Preparation method and application of targeted intracellular nanovesicle

Abstract

A preparation method and application of a targeted intracellular nanovesicle. The intracellular nanovesicle has a large yield, a small particle size and a narrow particle size distribution range, has higher encapsulation efficiency and drug loading efficiency when used as a carrier to load a drug, and has a wider distribution range and degree in a mode of intravitreal injection, for example, the drug loaded in the mode of intravitreal injection can be absorbed more quickly, and the intracellular nanovesicle has extremely good application and research value in the field of medicine. Particularly, targeting performance is given to the intracellular nanovesicle, and a targeting peptide is carried in the intracellular nanovesicle by modifying Lamp2b to obtain the intracellular nanovesicle having the targeting performance. The nanovesicle has a large yield and high targeting performance, can exert a therapeutic effect or a drug carrier effect more efficiently, and has an extremely good application prospect and research value.

Description

Preparation method and application of targeted nanovesicles derived from cells Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of targeted nanovesicles derived from cells, in particular to applications in eye diseases. Background Art

[0002] Cell secretions called "extracellular vesicles" (EVs), which are released by cells outside the cells or into the plasma and enter the blood circulation, have received widespread attention and research. "Extracellular vesicles" are mainly divided into three categories: exosomes, microvesicles or microparticles, and apoptotic bodies, among which the main component is exosomes. At present, exosomes are widely used in the treatment of various damage repair and immune diseases. However, the cell targeting of exosomes still needs to be further improved to reduce side effects and improve efficacy. Secondly, the efficiency of cell secretion of exosomes is limited, and collecting a certain amount of exosomes requires a lot of time. Therefore, further improving its targeting, biosafety and yield is a problem that needs to be solved in the future.

[0003] Modification strategies for cellular nanovesicles include genetic engineering and chemical modification. By genetically engineering, the gene sequence of a target protein or peptide can be fused with the gene sequence of a selected exosome surface protein, allowing the target protein or guide peptide to be expressed on the exosome surface. Lysosome-associated membrane protein 2b (Lamp2b), a member of the Lamp family, is a membrane protein that can be used to carry targeted proteins or peptides.

[0004] In addition, there are a large number of nanovesicles in the cell, which are free between various membrane-rich organelles and mediate the intracellular transport of substances and the cell's secretory pathway. Among them, constitutive secretory vesicles are the main type of intracellular vesicles (IVs). They are produced by the endoplasmic reticulum and exchange substances with the Golgi apparatus, lysosomes and cell membranes, mediating the production, transport and secretion of various secretory proteins in the cell. They are rich in content and contain a large number of secretory proteins, lipids and nucleic acid molecules. To date, there are no reports on how to enrich and apply intracellular nanovesicles. In addition, our previous results found that compared with EVs, these intracellular nanovesicles have smaller particle size, higher content of the transmembrane protein Lamp2b, higher drug delivery efficiency, and are more suitable for disease treatment and drug delivery.

[0005] Autoimmune uveitis is a common blinding eye disease that primarily affects the uvea and retina, causing a variety of ocular complications such as cataracts, glaucoma, macular degeneration, and optic atrophy, leading to severe vision loss. CD4-positive T helper cells (Th cells), particularly Th1 cells that secrete interferon-γ and Th17 cells that secrete IL-17A, are the primary effector T cells in autoimmune uveitis, and their aberrant activation plays a crucial role in the pathogenesis of the disease. CD40L, a member of the TNF superfamily, is considered an early activation marker for CD4+ T lymphocytes. CD40 / CD40L participates in triggering multiple downstream immune signaling pathways. Early studies have demonstrated that CD40 / CD40L costimulatory signaling is essential for the generation of T cell-dependent antibody responses and the differentiation of memory B cells. Activated CD40 / CD40L signaling in macrophages and DCs induces cytokine secretion and expression of surface activation molecules, regulating cross-stimulation and activation of CD4+ and CD8+ T cells. Dysregulation of the CD40 / CD40L signaling pathway is also present in various autoimmune diseases, potentially promoting the initiation or maintenance of pathogenic autoimmune responses. Therefore, targeting the CD40 / CD40L pathway is expected to become a new therapeutic strategy for autoimmune diseases.

[0006] Pathological retinal neovascularization (RNV) is a key pathological change in several common blinding retinal diseases, including diabetic retinopathy (DR), diabetic macular edema, retinal vascular occlusion, and retinopathy of prematurity (ROP). Current clinical treatments include intravitreal injections of anti-VEGF drugs, retinal photocoagulation, and vitrectomy. Although intravitreal anti-VEGF drugs can inhibit the further development of retinal and choroidal NV, their therapeutic efficacy remains controversial. Approximately 30% of patients do not respond well to anti-VEGF drug treatment, and laser and surgical treatments have limited efficacy, resulting in a significant number of patients experiencing visual loss. Therefore, there is a need to identify more effective and safer alternatives.

[0007] Previous studies have shown that mesenchymal stem cells (MSCs) have the potential to promote wound repair and neuroprotection, and are widely used in the treatment of retinal and nervous system diseases. However, their limited proliferation has limited their clinical translation and application. MSC-derived vesicles possess the biological properties of stem cells, lacking a nucleus and genetic material, and possess great potential for translational applications. Modifying vesicles to enhance their targeting can improve their bioavailability. Therefore, it is of great significance to modify intracellular nanovesicles to enhance their targeting for research on autoimmune uveitis and retinal neovascularization, and to identify therapeutic agents for these diseases.

[0008] Summary of the Invention

[0009] To overcome the deficiencies of the prior art, the present invention provides a method for preparing and applying targeted nanovesicles derived from cells, in particular, their application as drug carriers with targeting function.

[0010] In a first aspect of the present invention, a targeted nanovesicle derived from a cell is provided, which overexpresses a fusion protein of a targeting molecule and Lamp2b.

[0011] Specifically, the targeting molecule includes but is not limited to polypeptides, antibodies, activating or inhibiting receptors, protein ligands, bioactive enzymes, nucleic acid drugs, or combinations thereof. In particular, the targeting molecule is a polypeptide.

[0012] In some embodiments of the present invention, the targeting molecule is A25 polypeptide, and the intracellular nanovesicles can target T cells.

[0013] In some embodiments of the present invention, the targeting molecule is RGD polypeptide, and the intracellular nanovesicles can target neovascularization (eg, retinal neovascularization).

[0014] Specifically, the targeting molecule is located at the N-terminus of Lamp2b.

[0015] Specifically, the fusion protein structure includes:

[0016] 1) Lamp2b N-terminus - targeting molecule - Lamp2b C-terminus;

[0017] 2) Targeting molecule - the N-terminus of Lamp2b.

[0018] Specifically, the vesicle is spherical or coaster-shaped.

[0019] Specifically, the average particle size of the vesicles is 50-100 nm (e.g., 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 nm), especially 65-85 nm.

[0020] Specifically, the cells are derived from mammals, especially humans.

[0021] Specifically, the cells are eukaryotic cells, in particular at least one of stem cells, cardiomyocytes, human embryonic kidney cells (293T), macrophages, T cells and tumor cells; more specifically, the stem cells are mesenchymal stem cells (MSC), including but not limited to: umbilical cord mesenchymal stem cells (UC-MSC), bone marrow mesenchymal stem cells (BM-MSC), adipose mesenchymal stem cells (AD-MSC), dental pulp mesenchymal stem cells, placenta and amniotic fluid, and amniotic membrane mesenchymal stem cells.

[0022] In some embodiments of the present invention, the cells are mesenchymal stem cells, particularly umbilical cord mesenchymal stem cells (UC-MSCs).

[0023] In some embodiments of the present invention, the cells are epithelial cells, such as 293T cells.

[0024] In some embodiments of the present invention, the cells are tumor cells, such as HeLa cells.

[0025] Specifically, the vesicles are prepared by the method described in the second aspect of the present invention.

[0026] In a second aspect of the present invention, a method for preparing the above-mentioned vesicles is provided.

[0027] Specifically, the method comprises the steps of sequentially subjecting cells overexpressing a fusion protein of a targeting molecule-Lamp2b to ultrasonic treatment, centrifugation treatment, and ultracentrifugation treatment.

[0028] Specifically, the method comprises the following steps:

[0029] (1) introducing nucleotides encoding a targeting molecule-Lamp2b fusion protein into cells;

[0030] (2) dispersing the cells obtained in step (1) in a suspension solvent and performing ultrasonic treatment;

[0031] (3) centrifuging the liquid obtained in step (2) once or multiple times, discarding the cell membrane and organelle debris, and taking the supernatant;

[0032] (4) subjecting the supernatant obtained in step (3) to ultracentrifugation, and collecting the precipitate as intracellular nanovesicles;

[0033] Optionally, (5) resuspending the precipitate obtained in step (4).

[0034] Specifically, the method for introducing the nucleotide encoding the fusion protein of the targeting molecule-Lamp2b into the cell in step (1) can be carried out by transformation, transduction, transfection, infection and the like. The nucleotide can be introduced into the cell through a vector, and the vector includes a plasmid vector and a viral vector. The viral vector can be, for example, a retroviral vector, a lentiviral vector or other vector (e.g., an adenoviral vector, an adeno-associated viral vector).

[0035] In some embodiments of the present invention, step (1) includes: constructing a plasmid that overexpresses a fusion protein of the targeting molecule-Lamp2b, then packaging the plasmid into a lentivirus, and transfecting cells with the lentivirus.

[0036] In one embodiment of the present invention, the step of constructing the overexpression plasmid comprises: inserting the cDNA fragment encoding the A25 peptide and Lamp2b downstream of the CMV promoter in the vector plasmid.

[0037] Specifically, the cells in step (2) are isolated cells obtained after culture, digestion, and washing (after discarding the cell culture medium, digestion, washing, etc., the possibility of obtaining extracellular vesicles by separation can be eliminated).

[0038] Specifically, the method may further include cell digestion and counting steps; in some embodiments of the present invention, the cell digestion step includes: culturing cells to grow to 90% confluence, discarding the cell culture medium, washing the cells, adding trypsin to digest the cells, and then neutralizing and washing the cells.

[0039] Specifically, the cell density of the cells in the suspension solvent is 1-4×10 6 / mL, for example 1×10 6 / mL, 2×10 6 / mL, 3×10 6 / mL, 4×10 6 In some embodiments of the present invention, the cell density is 1×10 6 pieces / mL.

[0040] Specifically, the suspending solvent is any buffer suitable for culturing cells, such as PBS, Tris buffer, or glycine buffer. In some embodiments of the present invention, the solvent is PBS.

[0041] Specifically, the amplitude of the ultrasonic treatment in step (2) is 20%-35% (eg, 20%, 25%, 30%, 35%), for example, 20%-30%.

[0042] Specifically, the amplitude of the ultrasonic treatment in step (2) is 20%-25% (eg, 20%, 22%, 24%, 25%); in some embodiments of the present invention, the amplitude of the ultrasonic treatment is 20%.

[0043] Specifically, the ultrasonic treatment time in step (2) is 10-60s (e.g., 10, 15, 20, 25, 30, 60s), for example, 10-30s.

[0044] Specifically, the ultrasonic treatment time in step (2) is 10-20 s (e.g., 10, 15, 18, 20 s), preferably 15 s; in some embodiments of the present invention, the ultrasonic treatment time is 15 s, on 2 s, off 2 s.

[0045] In some embodiments of the present invention, the number of centrifugation treatments in step (3) is two, and the respective parameters are:

[0046] 1000-3000 g (e.g., 1000, 1500, 2000, 2500, 3000 g), 5-20 minutes (e.g., 5, 8, 10, 12, 15, 20 minutes);

[0047] 10,000-30,000 g (e.g., 10,000, 15,000, 20,000, 25,000, 30,000 g), 20-40 minutes (e.g., 20, 25, 28, 30, 32, 35, 40 minutes).

[0048] In one embodiment of the present invention, the first centrifugation is performed at 2000 g for 10 minutes.

[0049] In one embodiment of the present invention, the second centrifugation is performed at 20,000 g for 30 minutes.

[0050] Specifically, the parameters of the ultracentrifugation treatment in step (4) include 100,000-180,000 g (e.g., 100,000, 120,000, 140,000, 150,000, 160,000, 180,000), 50-100 minutes (e.g., 50, 60, 65, 70, 75, 80, 90, 100 minutes).

[0051] In one embodiment of the present invention, the ultracentrifugation is performed at 150,000 g for 70 minutes.

[0052] Specifically, the resuspension solvent in step (5) is any buffer suitable for culturing cells, such as PBS, Tris buffer, or glycine buffer. In some embodiments of the present invention, the resuspension solvent is PBS.

[0053] Specifically, one or more of the ultrasonic treatment, centrifugation treatment, and ultracentrifugation treatment is performed at low temperature, such as 0-5°C; in particular, the ultrasonic treatment, centrifugation treatment, and ultracentrifugation treatment are all performed on ice.

[0054] In some embodiments of the present invention, the method includes: taking 1×10 6 For a cell suspension with a density of 1 cell / mL, an ultrasonic probe was placed in the center of the liquid surface, and ultrasonic treatment was performed with an ultrasonic amplitude parameter range of 20% and a time parameter range of 15s, on 2s, and off 2s; the liquid was then transferred to a centrifuge tube for centrifugation with centrifugation parameters of 2000g×10min and 20000g×30min, and the supernatant was collected; the supernatant was transferred to an ultracentrifuge tube for centrifugation with centrifugation parameters of 150000g×70min.

[0055] In a third aspect of the present invention, there is provided use of the vesicles described in the first aspect as a drug carrier in the preparation of drugs for preventing and / or treating diseases.

[0056] In a preferred embodiment of the present invention, the disease is an eye disease, in particular a uveal or retinal related disease, including, but not limited to, uveitis, such as autoimmune uveitis; retinal vascular diseases, such as retinal artery occlusion, retinal vein occlusion, retinal periphlebitis, diabetic retinopathy, hypertensive retinopathy, retinopathy of prematurity, etc.; macular diseases, such as central serous chorioretinopathy, age-related macular degeneration, myopic macular degeneration, cystoid macular edema, macular hole, epiretinal membrane, etc.; retinal detachment diseases, such as rhegmatogenous retinal detachment, tractional retinal detachment, exudative retinal detachment, etc.; retinitis pigmentosa; retinal tumor diseases, such as retinoblastoma, etc.; and other eye diseases, such as glaucoma, dry eye, other ocular inflammatory diseases (such as blepharitis, blepharokeratoconjunctivitis, conjunctivitis, keratitis, optic neuritis, etc.), optic nerve damage (such as optic neuritis, optic atrophy, papilledema, ischemic optic neuropathy, etc.), ocular tumors, etc.

[0057] Specifically, ocular tumors include tumors of any ocular tissue or any ocular cell, including, but not limited to, choroidal tumors, conjunctival tumors, eyelid tumors, invasive intraocular tumors, iris tumors, metastatic ocular tumors, optic nerve tumors, orbital tumors, and retinal tumors. More specifically, the invention includes, but is not limited to, choroidal tumors such as choroidal hemangioma, choroidal melanoma, choroidal metastasis, choroidal nevus, choroidal osteoma, ciliary body melanoma and Ota nevus; conjunctival tumors such as conjunctival Kaposi's sarcoma, dermoid cyst on the surface of the eyeball, conjunctival lymphoma, atypical melanoma and PAM, pigmented conjunctival tumor, palpebral macules, pterygium, squamous cell carcinoma and conjunctival intraepithelial neoplasm; eyelid tumors such as basal cell carcinoma, capillary hemangioma, sweat gland cyst, palpebral nevus, seborrheic keratosis, eyelid malignant melanoma, eyelid sebaceous gland carcinoma and eyelid squamous cell carcinoma; invasive intraocular tumors such as chronic lymphocytic leukemia, eyelid tumors, choroidal and intraocular lymphoma; invasive choroidopathy and eyelid Endolymphoma; iris tumors, such as anterior uveal metastases, iris cysts, iris melanocytoma, iris melanoma, and iris pearly cysts; metastatic eye tumors, such as metastatic choroidal melanoma; optic nerve tumors, such as choroidal melanoma affecting the optic nerve, peripapillary metastases of optic neuropathy, optic nerve melanocytoma, and optic nerve sheath meningioma; orbital tumors, such as adenoid cystic carcinoma of the lacrimal gland, orbital cavernous hemangioma, orbital lymphangioma, orbital mucocele, orbital inflammatory pseudotumor, orbital rhabdomyosarcoma, childhood periocular hemangioma, and sclerosing inflammatory pseudotumor; retinal tumors, such as retinal pigment epithelium (RPE) hyperplasia, retinal pigment epithelium (RPE) tumor, retinoblastoma, and von Hippel angioma.

[0058] In some embodiments of the present invention, the vesicle is an A25-Lamp2b overexpression-modified intracellular nanovesicle (sIVs-A25), and the disease is autoimmune uveitis.

[0059] In some embodiments of the present invention, the vesicles are RGD-Lamp2b overexpression-modified intracellular nanovesicles (sIVs-RGD), and the disease is retinal neovascular disease, such as diabetic retinopathy, diabetic macular edema, retinal vascular occlusion, and retinopathy of prematurity.

[0060] Specifically, the vesicles serve as drug carriers to load active pharmaceutical ingredients, such as active pharmaceutical ingredients for the above-mentioned eye diseases; the active pharmaceutical ingredients include one or more of chemical drugs (such as rapamycin, methotrexate), biological drugs (such as proteins (such as PEDF, Lucentis), polypeptides (such as KV11, PEDF34mer, PEDF P5-3), oligonucleotide drugs (such as siRNA)), natural drugs, nanomedicines, radioactive drugs, photothermal therapy and photodynamic therapy drugs.

[0061] Specifically, the polypeptide and protein drugs can be, for example, cytokines (such as interleukins (such as IL-1, IL-2, IL-6, IL-10, IL-11), colony stimulating factors (such as granulocyte colony stimulating factor (G-CSF) and macrophage colony stimulating factor (M-CSF)), interferons (such as α, β, γ interferons), growth factors (such as pigment epithelium-derived factor), Tumor necrosis factor (such as TNF-α and TNF-β), transforming growth factor-β family or chemokine family, etc.), human hemoglobin, coagulation factors, vascular endothelial growth factor antibody antagonists, protein hormones (such as insulin, glucagon, calcitonin, hypothalamic hormones, pituitary hormones or gastrointestinal hormones, etc.), antibodies (such as monoclonal antibodies, polyclonal antibodies, dimers, multimers, multispecific antibodies or antibody fragments), enzymes and coenzyme drugs (phenylalanine lyase, arginase, arginine deacylase, pancreatic ribonuclease, superoxide dismutase, asparaginase, glucocerebrosidase or hyaluronidase), other polypeptide drugs (such as KV11, PEDF34mer, PEDF P5-3, etc.).

[0062] In some embodiments of the present invention, the vesicle is sIVs-A25, and the active pharmaceutical ingredient can be hormones, immunosuppressive drugs (rapamycin, methotrexate), siRNA, proteins (such as IL-10) and peptides.

[0063] In some embodiments of the present invention, the vesicle is sIVs-RGD, and the active pharmaceutical ingredient can be siRNA, protein (such as PEDF, Lucentis), or polypeptide (such as KV11, PEDF34mer, PEDF P5-3).

[0064] Specifically, the drug loading method can be a combination of one or more methods selected from the group consisting of genetic engineering, chemical synthesis, viral vectors, ultrasound, electroporation, and co-incubation.

[0065] Specifically, the drug can be administered in any suitable manner, in particular intraocularly, such as eye drops, eye ointment, retrobulbar injection, parabulbar injection, subconjunctival injection, or intravitreal injection, in particular intravitreal injection.

[0066] Specifically, the drug can be formulated into any suitable preparation form, such as, but not limited to, cream, foam, paste, ointment, emulsion, liquid solution, eye drops, injection, powder injection, gel, spray, suspension, microemulsion, eye mask or contact lens, etc., especially injection.

[0067] In a fourth aspect of the present invention, a method for preparing drug-loaded vesicles is provided, which comprises using the vesicles described in the first aspect of the present invention as drug carriers for drug loading.

[0068] Specifically, the drug loading method can be a combination of one or more methods selected from the group consisting of genetic engineering, chemical synthesis, viral vectors, ultrasound, electroporation, and co-incubation, in particular co-incubation.

[0069] Specifically, the drug loading step includes: mixing the vesicles with the active pharmaceutical ingredient and incubating;

[0070] Optionally, free pharmaceutically active ingredient is removed (by, for example, ultrafiltration and centrifugation).

[0071] Specifically, the incubation temperature is 35-40°C (eg, 35, 36, 37, 38, 39, 40°C), especially 37°C.

[0072] Specifically, the incubation time is 1-2 hours (eg, 1, 1.2, 1.5, 2 hours), especially 1 hour.

[0073] In some embodiments of the present invention, the ultrafiltration membrane parameter is 100 kD.

[0074] Specifically, the method for preparing the drug-loaded vesicles may also include the method steps for preparing vesicles described in the first aspect of the present invention.

[0075] In a fifth aspect of the present invention, a drug-loaded vesicle is provided, which uses the vesicle described in the first aspect of the present invention as a drug carrier.

[0076] Specifically, the drug in the drug-loaded vesicles is as described in the third aspect of the present invention.

[0077] Specifically, the drug loading rate of the drug-loaded vesicles can be 40%-90% (e.g., 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%).

[0078] Specifically, the encapsulation efficiency of the drug-loaded vesicles can be 40%-90% (e.g., 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%).

[0079] Specifically, the preparation method of the drug-loaded vesicles can be as described in the fourth aspect of the present invention.

[0080] In the sixth aspect of the present invention, a method for preventing and / or treating a disease is provided, which comprises the step of administering the drug-loaded vesicles of the first aspect (e.g., the drug-loaded vesicles of the fourth aspect of the present invention) to a subject in need thereof.

[0081] In particular, the disease is preferably an eye disease, as described in the third aspect of the present invention.

[0082] Specifically, the subject is a mammal, especially a human.

[0083] Specifically, the vesicles serve as drug carriers to load active pharmaceutical ingredients, such as active pharmaceutical ingredients for the above-mentioned eye diseases; the active pharmaceutical ingredients include one or more of chemical drugs, biological drugs, natural drugs, nanopharmaceuticals, radioactive drugs, photothermal therapy drugs and photodynamic therapy drugs.

[0084] Specifically, the administration can be by any suitable route of administration, in particular intraocular administration or intravenous injection, wherein the intraocular administration includes eye drops, eye ointment, retrobulbar injection, parabulbar injection, subconjunctival injection, and intravitreal injection, in particular intravitreal injection. In some embodiments of the present invention, intravenous injection is used to treat autoimmune uveitis, and intravitreal administration is used to treat retinal neovascularization.

[0085] The present invention provides a preparation method and application of targeted nanovesicles derived from cells. The inventors prepared intracellular nanovesicles sIVs-RGD modified by overexpression of Lamp2b-RGD and intracellular nanovesicles sIVs-A25 modified by overexpression of A25-Lamp2b, giving the vesicles that originally did not have a targeting function the ability to target neovascularization and T cells respectively. sIVs-RGD and sIVs-A25 with targeting function are further used as carriers to transport drugs to therapeutic targets for the treatment of autoimmune uveitis and retinal neovascularization. The intracellular nanovesicles of the present invention have a large yield, strong targeting, small particle size, and a narrow particle size distribution range. When used as a carrier to load drugs, they have a higher encapsulation rate and drug loading rate, and a wider range and degree of distribution under the vitreous cavity injection method. The modified vesicles obtained by the present invention can not only enhance their own therapeutic effects, but also serve as drug carriers, and have very good application prospects and research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0086] Figure 1 shows a schematic diagram of the process and steps of the method for producing intracellular nanovesicles, wherein A shows the process diagram and B shows the steps.

[0087] Figure 2 shows the optimization process for the isolation of intracellular nanovesicles. Figures AB show the protein yield (A) and vesicle yield (B) of sIVs obtained at different sonication times and a 20% sonication amplitude. At a 20% sonication amplitude, the vesicle yield dropped sharply when the sonication time exceeded 10 seconds or exceeded 20 seconds. Figures CD show the protein yield (C) and vesicle yield (D) of sIVs obtained at different sonication amplitudes and a 15-second sonication time. At a 15-second sonication time, the vesicle yield dropped sharply when the sonication amplitude exceeded 25%. Figure E shows transmission electron micrographs of sIVs obtained at different sonication amplitudes and a 15-second sonication time. Scale bar: 100 nm. Figure F shows transmission electron micrographs of sIVs obtained at different sonication times and a 20% sonication amplitude. Scale bar: 100 nm.

[0088] Figure 3 shows a simplified experimental flow chart.

[0089] Figure 4 shows the construction and identification of A25-Lamp2b overexpression-modified MSCs. A represents the A25-Lamp2b overexpression plasmid. B shows the expression of green fluorescent protein (GFP) 48 hours after MSCs were transfected with lentivirus at a gradient MOI (3, 15, 30). Scale bar: 200 μm. C shows the expression of Lamp2b mRNA in MSCs before and after lentiviral transfection as detected by qRT-PCR. D shows the expression of Flag-tagged protein and Lamp2b protein in MSCs before and after lentiviral transfection as detected by WB. The GFP group represents MSCs transfected with the empty virus, the A25 group represents MSCs transfected with the A25-Lamp2b overexpression virus, and N represents MSCs not transfected with the virus.

[0090] Figure 5 shows the acquisition and identification of sEVs / sIVs-GFP / A25. A shows a transmission electron micrograph of sEVs / sIVs-GFP / A25. Widefield scale bar: 200 nm; close-up scale bar: 200 nm. B-C show the nanoparticle size analysis results, which show the particle size distribution of sEVs / sIVs-A25 and the statistical analysis results. D shows the IL-10 content of sEVs / sIVs-A25 loaded with IL-10. E-F show the expression of Flag-tagged proteins and Lamp2b proteins in sEVs / sIVs-A25 by western blot and the statistical analysis results. (*p < 0.05, ****p < 0.0001 indicate significant differences between groups).

[0091] Figure 6 shows changes in CD40L expression in an in vitro T cell model and an experimental autoimmune uveitis animal model. A, B, and C show flow cytometry analysis of CD40L expression in naive CD4+ T cells 12 hours after in vitro stimulation, along with statistical analysis. The control group represents unstimulated CD4+ T cells; the Pma+iono group represents CD4+ T cells stimulated with PMA and ionomycin; and the anti-CD3 / CD28 group represents CD4+ T cells stimulated with anti-CD3 and anti-CD28 antibodies. Figures D and D show flow cytometry analysis of CD40L expression in draining lymph nodes and spleen 13 days after EAU induction, along with statistical analysis. The Normal group represents untreated mice; the EAU group represents mice induced with EAU. Figures F and G show Western blot analysis of CD40L expression in lymph nodes and spleen 13 days after EAU induction, along with statistical analysis (*p<0.05, **p<0.01, ***p<0.001 indicate significant differences between groups).

[0092] Figure 7 shows the in vitro T cell targeting validation of sEVs / sIVs-A25. AB shows the results of flow cytometry analysis of CFSE fluorescence intensity in T cells in each group after 12 hours of co-culture and its statistical analysis (*p < 0.05, ***p < 0.001 indicate significant differences between groups). C shows the distribution of DiD fluorescence in T cells in each group after 12 hours of co-culture by confocal microscopy. Among them, the high fluorescence in the first column from left to right is CD4 expressed on the cell membrane, the high fluorescence in the second column is DAPI, representing the cell nucleus, and the high fluorescence in the third column is DID, representing DID-labeled sEVs and sIVs.

[0093] Figure 8 shows sEVs / sIVs A25 Effects of IL-10 on naive CD4+ T cells. A and C show the inhibitory effects of sEVs and sIVs on T cell proliferation, along with statistical analysis. B and D show the promotional effects of sEVs and sIVs on Treg cell differentiation, along with statistical analysis. (*p<0.05, **p<0.01, ***p<0.001 indicate significant differences between groups).

[0094] Figure 9 shows the evaluation of fundus inflammation in each group of EAU mice. A shows fundus photographs of mice in each treatment group and the blank control group on day 17 of EAU model induction. B shows optical coherence tomography (OCT) images of mice in each group on day 17 of EAU model induction. C shows retinal HE-stained sections of mice in each treatment group and the blank control group on day 21 of EAU model induction. D and E show the clinical and pathological scores of mice in each treatment group and the blank control group after treatment, respectively. (*p<0.05, **p<0.01, ***p<0.001 indicate significant differences between groups).

[0095] Figure 10 shows the ERG measurement results for each group of EAU mice. Figures AB show the b-wave amplitude and its statistical analysis. Figures CD show the a-wave amplitude and its statistical analysis. (*p<0.05, **p<0.01, ***p<0.001 indicate significant differences between groups).

[0096] Figure 11 shows the changes in the proportion of cell subsets in the spleen and draining lymph nodes of EAU mice in each group. A shows the flow cytometry results of IL-17A+ cells and IFN-γ+ cells in the draining lymph nodes and spleen of each treatment group and the blank control group (from left to right: PBS, IL-10, sEVs A25 @IL-10, sIVs GFP @IL-10 and sIVs A25 B shows the flow cytometry results of CD25+FOXP3+ cells in the draining lymph nodes and spleen of each treatment group and the blank control group (PBS, IL-10, sEVs from left to right). A25 @IL-10, sIVs GFP @IL-10 and sIVs A25 @IL-10). C shows the statistical analysis results of the proportions of Th1 (IFN-γ+) and Th17 (IL-17A+) cells in the lymph nodes of each treatment group and the blank control group. D shows the statistical analysis results of the proportions of Th1 (IFN-γ+) and Th17 (IL-17A+) cells in the spleen of each treatment group and the blank control group. E shows the statistical analysis results of the proportions of Treg (CD25+FOXP3+) cells in the lymph nodes of each treatment group and the blank control group. F shows the statistical analysis results of the proportions of Treg (CD25+FOXP3+) cells in the spleen of each treatment group and the blank control group. (*p<0.05, **p<0.01, ***p<0.001 indicate significant differences between groups).

[0097] Figure 12 shows a simplified experimental flow chart.

[0098] FIG13 shows the results of a western blot experiment, which shows the protein expression of Lamp2b in three cell types (MSC cells, 293 cells, and Hela cells), sIVs, and sEVs.

[0099] Figure 14 shows the results of a western blot experiment, which shows the protein expression of Lmap2b and Flag (A) and the statistical analysis results of Lmap2b expression (B), GAPDH is an internal reference, NOR indicates the transfection virus group, Ctrl indicates the empty lentivirus transfection group, and 10 / 30 / 50 indicates the lentivirus transfection group (where 10 / 30 / 50 indicates the transfection multiplicity MOI).

[0100] Figure 15 shows the results of western blot experiments, which show the protein expression of Lmap2b and Flag (A) and statistical analysis results (B, C), GAPDH is an internal reference, NOR indicates the non-transfected virus group, Ctrl indicates the empty lentivirus transfection group, 10 / 30 / 50 indicates the lentivirus transfection group, and 10 / 30 / 50 indicates the transfection multiplicity MOI (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0101] Figure 16 shows the ELISA test results, sEVs RGD @PEDF indicates a composite preparation prepared by loading sEVs with PEDF, sIVs RGD @PEDF indicates the composite preparation prepared by loading sIVs with PEDF (**p<0.01, ***p<0.001 and ****p<0.0001 indicate significant differences among the groups).

[0102] Figure 17 shows the results of western blot experiments, which show the expression of RGD-binding integrins αV and β3 in normal endothelial cells and VEGF-induced proliferating endothelial cells (A) and statistical analysis results (B and C) (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0103] FIG18 shows the results of PCR experiments, which show the expression of RGD-binding integrins αV (A) and β3 in the retinas of normal mice and OIR mice (B) (**p<0.01, ***p<0.001 and ****p<0.0001 indicate significant differences between the groups).

[0104] FIG19 shows the results of western blot experiments, which show the expression of RGD-binding integrins αV and β3 in the retinas of normal mice and OIR mice (A) and statistical analysis results (B and C) (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0105] Figure 20 shows the experimental results of vesicle uptake by endothelial cells, which shows the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models for 12 hours (A) and statistical analysis results (B). The first row shows DID-stained vesicles, and the second row shows DAPI-stained cell nuclei. Scale bar: 50um (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0106] Figure 21 shows the experimental results of vesicle uptake by endothelial cells, which shows the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models for 24 hours (A) and statistical analysis results (B). The first row shows DID-stained vesicles, and the second row shows DAPI-stained cell nuclei. Scale bar: 50um (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0107] Figure 22 shows the experimental results of vesicle uptake in the retina of OIR mice, which shows the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models and statistical analysis results 8h (A and B), 24h (C and D) and 5 days (E and F) after intravitreal injection. The first row shows DID-stained vesicles, and the second row shows DAPI-stained cell nuclei. Scale bar: 50um (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0108] Figure 23 shows the results of an in vitro CCK assay, which shows that sIVs RGD @The therapeutic effect of PEDF on the proliferation of cells in the VEGF-induced neovascularization model in vitro (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0109] Figure 24 shows the results of an in vitro Transwell assay, which shows that sIVs RGD @Microscopic examination results (A) and statistical results of the specific number of migrating cells (B) of the therapeutic effect of PEDF on cell migration in a VEGF-induced neovascularization model in vitro, scale: 100 μm; (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0110] FIG25 shows the results of western blot experiments, which show the expression of inflammatory factor ICAM-1 in HRECs (A) and statistical analysis results (B) (**p<0.01, ***p<0.001 and ****p<0.0001 indicate significant differences among the groups).

[0111] Figure 26 shows the results of the retinal flat mount staining experiment of OIR mice, which shows the area of ​​the non-perfused area and the area of ​​neovascularization in the retina of OIR mice (A), the statistical analysis results of the non-perfused area (B), and the statistical analysis results of the neovascularization area (C), L represents low concentration (0.5 mg / ml), M represents medium concentration (1 mg / ml), and H represents high concentration (2 mg / ml), (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences among the groups).

[0112] Figure 27 shows the results of the retinal flat mount staining experiment of OIR mice, which shows the area of ​​the non-perfused area and the area of ​​neovascularization in the retina of OIR mice (A), the statistical analysis results of the area of ​​the non-perfused area (B), and the statistical analysis results of the area of ​​neovascularization (C) (**p < 0.01, ***p < 0.001 and ****p < 0.0001 indicate significant differences between the groups).

[0113] FIG28 shows the ERG measurement results of OIR mice in each group, which shows the overall situation of b-wave amplitude (A) and the b-wave amplitude at the highest stimulation (2.2 cd·s / m 2 ) statistical analysis (B), the overall situation of a-wave amplitude (C) and the a-wave amplitude at the highest stimulus (2.2 cd·s / m 2 ) Statistical analysis (D) (*p < 0.05, **p < 0.01, ***p < 0.001 indicate significant differences among the groups).

[0114] Figure 29 shows the results of western blot experiments, which show the expression of GFAP and VEGF in the mouse retina (A), the statistical analysis results of GFAP (B), and the statistical analysis results of VEGF (C) (**p < 0.01, ***p < 0.001, and ****p < 0.0001 indicate significant differences between the groups). DETAILED DESCRIPTION

[0115] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0116] The terms "patient" or "subject" and the like are used interchangeably herein to refer to any animal or cell thereof to be treated according to the methods described herein, whether in vitro or in situ. Specifically, the aforementioned animals include mammals, e.g., rats, mice, guinea pigs, rabbits, dogs, monkeys, humans, and particularly humans.

[0117] The term "treating" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, suppressing and / or halting one or more clinical symptoms of a disease after onset of the disease.

[0118] The term "prevent" or "prevent" refers to treating a disease before it occurs to avoid, minimize, or make the onset or development of the disease more difficult.

[0119] The intracellular nanovesicles modified by overexpression of A25-Lamp2b in the present invention are referred to as "sIVs-A25" or "sIVs A25 "express.

[0120] The extracellular vesicles modified by overexpression of A25-Lamp2b in the present invention are referred to as "sEVs-A25" or "sEVs A25 "express.

[0121] In the present invention, the intracellular nanovesicles modified by overexpression of RGD-Lamp2b are referred to as "sIVs-RGD" or "sIVs RGD "express.

[0122] In the present invention, the extracellular vesicles modified by overexpression of RGD-Lamp2b are referred to as "sEVs-RGD" or "sEVs RGD "express.

[0123] The disclosures of various publications, patents, and published patent specifications cited herein are incorporated by reference in their entirety.

[0124] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0125] Example 1: Cell extraction and culture

[0126] 1. Extraction and culture of mesenchymal stem cells (MSCs)

[0127] Human umbilical cords were provided by Beijing Beilai Biotechnology Co., Ltd., China. Umbilical cords were obtained from uncomplicated normal pregnancies after cesarean section and immediately placed in saline containing penicillin (100 U / mL) and streptomycin (100 mg / mL) before being transported to the laboratory within 4 hours. After removing residual blood and blood vessels, the cords were cut into 1-3 mm pieces and digested with 0.1% type II collagenase for 1 hour at 37°C. The suspension was then filtered through a 100-mesh sieve to remove undigested tissue. The supernatant from the filtration was centrifuged and washed three times with PBS. The cell pellet was resuspended in Dulbecco's modified Eagle's medium / Nutrient Mixture F12 complete medium. The medium contained 10% fetal bovine serum (FBS), 100 U / mL penicillin, and 100 mg / mL streptomycin. The cells were seeded in T175 culture flasks and cultured in a 37°C incubator with 5% CO2. The medium was changed every 3 days. When the cell confluence reached 80%, they were passaged at a subculture ratio of 1:2, and P3 to P5 cells were used for experiments.

[0128] 2. Culture of 293T cells

[0129] Cells were cultured in complete Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen, USA) supplemented with 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (ScienCell, Carlsbad, CA) at 37°C and 5% carbon dioxide. The medium was changed every 2-3 days. Cells were used for various experiments at passages 3 to 6 and 70-80% confluence.

[0130] 3. Culture of HeLa cells

[0131] Cells were cultured in complete Dulbecco's Modified Eagle's Medium (DMEM, Invitrogen, USA) supplemented with 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (ScienCell, Carlsbad, CA) at 37°C and 5% carbon dioxide. The medium was changed every 2-3 days. Cells were used in various experiments at passages 3 to 6 and 70-80% confluency.

[0132] At the same time, the above cell culture can refer to the patent application with application number 202410605857.X.

[0133] Example 2: Preparation of cell-derived nanovesicles

[0134] The process of producing intracellular nanovesicles is shown in Figure 1.

[0135] 1. Cell digestion and counting

[0136] Taking MSC cells as an example, the cells were grown to 90% confluence, the cell supernatant was aspirated, the cells were washed twice with PBS, the cells were digested with trypsin, and after digestion, the cells were neutralized and washed three times with PBS. The cells were then counted and the cell number was adjusted to 1×10 6 pieces / mL.

[0137] 2. Ultrasonic treatment of cells

[0138] Take 1×10 6 Add 2 mL of cell suspension at a density of 1 cell / mL to the bottom of a 50 mL centrifuge tube. Place the ultrasound probe in the center of the liquid surface. Set the ultrasound amplitude to 20% and the duration to 15 seconds, with a 2-second on cycle and a 2-second off cycle. Place the centrifuge tube on ice. Transfer the suspension to a 2 mL centrifuge tube and centrifuge.

[0139] 3. Collection of nanovesicles in small cells

[0140] Centrifugation parameters were 2000g for 10 minutes and 20,000g for 30 minutes. The supernatant was then collected and transferred to an ultracentrifuge tube and centrifuged at 150,000g for 70 minutes. All operations were performed on ice. The resulting pellet was resuspended in PBS to obtain small intracellular nanovesicles (sIVs).

[0141] 4. Collection of small extracellular vesicles

[0142] FBS is a necessary condition for culturing cells in vitro, but it contains a large number of bovine extracellular vesicles, which will also be present in complete cell culture medium containing FBS. In order to remove bovine extracellular vesicles, FBS was centrifuged at 110,000 × g at 4 ° C overnight (about 12 hours). When the cell fusion reached 60%, the cells were cultured in complete culture medium containing 10% exosome-removed FBS for 48 hours. Then, the supernatant was collected and the extracellular vesicles were separated by ultracentrifugation at 4 ° C. The specific steps include 300g × 10min, 2000g × 10min, 10,000g × 30min and 110,000g × 70min twice. The obtained precipitate was resuspended in PBS, which was small extracellular vesicles (sEVs) mainly composed of exosomes.

[0143] Example 3: Optimization of isolation parameters for intracellular nanovesicles

[0144] Referring to the steps of Example 2, the optimization process of the separation parameters of intracellular nanovesicles is shown in FIG2 .

[0145] 1. Nanoparticle size analyzer detects the difference in the yield of sIVs

[0146] PBS-resuspended sIVs were diluted to 1 ml with PBS and analyzed using Nanoparticle Tracking Analysis (NTA) software (NTA 3.3 Dev Build 3.3.104). The temperature was set to 25°C, the laser was set to Blue 488, the flow rate was set to 50, and the mode was set to automatic detection. Three injections and three analyses were performed, and the peak value average was used as the Mode particle size result. The camera mode was sCMOS, the laser type was Blue 488, and the viscosity was 0.9 cP.

[0147] 2. Transmission electron microscopy observation of the morphology of sIVs in different cells

[0148] Take the centrifuged sIVs, resuspend them in 200μL PBS solution and mix them evenly. Take 10μL of sIVs solution and mix it with 4% PFA in a volume ratio of 1:1, drop it on a clean plastic film to form a droplet, then put the front of the electron microscope carbon grid on the droplet and leave it for 20 minutes. Then negatively stain it with 10μL phosphotungstic acid for 90 seconds, bake the carbon grid dry, and observe it using a HitacW-7500 transmission electron microscope.

[0149] Figures 2A and 2B show the protein and vesicle yields of sIVs obtained according to this embodiment at an ultrasonic amplitude of 20% for exposure times of 5, 10, 15, 20, 25, 30, and 60 seconds, respectively. The results show that the number of vesicles and protein yield decreased significantly when exposure times were less than 10 seconds or greater than 20 seconds. Figures 2C and 2D show the protein and vesicle yields of sIVs obtained according to this embodiment at an ultrasonic amplitude of 20, 25, 30, 35, and 40% for an ultrasonic duration of 15 seconds, respectively. The results show that vesicle yield decreased significantly when the ultrasonic amplitude exceeded 25% for an ultrasonic duration of 15 seconds. Figure 2E shows transmission electron micrographs of sIVs obtained according to this embodiment at an ultrasonic amplitude of 20, 25, 30, 35, and 40% for an ultrasonic duration of 15 seconds. FIG2F shows transmission electron micrographs of sIVs obtained according to this implementation procedure at an ultrasonic amplitude of 20% and ultrasonic times of 5 s, 10 s, 15 s, 20 s, 25 s, 30 s, and 60 s.

[0150] This optimization process showed that at a 20% sonication amplitude, vesicle yield dropped sharply when the sonication duration exceeded 10 or 20 seconds. At a sonication duration of 15 seconds, vesicle yield dropped sharply when the sonication amplitude exceeded 25%. A 20% amplitude and a sonication duration of 15 seconds were the optimal parameters for collecting intracellular nanovesicles.

[0151] For the preparation of cell vesicles, please refer to the patent application number 202410605857.X.

[0152] Example 3: A25-Lamp2b overexpression modified nanovesicles sEVs / sIVs A25 Preparation of @IL-10 complex

[0153] Construction of A25-Lamp2b overexpression-modified nanovesicles sEVs / sIVs A25 The steps for preparing the IL-10 complex and conducting in vitro and in vivo experiments in mice are shown in Figure 3.

[0154] 1. Experimental instruments and materials

[0155] 1.1 Experimental Reagents

[0156] DMEM-F12 medium (Gibco, USA); collagenase II (Gibco, USA); phosphate-buffered saline (PBS) (Gibco, USA); fetal bovine serum (FBS) (Gibco, USA); insulin-transferrin-selenium (Gibco, USA); penicillin-streptomycin (Gibco, USA); trypsin (0.25% trypsin-EDTA) (Gibco, USA); glutamine (Gibco, USA); polybrene (Solaibao, China); BCA (Solaibao, China); Triton X-100 (Solaibao, China); reverse transcription kit (RevertAidTM First Strand cDNA Synthesis) Kit) (Thermo Fisher Scientific, USA); GAPDH and Lamp2b primers (Suzhou Jinweizhi Biotechnology Co., Ltd., China); Flag-tag, GAPDH, and Lamp2b antibodies (Abcam, USA); 75 cm2 and 175 cm2 cell culture flasks (Corning, USA); -80°C ultra-low temperature freezer (Thermo Fisher Scientific, USA); 10 ml and 25 ml pipettes (Junyao Company, Tianjin, China).

[0157] 1.2 Experimental instruments

[0158] Water bath (Ounuo Instrument Co., Ltd., Tianjin, China); pipette (Eppendorf, Germany); desktop centrifuge (Eppendorf, Germany); inverted phase contrast microscope (OLYMPUS, Japan); high-pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany).

[0159] 2. Experimental methods:

[0160] 2.1. Construction of A25-Lamp2b Overexpression-Modified Cells

[0161] 2.1.1 Construction of A25-Lamp2b fusion protein overexpression plasmid

[0162]

[0163] 2.1.2 Isolation and purification of lentivirus overexpressing A25-Lamp2b-Flag fusion protein

[0164] The overexpression plasmid in 2.1.1 was delivered to the company, which packaged the corresponding high-titer A25-Lamp2b-Flag lentivirus. Flag is a common fusion tag protein composed of eight amino acids (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 4)). After being fused and expressed with the target protein, it can be effectively recognized by anti-Flag antibodies, making it convenient to detect and identify the Flag-containing fusion protein A25-Lamp2b using Western Blot.

[0165] 2.1.3 Lentiviral infection of MSCs

[0166] When P2 MSCs or 293T cells reached 60% confluency, lentivirus and 5 μg / ml Polybrene were added according to the MOI (Multiplicity of Infection) and the medium was changed by half. Fresh complete medium was replaced 8 h after infection, and fluorescence expression was observed under a fluorescence microscope 48 h later (Figure 4B).

[0167] 2.1.4. Detection of target gene Lamp2b expression by RT-PCR

[0168] P5 MSCs or 293T cells, as well as normal cells not infected with lentivirus, served as controls. Total RNA was extracted using Trizol reagent (Invitrogen, USA). cDNA was synthesized using a reverse transcription kit (Thermo, USA) according to the kit's instructions. Reverse primers, cDNA, and SYBR Green Master (Roche, Switzerland) were sequentially added to a 384-well plate for RT-PCR, using GAPDH expression as an internal control. Relevant mRNA expression levels were calculated using the ΔΔCt method (Figure 4, C). Lamp2b amplification primers were designed based on the NCBI gene sequence library: F: TGGCTCCGTTTTCAGCATTG (SEQ ID NO: 2) and R: TGGTGTCATCATCCAGCGAA (SEQ ID NO: 3).

[0169] 2.1.5 Western Blot analysis of target protein Lamp2b and Flag-tagged protein expression

[0170] A 20 μl sample was drawn, and protein loading buffer was added. The sample was denatured in a 95°C metal bath for 10 minutes. SDS-PAGE gel electrophoresis was performed, and the membrane was transferred. The sample was blocked with 5% skim milk powder for 2 hours. The primary antibody was incubated at 4°C overnight. The membrane was washed with TBST solution three times for 10 minutes each time. The secondary antibody was incubated at room temperature for 2 hours. The membrane was washed with TBST solution three times for 10 minutes each time. The target band was observed after ECL development (Figure 4D).

[0171] 2.2.1 Isolation and Storage of sIVs / sEVs

[0172] Taking MSCs as an example, after culturing in complete medium for 2 days, the medium was replaced with one containing 10% exosome-free serum. When the cell density reached 70-80%, the cells were digested with trypsin and washed twice with PBS to prepare a concentration of 1x10 6 / ml of cell suspension. The cell suspension was ultrasonically treated to break the cell membrane (2ml power: 20%-30%, 2s / 2s, 15s-120s). The suspension after ultrasonication was collected, and the cell debris was removed by gradient centrifugation at 2000g for 10min, followed by 20000g for 30min, and then sIVs was obtained by ultracentrifugation (150,000×g for 70min). sEVs were obtained according to a similar method in Example 2 and steps 1-4. sIVs / sEVs overexpressing A25-Lamp2b are targeted modified sIVs / sEVs, and sIVs / sEVs transfected with empty virus are unmodified sIVs / sEVs, hereinafter referred to as sIVs-A25, sEVs-A25, sIVs-GFP, and sEVs-GFP.

[0173] 2.3 sIVs A25 Preparation and identification of @IL-10 complex

[0174] 2.3.1 sIVs A25 Preparation of @IL-10 complex

[0175] Take sIVs-A25 and add IL-10 drug solution in a mass ratio gradient (1:20, 1:10, 1:5, 1:1) in sequence. After mixing, let it stand in a 37°C incubator for 1 hour. The liquid was added to a 100kDa ultrafiltration tube and centrifuged to remove free drugs. After wetting the ultrafiltration tube with PBS, add the liquid and centrifuge at 14000g for 20 minutes. Then add 300ul of PBS and centrifuge at 14000g for 20 minutes twice. Then, invert and centrifuge at 4000g for 2 minutes to recover sIVs. A25 @IL-10, temporarily stored at 4°C. At the same time, sIVs were obtained using a similar method. GFP @IL-10, sEVs A25 @IL-10, sEVsGFP @IL-10. Among them, sIVs A25 @IL-10 and sEVs A25 @IL-10 represents IL-10-loaded targeted modified sIVs and sEVs, sIVs GFP @IL-10 and sEVs GFP @IL-10 represents unmodified sIVs and sEVs loaded with IL-10.

[0176] 2.3.2 sIVs A25 Identification of the @IL-10 complex

[0177] 2.3.2.1 Electron Microscopy: After fixation with 2% paraformaldehyde, transmission electron microscopy was used to determine morphology and size. Method: 10 μl of the suspension of small intracellular nanovesicles and small extracellular vesicles was dripped onto a copper grid and allowed to settle for 5-10 minutes. 10 μl of 2% uranyl acetate was dripped onto the copper grid and stained for 1-2 minutes. The supernatant was removed with filter paper. The cells were dried at room temperature for several minutes. Morphology was observed using an electron microscope at 80 kV.

[0178] 2.3.2.2 Nanosight laser particle size analyzer: Take the small intracellular nanovesicles and small extracellular vesicles resuspended in PBS, dilute them to 1 ml with PBS, and use NTA 3.3Dev Build 3.3.104 for detection. Set the temperature to 25°C, the laser to Blue488, the flow rate to 50, the mode to automatic detection, and inject and analyze three times. The peak value average is taken as the mode particle size result.

[0179] 2.3.2.3 Western Blot: Same steps as 2.1.5.

[0180] 2.3.3 Determination of IL-10 Content in sIVsA25@IL-10 Complex

[0181] sIVs were detected by ELISA A25 @IL-10, sEVs A25 @IL-10, sIVs GFP @IL-10 and sEVs GFP To determine the drug loading in IL-10, sample each nanovesicle group and add it to an ELISA kit plate. Add the corresponding standard control group and incubate at room temperature for 1 hour. Add the corresponding volume of primary antibody, incubate at room temperature for 1 hour, and then wash the plate three times. Add the corresponding volume of secondary antibody, incubate at room temperature for 1 hour, and then wash the plate three times. Add the corresponding volume of substrate for color development. Incubate at room temperature for 20 minutes, then add the corresponding volume of stop solution to terminate color development. Detect absorbance using a microplate reader at 562 nm excitation.

[0182] 2.4 Statistical analysis

[0183] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0184] 3. Experimental results:

[0185] 3.1 Construction and identification of MSCs overexpressing A25-Lamp2b

[0186] Due to the non-phagocytic nature of T cells, targeted drug delivery to T cells remains technically challenging. In T cell-targeted research, the most commonly selected receptors for modification are T cell markers, including CD3, CD4, CD7, and CD8. However, targeting all T cell subsets may result in dose-limiting toxicities. Therefore, it is important to select markers specific to specific cell subsets or markers that are overexpressed in disease states. CD40 ligand (CD40L, CD154) is a 39 kDa type II transmembrane protein belonging to the TNF superfamily and is considered an early activation marker for CD4+ T lymphocytes. CD40 / CD40L participates in triggering multiple downstream immune signaling pathways. Early studies have demonstrated that CD40 / CD40L costimulatory signaling is essential for the generation of T cell-dependent antibody responses and the differentiation of memory B cells. Activation of CD40 / CD40L signaling in macrophages and DCs induces cytokine secretion and expression of surface activation molecules, which regulate cross-stimulation and activation of CD4+ and CD8+ T cells. During tissue inflammation, CD40 / CD40L activation in epithelial or endothelial cells induces cytokine and chemokine secretion, potentially triggering additional leukocyte infiltration. Dysregulation of the CD40 / CD40L signaling pathway is also observed in various autoimmune diseases. For example, CD40L expression is significantly elevated in various cell subsets, including B cells, T cells, and monocytes, in patients with systemic lupus erythematosus (SLE), as well as in circulating T cells in patients with psoriatic arthritis (PsA) and rheumatoid arthritis (RA). Furthermore, overexpression of CD40L in T cells of RA patients is associated with poor prognosis. Furthermore, studies have found that soluble CD40L is also increased in several autoimmune diseases. These findings suggest that dysregulation of the CD40 / CD40L signaling pathway may contribute to the initiation or maintenance of pathogenic autoimmune responses.

[0187] Therefore, targeting the CD40 / CD40L pathway holds promise as a new therapeutic strategy for autoimmune diseases. Currently, anti-CD40L therapy has demonstrated efficacy in mouse models of systemic lupus erythematosus (SLE), experimental autoimmune encephalomyelitis (EAE), and EAU. Clinical trials of anti-CD40L therapy have also been conducted. Early results indicate that, while the drug exhibits clinical efficacy, trials have been terminated due to the development of thromboembolic events. Thrombosis may be related to the binding of the Fc domain of CD40L monoclonal antibodies to FcγRIIa (CD32a) on the surface of human platelets. Therefore, ongoing clinical trials are using anti-CD40L monoclonal antibodies or specific ligands that lack an Fc domain. A study designed a CD40L-specific peptide ligand, A25, which was modified with methotrexate-loaded liposomes for the treatment of EAE. This treatment significantly reduced the proportion of CD40L+ T cells in EAE mice and effectively inhibited disease progression. Therefore, using A25 as a CD40L-specific peptide ligand can effectively target CD40L+ T cells, thereby enhancing drug efficacy.

[0188] A25-Lamp2b lentivirus and empty vector lentivirus (as shown in Figure 4A) were purchased from Heyuan Bio. MSCs were infected with different MOI transfection multiplicity values ​​(3, 15, 30). After 48 hours, the expression of green fluorescent protein GFP could be detected under a fluorescence microscope (Figure 4B). qPCR results showed that compared with the non-transfected group and the empty vector transfection group, the expression of the target gene Lamp2b in the MSCs in the A25-Lamp2b virus transfection group increased, and the difference was statistically significant (Figure 4C). In addition, Western blot results showed that the expression of Lamp2b and Flag tag proteins in the MSCs in the A25-Lamp2b virus transfection group was significantly better than that in the empty vector transfection group (Figure 4D).

[0189] 3.2 sIVs A25 Preparation and identification of @IL-10

[0190] Transmission electron microscopy results showed that the sIVs and sEVs obtained by ultracentrifugation were relatively uniform in size, with spherical or cup-cushion shapes ranging in diameter from 70 to 150 nm (Figure 5A). The diameters of the extracted sEVs were analyzed using Nanosight technology. Statistical data showed that the average diameters of sEVs-GFP, sEVs-A25, sIVs-GFP, and sIVs-A25 were approximately 154.8±1.3 nm, 154.0±1.3 nm, 128.7.3±0.8, and 119.1±2.2 nm, respectively; and the D50 values ​​were 146.9 nm, 146.1 nm, 113.2 nm, and 100.7 nm, respectively; and the D90 values ​​were 215.4 nm, 209.4 nm, 194.2 nm, and 175.2 nm, respectively (Figure 5BC). ELISA results showed that the IL-10 protein concentration in the sIVs group was higher than that in the sEVs group (Figure 5, D), indicating that sIVs have a better drug-loading capacity than sEVs. Western blot results showed that Lamp2b expression levels in sIVs were higher than in sEVs in both normal and overexpression states. In the overexpression state, the expression level of Flag-tagged protein in sIVs-A25 was higher than that in sEVs-A25 (Figure 5, E-F).

[0191] 4. Summary

[0192] A25-Lamp2b-overexpressing lentivirus was used to successfully transfect MSCs and generate targeted sIVs and sEVs. sIVs-N expressed higher levels of Lamp2b than sEVs-N, indicating that sIVs are more suitable for targeted transfection. sIVs-A25 expressed higher levels of both Lamp2b and Flag-tagged proteins than sEVs-A25. Furthermore, sIVs exhibited superior drug delivery to sEVs, demonstrating their superior performance as drug delivery vehicles.

[0193] Example 4: Changes in CD40L expression in in vitro T cell models and experimental autoimmune uveitis animal models

[0194] 1. Experimental Animals

[0195] Seven-week-old female C57BL / 6J mice provided by Jicui Pharmaceuticals were used to establish the EAU animal model. All experimental mice were free of ocular and systemic lesions before use. The mice were raised in the animal room (SPF grade) of the Institute of Eye Hospital of Tianjin Medical University. The environmental conditions were set as follows: stable temperature (23±2)°C, humidity (55%±10%), and 12 hours of light day and night. The mice in each group were numbered in advance and grouped according to the generated random number table. During the experiment, we strictly followed the standard procedures of the Animal Care and Use Committee of Tianjin Medical University.

[0196] 2. Experimental methods

[0197] 2.1. Differences in CD40L Expression in In Vitro T Cell Models

[0198] 2.1.1 Mice CD4+ T cell isolation

[0199] The spleen and draining lymph nodes of the mouse were taken, placed on a copper grid, and ground with a syringe core. After lysing the red blood cells, single cells were obtained by centrifugation and resuspended in a 15 ml centrifuge tube: 90 μL of cold MACS buffer / 10 7 cells, anti-CD4 magnetic beads 10 μL / 10 7 cells. Incubate in a 15ml centrifuge tube for 15-30 minutes. Add cold MACS buffer to the 15ml centrifuge tube to 15ml, centrifuge and resuspend the cells with 5ml cold MACS buffer. Slowly add the cells to the magnetic column that has been washed with MACS buffer and placed on the magnetic stand, and rinse 3 times with 5ml MACS buffer. Remove the magnetic column from the magnetic stand, place it on a 15ml centrifuge tube, add 5ml MACS buffer to the magnetic column, and then use a needle plug to quickly push all the liquid in the magnetic column into the centrifuge tube. CD4+ T cells are used for in vitro activation, proliferation, and differentiation experiments.

[0200] 2.1.2 In vitro T cell activation stimulation model

[0201] During the course of autoimmune uveitis, After encountering retinal antigens in the body, T cells are activated into antigen-specific T cells (Th1 and / or Th17 cells), differentiate and proliferate, enter the eye through draining lymph nodes and / or spleen, recognize intraocular antigens, and are reactivated. Through the secretion of adhesion molecules, chemokines, etc., T cells, mononuclear macrophages, neutrophils, etc. are further recruited to gather in the eye, amplifying the inflammatory response and causing damage to intraocular parenchymal cells. The upregulation of CD40L expression of activated T cells is the basis of the targeted design of this embodiment.

[0202] Anti-CD3 & CD28 and PMA & Ionomycin are both commonly used stimulators for in vitro T cell activation. Studies have shown that inducing T cell activation and proliferation requires two signals: a specific antigen-stimulating signal generated by the binding of TCR / CD3 to specific MHC II antigen-peptide complexes on the surface of antigen-presenting cells (APCs); and a nonspecific costimulatory signal, generated by the interaction of costimulatory molecules on the surface of APCs with the corresponding receptors on T cells. CD28 / B7 is the most important costimulatory molecule, increasing IL-2 production, accelerating T cell proliferation, and preventing cell anergy or death. In vitro stimulation of T cells with combined antibodies against CD3 and CD28 mimics the dual signaling mechanism of T cell activation and is currently the most widely used method for T cell activation and expansion. Furthermore, within cells, activation of protein kinase C (PKC) triggers the phosphorylation of numerous downstream protein kinases, forming a cascade reaction that leads to the expression of multiple proteins and, in turn, cell activation. PKC can be activated by the combined action of diacylglycerol (DAG) and calcium (Ca2+). PMA (phorbol myristate) is a DAG mimetic, and ionomycin is a Ca2+ transporter that can transport Ca2+ in organelles to the cytoplasm. Therefore, the combined action of PMA and ionomycin can activate PKC, thereby causing a series of downstream reactions.

[0203] Therefore, in the above sorting CD4+ T cell culture systems were stimulated for 6-12 hours with either 6ng / ml PMA and 1ug / ml ION or 10μg / ml anti-CD3 and 5μg / ml anti-CD28. Cells were harvested, washed twice with PBS, and stained with the corresponding anti-CD40L antibody. Changes in the proportion of CD40L+ T cells were then measured by flow cytometry.

[0204] 2.2 Changes in CD40L expression in experimental autoimmune uveitis animal models

[0205] 2.2.1 Induction of experimental autoimmune uveitis (EAU) animal model

[0206] EAU is an animal model of T cell-mediated autoimmune disease. CD4+ T cells are the main immune cell type that upregulates CD40L expression after EAU. Female C57BL / 6 mice, 6-8 weeks old, were selected. 651-670Add the emulsion to complete Freund's adjuvant in a 1:1 ratio into two syringes connected to a three-way tube. The final volume is 200 μL per mouse. The antigen dosage is 300 μg per mouse. After thorough mixing on ice, 200 μL of the emulsion is injected subcutaneously at six points on the flank and base of the tail. Administer PTX intraperitoneally 30 minutes prior to subcutaneous injection of the emulsion (1 μg per mouse).

[0207] 2.2.2 Detection of changes in CD40L expression

[0208] Flow cytometry: Take EAU mice on day 13 and the same age Single cell suspensions were prepared from mouse spleen and lymph node tissues, stained with corresponding anti-CD40L antibodies, and then the changes in the proportion of CD40L+T cells were detected by flow cytometry.

[0209] Western Blot: EAU mice on day 13 and mice of the same age Protein was extracted from mouse spleen and lymph node tissues, then added with protein loading buffer and denatured in a 95°C metal bath before Western blotting. Western blotting procedures were the same as above.

[0210] 2.3 Statistical analysis

[0211] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0212] 3. Experimental results

[0213] 3.1 CD40L expression is upregulated in an in vitro T cell activation stimulation model

[0214] As shown in Figure 6 , AC, after in vitro stimulation, the proportion of CD40L + cells in CD4 + T cells was significantly increased compared with the unstimulated group.

[0215] 3.2 CD40L expression is upregulated in the spleen and lymph nodes of the EAU mouse model

[0216] As shown in the flow cytometry results of DE in Figure 6 , the proportion of CD40L+ cells in CD4+ T cells in the spleen and draining lymph nodes of mice after EAU induction was significantly increased compared with the non-modeling group; as shown in the Western Blot results of FG in Figure 6 , the expression of CD40L protein in the spleen of mice after EAU induction was upregulated compared with the non-modeling group.

[0217] 4. Summary

[0218] The results showed that CD40L expression was significantly upregulated after T cell activation. Therefore, targeting the CD40 / CD40L pathway is expected to become a new therapeutic strategy for autoimmune diseases.

[0219] Example 5: Evaluation of sIVs-A25 and sEVs-A25 T cell targeting function

[0220] 1. Experimental instruments and materials

[0221] 1.1 Experimental Reagents

[0222] CFSE (Invitrogen, USA); RPMI 1640 medium (Gibco, USA); Glutamine (Gibco, USA); FBS fetal bovine serum (Gibco, USA); Magnetic bead positive selection mouse Navie CD4 kit (eBioscience, USA); Magnetic bead positive selection mouse Total CD4 kit (eBioscience, USA); IL-10 protein (MCE, USA); BSA (Biyuntian, China); phosphate-buffered saline (PBS) (Gibco, USA); DID (Biyuntian, China); DAPI (Sigma, USA); anti-fluorescence fading mounting medium (Solaibao, China); adhesive slides (Shitai, China); Polybrene (Gibco, USA); CD3 antibody (Thermo Fisher Scientific, USA); CD28 antibody (Thermo Fisher Scientific, USA) Scientific Company); 15ml / 50ml centrifuge tubes (Corning Company, USA); 48-well plates and 96-well plates (Corning Company, USA); LS-column (Miltenyi Company, Germany); 1ml and 50ml syringes (Ganfa Company, China); 1.5ml EP tubes (Axygen Company, USA); cell counting chamber (Thermo Fisher Scientific Company, USA); 0.45μm and 0.22μm filters (Sigma Company, USA).

[0223] 1.2 Experimental instruments

[0224] Water bath (Ounuo Instrument Co., Ltd., Tianjin, China); pipette (Eppendorf, Germany); desktop centrifuge (Eppendorf, Germany); confocal microscope (Ceiss, USA); inverted phase contrast microscope (OLYMPUS, Japan); high-pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany); flow cytometer (BD, USA).

[0225] 2. Experimental methods

[0226] 2.1 Verification of the targeting activity of sIVs-A25 in vitro

[0227] 2.1.1 CFSE labeling of sIVs and sEVs

[0228] Dilute the sIVs and sEVs suspension to 400 μl with PBS and add CFSE to the dilution to a final CFSE concentration of 5 μM. Incubate at room temperature for 10 min. Neutralize excess dye with a large volume of PBS, wash once by centrifugation at 11,000 g for 70 min, resuspend in an appropriate amount of PBS, and filter through a 0.22 μm filter. The sIVs and sEVs described were obtained in 2.2.1 of Example 3.

[0229] 2.1.2 DID labeling of sIVs and sEVs

[0230] Dilute the sIVs resuspension to 400 μl in PBS and add DID to the sIVs dilution to a final concentration of 5 μg / ml. Incubate at 37°C in the dark for at least 30 minutes. Transfer the DID suspension to a 100 kDa ultrafiltration tube and centrifuge at 14,000g for 15 minutes. Add 400 μl of PBS to the ultrafiltration tube to resuspend the pellet and centrifuge at 14,000g for 15 minutes. Add 50 μl of PBS to resuspend the pellet, invert the ultrafiltration tube, replace it with a new collection tube, and centrifuge at 1,000g for 2 minutes. Transfer the pellet to a new 1.5 ml EP tube and centrifuge at 14,000g for 3 minutes. Remove the supernatant.

[0231] 2.1.3 T cell co-culture

[0232] Magnetic bead negative selection kit separation CD4+ T cells, 2x10 5 The cells were plated in 96-well plates pre-incubated with CD3 antibodies. After culturing in a cell culture incubator for 24 hours, 20 μg / ml of nanovesicles in each group were added and cultured continuously. After incubation for 1 hour, 6 hours, 12 hours, and 24 hours, the cells were collected for flow cytometry and confocal microscopy.

[0233] 3. Experimental results

[0234] 3.1 sIVs are more easily internalized by T cells than sEVs

[0235] As shown in Figure 7 , when sEVs-GFP, sEVs-A25, sIVs-GFP, and sIVs-A25 were co-incubated with CD4+ T cells, flow cytometry and confocal microscopy results showed that the proportion of T cells taking up A25-modified sEVs and sIVs was higher than that of their corresponding unmodified groups, and the T cell uptake ratio of sIVs-A25 was significantly higher than that of sEVs-A25.

[0236] 4. Summary

[0237] The above experimental results show that sIVs are more easily internalized by T cells than sEVs; and A25 modification significantly increases the number of sIVs and sEVs taken up by T cells. Compared with sEVs, the modification of sIVs more significantly improves the targeting of T cells.

[0238] Example 6: sIVs A25 @IL-10 inhibits CD4+ T cell proliferation and promotes Treg cell differentiation in vitro

[0239] 1. Experimental instruments and materials

[0240] 1.1 Experimental Reagents

[0241] CFSE (Invitrogen, USA); RPMI 1640 medium (Gibco, USA); glutamine (Gibco, USA); fetal bovine serum (FBS) (Gibco, USA); magnetic bead positive selection mouse Navie CD4 kit (eBioscience, USA); magnetic bead positive selection mouse Total CD4 kit (eBioscience, USA); IL-10 protein (MCE, USA); BSA (Biyuntian, China); phosphate-buffered saline (PBS) (Gibco, USA); CD3 antibody (Thermo Fisher Scientific, USA); CD28 antibody (Thermo Fisher Scientific, USA); 15 ml / 50 ml centrifuge tubes (Corning, USA); 48-well and 96-well plates (Corning, USA); LS-column (Miltenyi, Germany); 1 ml and 50 ml syringes (Ganfa, China); 1.5 ml EP tubes (Axygen, USA); cell counting chamber (Thermo Fisher Scientific, USA) Scientific Company); 0.45 μm and 0.22 μm filters (Sigma Company, USA).

[0242] 1.2 Experimental instruments

[0243] Water bath (Ounuo Instrument Co., Ltd., Tianjin, China); desktop centrifuge (Eppendorf, Germany); inverted phase contrast microscope (OLYMPUS, Japan); high-pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany); flow cytometer (BD, USA).

[0244] 2. Experimental methods

[0245] 2.1 T cell proliferation assay in vitro (CFSE method)

[0246] Pretreatment of 96-well plates (plating): Dilute CD3 antibody in PBS to a concentration of 10 μg / ml, add 100 μl to each well of the 96-well plate, and add 100 μl PBS to the outer wells of the 96-well plate to prevent excessive evaporation. Incubate at 4°C overnight or incubate in a cell incubator at 37°C for 2 hours. Aspirate the antibody, wash the wells twice with PBS and set aside.

[0247] Magnetic bead separation of mouse spleen CD4+ T cells. Adjustment CD4+ T cells were placed in a centrifuge tube to a volume of 5 ml, 1 μl of CFSE storage solution (5 mmol / L) was added, and the cells were quickly mixed and incubated at room temperature in the dark for 10 min. The same volume of RPMI1640 medium containing 10% FBS was added to terminate the staining. After centrifugation, the cells were resuspended in complete medium (configuration: 90% 1640 basal medium + 10% FBS + 2 μg / ml CD28 antibody + 100 U / ml double antibody + 50 μM β-mercaptoethanol) and the cells were plated at 3x10 5 Cells were plated in 96-well plates pretreated with 100 μl of CFSE per well. A blank control group and three nanovesicle-treated groups were set up, with three replicate wells per group. After 72 hours of culture, cells were harvested and stained with CD4 antibodies, and CFSE fluorescence expression was detected by flow cytometry.

[0248] 2.2 Treg differentiation assay in vitro

[0249] 2.2.1 Treg differentiation in vitro

[0250] The separation of naive CD4+T cells was carried out according to the instructions of the magnetic bead negative separation kit. After separation, 2x10 5 Cells were plated per well in a 96-well plate pre-incubated with CD3 antibody and cultured in a cell incubator under the following differentiation conditions: X-VIVO 15 medium + 2 μg / ml CD28 antibody + 5 ng / ml TGF-β + 20 ng / ml IL-2 for 5 days. A blank control group and three replicate wells were set up for each nanovesicle-treated group. Flow cytometry analysis was performed 5 days later.

[0251] 2.2.2 Flow cytometry detection of Treg cell proportion

[0252] The cells to be tested were placed in a flow cytometer, PBS was added and centrifuged at 400 g for 5 min, and the cells were resuspended in 100 μl PBS. 1 μl CD4-BV711 antibody was added for staining, and the cells were incubated in the dark for 30 min. PBS was added and centrifuged at 400 g for 5 min. Fixative / permeabilization solution was added in sequence for fixation and permeabilization. 1 μl FOXP3-PE antibody was added for staining, and the cells were incubated in the dark for 30 min. 400 g centrifugation was performed for 5 min, and the cells were resuspended in 500 μl PBS. The proportion of FOXP3+CD4+ cells was detected by flow cytometry.

[0253] sEVs used in the experiment A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 @IL-10 was obtained according to Example 3.

[0254] 2.3 Statistical analysis

[0255] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0256] 3. Experimental results

[0257] 3.1 In vitro T cell proliferation assay

[0258] When using sEVs at a concentration of 10 μg / ml A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 When IL-10 was used, the results showed that they could inhibit the proliferation of T cells stimulated by CD3 / CD28 antibodies to a certain extent (Figure 8A, C). GFP The inhibition of T cell proliferation in vitro by IL-10 group was significantly better than that by sIVs GFP @IL-10 group and sEVs A25 In the IL-10 group, the difference was statistically significant, indicating that the targeted modification of sIVs increased the targeted delivery efficiency of the loaded drug IL-10 and enhanced the inhibitory effect of IL-10 on T cell proliferation stimulated by CD3 / CD28 antibodies.

[0259] 3.2 Treg cell differentiation assay

[0260] Treg cells are the main suppressive cell population in the body, playing an important role in graft tolerance, suppressing autoimmune responses, and maintaining immune balance. In autoimmune diseases, Treg cells can suppress pathogenic T cells and promote disease regression. Abnormalities in their function and regulation can lead to autoimmune diseases.

[0261] The results in Figure 8B and D show that sIVs GFP @IL-10 group had no significant promoting effect on Treg differentiation, but sIVs A25 @IL-10 group, sEVs A25 The @IL-10 group showed a significant effect in promoting the differentiation of T cells into Treg cells, and this difference was statistically significant (P < 0.05). This suggests that the targeted modification of sIVs increased the targeted delivery efficiency of the loaded drug IL-10 and enhanced the effect of IL-10 on TGF-β-induced Treg cell differentiation.

[0262] 4. Summary

[0263] By encapsulating IL-10 in sIVs and sEVs, the aim is to enhance the inhibitory ability of MSC-derived sIVs and sEVs on T cell proliferation in vitro and promote the development of Treg cells in vitro, thereby achieving a more significant immunosuppressive effect. A25 @IL-10 can not only effectively inhibit the proliferation in vitro induced by CD3 / CD28 antibody stimulation, but also promote CD4+ T cells differentiate into Treg cells. In addition, the effect of targeted modified sIVs is more significant than that of unmodified ones, and the targeted modified sIVs and sEVs show comparable immunosuppressive efficacy.

[0264] Example 7: sIVs A25 The therapeutic effect of IL-10 on experimental autoimmune uveitis

[0265] 1. Experimental subjects

[0266] 1.1 Experimental Animals

[0267] Seven-week-old female C57BL / 6 mice provided by Jicui Pharmaceutical Co., Ltd. were used to establish the EAU animal model. All experimental mice were free of ocular and systemic lesions before use. The mice were raised in the animal room (SPF grade) of the Institute of Eye Hospital of Tianjin Medical University. The environmental conditions were set as follows: stable temperature (23±2)°C, humidity (55%±10%), and 12 hours of light day and night. The mice in each group were numbered in advance and grouped according to the generated random number table. During the experiment, we strictly followed the standard procedures of the Animal Care and Use Committee of Tianjin Medical University.

[0268] 2. Experimental methods

[0269] 2.1 EAU induction

[0270] Female C57BL / 6 mice, 6-8 weeks old, were selected. 651-670 Add the emulsion to complete Freund's adjuvant at a 1:1 ratio into two syringes connected to a three-way tube. The final volume is 200 μL per mouse, and the antigen dosage is 300 μg per mouse. After thorough mixing on ice, 200 μL of the emulsion is injected subcutaneously at six points on the flank and base of the tail. Administer PTX intraperitoneally 30 minutes prior to subcutaneous injection of the emulsion at a dose of 1 μg per mouse.

[0271] 2.2 sIVs A25 @IL-10 in vivo efficacy verification

[0272] 2.2.1 Treatment and grouping of EAU model mice

[0273] On the 11th day after modeling, EAU model mice were randomly divided into groups, ensuring that each group contained 6 mice. Each group of mice was injected with 1ug IL-10, 30ug sIVs, and 10mg IL-10, respectively. A25 @IL-10, 30ug sIVs GFP @IL-10 and 30ug sEVs A25 @IL-10. Similarly, in the blank control group, mice were injected with an equal volume of phosphate buffered saline (PBS) to ensure the consistency of experimental conditions. sEVs used in the experiment A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 @IL-10 was obtained according to Example 3.

[0274] 2.2.2 Clinical / pathological inflammation scores in experimental autoimmune uveitis

[0275] Starting on day 9 after model induction, the severity of disease in each group of mice was observed every two days using indirect ophthalmoscopy. Eyeballs were removed at different stages of disease onset, fixed, and paraffin sections were prepared for routine hematoxylin and eosin staining. The extent of retinal tissue damage was recorded under a light microscope. Fundus clinical and histopathological scores were recorded according to the CASPI classification system.

[0276] 2.2.3 Mouse OCT and fundus imaging examination

[0277] Starting 10 days after model induction, changes in the mouse fundus structure were observed every four days using a Heidelberg SPECTRALIS-OCT. Tropicamide and epinephrine eye drops were used to dilate both eyes of the mouse. Avertin was then injected intraperitoneally to anesthetize the mouse. After anesthesia reached a stable stage, sodium hyaluronate gel was applied to the mouse's eyes and retinal scans were performed. Scans were taken with the mouse's optic disc as the center, with one horizontal and one vertical section captured.

[0278] 2.2.4 Electroretinogram (ERG)

[0279] Each group of EAU mice underwent dark adaptation for more than 12 hours in a darkroom 25 days after modeling. The electrophysiological responses of the retinas of each group of mice under dark adaptation were measured. Mice were dark adapted for 12 hours, and after intraperitoneal anesthesia, the pupils were fully dilated. After anesthetizing the ocular surface, the mice were placed on a 37°C thermostat. A red electrode needle was inserted into the skin of the mouse's neck, with the lower needle pointing toward the head. A green electrode needle was inserted into the mouse's tail, and the electrodes were secured with tape. Gatifloxacin ophthalmic gel was applied to the cornea to keep it moist and prevent the instrument from scratching the cornea and causing infection. The angle of the cornea was adjusted to align with the corneal electrode. Stimulation was administered to the mice from low to high levels, and electroretinograms were recorded according to the standardized protocol of the International Society for Clinical Electrophysiology of Vision (ISCEV). The stimulation intensity ranged from -1.7 to 3.1 log(cd·s / m2). Stimulation was given according to low (-1.7~0.4), medium (0.7~2.2), and high stimulation intensities (2.5~3.1), which were repeated 7, 5, and 3 times respectively, and the average value of single flashes was recorded. The stimulation intervals were 15, 30, and 60 seconds respectively.

[0280] 2.2.5 Isolation of draining lymph node and spleen tissue cells and determination of T cell subsets by flow cytometry

[0281] On day 17 after induction of the EAU mouse model, draining lymph nodes and spleen tissues were collected from each group of EAU mice, ground and isolated to obtain single-cell suspensions. The single-cell suspensions were divided into two parts.

[0282] Part of the cells were stained intracellularly. Under the co-stimulation of PMA, ION and BFA, the cells were cultured in a CO2 incubator for 6 hours. The cells were collected and rinsed with PBS. Live / Dead antibodies and CD4 antibodies were added for staining respectively, and the cells were incubated in the dark at 4°C for 30 minutes. After rinsing, fixative was added and fixed at room temperature for 30 minutes. After centrifugation, permeabilization agent was added and rinsed twice. Then, permeabilization agent and IFN-γ, IL-4, and IL-17A antibodies were added to the sample for intracellular staining respectively, and the cells were incubated in the dark at 4°C for 30 minutes. After staining, the permeabilization agent was thoroughly rinsed, and after PBS reselection, the cells were loaded onto the BD FacsCelesta machine to detect changes in Th1, Th2, and Th17 cell subsets.

[0283] Another portion of unstimulated cells was stained for FOXP3+CD25+CD4+ T cell nuclei. Live / Dead antibodies and CD4+ antibodies were added to the cell samples for staining, and the cells were incubated at 4°C in the dark for 30 minutes. After rinsing, a nuclear permeabilization fixative was added and fixed at room temperature for 30 minutes. After centrifugation, the nuclear permeabilization agent was added and rinsed twice. The permeabilization agent and FOXP3+CD25+ antibodies were then added to the sample for intranuclear staining. The cells were incubated at 4°C in the dark for 30 minutes. After staining, the permeabilization agent was thoroughly rinsed, and the cells were reselected with PBS and loaded onto a BD FacsCelesta instrument to detect changes in Treg cell subsets.

[0284] 2.4 Statistical analysis

[0285] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0286] 3. Experimental results

[0287] 3.1 sIVs A25 @IL-10 and sEVs A25 @IL-10 is similar and can significantly alleviate fundus inflammation in EAU mice

[0288] The results showed that the fundus inflammation scores and pathological scores of the three treatment groups were lower than those of the control group (P < 0.05) (Figure 9). A25 @IL-10 and sIVs A25The therapeutic effect of the IL-10 treatment group was comparable, with significant improvement in fundus inflammation, reduced optic disc edema, disappearance of vascular white sheaths, and reduction in vitreous inflammatory cells; HE sections showed that the retinal structure had returned to a flat state, and the structure of each retinal layer was superior to that of sIVs GFP The difference in the IL-10 treatment group was statistically significant, and the OCT results were consistent with this.

[0289] 3.2 sIVs A25 IL-10 has a stronger neuroprotective effect on EAU mice

[0290] As shown in Figure 10, the unmodified sIVs GFP Compared with the PBS and IL-10 groups, the IL-10 group showed significantly increased a- and b-wave amplitudes under high stimulation. Modified sIVs also significantly increased a- and b-wave amplitudes compared with modified sEVs. This suggests that modified sIVs have a more protective effect on neurons.

[0291] 3.3 sIVs A25 @IL-10 and sEVs A25 Similar to IL-10, it can increase the proportion of Treg cells in draining lymph nodes and reduce the proportion of Th1 cells in draining lymph nodes and spleen.

[0292] As shown in Figure 11, the modified sIVs A25 @IL-10 and sEVs A25 The proportion of Treg (CD4+CD25+FOXP3+) cells in the draining lymph nodes of mice treated with IL-10 was significantly higher than that in PBS, IL-10 and sIVs GFP @IL-10 group significantly improved; and the modified sIVs A25 @IL-10 and sEVs A25 The proportion of Th1 (CD4+IFN-γ+) cells in the draining lymph nodes and spleen of mice treated with IL-10 was significantly higher than that in PBS, IL-10 and sIVs GFP The @IL-10 group was significantly reduced, indicating that the modified sIVs improved the tissue-targeted delivery efficiency of IL-10, enhanced the promoting effect of IL-10 on Treg cell differentiation in the draining lymph nodes of EAU mice, and enhanced the inhibitory effect of IL-10 on Th1 cell proliferation in the draining lymph nodes and spleen of EAU mice.

[0293] 4. Summary

[0294] EAU mice were injected with sIVs via tail vein A25After IL-10 treatment, the severity of the disease was significantly improved, and HE staining showed that the retinal structure returned to normal and the infiltration of inflammatory cells was reduced. A25 @IL-10 can effectively inhibit the progression of inflammation in EAU mice. ERG electrophysiological results showed that sIVs A25 @IL-10 has significant retinal neuroprotective function. Flow cytometry results suggest that sIVs A25 @IL-10 may inhibit the progression of inflammation in EAU mice by promoting the differentiation of Treg cells in the draining lymph nodes and spleen of EAU mice.

[0295] Example 8: The expression level of Lamp2b in sIVs is higher than that in sEVs

[0296] 1. Experimental methods

[0297] The specific experimental process is shown in Figure 12.

[0298] 1.1 Cell culture

[0299] The extraction and culture of cells were the same as in Example 1.

[0300] 1.2 Extraction of sIVs

[0301] When cells grow to 90% confluence, remove the supernatant and wash the cells twice with PBS. Then, trypsinize the cells and neutralize and wash the cells three times with PBS. Then, count the cells and adjust the cell number to 1×10 with PBS. 6 / mL. Take 1×10 6 Add 2 mL of cell suspension at a density of 1 cell / mL to the bottom of a 50 mL centrifuge tube. Place the ultrasound probe in the center of the liquid surface. Set the ultrasound amplitude to 20% and the duration to 15 seconds, with a 2-second on cycle and a 2-second off cycle. Place the centrifuge tube on ice. Transfer the suspension to a 2 mL centrifuge tube and centrifuge.

[0302] The supernatant was filtered using a 50 ml syringe and a 0.45 μm filter (previously the filter membrane was moistened with PBS), and IVs were extracted and separated using differential centrifugation at an RCF of 150,000 for 70 min at 4°C. The precipitate was resuspended in 60 μl of clean PBS per tube and collected in an EP tube. Protein was quantified using the BCA method, and then protein denaturation was performed for western blot analysis.

[0303] 1.3 Collection of sEVs

[0304] FBS is a necessary condition for culturing cells in vitro, but it contains a large number of extracellular vesicles of bovine origin, which will also be present in complete cell culture medium containing FBS. In order to remove bovine extracellular vesicles, FBS was centrifuged at 110,000 × g at 4 ° C overnight (about 12 hours). When the cell fusion reached 60%, the cells were cultured for 48 hours in complete culture medium containing 10% FBS that had removed exosomes. Then, the supernatant was collected and the extracellular vesicles were separated by ultracentrifugation at 4 ° C. The specific steps included 300g × 10min, 2000g × 10min, 10,000g × 30min and 110,000g × 70min twice. The obtained precipitate was resuspended in PBS, which was mainly sEVs composed of exosomes. It was collected in an EP tube and quantified by the BCA method, and then the protein was denatured for western blot experiments.

[0305] The experimental steps for collecting intracellular vesicles and western blot of 293T cells and Hela cells were the same as above.

[0306] 2. Statistical processing

[0307] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0308] 3. Experimental results

[0309] 3.1 The expression level of Lamp2b in sIVs is higher than that in sEVs in MSC cells, 293 cells, and HeLa cells

[0310] In this experiment, western blot experiments were performed using cellular proteins, sIVs proteins, and sEVs proteins from three cell types (MSC cells, 293 cells, and Hela cells) to detect the protein expression of Lamp2b (Figure 13). The results showed that the protein expression level of Lamp2b in sIVs was much higher than that in sEVs.

[0311] 4. Summary

[0312] This example demonstrates that the expression of Lamp2b in sIVs of MSCs cells, 293T cells and Hela cells is higher than that in sEVs, indicating that the expression level of Lamp2b in sIVs of cells is higher than that in sEVs.

[0313] Example 9: sIVs RGDPreparation of @PEDF

[0314] 1. Experimental methods

[0315] 1.1 Isolation, culture, and lentiviral infection of MSCs

[0316] MSCs were extracted from human umbilical cords by digestion and centrifugation, then harvested and purified using the differential adhesion method. MSCs were transfected with lentivirus to construct MSC-RGD. Healthy P3 UMSCs were selected and, after 12 hours, transfected with lentivirus when the cells reached 50%-70% confluency. To prepare the lentiviral transfection solution, add half the volume of complete medium used in a normal culture system to each of six 50ml centrifuge tubes. Polybrene-assisted transfection reagent was added to a final concentration of 6ug / ml. The experimental group was treated with the corresponding volume of Lamp2b-RGD lentivirus calculated at an MOI of 10, 30, and 50. The control group was treated with a gradient of control lentivirus at the same MOI. Mix thoroughly by pipetting. The original cell culture medium was aspirated, and the transfection solution was added to each of the cells. Gently swirl to evenly coat the cell surface, and the cells were gently transferred to a cell culture incubator for incubation. Six hours later, complete medium was added to the cells until the normal culture volume was reached. 24 hours after the addition of the lentiviral transfection solution, the cells were replaced with a medium change. The infection steps of 293T cells were the same as above.

[0317] 1.2 Collection and storage of sIVs

[0318] When the UMSCs reached 90% confluency, the culture medium was aspirated to remove the cell supernatant. The cells were then washed with warm PBS and digested with 3 ml of trypsin for 3 minutes. The cells were neutralized with 6 ml of PBS and centrifuged at 1000 g for 5 minutes. The cells were resuspended in PBS and washed twice by centrifugation. After resuspending in PBS, the cells were counted using an automated cell counter. The cell separation solution was diluted with PBS to a density of 1 x 10^6 / ml. IVs were then obtained by ultrasonication. 2 ml of the solution was sonicated on ice (2 ml power: 20%-30%, 2s / 2s, 15s-120s). The sonicated solution was collected in a 2 ml EP tube and centrifuged at 2000 g for 10 minutes and then at 20,000 g for 30 minutes. The supernatant was then collected and transferred to a fresh 15 ml centrifuge tube, date-labeled, and stored at -80°C.

[0319] The steps for collecting intracellular vesicles from 293T cells are the same as above.

[0320] 1.3 Extraction of sIVs

[0321] The supernatant was filtered using a 50 ml syringe and a 0.45 μm filter (previously the filter membrane was moistened with PBS). IVs were extracted and separated by differential centrifugation at an RCF of 150,000 for 70 min at 4°C. The precipitate was resuspended in 60 μl of clean PBS per tube and collected in an EP tube for protein quantification using the BCA method.

[0322] sEVs were obtained according to methods similar to those in 1.1-1.3 and Example 8. sIVs / sEVs overexpressing Lamp2b-RGD were sIVs / sEVs after targeted modification, and sIVs / sEVs transfected with empty vector virus were sIVs / sEVs without modification, hereinafter referred to as sIVs-RGD, sEVs-RGD, sIVs-GFP, and sEVs-GFP.

[0323] 1.4 sIVs RGD Preparation of @PEDF

[0324] Take sIVs-RGD, add PEDF drug solution, mix well and let it stand in a 37℃ incubator for 1 hour. Add the liquid to a 100kDa ultrafiltration tube and centrifuge to remove free drugs. First, wet the ultrafiltration tube with PBS, add the liquid and centrifuge at 14000g for 20 minutes. Then add 300ul of PBS and centrifuge at 14000g for 20 minutes twice. Then, invert and centrifuge at 4000g for 2 minutes to recover sIVs. RGD @PEDF, temporarily stored at 4°C. At the same time, sIVs were obtained using a similar method. GFP @PEDF and sEVs RGD @PEDF. Among them, sIVs RGD @PEDF and sEVs RGD @PEDF stands for PEDF-loaded targeted modified sIVs and sEVs, sIVs GFP @PEDF and sEVs GFP @PEDF represents unmodified sIVs and sEVs loaded with PEDF.

[0325] 1.5 Quantification of sIVs by ELISA RGD @PEDF drug loading

[0326] Detection of sIVs using ELISA RGD The concentration of the drug loaded in the PEDF was determined by generating a standard curve using a series of drug concentrations ranging from 0 to 6 ng / mL. 100 μl of the standard solution and sample solution were added to the ELISA plate for testing. The standard curve was plotted with drug concentration as the horizontal axis and absorbance as the vertical axis, and the regression equation was calculated. This was then used to calculate the drug loading rate and encapsulation efficiency.

[0327] 2. Statistical processing

[0328] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0329] 3. Experimental results

[0330] 3.1 Lamp2b-RGD lentivirus successfully expressed in MSCs

[0331] RGD is known to specifically target integrins. It is weakly expressed in resting endothelial cells and most normal tissues, but is strongly expressed on proliferating endothelial cells, particularly integrin αv and integrin β3. Therefore, we chose to overexpress RGD in MSCs to collect highly RGD-expressing sIVs and sEVs, aiming to target lesions in the retinal neovascularization model for treatment. Lamp2b is a lysosomal membrane protein and a transmembrane protein on the surface of exosomes. In Example 8, we found that sIVs expressed Lamp2b at higher levels than sEVs. Therefore, we constructed a Lamp2b-RGD lentivirus to transfect MSCs. Flag is a common lentiviral tag protein, and successful Flag expression can also be used to confirm successful lentiviral transfection.

[0332] In the preliminary experiment, the transfection multiplicity of infection (MOI) of lentivirus for MSC transfection was 10, 30, and 50. MSC cells from the normal control group, empty vector group, and transfected virus group were collected for protein denaturation and Western Blot experiments. The results showed that the target lentivirus Lamp2b-RGD was successfully overexpressed in MSC. Western blot results showed that when the MOI was 30, the overexpression of Lamp2b reached the maximum (Figure 14), and Flag, a common lentiviral tag protein, was also successfully highly expressed, indicating that the Lamp2b-RGD lentivirus was successfully overexpressed in MSC. When the MOI was 30, the overexpression of the Flag tag protein reached the maximum. Subsequent experiments were performed using MOI = 30.

[0333] 3.2 In the MSC group with high expression of Lamp2b-RGD, Lamp2b expression in sIVs was higher than that in sEVs

[0334] By collecting sIVs and sEVs from normal MSCs, empty vector MSCs, and MSCs overexpressing Lamp2b-RGD, followed by protein denaturation and Western blotting, we found that Lamp2b expression in sIVs was higher than in sEVs in both normal and empty vector MSCs (Figure 15). Notably, in the Lamp2b-RGD overexpressing MSCs group, Lamp2b expression in sIVs was still higher than in sEVs (Figure 15).

[0335] 3.3 The drug loading capacity of sIVs is superior to that of sEVs

[0336] sEVs RGD sEVs loaded with PEDF-prepared composite formulations RGD @PEDF said that sIVs RGD sIVs loaded with PEDF-prepared composite formulations RGD @PEDF indicates that sEVs were detected by ELISA. RGD @PEDF and sIVs RGD @PEDF content in sIVs. The results showed that the concentration of PEDF encapsulated in sIVs was higher than that in sEVs, proving that the drug loading capacity of sIVs is better than that of sEVs (Figure 16).

[0337] 4. Summary

[0338] This example demonstrates that the Lamp2b-RGD lentivirus is successfully expressed in MSCs. Furthermore, in the MSC group with high Lamp2b-RGD expression, Lamp2b expression in sIVs is still higher than in sEVs. sIVs have a better drug-loading capacity than sEVs.

[0339] Example 10: RGD-binding integrins are highly expressed in neovascularization models in vitro and in vivo

[0340] 1. Experimental methods

[0341] 1.1 Cell culture

[0342] Human HRECs were purchased from Angioproteomie, USA. Preparation of complete cell culture medium: 5 ml of fetal bovine serum, 1 ml of growth factor and 1 ml of penicillin-streptomycin were added to 93 ml of ECM basic medium to obtain a complete culture medium containing 5% serum. Use a low-power microscope to check the cell growth density, and use a high-power microscope to observe that the cells are round, oval or polygonal flat cells with rich components in the cytoplasm and very small vacuoles in the cells. The cells were seeded in culture flasks and cultured in a 5% CO2 incubator at 37°C. The culture medium was changed every 3 days. When the cell fusion reached 80%, the cells were passaged at a subculture ratio of 1:2, and cells from P3 to P5 were used for the experiment.

[0343] 1.2 Experimental animals

[0344] Healthy male C57BL / 6 mice, 8 weeks old, weighing 21-22 g, SPF grade, were purchased from Spayfor (Animal Production License: SCXK (Beijing) 2019-0010). All experimental animals were fed a normal diet at room temperature, with a 12-h light and dark cycle. The animal husbandry environment and experimental procedures complied with the "Regulations on the Administration of Laboratory Animals" of the State Science and Technology Commission of China and were approved by the Animal Ethics Committee of our hospital (Ethics Number: TJYY2023120297). Mice were randomly assigned to groups for intravitreal injections.

[0345] 1.3 VEGF-induced proliferation of endothelial cells model

[0346] HRECs were seeded into 12-well culture plates in a half-medium medium (FBS 2.5% / ECG 0.05%). After 12 hours of incubation, the medium was replaced and the cells were divided into two groups: a normal group and a VEGF group (10 ng / ml). The cells were incubated at 37°C for 24 hours. After removing the culture medium, the cells were washed with PBS, and the RNA and protein were collected. PCR and Western blot were used to detect the expression levels of RGD-targeted integrins αV and β3 in VEGF-induced HRECs.

[0347] 1.4 Oxygen-induced retinopathy model (OIR mouse)

[0348] Newborn C57BL / 6J mice and their lactating mothers were exposed to hyperoxia (75% O₂) for 5 days on postnatal day 7 (P7) and returned to room air on P12. Each lactating mother was assigned an equal number of newborn mice, and the mothers were alternated between a hyperoxia chamber and normoxia every 24 hours. Mice were provided with a standard diet and water and randomly assigned to each treatment group. Retinal tissues were harvested on days 12, 14, and 17 for RNA and protein extraction, and PCR and Western blot were used to determine the expression of RGD-targeted integrins αV and β3 in OIR mice.

[0349] 2. Statistical processing

[0350] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0351] 3. Experimental results

[0352] 3.1 RGD-binding integrins are highly expressed in VEGF-induced endothelial cells

[0353] Vascular endothelial growth factor (VEGF) is a highly specific endothelial growth factor that promotes vascular endothelial cell growth, including increased vascular permeability, endothelial cell migration, proliferation, and angiogenesis. The VEGF-induced endothelial cell proliferation model is the most common in vitro model of retinal neovascularization. RGD is known to specifically target integrins, which are weakly expressed in resting endothelial cells and most normal tissues but highly expressed in proliferating endothelial cells, particularly integrin αv and integrin β3. Therefore, we first examined the expression of integrin αv and integrin β3 in VEGF-induced endothelial cells.

[0354] Western blot experiments were performed by collecting proteins from VEGF-induced HRECs. The results showed that RGD-binding integrins αV and β3 were highly expressed in VEGF-induced proliferating endothelial cells ( FIG. 17 ).

[0355] RGD-binding integrins are highly expressed in the retina of OIR mice

[0356] The oxygen-induced retinal neovascularization (OIR) mouse model uses high oxygen to create a non-perfused area of ​​the retina, inducing a significant upregulation of angiogenic factors, thereby forming new blood vessels. It is often used to verify the effects of drugs or therapeutic targets targeting retinal neovascularization.

[0357] RNA from mouse retinas at P12, P14, and P17 was collected for PCP, and the results showed that RGD-binding integrin αV was highly expressed in the retinas of OIR mice at P12, P14, and P17, and integrin β3 was highly expressed in the retinas of OIR mice at P14 and P17 (Figure 18). Protein from mouse retinas at P12, P14, and P17 was collected for Western blot, and the results showed that RGD-binding integrin αV was highly expressed in the retinas of OIR mice at P12, P14, and P17, and integrin β3 was highly expressed in the retinas of OIR mice at P17 (Figure 19).

[0358] 4. Summary

[0359] This example demonstrates that RGD-binding integrin αV and integrin β3 are highly expressed in VEGF-induced endothelial cells and OIR mice, indicating that sIVs and sEVs that highly express RGD can be used to study therapeutic effects.

[0360] Example 11: sIVs-RGD has a stronger ability to target neovascular endothelial cells than sEVs-RGD

[0361] 1. Experimental methods

[0362] 1.1 Cell culture

[0363] Human HRECs were purchased from Angioproteomie, USA. Preparation of complete cell culture medium: 5 ml of fetal bovine serum, 1 ml of growth factor and 1 ml of penicillin-streptomycin were added to 93 ml of ECM basic medium to obtain a complete culture medium containing 5% serum. Use a low-power microscope to check the cell growth density, and use a high-power microscope to observe that the cells are round, oval or polygonal flat cells with rich components in the cytoplasm and very small vacuoles in the cells. The cells were seeded in culture flasks and cultured in a 5% CO2 incubator at 37°C. The culture medium was changed every 3 days. When the cell fusion reached 80%, the cells were passaged at a subculture ratio of 1:2, and cells from P3 to P5 were used for the experiment.

[0364] 1.2 Experimental animals

[0365] Healthy male C57BL / 6 mice, 8 weeks old, weighing 21-22 g, SPF grade, were purchased from Spayfor (Animal Production License: SCXK (Beijing) 2019-0010). All experimental animals were fed a normal diet at room temperature, with a 12-h light and dark cycle. The animal husbandry environment and experimental procedures complied with the "Regulations on the Administration of Laboratory Animals" of the State Science and Technology Commission of China and were approved by the Animal Ethics Committee of our hospital (Ethics Number: TJYY2023120297). Mice were randomly assigned to groups for intravitreal injections.

[0366] 1.3 Co-culture of DiD-labeled sIVs and sEVs with cells

[0367] The vesicles were incubated with a lipid-soluble tracer solution of DiD at 37°C for 30 minutes. Ultra centrifugal filter to remove excess DiD. The cells were seeded into pre-placed circular pieces on a 24-well culture plate and incubated for 24 hours. DiD-labeled vesicles were added to the culture medium of the cells and grouped into: empty group and Lamp2b-RGD high expression group. The sIVs and sEVs (sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD vesicles were obtained by referring to the description in 1.3 of Example 9) collected by UMCs were incubated at 37°C for different times: 12 hours or 24 hours. After removing the culture medium, the cells were washed with PBS at room temperature. The cells were fixed with 4% PFA for 10 minutes and then incubated with 0.1% Triton X-100 for 5 minutes at room temperature to allow the cells to permeabilize. Subsequently, the cells were fixed with 4% PFA for 10 minutes and then incubated with 0.1% Triton X-100 at room temperature for 5 minutes to allow the cells to permeabilize. Subsequently, the cells were fixed with The cells were then stained with a phalloidin antibody conjugated to Plus 488 for 30 minutes. DAPI was used to label the nuclei. Finally, cells were imaged using a confocal laser scanning microscope, and the amount of endocytosed vesicles was analyzed using Image J.

[0368] 1.4 Intravitreal injection of DiD-labeled vesicles into OIR mice

[0369] OIR mice were established as described above, and vesicles were stained with DiD as described above. 1 μg of DiD-labeled vesicles were injected subconjunctivally into OIR mice. Eyeballs were harvested for observation and evaluation 8 hours, 24 hours, and 5 days after injection.

[0370] 1.5 Retinal sections

[0371] Frozen retinal sections (8 μm thick) were used for immunofluorescence analysis. Retinal sections were fixed with PFA for 15 minutes at room temperature, then the slides were washed with PBS and the cell nuclei were stained with DAPI. Finally, the sections were mounted with anti-fluorescence attenuation mounting medium and observed using a confocal laser scanning microscope.

[0372] 2. Statistical processing

[0373] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0374] 3. Experimental results

[0375] 3.1 Cells have a better ability to internalize sIVs-RGD than sEVs-RGD

[0376] In order to evaluate the phagocytic ability of cells for the two types of vesicles, HRECs were co-cultured with the above four groups of vesicles (sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD) for 12h (Figure 20) and 24h (Figure 21). In brief, equal amounts of DiD-labeled vesicles were incubated with normal cells and VEGF-induced HRECs, and the distribution of DiD was observed using confocal microscopy at different time points to observe the amount of vesicle uptake by cells. The results showed that in HRECs, the internalization rate of sIVs by cells always exceeded that of sEVs. It is worth noting that the internalization rate of RGD-targeted sIVs-RGD by cells was always higher than that of sEVs-RGD.

[0377] 3.2 sIVs-RGD penetrates the retina faster and remains in the retina longer than sEVs-RGD

[0378] To evaluate the retinal phagocytosis of four groups of vesicles (sEVs-GFP, sEVs-RGD, sIVs-GFP, and sIVs-RGD), equal amounts of DiD-labeled vesicles were administered intravitreally into the eyes of OIR mice, a model of retinal neovascularization. Eyeball samples were collected at different time points, frozen sections were prepared, and vesicle uptake within the retina was observed using confocal microscopy.

[0379] After intravitreal injection of DiD-labeled vesicles, the vesicles spread from the vitreous cavity to the retina. The results showed that 8 hours after injection, sEVs were distributed in the vitreous cavity and had not yet reached the retina, while sIVs had reached the entire retinal layer and were internalized by cells in the ganglion cell layer and the inner nuclear layer. The internalization rate of sIVs-RGD exceeded that of sIVs-GFP and sEVs-RGD (Figure 22A and B). 24 hours after intravitreal injection, the four types of vesicles were diffusely distributed throughout the retina, and the internalization rate of sIVs-RGD always exceeded that of sIVs-GFP and sEVs-RGD (Figure 22C and D). Subsequently, the distribution of the four types of vesicles in the retina gradually decreased after 5 days, but the distribution trend remained the same as the previous observations (Figure 22E and F). Notably, sIVs-RGD penetrated the retina faster and retained longer than sEVs, and the internalization rate of sIVs with high RDG expression in the retina of OIR mice was always higher than that of sIVs.

[0380] 4. Summary

[0381] This example demonstrates that cells cultured in vitro have a better ability to internalize sIVs than sEVs, and that sIVs with high RDG expression have a higher uptake rate in proliferating endothelial cells compared to sIVs and sEVs with high RDG expression. Intravitreal injection in mice revealed that the retina internalizes sIVs better than sEVs. sIVs-RGD penetrates the retina faster and remains there longer than sEVs, and sIVs with high RDG expression consistently have a higher internalization rate than sIVs in the retinas of OIR mice. This finding demonstrates the good tissue compatibility of sIVs and the enhanced targeting ability of sIVs-RGD to neovascular endothelial cells.

[0382] Example 12: sIVs RGD The therapeutic effect of PEDF on angiogenesis model in vitro

[0383] 1. Experimental methods

[0384] 1.1 Proliferation assay

[0385] HRECs were seeded in 96-well plates at a cell density of 4500 / well. VEGF solution (10 ng / ml) was added to the culture medium. Different groups were designed, with only VEGF solution added as the positive control group, and groups including sIVs-GFP, PEDF, sIVs GFP @PEDF, sIVs RGD @PEDF, sEVs RGD @PEDF, the sources of each vesicle refer to Example 9.

[0386] After culturing the experimental groups for 24 h, the proliferation of cells in each group was tested using the CCK method.

[0387] 1.2 Transwell migration assay

[0388] HRECs were seeded at 8,000 per well on the upper semipermeable membrane of a Transwell chamber in a 24-well plate. The membrane was coated with an extracellular matrix to allow cell adhesion and migration. Culture medium was added to the lower chamber below the membrane. After incubation for 24 hours, the cells were grouped as described above. HRECs that passed through the membrane were stained and counted, and the data were recorded and analyzed for their inhibitory effects on HREC migration.

[0389] 1.3 Protein expression levels of inflammatory factors and angiogenesis-related factors

[0390] Proteins extracted from HRECs in each experimental group after 24 hours of treatment were quantified using the BCA assay. Equal amounts of protein were mixed with loading buffer for denaturation. The proteins were then subjected to electrophoresis using 7.5-12.5% ​​SDS-PAGE gels, followed by transfer, blocking, antibody incubation, and color development. The expression of the target proteins was then determined, and their effects on the protein expression of inflammatory and angiogenesis-related factors were evaluated.

[0391] 2. Statistical processing

[0392] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0393] 3. Experimental results

[0394] 3.1 sIVs RGD @PEDF inhibits VEGF-induced endothelial cell proliferation--CCK experiment

[0395] CCK test is a commonly used method to detect cell proliferation. The results show that simple sIVs cannot significantly inhibit the proliferation of endothelial cells, while sIVs RGD @PEDF can significantly inhibit the proliferation of endothelial cells, although it is similar to sEVs RGD -PEDF had no significant statistical difference, but compared with sIVs GFP PEDF significantly inhibited the proliferation of HRECs ( FIG. 23 ).

[0396] 3.2 sIVs RGD @PEDF inhibits VEGF-induced endothelial cell migration--Transwell experiment

[0397] Transwell assay is a commonly used method to detect cell migration. The results show that simple sIVs cannot significantly inhibit the migration of endothelial cells, while sIVs RGD @PEDF can significantly inhibit the migration of endothelial cells, although it is similar to sEVs RGD -PEDF had no significant statistical difference, but compared with sIVs GFP PEDF significantly inhibited the migration of HRECs ( FIG. 24 ).

[0398] 3.3 sIVs RGD @PEDF inhibits the release of inflammatory factors in endothelial cells induced by VEGF

[0399] ICAM-1 (intercellular cell adhesion molecule-1), a member of the immunoglobulin superfamily of adhesion molecules, is a key adhesion molecule mediating adhesion responses. ICAM-1 is expressed at low levels on resting endothelial cells and is highly expressed in VEGF-induced endothelial cells.

[0400] The expression level of ICAM-1 was detected by collecting protein from endothelial cells. The results showed that sIVs RGD @PEDF significantly reduced the expression level of ICAM-1, compared with simple PEDF and sIVs RGD Compared with sIVs, the treatment effect is more significant, and sIVs RGD @PEDF and sEVs RGD @PEDF has the same ability to inhibit ICAM-1 (Figure 25), indicating that sIVs RGD @PEDF and sEVs RGD @PEDF has the same effect of suppressing inflammation.

[0401] 4. Summary

[0402] sIVs RGD @PEDF inhibited the proliferation and migration of endothelial cells induced by VEGF, and compared with sIVs-GFP, PEDF and sIVs GFP @PEDF has a significant inhibitory effect on the proliferation of HRECs, and RGD There was no statistically significant difference in the effect of @PEDF.

[0403] Example 13: sIVs RGDIn vitro experiments on PEDF compound preparations

[0404] 1. Experimental methods

[0405] 1.1 Intravitreal injection of OIR mice

[0406] OIR mice were modeled as described above. At P12, 1 μl of liquid was injected into each eye. The groups included PBS, sIVs-GFP, PEDF, and sIVs. GFP @PEDF, sIVs RGD @PEDF, sEVs RGD @PEDF, the origin of each vesicle was referred to Example 9, and then observed and evaluated.

[0407] 1.2 Retinal flat mount staining and analysis of neovascularization area and nonperfused area

[0408] Retinal flat mounts were prepared at P17. Mouse eyes were removed and fixed in room-temperature paraformaldehyde for 15 minutes, then placed in cold PBS for 5-10 minutes. The eyes were then transferred to gauze. Under an operating microscope, an incision was made at the corneoscleral limbus. The sclera was gently dissected with two toothed forceps, and the lens was removed. The retina was cut into four sections with small scissors, and obvious vascular clusters were trimmed. Cold anhydrous methanol was gently dripped over the retina for fixation. After the retina turned white, it was transferred to a 2 ml flat-bottomed EP tube. The anhydrous methanol in the EP tube was aspirated, and the retina was washed twice with PBS at 4°C. 1 ml of blocking solution was added and shaken at 4°C for 2 hours. The retina was washed twice with PBS, and 200 μl of IB4 was added and shaken at 4°C overnight in the dark. The retina was washed five times with PBS for 1 hour each, and the slides were mounted after each wash. The stained retinas were photographed under a confocal microscope, and the areas of retinal neovascularization and nonperfused areas were annotated and counted using Photoshop software. Statistical differences between groups were analyzed.

[0409] 1.3 Electroretinogram (ERG)

[0410] Retinal neural function was tested on P25 (±1d) and P42 (±1 day) mice using an electroretinogram instrument to evaluate the retinal function of OIR mice. The mice were dark-adapted overnight and anesthetized before ERG. The cornea was anesthetized with 0.5% propoxytacaine, and gatifloxacin eye gel was applied to the ocular surface to prevent tissue drying. A reference electrode was inserted under the scalp, near the midline between the ears, and another electrode was inserted into the tail of the mouse. The settings were -1.1, 0.1, 1.0, and 3.0 log (cd·s / m 2) light intensity stimulation parameter range, and each mouse was tested three times to obtain the average value. The a-wave amplitude was measured from baseline to the trough of the a-wave, and the b-wave amplitude was measured from the peak of the a-wave to the peak of the b-wave, and was automatically quantified using ERG software.

[0411] 1.4 Protein expression levels of inflammatory factors and angiogenesis-related factors

[0412] Proteins extracted from the retinas of P17 mice treated with the above experimental groups were quantified using the BCA assay. Equal amounts of protein were thoroughly mixed with loading buffer and denatured. The proteins were then subjected to electrophoresis using 7.5-12.5% ​​SDS-PAGE gels, followed by transfer, blocking, antibody incubation, and color development. The expression of the target proteins was then measured, and their effects on the protein expression of inflammatory factors and angiogenesis-related factors were evaluated.

[0413] 2. Statistical processing

[0414] The experimental data are expressed as mean ± standard deviation All experimental data were tested for normality. All quantitative data were analyzed using SPSS 22.0. One-way ANOVA was used for analysis of variance, with least significant difference (LSD) analysis for post hoc testing. Nonparametric tests were used for nonnormally distributed data and data with unequal variances, and P values ​​< 0.05 were considered statistically significant.

[0415] 3. Experimental results

[0416] 3.1 sIVs RGD PEDF significantly reduced the area of ​​retinal nonperfusion in OIR mice and inhibited the formation of new blood vessels

[0417] OIR mice were treated with different concentrations of sIVs RGD @PEDF and sEVs RGD @PEDF intravitreal injection, retinal flat-section was performed at P17, and the area of ​​retinal non-perfusion area and neovascularization area were counted. The results showed that sIVs RGD @PEDF inhibited the formation of retinal non-perfusion area and neovascularization at low concentration (0.5mg / ml), medium concentration (1mg / ml) and high concentration (2mg / ml). The therapeutic effect of medium concentration was more obvious than that of low concentration, but there was no significant statistical difference between the therapeutic effect of medium concentration and high concentration. Therefore, medium concentration of sIVs was selected. RGD @PEDF and sEVs RGD @PEDF conducted subsequent experiments (Figure 26).

[0418] The retinal non-perfusion area and the area of ​​new blood vessels were counted by flat mount of the mice in each treatment group. The results showed that sIVs RGD PEDF significantly inhibited the formation of retinal non-perfused areas and neovascularization, which was similar to sEVs. RGD @PEDF has the same therapeutic effect as untargeted sIVs GFP @PEDF has a better therapeutic effect than the other two groups (Figure 27).

[0419] 3.2 sIVs RGD PEDF has a better neuroprotective effect than sEVs RGD @PEDFStrong

[0420] We used ERG to evaluate the retinal electrophysiological function of OIR mice at P42 and found that the amplitudes of the a-wave and b-wave of the ERG in untreated OIR mice were reduced (Figure 28A and C), indicating a decrease in the function of bipolar cells and photoreceptor cells. Statistically, the light response of OIR mice was significantly reduced at all tested flash intensities, including sIVs and sIVs. GFP @PEDF, sIVs RGD @PEDF and sEVs RGD @PEDF treatment significantly rescued the retinal light response (Figure 28). In addition, sIVs RGD @PEDF significantly outperformed sEVs in improving a-wave and b-wave amplitudes at the highest stimulation. RGD @PEDF and sIVs GFP @PEDF (B and D in Figure 28). In summary, our results suggest that sIVs RGD PEDF has a better neuroprotective effect than sEVs RGD @PEDF and sIVs GFP @PEDF Strong.

[0421] 3.3 sIVs RGD @PEDF's ability to inhibit inflammation is better than sEVs RGD @PEDFStrong

[0422] GFAP is a marker of astrocyte activation and an important factor related to retinal inflammation. The expression level of GFAP was detected by collecting retinal proteins of OIR mice at P17. The results showed that sIVs RGD PEDF significantly reduced the expression level of GFAP and was more effective than non-targeted sIVs GFP @PEDF has a more significant therapeutic effect than sIVs RGDThe ability of PEDF to inhibit GFAP expression is better than that of sEVs RGD @PEDF is stronger, indicating sIVs RGD @PEDF is more effective than non-targeted treatments, and sIVs RGD @PEDF's ability to inhibit inflammation is better than sEVs RGD @PEDF is stronger (A and B in Figure 29).

[0423] Vascular endothelial growth factor (VEGF) is a highly specific growth factor that promotes vascular endothelial cell growth. It has the functions of increasing vascular permeability, promoting vascular endothelial cell migration, proliferation and angiogenesis. It is an important angiogenesis-related factor. The expression level of VEGF was detected by collecting retinal proteins of P17 OIR mice. The results showed that sIVs RGD PEDF significantly reduced the expression level of VEGF and was more effective than non-targeted sIVs GFP @PEDF has a more significant therapeutic effect than sIVs RGD @PEDF and sEVs RGD @PEDF has the same ability to inhibit VEGF, indicating that it has the same ability to inhibit VEGF in sIVs with angiogenesis targeting effect. RGD @PEDF is more effective than non-targeted treatments, and sIVs RGD @PEDF and sEVs RGD @PEDF has the same inhibitory effect on VEGF (Figure 29A and C).

[0424] 4. Summary

[0425] sIVs RGD The therapeutic effect of PEDF on OIR mice was dose-dependent. At a dose of 1 mg / ml, it significantly reduced the area of ​​retinal non-perfusion in OIR mice, inhibited the formation of new blood vessels, suppressed retinal inflammation, and protected the structure and function of the retina. It was more effective than sIVs with the ability to target new blood vessels. GFP @PEDF has a stronger effect. It is worth noting that sIVs RGD PEDF's ability to inhibit inflammation and protect neurons is better than sEVs RGD @PEDF Strong.

[0426] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

[0427] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience, and preference of those skilled in the art.

[0428] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. A method for preparing targeted nanovesicles derived from cells, comprising the following steps: (1) introducing nucleotides encoding a fusion protein of the targeting molecule-Lamp2b into cells; (2) dispersing the cells obtained in step (1) in a suspending solvent and subjecting them to ultrasonic treatment; (3) centrifuging the liquid obtained in step (2) once or multiple times, discarding cell membranes and organelle fragments, and taking the supernatant; (4) The supernatant obtained in step (3) is subjected to ultracentrifugation, and the precipitate is obtained as the intracellular nanovesicles.

2. The method according to claim 1, characterized in that Step (1) comprises: constructing a plasmid that overexpresses a fusion protein of a targeting molecule-Lamp2b, then packaging the plasmid into a lentivirus, and transfecting cells with the lentivirus.

3. The method according to claim 1, characterized in that The targeting molecule is selected from: polypeptides, antibodies, activating or inhibiting receptors, protein ligands, biologically active enzymes, nucleic acid drugs, or a combination thereof.

4. The method according to claim 3, characterized in that The targeting molecule is a polypeptide.

5. The method according to claim 4, characterized in that The targeting molecule is selected from A25 polypeptide or RGD polypeptide.

6. The method according to any one of claims 3 to 5, characterized in that: The targeting molecule is located at the N-terminus of Lamp2b.

7. The preparation method according to claim 1, characterized in that: The amplitude of the ultrasonic treatment in step (2) is 20%-25%, and / or the time of the ultrasonic treatment is 10-20s.

8. The preparation method according to claim 7, characterized in that: The amplitude of the ultrasonic treatment in step (2) is 20%; and / or the time of the ultrasonic treatment is 15s, on 2s, off 2s.

9. The preparation method according to claim 1, characterized in that: The number of centrifugation treatments in step (3) is two times. Their respective parameters are: 1000-3000g, 5-20 minutes; 10000-30000g, 20-40 minutes; The parameters of the ultracentrifugation treatment in step (4) include 100000-180000 g, 50-100 minutes.

10. The preparation method according to claim 1, characterized in that: The cell is at least one of a stem cell, a cardiomyocyte, a human embryonic kidney cell, a macrophage, a T cell and a tumor cell.

11. The preparation method according to claim 10, characterized in that: The stem cells are mesenchymal stem cells, which include umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, dental pulp mesenchymal stem cells, placenta, amniotic fluid and amniotic membrane mesenchymal stem cells.

12. The vesicle prepared according to the method according to any one of claims 1 to 11.

13. The vesicle according to claim 12, characterized in that The vesicles are intracellular nanovesicles modified by overexpression of A25-Lamp2b or intracellular nanovesicles modified by overexpression of RGD-Lamp2b.

14. Use of the vesicle prepared according to the method according to any one of claims 1 to 11 as a drug carrier in the preparation of drugs for preventing and / or treating diseases.

15. The use according to claim 14, characterized in that: The disease is an eye disease.

16. The use according to claim 15, characterized in that The disease is autoimmune uveitis or retinal neovascular disease.

17. A method for preparing drug-loaded vesicles, comprising using the vesicles prepared by the method according to any one of claims 1 to 11 as drug carriers for drug loading.

18. A drug-loaded vesicle, using the vesicle prepared by the method according to any one of claims 1 to 11 as a drug carrier.

Images