Azotobacter and use thereof

Abstract

The present invention relates to the technical field of microorganisms, in particular to an azotobacter and the use thereof. The azotobacter comprises Kosakonia LWNF014 and / or Klebsiella variicola LWNK004, the Kosakonia LWNF014 being screened from farmlands of Gongzhuling, Jilin province, the accession number thereof being CGMCC No. 28352, the Klebsiella variicola LWNK004 being screened from farmlands of Gongzhuling, Jilin province, and the accession number thereof being CGMCC No. 28351. The strains have a nitrogen fixation capability, can form efficient interactions with corn, and can accelerate the growth process of corn and improve the content of chlorophyll in leaves. An efficient microbial agent prepared from the related strains has the advantages of low production cost, simple operation, no secondary pollution to soil, etc.

Description

Nitrogen-fixing bacteria and their applications

[0001] Cross-references

[0002] This application is based on the Chinese patent application with application number 202311268005.8 and application date on September 28, 2023, and the Chinese patent application with application number 202311277829.1 and application date on October 7, 2023, and claims the priority of the above-mentioned Chinese patent applications. The entire contents of the above-mentioned Chinese patent applications are hereby introduced into this application as a reference. Technical Field

[0003] The present invention relates to the field of microbial technology, in particular to nitrogen-fixing bacteria and applications thereof. Background Art

[0004] Soil microorganisms, including bacteria, fungi, and actinomycetes, are numerous and diverse, each performing distinct functions in the soil. Some microorganisms can cause plant diseases, known as plant pathogens, while others can promote plant growth, known as plant growth-promoting microorganisms. In recent years, as global environmental and climate challenges have become increasingly severe, countries are increasingly focused on and demanding green, environmentally friendly, and low-carbon industries. These plant growth-promoting microorganisms are gaining increasing attention and favor in modern agriculture. As a new type of fertilizer for improving crop growth, their sustainability and soil-friendly properties are unmatched by traditional chemical fertilizers. Furthermore, microbial fertilizers offer significant advantages such as a gentle production process, low energy consumption, and minimal pollution, holding significant advantages and potential in the fertilizer sector. Plant growth-promoting bacteria have diverse mechanisms of action on crop growth. Some fix nitrogen and dissolve phosphate, providing plants with nitrogen and phosphorus, while others inhibit the growth of plant pathogens, protecting crops from soilborne diseases. Regardless of the mechanism, the ability of plant growth-promoting bacteria to colonize plants directly impacts their effectiveness. Growth-promoting bacteria with strong colonization ability and long colonization time usually have better growth-promoting effects.

[0005] Nitrogen is one of the three essential nutrients for plant growth and development. It is not only a crucial component of proteins, nucleic acids, and chlorophyll in plants, but also a component of numerous enzymes. It is also a constituent of several vitamins and alkaloids in plants. Numerous studies have shown that the amount of nitrogen fertilizer applied during crop growth directly affects crop growth and ultimate yield, and also significantly influences crop physiological metabolism. Traditional fertilization, often characterized by excessive use of chemical fertilizers to increase yields, has, is, and will continue to cause a series of negative impacts, including soil compaction, altered physical and chemical properties, the mortality of beneficial bacteria and earthworms, and the over-accumulation of certain elements. In the short term, these negative impacts directly result in decreased crop yields and increased environmental pollution. In the long term, excessive use of chemical fertilizers reduces the soil's ability to regenerate and recycle fertility, necessitating even greater use of chemical fertilizers, creating a vicious cycle. Therefore, exploring green and pollution-free alternatives to current chemical fertilizer applications through microbial technology is crucial for sustainable agricultural development. Nitrogen-fixing bacteria exist naturally in nature, especially in soil. Through their nitrogen-fixing function, they convert elemental nitrogen in the air into ammonium ions that plants can use, providing nitrogen fertilizer for them. Attempts have been made to isolate highly efficient nitrogen-fixing strains from soil microbial communities that can coexist with crops, partially or completely replacing industrial nitrogen fertilizers to support crop growth. However, most known nitrogen-fixing bacteria have weak nitrogen-fixing abilities and a limited effect on plant growth, making them unsuitable as a supplement or replacement for industrial nitrogen fertilizers.

[0006] In summary, screening native nitrogen-fixing strains that have a growth-promoting effect on plants from the soil as microbial fertilizers to partially or completely replace chemical fertilizers to improve plant growth and development, while achieving stable and increased plant yields without destroying or even improving the ecological environment of the soil, has huge demand potential.

[0007] Summary of the Invention

[0008] The object of the present invention is to provide a strain with nitrogen-fixing function and related applications thereof, wherein the strain comprises Kosakonia sacchari LWNF014 and / or Klebsiella variicola LWNF004.

[0009] Another object of the present invention is to provide a strain having a growth-promoting effect on plants, wherein the strain comprises Kosakonia sacchari LWNF014 and / or Klebsiella variicola LWNF004.

[0010] Preferably, the strain can stably colonize corn roots for more than 2 months.

[0011] Another object of the present invention is to provide Kosakonia sacchari LWNF014 and / or Klebsiella variicola LWNF004 having one or more of the above capabilities and related applications thereof.

[0012] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0013] A strain of Kosakonia LWNF014 was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on September 4, 2023, with the deposit number CGMCC No. 28352 and the classification name Kosakonia sacchari.

[0014] The Kosakonia sacchari strain LWNF014 described in this invention was obtained through multiple screening experiments from the rhizosphere and rhizosphere soil of corn plants in Gongzhuling, Jilin Province. It is capable of growing in nitrogen-free medium and possesses nitrogen fixation. Sequencing of the 16S rRNA gene encoding this strain revealed the sequence shown in SEQ ID NO. 1. Based on the results of the aforementioned physiological and biochemical tests, this strain was identified at the molecular level as belonging to the genus Kosakonia and designated Kosakonia sacchari.

[0015] Corn colonization experiments have shown that the Kosakonia sacchari strain LWNF014 has the effect of enhancing the chlorophyll content of corn, increasing the nitrogen content of leaves, and increasing the biomass of corn.

[0016] A strain of Klebsiella variicola LWNF004 was deposited at the General Microbiology Center of the China Culture Collection Administration (address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on September 4, 2023, and was classified and named Klebsiella variicola, with the deposit number CGMCC No. 28351.

[0017] The Klebsiella variicola strain LWNF004 described in this invention was obtained through multiple screening experiments from the rhizosphere and rhizosphere soil of corn plants in Gongzhuling, Jilin Province. It is capable of growth in nitrogen-free medium, and acetylene reduction experiments demonstrate its ability to fix nitrogen. Sequencing of the 16S rRNA gene encoding the strain yielded the sequence shown in SEQ ID NO. 4. Based on the aforementioned physiological and biochemical test results, the strain was identified at the molecular level as Klebsiella variicola.

[0018] Corn colonization experiments have shown that the Klebsiella variicola LWNF004 (Klebsiella variicola) can stably colonize corn roots for more than 2 months and has the effect of promoting corn root growth.

[0019] The present invention provides a Kosakonia sacchari strain LWNF014. The deposit number of the Kosakonia sacchari strain LWNF014 is CGMCC No.28352.

[0020] The present invention provides a strain of Klebsiella variicola LWNF004 (Klebsiella variicola). The preservation number of the strain of Klebsiella variicola LWNF004 (Klebsiella variicola) is CGMCC No. 28351.

[0021] The present invention provides use of a strain in promoting plant growth. The strain comprises the above-mentioned Kosakonia sacchari LWNF014 and / or the above-mentioned Klebsiella variicola LWNF004.

[0022] Preferably, the plants can be crops, including food crops and cash crops; optionally, the cash crops include oil crops and vegetable crops; the food crops include cereal crops, tuber crops, and edible bean crops; further preferably, the crops are vegetable crops, including corn, beans, cucumbers or peppers, more preferably corn.

[0023] Preferably, the Klebsiella coryza LWNF014 and / or Klebsiella mutans LWNF004 can enhance nitrogen fixation and promote photosynthesis, increase chlorophyll content or promote plant growth.

[0024] Preferably, the promoting plant growth includes promoting the growth of plant roots or promoting the growth of above-ground parts of plants.

[0025] Preferably, the Cossackia sp. LWNF014 can improve nitrogen fixation, promote photosynthesis, and increase chlorophyll content.

[0026] Preferably, the Klebsiella mutans LWNF004 stably colonizes the plant roots for more than 2 months, providing nitrogen source nutrition for the plants and promoting the clustering effect of plant root growth.

[0027] The present invention provides use of the above-mentioned Kosakonia sacchari LWNF014 and / or the above-mentioned Klebsiella variicola LWNF004 as nitrogen-fixing bacteria.

[0028] The present invention further provides a microbial nitrogen-fixing agent, wherein the microbial agent contains the aforementioned Cossackia LWNF014 and / or the aforementioned Klebsiella mutans LWNF004.

[0029] Preferably, the microbial nitrogen-fixing agent can be applied to plants as a fertilizer, and the plants are preferably crops.

[0030] Preferably, the crops include food crops and cash crops; optionally, the cash crops include oil crops and vegetable crops; the food crops include cereal crops, tuber crops, and edible bean crops; further preferably, the crops are vegetable crops, and the vegetable crops include corn, beans, cucumbers or peppers, more preferably corn.

[0031] In the above-mentioned bacterial agent, the effective viable count of the Cossackia LWNF014 is preferably 10 10 ~10 11 CFU / g.

[0032] In the above-mentioned bacterial agent, the effective viable cell count of the Klebsiella variicola LWNF004 is preferably 10 10 ~10 11 CFU / g.

[0033] The above-mentioned microbial agent can be prepared by conventional preparation methods in the art, and can be in various forms, such as liquid agent or solid agent, preferably solid agent.

[0034] The solid bacterial agent is preferably prepared by fermentation and freeze-drying.

[0035] The present invention further provides a plant growth-promoting microbial agent, which contains the above-mentioned Cossackia LWNF014 and / or the above-mentioned Klebsiella mutans LWNF004.

[0036] Preferably, the microbial growth-promoting agent can be applied to plants as a fertilizer, and the plants are preferably crops.

[0037] Preferably, the crops include food crops and cash crops; optionally, the cash crops include oil crops and vegetable crops; the food crops include cereal crops, tuber crops, and edible bean crops; further preferably, the crops are vegetable crops, and the vegetable crops include corn, beans, cucumbers or peppers, more preferably corn.

[0038] In the above-mentioned bacterial agent, the effective viable count of the Cossackia LWNF014 is preferably 10 10 ~10 11 CFU / g.

[0039] In the above-mentioned bacterial agent, the effective viable cell count of the Klebsiella variicola LWNF004 is preferably 10 10 ~10 11 CFU / g.

[0040] The above-mentioned microbial agent can be prepared by conventional preparation methods in the art, and can be in various forms, such as liquid agent or solid agent, preferably solid agent.

[0041] The solid bacterial agent is preferably prepared by fermentation and freeze-drying.

[0042] The present invention provides a method for preparing a microbial agent, comprising activating the above-mentioned Cossackia LWNF014 and / or the above-mentioned Klebsiella mutans LWNF004 to prepare a seed liquid, which is then inoculated into a fermentation medium for expansion and culture to a stable phase, and is separated to obtain the microbial agent.

[0043] The present invention provides a method for preparing freeze-dried powder bacterial fertilizer. The method comprises the following steps: centrifuging a fermentation broth obtained by fermenting the above-mentioned Klebsiella pneumoniae LWNF014 and / or the above-mentioned Klebsiella variegata LWNF004 to obtain a bacterial precipitate, adding a freeze-drying protective agent, and freeze-drying the broth under sterile conditions to prepare the freeze-dried powder.

[0044] Preferably, the freeze-drying protective agent is prepared by mixing skimmed milk powder, sodium glutamate, glycerol, sucrose and water in a mass ratio of 75:15:70:10:330.

[0045] The effective viable count of the freeze-dried powder of Cossackia LWNF014 and / or Klebsiella variegata LWNF004 is 10 10 ~10 11 CFU / g, and can be stored at room temperature for 6 months without loss of activity.

[0046] The present invention provides a plant photosynthesis improver, which comprises the above-mentioned Cossackia LWNF014 and / or the above-mentioned Klebsiella variegata LWNF004, or the above-mentioned microbial agent, the above-mentioned plant growth-promoting microbial agent, the above-mentioned microbial nitrogen-fixing agent, or the microbial agent prepared by the above-mentioned method.

[0047] The present invention provides a plant nitrogen nutrition improver, which comprises the above-mentioned Cossackia LWNF014 and / or the above-mentioned Klebsiella variegata LWNF004, or the above-mentioned microbial agent, the above-mentioned plant growth-promoting microbial agent, the above-mentioned microbial nitrogen-fixing agent, or the microbial agent prepared by the above-mentioned method.

[0048] The present invention provides a plant growth and development promoter, which comprises the above-mentioned Klebsiella pneumoniae LWNF014 and / or the above-mentioned Klebsiella variegata LWNF004, or the above-mentioned microbial agent, the above-mentioned plant growth-promoting microbial agent, the above-mentioned microbial nitrogen-fixing agent, or the microbial agent prepared by the above-mentioned method.

[0049] Strain deposit information:

[0050] 1) Strain LWNF014

[0051] Depository: China General Microbiology Center (CGMCC);

[0052] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0053] Accession number: CGMCC No.28352;

[0054] Deposit date: September 4, 2023;

[0055] Taxonomic nomenclature: Kosakonia sacchari.

[0056] 2)LWNF004

[0057] Depository: China General Microbiology Center (CGMCC);

[0058] Address of the depository: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0059] Accession number: CGMCC No.28351;

[0060] Deposit date: September 4, 2023;

[0061] Classification name: Klebsiella variicola. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] FIG1 is an electrophoretic diagram of the nifH gene on the genome of Cossackia LWNF014 detected by colony PCR.

[0063] FIG2 shows the effect of Korsakoffia LWNF014 on the growth of corn seedlings after 7 days of treatment.

[0064] FIG3 shows the effect of Korsakoffella LWNF014 treatment on the growth of corn seedlings after 14 days.

[0065] Figure 4 shows the effects of Korsakoffella LWNF014 treatment on chlorophyll and nitrogen content in corn seedlings after 7 days.

[0066] Figure 5 shows the effects of Korsakoffella LWNF014 treatment on chlorophyll and nitrogen content in corn seedlings after 14 days.

[0067] Figure 6 is a schematic diagram of the bacterial agent preparation process.

[0068] FIG7 shows the effect of Klebsiella variicola LWNF004 on the fresh weight of corn roots.

[0069] FIG8 is a picture of corn root samples in an experiment for detecting the abundance of Klebsiella variicola LWNF004 in corn roots.

[0070] FIG9 is a fluorescence colorimetric plate image of the abundance detection experiment of Klebsiella variicola LWNF004 in corn roots. DETAILED DESCRIPTION

[0071] The present invention is further described below with reference to specific examples. Where specific experimental conditions are not specified, they are based on conventional conditions well known to those skilled in the art.

[0072] Example 1 Screening and Application of Nitrogen-Fixing Corsaccharomyces LWNF014

[0073] 1 Screening of nitrogen-fixing Corsaccharomyces cerevisiae LWNF014

[0074] Soil and corn root samples were collected from corn fields in Gongzhuling, Jilin Province, transported to the laboratory at low temperatures, and plated on nitrogen-free KPM medium (see Table 1 for the medium recipe). Single colonies were picked from the plates and re-streaked onto nitrogen-free KPM plates for purification. The 16s rRNA encoding gene was amplified by PCR and sequenced. Sequence comparison identified one strain, LWNF014, as belonging to the genus Kosakonia sacchari. The 16s rRNA encoding gene sequence of this strain is shown in SEQ ID NO. 1.

[0075] Table 1 KPM nitrogen-free culture medium formula

[0076] 2 Identification of nitrogen-fixing genes of the nitrogen-fixing strain Cossackia LWNF014

[0077] Colony PCR was performed on Klebsiella pneumoniae LWNF014 using the specific primers for the nitrogen-fixing gene nifH, Ks nifH-F: tcatcaataacaatccctgcgacgc (SEQ ID NO. 2); KsnifH-R: acccttcgcaccgcaccggaataac (SEQ ID NO. 3). The electrophoresis results of the PCR products ( FIG1 ) showed that a specific band of approximately 2037 bp in length was amplified, which is consistent with the size of nifH of Klebsiella variegata, indicating that this strain carries the nitrogen-fixing gene nifH ( FIG1 ).

[0078] 3. Determination of nitrogenase activity of nitrogen-fixing strain Cossackia LWNF014

[0079] The strain in the logarithmic growth phase was transferred to LB liquid medium and cultured overnight in a shaker at 30°C and 220RPM. The OD value of the strain was measured using a spectrophotometer. 600 Afterwards, the cells were collected by centrifugation at 5500 rpm for 5 minutes, washed three times with nitrogen-free KPM medium, and then suspended in nitrogen-free KPM medium to adjust the OD600 to 0.2. 2 ml of bacterial solution was added to each anaerobic tube. An anaerobic tube containing 2 ml of nitrogen-free KPM was used as a control (no bacteria). The tubes were sealed with stoppers and caps. 2 ml of acetylene gas was injected into the tubes, shaken evenly, and then placed in a 30°C incubator for 16 hours. 1 ml of gas was withdrawn from each anaerobic tube using a microinjector and injected into a gas chromatograph to measure ethylene content.

[0080] Table 2 Amount of ethylene produced in the nitrogenase activity assay

[0081] The test results in Table 2 show that when LWNF014 was added to the anaerobic tube, it catalyzed the conversion of acetylene to ethylene, while no ethylene production was detected in the uninfected control group. Based on the actual measured acetylene standard gas concentration / area ratio, the nitrogenase activity of LWNF014 was calculated to be 0.35 nmol C2H4 / h vial, which fully demonstrates that LWNF014 has high nitrogen fixation activity.

[0082] 4. Effects of Cossaccharomyces cerevisiae LWNF014 on corn growth

[0083] The Korsakoff bacteria LWNF014 was inoculated into LB medium and cultured at 30°C and 220RPM for 16 h. The cells were collected by centrifugation at 5500 rpm for 5 min, the supernatant was discarded, and the concentration was adjusted to 10% with sterile PBS. 9 CFU / ml. Plant corn seeds in a 50ml centrifuge tube, add 200 microliters of the prepared bacterial suspension to the experimental group, and then add 10 ml of sterile water (the right centrifuge tube in Figures 2 and 3). Add 200 microliters of sterile PBS and 10 ml of sterile water to the control group (the left centrifuge tube in Figures 2 and 3). Repeat 4 groups for each of the two treatments. Thereafter, water 5 ml every other day. Three weeks after planting, the chlorophyll content of corn (ie, SPAD value) was measured with a chlorophyll meter to characterize its photosynthetic capacity. Since the SPAD value has a specific proportional relationship with the nitrogen content of the plant, the nitrogen content of the leaves can be calculated.

[0084] Corn growth is shown in Figures 2 and 3 and Table 3. At 7 days of incubation, corn seedlings in the experimental group treated with the K. corylifolia LWNF014 suspension reached 20 cm in height, while those in the control group, which did not receive the suspension, reached 15 cm. This represents a 33% increase in height and a significantly larger diameter. By 14 days, the experimental group had reached the four-leaf stage, while the control group was still at the three-leaf stage. The height and diameter advantage of the experimental group over the control group continued to increase, reaching 139% of the control group, a gap that widened further compared to the 7-day incubation period. These results demonstrate that K. corylifolia LWNF014 accelerates corn seedling growth, increasing both height and size, while also shortening the corn growth cycle.

[0085] Table 3 Statistics of height and diameter of corn seedlings

[0086] The results in Figures 4 and 5 show that at 7 days of incubation, the average chlorophyll content of corn seedlings in the control group without bacterial application was 37 SPAD, and the average leaf nitrogen content was 14 mg / g. In contrast, the corn seedlings in the experimental group treated with the Korsakoffia LWNF014 bacterial suspension had a chlorophyll content of 43.8 SPAD and a leaf nitrogen content of 16 mg / g, representing increases of 18% and 14%, respectively, compared to the control group. At 14 days of incubation, the chlorophyll content of the corn seedlings in the control group without bacterial application was 29 SPAD, and the leaf nitrogen content was 12 mg / g. In contrast, the corn seedlings in the experimental group treated with the Korsakoffia LWNF014 bacterial suspension had a chlorophyll content of 38.5 SPAD and a leaf nitrogen content of 14 mg / g, representing increases of 32% and 16%, respectively, compared to the control group. These results demonstrate that the application of Korsakoffia LWNF014 enhances chlorophyll storage and nitrogen accumulation in corn seedlings, promoting their growth.

[0087] 5. Preparation of microbial fertilizer

[0088] In order to facilitate storage and transportation, the Corsacella LWNF014 screened in step 2 was prepared into freeze-dried powder fertilizer. Specifically (see Figure 6 for the preparation process):

[0089] (1) The fermentation broth of Cossackia LWNF014 was centrifuged to obtain bacterial precipitate.

[0090] (2) Skimmed milk powder, sodium glutamate, glycerol, sucrose and water were mixed in a mass ratio of 75:15:70:10:330 to prepare a freeze-drying protective agent.

[0091] (3) Add the freeze-dried protective agent to the bacterial precipitate obtained in the above step (1) at a mass ratio of 1:1, allow the bacterial cells and the protective agent to be fully mixed and equilibrated for 60 minutes, and freeze at -20°C overnight.

[0092] (4) Freeze-drying is performed under sterile conditions to prepare freeze-dried powder for later use.

[0093] The effective viable count of the freeze-dried powder of Cossackia LWNF014 is 10 10 ~10 11 CFU / g, and can be stored at room temperature for 6 months without loss of activity.

[0094] Example 2 Screening and Application of Nitrogen-Fixing Klebsiella Mutans LWNF004

[0095] 1 Screening of nitrogen-fixing Klebsiella variegata LWNF004

[0096] Soil and corn root samples were collected from farmland in Gongzhuling, Jilin Province, transported to the laboratory at low temperature, and plated on nitrogen-free KPM medium (see Table 4 for the medium recipe). Single colonies were picked from the plates and re-streaked onto nitrogen-free KPM medium for purification. The 16s rRNA encoding gene was amplified by PCR and sequenced. Sequence comparison revealed one strain, LWNF004, which was identified as Klebsiella variicola. The 16s rRNA encoding gene sequence of this strain is shown in SEQ ID NO. 4.

[0097] Table 4KPM nitrogen-free culture medium formula

[0098] 2. Identification of nitrogen-fixing ability of Klebsiella variegata LWNF004

[0099] The nitrogen fixation activity of Klebsiella mutans LWNF004 was detected using the acetylene reduction method commonly used in the art.

[0100] The strain in the logarithmic growth phase was transferred to LB liquid medium and cultured overnight in a shaker at 30°C and 220RPM. The OD value of the strain was measured using a spectrophotometer. 600 Afterwards, the cells were collected by centrifugation at 5500 rpm for 5 minutes, washed three times with nitrogen-free KPM medium, and then suspended in nitrogen-free KPM medium to adjust the OD600 to 0.2. 2 ml of bacterial solution was added to each anaerobic tube. An anaerobic tube containing 2 ml of nitrogen-free KPM was used as a control (no bacteria). The tubes were sealed with stoppers and caps. 2 ml of acetylene gas was injected into the tubes, shaken evenly, and then placed in a 30°C incubator for 16 hours. 1 ml of gas was withdrawn from each anaerobic tube using a microinjector and injected into a gas chromatograph to measure ethylene production.

[0101] Table 5 Ethylene production in nitrogenase activity assay

[0102] The results in Table 5 indicate that Klebsiella variicola LWNF004 catalyzes the conversion of acetylene to ethylene when added to the anaerobic tube, whereas no ethylene production was detected in the uninfected control group. Based on the measured acetylene standard gas concentration / area ratio, the nitrogenase activity of Klebsiella variicola LWNF004 was calculated to be 8.8 nmol C2H4 / h vial. These results demonstrate that Klebsiella variicola LWNF004 has high nitrogen fixation activity.

[0103] 3. Effects of Klebsiella variegata LWNF004 on corn roots.

[0104] The Klebsiella variegata LWNF004 was inoculated into LB medium and cultured at 30°C and 220RPM for 16 h. The cells were collected by centrifugation at 5500 rpm for 5 min, the supernatant was discarded, and the concentration was adjusted to 10 9 CFU / ml. Corn seeds were planted in a greenhouse and 1000 μL of the prepared bacterial suspension was added, followed by 10 mL of sterile water. The control group (CK) was treated with 1000 μL of sterile PBS and 10 mL of sterile water. Four replicates were performed for each of the two treatments. Seven weeks after planting, roots were harvested, the covering soil removed, and root fresh weight measured.

[0105] The results are shown in Figure 7. Seven weeks after planting, the fresh weight of corn roots in the control group not treated with K. mutans LWNF004 was 52 grams, while the fresh weight of corn roots in the experimental group treated with K. mutans LWNF004 was 111 grams, a 116% increase compared to the control group. These results demonstrate that this strain significantly promotes corn root growth.

[0106] 4. Determination of colonization abundance of Klebsiella variegata LWNF004.

[0107] Using gene editing methods, the Klebsiella variegata LWNF004 strain was labeled with a red fluorescent marker, and then the labeled strain was used for colonization experiments. The fluorescently labeled Klebsiella variegata LWNF004 was inoculated into LB medium and cultured at 30°C and 220 RPM for 16 hours. The cells were collected by centrifugation at 5500 rpm for 5 minutes, the supernatant was discarded, and the OD value was adjusted to 10 with sterile PBS. 9 CFU / ml. Plant corn seeds in a greenhouse, add 1000 microliters of the prepared bacterial suspension, then add 10 ml of sterile water, and repeat 4 times. After nine weeks of growth, take root samples (see Figure 8). For each root sample, take a mixed sample of 0.25g from the lateral roots, root tips, and middle roots. Add a certain proportion of sterile water to dilute the sample, break it with an oscillator, and then perform a gradient dilution of the stock solution to 10 -5 The cells were then spread on LB solid medium and cultured under aerobic conditions at 30°C for 2 days. They were then placed at 4°C for one day to wait for the red fluorescence to fully develop before counting (see Figure 9).

[0108] According to the fluorescence counting results, after nine weeks, the abundance of Klebsiella mutans in corn roots was still 5×10 4 CFU / root. The abundance of other Klebsiella diazotropha isolated at the same time only lasted for 3 weeks.

[0109] 5. Preparation of microbial agents

[0110] In order to facilitate storage and transportation, the screened Klebsiella mutans LWNF004 was prepared into a freeze-dried powder bacterial agent. The specific steps are as follows (the preparation process is the same as Figure 6):

[0111] (1) The fermentation broth of Klebsiella mutans LWNF004 was centrifuged to obtain bacterial precipitate.

[0112] (2) Skimmed milk powder, sodium glutamate, glycerol, sucrose and water were mixed in a mass ratio of 75:15:70:10:330 to prepare a freeze-drying protective agent.

[0113] (3) Add the freeze-dried protective agent to the bacterial precipitate obtained in the above step (1) at a mass ratio of 1:1, allow the bacterial cells and the protective agent to be fully mixed and equilibrated for 60 minutes, and freeze at -20°C overnight.

[0114] (4) Freeze-drying is performed under sterile conditions to prepare freeze-dried powder for later use.

[0115] The effective viable count of the Klebsiella mutans LWNF004 freeze-dried powder is 10 10 ~10 11 CFU / g, and can be stored at room temperature for 6 months without loss of activity.

[0116] Example 3 Effect of a combined bacterial agent of Klebsiella mutans LWNF004 and Korsakoffia coli LWNF014 on corn growth

[0117] Klebsiella mutans LWNF004 and Klebsiella coryza LWNF014 were inoculated into LB medium, cultured at 30°C and 220 RPM for 16 h, and centrifuged at 5500 rpm for 5 min to collect the cells. The supernatant was discarded and the OD value was adjusted to 2×10 with sterile PBS. 9 CFU / ml. Equal volumes of Klebsiella mutans LWNF004 and Klebsiella coryzae LWNF014 were mixed to form the mixed inoculum experimental group. Klebsiella mutans LWNF004 mixed with equal volumes of sterile PBS and Klebsiella coryzae LWNF014 mixed with equal volumes of sterile PBS served as the single-bacterial inoculum control group. Sterile PBS served as the sterile control group. Corn seeds were sown in a 50ml centrifuge tube. 200µl of the prepared bacterial suspensions were added to each of the experimental and single-bacterial inoculum control groups, followed by 10ml of sterile water. The sterile control group was treated with 200µl of sterile PBS and 10ml of sterile water. Four replicates were used for each treatment. Water was then applied every other day with 5ml of water. Two weeks after planting, the aboveground corn was harvested and fresh weight was measured.

[0118] Corn growth is shown in Table 6. After two weeks of cultivation, the aboveground fresh weight of corn plants in the experimental group treated with the combination of K. mutans LWNF004 and K. corysella LWNF014 was 1.40 grams, while the aboveground fresh weight of corn plants in the control group treated with K. mutans LWNF004 alone was 0.93 grams, the aboveground fresh weight of corn plants in the control group treated with K. mutans LWNF014 alone was 1.13 grams, and the aboveground fresh weight of corn plants in the sterile control group was 0.67 grams. Compared with the sterile control group, the aboveground fresh weight of corn plants treated with K. mutans LWNF004 alone, K. corysella LWNF014 alone, and the combination of K. mutans LWNF004 and K. corysella LWNF014 increased by 38.9%, 67.9%, and 109.0%, respectively. The plant height of the combined inoculum group increased by 50.5% and 23.9% respectively compared with the two single-bacteria control groups. The above results fully demonstrate that the combined inoculum of Klebsiella mutans LWNF004 and Korzakella coryzae LWNF014 can further promote the growth of corn.

[0119] Table 6 Effects of combined inoculants of Klebsiella mutans LWNF004 and Korzakella coryza LWNF014 on fresh weight of corn plants

[0120] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. A strain of Cossackia LWNF014, characterized in that Its classification name is Kosakonia sacchari and its preservation number is CGMCC No.28352.

2. A strain of Klebsiella mutans LWNF004, characterized in that: Its classification name is Klebsiella variicola, and its preservation number is CGMCC No.28351.

3. Use of a strain in promoting plant growth, characterized in that: The strains include the Cossackia sp. LWNF014 described in claim 1 and / or the Klebsiella variegata LWNF004 described in claim 2.

4. A use as claimed in claim 3, characterized in that The plants are crops, and the crops include food crops and cash crops; optionally, the cash crops include oil crops and vegetable crops; the food crops include cereal crops, potato crops, and edible bean crops; preferably, the crops are vegetable crops, and the vegetable crops include corn, beans, cucumbers or peppers.

5. A use according to claim 3 or 4, characterized in that: It can increase the nitrogen content of plants, promote photosynthesis, increase chlorophyll content or promote plant growth.

6. A microbial agent, characterized in that: The method comprises the Cossackia sp. LWNF014 according to claim 1 and / or the Klebsiella variegata LWNF004 according to claim 2.

7. A method for preparing the microbial agent according to claim 6, characterized in that: The Cossackia LWNF014 described in claim 1 and / or the Klebsiella mutans LWNF004 described in claim 2 are activated and prepared into seed liquid, which is then inoculated into a fermentation medium for expansion and culture until a stable period, and the microbial agent is obtained after separation.

8. A method for preparing the microbial agent according to claim 6, characterized in that: The freeze-dried powder bacterial fertilizer is prepared by centrifuging the fermentation liquid obtained by fermenting the Cossackia LWNF014 described in claim 1 and / or the Klebsiella mutans LWNF004 described in claim 2 to obtain bacterial precipitates, adding a freeze-drying protective agent, and freeze-drying under sterile conditions to prepare the freeze-dried powder.

9. A plant photosynthesis improver, characterized in that: It comprises the Cossackia LWNF014 according to claim 1 and / or the Klebsiella variegata LWNF004 according to claim 2, or the microbial agent according to claim 6, or the microbial agent prepared by any one of the methods of claims 7-8.

10. A plant nitrogen nutrition improver, characterized in that: It comprises the Cossackia LWNF014 according to claim 1 and / or the Klebsiella variegata LWNF004 according to claim 2, or the microbial agent according to claim 6, or the microbial agent prepared by any one of the methods of claims 7-8.

11. A plant growth promoter, characterized in that: It comprises the Cossackia LWNF014 according to claim 1 and / or the Klebsiella variegata LWNF004 according to claim 2, or the microbial agent according to claim 6, or the microbial agent prepared by any one of the methods of claims 7-8.

Images