO2;

[0079] 2) Virus inoculation: The porcine pseudorabies virus gE gene-deficient recombinant strain JSY7ΔgE-LoxP-RFP constructed in step 3.1 was inoculated into a 6-well plate at an infection dose of 0.1;

[0080] 3) Virus culture collection: Observe the red fluorescence and cytopathic effects of the cell wells after virus inoculation daily until more than 80% of the cells in the wells show obvious cytopathic effects or even die and fall off. Collect the virus culture and divide it into two aliquots. One aliquot is frozen and thawed three times, centrifuged at 10,000 rpm for 5 minutes, and the supernatant is collected and stored at -80°C until further use. The other aliquot is used to collect cells and extract the genome.

[0081] 4) Seeding cells: Same as step 1) Seed IPBM14w3-Cre-1 cells in 6-well plates, 10 cells per well. 6 cells, cultured overnight at 37°C in 5% CO2;

[0082] 5) Virus inoculation: The virus solution collected in step 3) was inoculated into the cells of a 6-well plate at 100 μl / well;

[0083] 6) Fluorescence observation: Observe the red fluorescence and pathological changes of the virus-inoculated cell wells for three consecutive days.

[0084] The experimental results are shown in Figure 6. "P1" in Figure 6A represents the first infection of IPBM14w3-Cre-1 cells with the gE gene-deficient recombinant virus JSY7ΔgE-LoxP-RFP in step 3). Three days later, a small number of red fluorescent cells were still visible. The first-generation virus solution was collected and reinfected with IPBM14w3-Cre-1 using the same method. As shown in "P2" in Figure 6A, no cells expressing red fluorescence were observed. Furthermore, as shown in Figure 6A, the parental cells IPBM14w3 infected with the wild-type virus JSY7 did not express fluorescent protein, but red fluorescence was still observed after repeated infection with JSY7ΔgE-LoxP-RFP. Primers were designed on both sides of the gE gene (forward primer: 5'-CCGGGAAGATAGCCATGGTG-3'; back primer: 5'-CGTCACCGTCGTAGTAGTCCTCG-3') and PCR amplification was performed. The results of nucleic acid electrophoresis are shown in Figure 6B. The genomic sample of the parental cell IPBM 14w3 infected with the wild-type virus JSY7 amplified a band of 1834 bp, which was consistent with expectations; the genomic sample of the parental cell IPBM 14w3 infected with JSY7ΔgE-LoxP-RFP amplified a band of 3339 bp, which was consistent with expectations; the genomic sample of the IPBM14w3-Cre-1 cell line infected with JSY7ΔgE-LoxP-RFP for the first time only amplified a band of 1074 bp, which was consistent with expectations, indicating that the Cre / LoxP recombinase system is fully functional and the Cre protein in the cell line successfully removes the selection marker in the gE-deficient recombinant virus - the red fluorescent protein gene. Therefore, the cell line IPBM14w3-Cre-1 stably expressing the Cre gene only needs a single infection with the deletion recombinant virus to successfully remove the selection marker gene.

[0085] To compare the efficiency of removing marker genes from gene-deleted recombinant viruses using conventional transient transfection to express Cre and the IPBM14w3-Cre-1 cell line provided by the present invention, the parental cell line IPBM 14w3 was electroporated with the Cre eukaryotic expression vector pcDNA3-Cre according to the electroporation method described in 1.2 of Example 1. 24 hours later, the gE gene-deleted recombinant virus strain JSY7ΔgE-LoxP-RFP was inoculated. 48 hours later, the cell genome was extracted and tested using the PCR amplification method described in Example 3. The results of nucleic acid electrophoresis are shown in Figure 7. The sample infected with JSY7ΔgE-LoxP-RFP in IPBM14w3-Cre-1 cells only amplified a single band of 1074 bp, while the sample infected with JSY7ΔgE-LoxP-RFP in IPBM 14w3 cells after electroporation with pcDNA3-Cre still amplified two bands of 3339 bp and 1074 bp. Therefore, the IPBM 14w3-Cre-1 cell line can not only efficiently remove the missing recombinant virus selection marker, but also is easy to operate, avoiding the repeated virus purification steps.

[0086] In summary, the method provided by the present invention constructs immortalized porcine bone marrow macrophages with normal karyotype, no tumorigenicity, no drug resistance genes, and high expression of macrophage-specific surface molecules, resulting in a mature porcine macrophage cell line. This cell line can also be used to construct stably expressing cell lines, such as a porcine bone marrow macrophage cell line expressing the Cre gene, effectively removing the selection marker in gene-deletion recombinant viruses, facilitating the construction of gene-deletion vaccines.

[0087] The above are preferred embodiments of the present invention. It should be noted that those skilled in the art may modify or substitute equivalents for the technical solutions described in the aforementioned embodiments. Any modifications and substitutions made within the spirit and principles of the present invention shall be included in and considered within the scope of protection of the present invention.

Claims

1. An immortalized porcine bone marrow macrophage, characterized in that: The immortalized porcine bone marrow macrophages are Porcine bone marrow macrophages IPBM 14w3 were deposited in China Center for Type Culture Collection on June 7, 2023, with the deposit address: Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C2023157; Or porcine bone marrow macrophage IPBM14w3-Cre was deposited in China Center for Type Culture Collection on June 20, 2023, with the deposit address: Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C2023178.

2. A method for constructing the immortalized porcine bone marrow macrophages according to claim 1, characterized in that: The following steps are involved: (1) Obtaining the femur and tibia of a pig, isolating bone marrow cells, inducing and culturing them into macrophages in vitro, and then digesting and collecting them; (2) introducing the transposon vector and transposase vector containing the SV40LT gene into primary porcine bone marrow macrophages by electroporation; The transposon vector of the SV40LT gene includes the nucleotide sequence shown in the CDS region of the "large T antigen" gene in GenBank accession number NC_001669.1; (3) The surviving cells were subjected to limiting dilution method to select monoclonal cell lines, and then serially subcultured to obtain immortalized porcine bone marrow cells IPBM 14w3; (4) The Cre gene was introduced into pig bone marrow macrophages IPBM14w3-Cre.

3. The method according to claim 2, characterized in that Step (4) Pig bone marrow macrophage IPBM14w3-Cre is prepared by the following steps: A transposon vector and a transposase vector containing the Cre gene were introduced into immortalized porcine bone marrow macrophages IPBM 14w3 by electroporation; the transposon vector of the Cre gene included the nucleotide sequence shown in the CDS region of the "Cre" gene in GenBank accession number NC_005856.1; after electroporation, positive clone cell lines were screened using G418 selective culture medium to obtain porcine bone marrow macrophages IPBM14w3-Cre that stably expressed Cre.

4. Use of the immortalized porcine bone marrow macrophages according to claim 1 in isolating and culturing adapted viruses or preparing vaccines.

Images