Nucleic acid construct for gene therapy and use thereof

Abstract

Provided are a nucleic acid construct for gene therapy and a use thereof. The nucleic acid construct encodes an anti-PCSK9 antibody or an antigen-binding fragment thereof. Also provided are a recombinant virus, such as a recombinant adeno-associated virus and a recombinant lentivirus, prepared from the nucleic acid construct, and a use of the nucleic acid construct and the recombinant virus in the treatment of a hyperlipidemic disease.

Description

Nucleic acid constructs for gene therapy and uses thereof Technical Field

[0001] The present invention belongs to the field of gene therapy, and specifically relates to a nucleic acid construct for gene therapy of hyperlipidemic diseases. The nucleic acid construct can be used for gene therapy of diseases such as familial hypercholesterolemia and atherosclerosis. Background Art

[0002] According to the "China Cardiovascular Health and Disease Report 2019" released by the National Center for Cardiovascular Disease, the prevalence of cardiovascular disease (CVD) in my country continues to rise. It is estimated that approximately 330 million people currently suffer from CVD. In fact, CVD deaths account for 40% of all deaths, far exceeding cancer and other diseases. The most common CVD is atherosclerotic cardiovascular disease (ASCVD), which accounts for over 95% of all causes.

[0003] Familial hypercholesterolemia (FH) is a genetic disorder closely associated with early atherosclerotic cardiovascular disease (ASCVD) and high mortality. It is an inherited disorder of lipoprotein metabolism and one of the most common inherited metabolic diseases. The root cause of FH is a genetic defect in the low-density lipoprotein receptor (LDL-R) or the protein that regulates its metabolism, resulting in abnormally low liver uptake of low-density lipoprotein (LDL). As a result, circulating cholesterol accumulates, leading to an increased risk of cardiovascular disease.

[0004] Current treatments for hyperlipidemia (including FH) primarily include statins and non-statin drugs, as well as antibody-based PCSK9 inhibitors. These drugs each offer advantages in therapeutic efficacy, but also have corresponding drawbacks. Statins lower total cholesterol and low-density lipoprotein cholesterol (LDL-C) by inhibiting 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase. Multiple studies have clearly demonstrated that statins can lower LDL-C levels, thereby reducing the risk of incident cardiovascular disease (CVD) and mortality and disease progression in patients with clinical ASCVD. Statins are the mainstay of treatment for hyperlipidemia, including FH. However, while statins are generally well tolerated, they are associated with numerous adverse effects, including gastrointestinal events, musculoskeletal pain, respiratory infections, and headaches. Statins may also be associated with elevated blood glucose and glycated hemoglobin (A1C) levels. Statins are contraindicated in patients with active liver disease and unexplained and chronic elevations of liver enzymes and transaminases. This leads to the need for patients who are not suitable for statins to seek other drug treatments.

[0005] For patients who do not respond well to statins or are intolerant to statins, several non-statin drugs can be used as adjunctive therapy. These include bile acids, fibric acids, niacin, cholesterol absorption and synthesis inhibitors, and PCSK9 inhibitors. Non-statin drugs primarily lower lipoproteins by binding bile acids, hindering bile acid reabsorption and enterohepatic circulation, increasing the conversion of cholesterol to bile acids, and increasing the number of liver LDL-Rs to lower cholesterol, triglycerides, increase HDL-C, lower very low-density lipoprotein (VLDL) levels, and inhibit cholesterol absorption in the intestine.

[0006] Proprotein convertase subtilisin / kexin type 9 (PCSK9) is a serine protease produced by hepatocytes. PCSK9 prevents LDL-R recirculation by binding to the LDL-R on the hepatocyte surface and subsequently inducing its lytic degradation. This leads to LDL accumulation in the circulation and ultimately promotes atherosclerosis. Therefore, if PCSK9 binding to LDL-Rs can be blocked, thereby preventing PCSK9-mediated LDL-R degradation in the liver, LDL-R levels on the hepatocyte surface can be increased, thereby promoting LDL-C uptake and clearance, and lowering plasma LDL-C levels. Based on this concept, two antibody drugs currently approved for PCSK9 blocking are alirocumab (Praluent), jointly developed by Sanofi and Regeneron, and evolocumab (Repatha), developed by Amgen. They are used in adults with heterozygous FH (HeFH) or in patients with clinical ASCVD who require additional LDL-C lowering. PCSK9 inhibitors have a good lipid-lowering effect, but they also have some disadvantages, such as being prone to allergic reactions, which can lead to medication interruption. In addition, the half-life of Evolocumab (Repatha) is 11-17 days, and the half-life of Alirocumab (Praluent) is 17-20 days (Chanukya Dahagam, Aditya Goud, Abdelhai Abdelqader1, et al. PCSK9 inhibitors and their role in high-risk patients in reducing LDL cholesterol levels: alirocumab. Future Cardiol. 2016; 12(2): 149-57.), which means that patients need to inject the drug about every two weeks.

[0007] Therefore, there is still a need to develop new drugs for hyperlipidemia that can prolong the duration of drug efficacy while ensuring good therapeutic effects and avoiding the inconvenience of multiple dosing for patients.

[0008] Summary of the Invention

[0009] Based on the principle that blocking the binding of PCSK9 to LDL-R can achieve the purpose of lowering LDL-C, the present invention creatively invented a recombinant adeno-associated virus (rAAV) vector and a recombinant lentiviral vector for treating hyperlipidemia. The vector carries a gene encoding an anti-PCSK9 antibody or an antigen-binding fragment thereof, and can be administered in vivo to enable the body to continuously produce anti-PCSK9 antibodies or antigen-binding fragments thereof, thereby reducing the PCSK9 content in the body, increasing the LDL-R content, and achieving the purpose of lowering the LDL-C content.

[0010] Accordingly, in a first aspect, the present invention provides a nucleic acid construct for gene therapy, comprising a nucleotide sequence encoding an anti-PCSK9 antibody or an antigen-binding fragment thereof, wherein the nucleotide sequence encoding the anti-PCSK9 antibody or an antigen-binding fragment thereof comprises a first coding region encoding the heavy chain variable region of the antibody and a second coding region encoding the light chain variable region of the antibody, and the first coding region and the second coding region are connected by a nucleotide sequence encoding a linker or an internal ribosome entry site (IRES).

[0011] In some embodiments, the anti-PCSK9 antibody is selected from Alirocumab and Evolocumab.

[0012] In some embodiments, the antigen-binding fragment derived from an anti-PCSK9 antibody can be selected from Fab, Fab', F(ab')2, Fv, scFv, and ds-scFv.

[0013] In some embodiments, the nucleic acid construct comprises a first coding region encoding a heavy chain of an anti-PCSK9 antibody and a second coding region encoding a light chain of an anti-PCSK9 antibody. In some embodiments, the nucleic acid construct encodes the following structure from the 5' end to the 3' end:

[0014] (1) Alirocumab heavy chain-linker-Alirocumab light chain;

[0015] (2) Alirocumab light chain-linker-Alirocumab heavy chain;

[0016] (3) Evolocumab heavy chain-linker-Evolocumab light chain; or

[0017] (4) Evolocumab light chain-linker-Evolocumab heavy chain;

[0018] Here, linker is a nucleotide sequence encoding a linker or an internal ribosome entry site (IRES).

[0019] In some embodiments, the alirocumab heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 17, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 17. In some embodiments, the nucleotide sequence encoding the alirocumab heavy chain in the nucleic acid construct of the invention comprises the nucleotide sequence set forth in SEQ ID NO: 19 or 21, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 19 or 21.

[0020] In some embodiments, the alirocumab light chain comprises the amino acid sequence set forth in SEQ ID NO: 18, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 18. In some embodiments, the nucleotide sequence encoding the alirocumab light chain in the nucleic acid construct of the invention comprises the nucleotide sequence set forth in SEQ ID NO: 20 or 22, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 20 or 22.

[0021] In some embodiments, the Evolocumab heavy chain comprises the amino acid sequence set forth in SEQ ID NO: 23, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 23. In some embodiments, the nucleotide sequence encoding the Evolocumab heavy chain in the nucleic acid construct of the present invention comprises the nucleotide sequence set forth in SEQ ID NO: 25 or 27, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 25 or 27.

[0022] In some embodiments, the Evolocumab light chain comprises the amino acid sequence set forth in SEQ ID NO: 24, or an amino acid sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 24. In some embodiments, the nucleotide sequence encoding the Evolocumab light chain in the nucleic acid construct of the present invention comprises the nucleotide sequence set forth in SEQ ID NO: 26 or 28, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 26 or 28.

[0023] 2A peptides are short peptides derived from viruses that enable the translation of multiple polypeptide chains from a single transcript. 2A peptides work by causing the ribosome to skip the synthesis of the glycine and proline peptide bonds at the C-terminus of the 2A element, ultimately leading to the separation of the end of the 2A sequence from the downstream polypeptide chain. After translation of two proteins linked by the nucleotide sequence encoding the 2A peptide, the upstream protein will have additional 2A residues at its C-terminus, while the downstream protein will have an additional proline at its N-terminus.

[0024] In some embodiments, the linker encoded by the nucleotide sequence connecting the first coding region and the second coding region is a 2A peptide linker. In some embodiments, the 2A peptide linker comprises a 2A peptide selected from the group consisting of foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), thosea asign virus 2A peptide (T2A), and equine rhinitis virus 2A peptide (E2A). In some preferred embodiments, the 2A peptide linker comprises an amino acid sequence selected from any one of SEQ ID NOs: 30-33. In some more preferred embodiments, the 2A peptide linker comprises the amino acid sequence set forth in SEQ ID NO: 31.

[0025] In some embodiments, the 5' ends of the first and second coding regions further comprise a nucleotide sequence encoding a signal peptide, and the signal peptides encoded by the first and second coding regions may be the same or different. In some preferred embodiments, the signal peptide may be selected from the group consisting of: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, SP1 signal peptide, and H1 signal peptide. In some more preferred embodiments, the signal peptide may be selected from the group consisting of: IL2 signal peptide, TPA signal peptide, SP1 signal peptide, H7 signal peptide, H1 signal peptide, CSP signal peptide, and L1 signal peptide.

[0026] In some embodiments, the SAP signal peptide comprises the amino acid sequence shown in SEQ ID NO:6.

[0027] In some embodiments, the IHC signal peptide comprises the amino acid sequence shown in SEQ ID NO:7.

[0028] In some embodiments, the ILC signal peptide comprises the amino acid sequence shown in SEQ ID NO:8.

[0029] In some embodiments, the AP signal peptide comprises the amino acid sequence shown in SEQ ID NO:9.

[0030] In some embodiments, the CSP signal peptide comprises the amino acid sequence shown in SEQ ID NO:10.

[0031] In some embodiments, the IL2 signal peptide comprises the amino acid sequence shown in SEQ ID NO:11.

[0032] In some embodiments, the TPA signal peptide comprises the amino acid sequence shown in SEQ ID NO:12.

[0033] In some embodiments, the L1 signal peptide comprises the amino acid sequence shown in SEQ ID NO:13.

[0034] In some embodiments, the H7 signal peptide comprises the amino acid sequence shown in SEQ ID NO:14.

[0035] In some embodiments, the SP1 signal peptide comprises the amino acid sequence shown in SEQ ID NO:15.

[0036] In some embodiments, the H1 signal peptide comprises the amino acid sequence shown in SEQ ID NO:16.

[0037] In some embodiments, the nucleic acid construct of the present invention comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 41-51, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 41-51. In some preferred embodiments, the nucleic acid construct of the present invention comprises a nucleotide sequence as shown in SEQ ID NOs: 41 or 42, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NOs: 41 or 42.

[0038] In some embodiments, the nucleic acid construct of the present invention further comprises a promoter, which is operably linked to the nucleotide sequence encoding the anti-PCSK9 antibody or antigen-binding fragment thereof for expression of the nucleotide sequence. In some embodiments, the promoter is selected from any one of a CMV promoter, a CBH promoter, an EF1α promoter, a CAG promoter, a CAGG promoter, a CASI promoter, a desmin promoter, a TMCK promoter, a MCK promoter, a MHCK7 promoter, a PGK promoter, and a TTR promoter. In some preferred embodiments, the promoter is selected from a CAG promoter, a CAGG promoter, and a CBH promoter.

[0039] In some embodiments, the CMV promoter comprises the nucleotide sequence shown in GenBank Accession No. MN996867.1, positions 235-818.

[0040] In some embodiments, the CBH promoter comprises the nucleotide sequence shown in SEQ ID NO: 1.

[0041] In some embodiments, the EF1α promoter comprises the nucleotide sequence shown in GenBank Accession No. KY447299.1, positions 529-1710.

[0042] In some embodiments, the CAG promoter comprises the nucleotide sequence shown in GenBank Accession No. KC152483.1, positions 200-1096.

[0043] In some embodiments, the CAGG promoter comprises the nucleotide sequence shown in GenBank Accession No. GU299216.1, positions 63-1664.

[0044] In some embodiments, the CASI promoter comprises the nucleotide sequence shown in GenBank Accession No. ON512571.1, positions 80-1104.

[0045] In some embodiments, the desmin promoter comprises the nucleotide sequence shown in GenBank Accession No. M63391.1, positions 2194-3233.

[0046] In some embodiments, the TMCK promoter comprises the nucleotide sequence shown in SEQ ID NO:2.

[0047] In some embodiments, the MCK promoter comprises the nucleotide sequence shown in SEQ ID NO:3.

[0048] In some embodiments, the MHCK7 promoter comprises the nucleotide sequence shown in SEQ ID NO:4.

[0049] In some embodiments, the PGK promoter comprises the nucleotide sequence shown in GenBank Accession No. JF313343.1, positions 683-1192.

[0050] In some embodiments, the TTR promoter comprises the nucleotide sequence shown in SEQ ID NO:5.

[0051] In some embodiments, the nucleic acid construct of the present invention is a viral vector. In some embodiments, the viral vector of the present invention is selected from a bovine papilloma virus vector, an Epstein-Barr virus vector, a retroviral vector (eg, a lentiviral vector), and an adeno-associated virus vector.

[0052] In some embodiments, the viral vector is an adeno-associated viral vector. In some preferred embodiments, the adeno-associated viral vector further comprises one or more elements selected from the group consisting of a polyadenylation signal of SV40 virus (SV40SL), a woodchuck hepatitis B virus post-transcriptional regulatory element (WPRE), and an inverted terminal repeat (ITR).

[0053] In some embodiments, the viral vector is a lentiviral vector. In some preferred embodiments, the lentiviral vector further comprises one or more elements selected from the group consisting of a chimeric LTR promoter, an HIV-1 packaging signal (ψ), a central polypurine tract (cPPT), a Rev response element (RRE), a polypurine tract (PPT), a woodchuck hepatitis B virus posttranscriptional regulatory element (WPRE), an SV40 virus polyadenylation signal (SV40SL), an SV40 virus replication origin (SV40 ori), and a self-inactivating long terminal repeat sequence.

[0054] In a second aspect, the present invention provides a viral particle comprising the nucleic acid construct of the first aspect of the present invention. In some preferred embodiments, the viral particle of the present invention is an adeno-associated viral particle or a lentiviral particle.

[0055] In some embodiments, the viral particle of the invention is an adeno-associated viral particle, and the adeno-associated viral particle is of the AAV8 or AAV6 serotype.

[0056] In a third aspect, the present invention provides a cell comprising the nucleic acid construct of the first aspect of the present invention.

[0057] In some embodiments, the nucleic acid construct contained in the cell of the present invention is an adeno-associated viral vector, and the cell further comprises a serotype plasmid and / or a helper plasmid for assembling the nucleic acid construct into viral particles. In some preferred embodiments, the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

[0058] In some embodiments, a serotype plasmid suitable for use in the present invention comprises a nucleotide sequence as set forth in SEQ ID NO: 34 or 35, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 34 or 35.

[0059] In some embodiments, a helper plasmid suitable for use in the present invention comprises a nucleotide sequence as shown in SEQ ID NO:36, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% sequence identity to SEQ ID NO:36.

[0060] In some embodiments, the nucleic acid construct contained in the cell of the present invention is a lentiviral vector, and the cell further comprises an envelope plasmid and / or a packaging plasmid for assembling the nucleic acid construct into viral particles.

[0061] In a fourth aspect, the present invention provides a vector system comprising the nucleic acid construct of the first aspect of the invention, and optionally one or more additional vectors.

[0062] In some embodiments, the one or more additional vectors are plasmid vectors.

[0063] In some embodiments, the nucleic acid construct in the vector system is an adeno-associated viral vector, and the vector system further comprises a serotype plasmid and / or a helper plasmid for assembling the nucleic acid construct into viral particles. In some preferred embodiments, the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

[0064] In some embodiments, the serotype plasmid suitable for use in the present invention comprises a nucleotide sequence as shown in SEQ ID NO: 34 or 35, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 34 or 35. In some embodiments, the helper plasmid suitable for use in the present invention comprises a nucleotide sequence as shown in SEQ ID NO: 36, or a nucleotide sequence having at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 36. In some embodiments, the vector system further comprises a host cell, preferably a 293T cell.

[0065] In some embodiments, the nucleic acid construct in the vector system is a lentiviral vector, and the vector system further comprises a helper plasmid (e.g., an envelope plasmid and / or a packaging plasmid) for assembling the nucleic acid construct into viral particles. In some embodiments, the helper plasmid comprises one or more nucleotide sequences encoding gag and pol proteins and optionally a nucleotide sequence encoding other viral packaging components. In some embodiments, the helper plasmid may include a packaging plasmid and / or an envelope plasmid. In some embodiments, the vector system further comprises a host cell, which may be a cell producing a lentivirus, such as a 293T cell.

[0066] In a fifth aspect, the present invention provides a composition comprising the nucleic acid construct of the first aspect of the present invention, the viral particle of the second aspect of the present invention, the cell of the third aspect of the present invention, or the vector system of the fourth aspect of the present invention. Optionally, the composition of the present invention further comprises a pharmaceutically acceptable carrier and / or excipient.

[0067] In a sixth aspect, the present invention provides a kit comprising the nucleic acid construct of the first aspect of the present invention, the viral particle of the second aspect of the present invention, the cell of the third aspect of the present invention, the vector system of the fourth aspect of the present invention, or the composition of the fifth aspect of the present invention. In some embodiments, the kit of the present invention further comprises a device for intramuscular or intravenous injection.

[0068] In a seventh aspect, the present invention provides a method for preventing, ameliorating or treating a hyperlipidemic disease in a subject, the method comprising administering to the subject a nucleic acid construct according to the first aspect of the present invention, a viral particle according to the second aspect of the present invention, a cell according to the third aspect of the present invention, a vector system according to the fourth aspect of the present invention, or a composition according to the fifth aspect of the present invention. In some embodiments, the hyperlipidemic disease is selected from familial hypercholesterolemia and atherosclerosis.

[0069] In some preferred embodiments, the nucleic acid construct, viral particle, cell, vector system or composition of the present invention is administered to a subject by intramuscular injection or intravenous injection.

[0070] The nucleic acid construct, viral particle, cell, vector system or composition of the present invention has the following advantages in preventing, improving or treating hyperlipidemic diseases in subjects:

[0071] 1. Traditional antibodies have a relatively short half-life in the human body after administration. Therefore, antibody drugs need to be injected every two weeks to one month, which brings a lot of inconvenience to patients. The present invention uses a recombinant AAV vector to carry the gene of the anti-PCSK9 antibody, enabling long-term and continuous expression of the anti-PCSK9 antibody in the body, eliminating the need for multiple administrations, and can treat hyperlipidemia (by lowering PCSK9, increasing LDL-R, and thus lowering LDL-C);

[0072] 2. There is no need to go through the complex processing steps after the antibody is expressed in vitro, including cell culture, screening of cell lines that stably express antibodies, large-scale culture, antibody purification, quality control, etc. Using the technology of the present invention, only the purified recombinant AAV virus needs to be obtained and directly injected into the patient's body to complete the drug administration step. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 shows the design principles of rAAV constructs.

[0074] Figure 2 shows the protein detection results of the cell culture medium after transient transfection of 293T cells with mAb rAAV construct plasmids.

[0075] FIG3 shows the protein expression detection results after transduction of C2C12 cells with different constructs and different serotypes of rAAV.

[0076] FIG4A shows the in vivo antibody protein expression levels of rAAV using different signal peptides.

[0077] FIG4B shows the in vivo antibody protein expression levels of rAAV of different serotypes.

[0078] FIG4C shows the in vivo antibody protein expression levels of rAAV using different promoters.

[0079] Figure 5A shows the concentration of free hPCSK9-flag in the cell culture medium after HepG2 cells highly expressing hPCSK9-flag were infected with rAAV carrying a mAb construct.

[0080] Figure 5B shows the LDLR and LDLR / GAPDH levels of HepG2 cells after HepG2 cells highly expressing hPCSK9-flag were infected with rAAV carrying the mAb construct.

[0081] FIG6A shows the antibody protein expression level of rAAV carrying the monoclonal antibody Alirocumab construct in golden hamsters.

[0082] FIG6B shows the effect of rAAV carrying the mAb alirocumab construct on lowering low-density lipoprotein cholesterol (LDL-C) in golden hamsters.

[0083] FIG7 shows the effect of rAAV carrying the monoclonal antibody Evolocumab construct on lowering LDL-C and total cholesterol (T-CHO) in golden hamsters.

[0084] FIG8 shows the antibody concentration in the serum of C57 mice injected with rAAV carrying mAb constructs. DETAILED DESCRIPTION

[0085] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0086] In order to make the present disclosure more easily understood, certain terms are first defined below. Additional definitions of the following terms and other terms are set forth throughout the specification.

[0087] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0088] As used herein, the terms "comprising," "having," "including," and "containing" are to be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0089] In this article, "and / or" refers to and includes any and all possible combinations of one or more of the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0090] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are optionally varied (+) or (-) in increments of 1.0 or 0.1, or by variations of + / - 15%, 10%, 5%, or 2%, as appropriate. It should be understood that all numerical designations are preceded by the term "about." It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. As used herein, the term "about" when referring to a measurable value such as an amount or concentration, etc., is intended to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0091] The terms "protein," "peptide," "polypeptide," and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs, or peptidomimetics. "Protein," "peptide," "polypeptide," and "amino acid sequence" contain at least two amino acids, and there is no limitation on the maximum number of amino acids. As used herein, the term "amino acid" refers to natural and / or unnatural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0092] As used herein, the terms "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," "nucleotide sequence," and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or double-stranded DNA or RNA, genomic DNA, cDNA, DNA RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases.

[0093] In this article, "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence, or protein. If the nucleic acid sequence is from genomic DNA, expression may include splicing mRNA in a eukaryotic cell.

[0094] The term "encoding" when applied to a nucleic acid sequence refers to a nucleic acid sequence that, in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed to produce mRNA and / or translated to produce a polypeptide. The antisense strand is the complement of such a nucleic acid, and the coding sequence can be deduced therefrom.

[0095] "Homology" or "identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing positions in each sequence that can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. "Unrelated" or "non-homologous" sequences share less than 40% identity, less than 25% identity with one of the sequences of the present invention. The alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be determined by importing the nucleic acid or amino acid sequence into ClustalW (available at https: / / genome.jp / toolsbin / clustalw / ) and using ClustalW.

[0096] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and rate of transcription of a gene or transgene. Promoters can be, for example, constitutive, inducible, repressible, or tissue-specific. Promoters can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind.

[0097] Non-limiting examples of promoters include pol I promoter, pol II promoter, pol III promoter, T7 promoter, U6 promoter, H1 promoter, retroviral Rous sarcoma virus LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β-actin promoter, elongation factor 1 alpha short (EFS) promoter, β glucuronidase (GUSB) promoter, cytomegalovirus (CMV) immediate early (IE) enhancer and / or promoter, chicken β-actin (CBA) promoter or derivatives thereof such as CAG promoter, CB promoter, (human) elongation factor 1 alpha-subunit (EF1α) promoter, ubiquitin C (UBC) promoter, prion promoter, neuron-specific enolase (NSE), neurofilament light chain (NFL) promoter, neurofilament heavy chain (NFH) promoter, platelet-derived The present invention also provides a pro-inflammatory cytokine receptor 2 (PGR2) promoter, a PDGF (PDGF) promoter, a platelet-derived growth factor B chain (PDGF-β) promoter, a synapsin (Syn) promoter, a synapsin 1 (Syn1) promoter, a methyl-CpG binding protein 2 (MeCP2) promoter, a Ca2+ / calmodulin-dependent protein kinase II (CaMKII) promoter, a metabotropic glutamate receptor 2 (mGluR2) promoter, a neurofilament light chain (NFL) promoter, a neurofilament heavy chain (NFH) promoter, a β-globin minigene nβ2 promoter, a preproenkephalin (PPE) promoter, an enkephalin (Enk) promoter, an excitatory amino acid transporter 2 (EAAT2) promoter, a glial fibrillary acidic protein (GFAP) promoter, a myelin basic protein (MBP) promoter, or a functional fragment thereof.

[0098] As known in the art, the nucleotide sequences of these promoters can be modified to increase or decrease the efficiency of mRNA transcription. Promoters of synthetic origin can be used for ubiquitous or tissue-specific expression. In addition, promoters of viral origin, some of which are described above, can be used in the methods disclosed herein, such as CMV, HIV, adenovirus, and AAV promoters. In an embodiment, a promoter can be used together with an enhancer to increase transcription efficiency. Non-limiting examples of enhancers include interstitial retinoid binding protein (IRBP) enhancer, RSV enhancer, or CMV enhancer.

[0099] As used herein, "poly A signal," "polyadenylation signal," or "polyadenylation signal" refers to an RNA sequence located downstream of the 3' coding region and is recognized by an RNA cleavage complex, which cleaves the 3' terminal sequence of the newly transcribed RNA by an RNA polymerase (such as Pol II), allowing polyadenylation to occur. Poly(A) polymerase then adds and extends the poly(A) tail by adding adenosine monophosphate units from ATP to the newly cleaved 3' end of the RNA. The poly(A) tail (or poly(A) tail) protects the mRNA from exonucleases and is important for transcription termination, nuclear export of the mRNA, and subsequent translation.

[0100] Exemplary polyadenylation signals include bovine growth hormone polyadenylation signal (bGH poly A), small poly A signal (SPA), human growth hormone polyadenylation signal (hGH poly A), SV40 virus polyadenylation signal (SV40 polyA), rabbit beta globin poly A sequence (rBG poly A), or variants thereof.

[0101] As used herein, the term "antibody" refers to an immunoglobulin molecule that has the ability to specifically bind to a specific antigen. Antibodies typically comprise a variable region and a constant region in each heavy chain and light chain. The variable regions of the antibody heavy and light chains contain binding domains that interact with the antigen. The constant region of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, which include various cells of the immune system (such as effector cells) and components of the complement system such as C1q (the first component in the classical pathway of complement activation). Therefore, most antibodies have a heavy chain variable region (VH) and a light chain variable region (VL) that together form the antibody portion that binds to the antigen.

[0102] The term "antibody" as used herein should be understood in its broadest sense and includes monoclonal antibodies (including full-length monoclonal antibodies), polyclonal antibodies, antibody fragments, and multispecific antibodies (e.g., bispecific antibodies) containing at least two antigen-binding regions. Antibodies may contain additional modifications, such as non-naturally occurring amino acids, mutations in the Fc region, and mutations in glycosylation sites. Antibodies also include post-translationally modified antibodies, fusion proteins containing antigenic determinants of antibodies, and immunoglobulin molecules containing any other modifications to antigen recognition sites, as long as these antibodies exhibit the desired biological activity.

[0103] In this article, the term "monoclonal antibody" generally refers to the antibody obtained from a group of substantially homogeneous antibodies, i.e., the individual antibodies in the cluster are identical, except a small amount of natural mutations that may exist. Monoclonal antibodies are usually highly specific for a single antigenic site. And, different from conventional polyclonal antibody preparations (usually having different antibodies for different determinants), each monoclonal antibody is for a single determinant on the antigen. Except for their specificity, the advantage of monoclonal antibodies is that they can be synthesized by hybridoma culture, not polluted by other immunoglobulins. The modifier "monoclonal" represents the feature of the antibody obtained from a substantially homogeneous antibody colony, and is not interpreted as needing to produce antibody by any ad hoc method. For example, the monoclonal antibody used according to the present invention can be prepared in hybridoma cell, or can be prepared by recombinant DNA method.

[0104] As used herein, the term "antigen-binding fragment" of an antibody refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen (e.g., a PCSK9 protein as described herein). It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody.

[0105] Examples of the term "antigen-binding fragment" of an antibody include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bond at the hinge region; (iii) a Fab' fragment, which is essentially a Fab with a partial hinge region; (iv) an Fd fragment, which consists of the VH and CH1 domains; (v) an Fd' fragment, which has the VH and CH1 domains and one or more cysteine ​​residues at the C-terminus of the CH1 domain; (vi) an Fv fragment, which consists of the VL and VH domains of a single arm of an antibody; (vii) a dAb fragment, which consists of the VH domain; (viii) a single complementarity determining region (CDR); and (ix) a nanobody, a heavy chain variable region containing a single variable domain and two constant domains. In addition, although the two domains VL and VH of the Fv fragment are encoded by different genes, they can be connected by synthetic linkers using recombinant methods so that they can form a single protein chain in which the VL and VH regions are paired to form a monovalent molecule (called single-chain Fv (scFv)). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. In addition, the term also includes "straight-chain antibodies" comprising a pair of tandem Fd fragments (VH-CH1-VH-CH1), which together with the complementary light chain polypeptides and any modified forms of the aforementioned fragments that retain antigen-binding activity form an antigen-binding region.

[0106] These antigen-binding fragments can be obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

[0107] In this article, the term "binding" or "specific binding" refers to a non-random binding reaction between two molecules, such as an antibody and its target antigen. The binding specificity of an antibody can be determined based on affinity and / or avidity. Avidity is represented by the equilibrium constant (KD) of antigen-antibody dissociation, and is a measure of the binding strength between an antigenic determinant and the antigen binding site of an antibody: the smaller the value of KD, the stronger the binding strength between the antigenic determinant and the antibody. Alternatively, affinity can also be expressed as an affinity constant (KA), which is 1 / KD. Avidity is a measure of the binding strength between an antibody and the associated antigen. Avidity relates to the affinity between an antigenic determinant and the antigen binding site of an antibody and the number of associated binding sites present on the antibody.

[0108] Specific binding of an antibody to an antigen or antigenic determinant can be determined in any known suitable manner, including, for example, Scatchard analysis and / or competitive binding assays, such as radioimmunoassay (RIA), enzyme immunoassay (EIA), and sandwich competition assays, and various variations thereof known in the art.

[0109] Equivalents having one or more amino acid modifications compared to the antibodies or antigen-binding fragments thereof described herein are also encompassed within the scope of the present invention, provided that the one or more amino acid modifications do not affect or substantially do not affect the ability of the antibody or antigen-binding fragment thereof to specifically bind to the antigen. In this article, the amino acid modification may be an amino acid substitution, an amino acid deletion, or an amino acid insertion. The amino acid substitution may be a conservative amino acid substitution or a non-conservative amino acid substitution. Conservative substitutions (also referred to as conservative mutations, conservative substitutions, or conservative variations) are amino acid substitutions in a protein that change a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity, or size). In this article, "conservative substitutions" refer to replacement of an amino acid residue by another biologically similar residue. Examples of conservative substitutions include substitution of one hydrophobic residue such as isoleucine, valine, leucine, or methionine for another; or substitution of one charged or polar residue for another, such as substitution of arginine for lysine, substitution of glutamic acid for aspartic acid, substitution of glutamine for asparagine, and the like. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and the like.

[0110] The term "vector" generally refers to a nucleic acid molecule capable of self-replication in a suitable host, which transfers the inserted nucleic acid molecule into and / or between host cells. The vector may include a vector primarily used to insert DNA or RNA into a cell, a vector primarily used to replicate DNA or RNA, and a vector primarily used for expression by transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above-mentioned functions. The vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the vector can produce a desired expression product by culturing a suitable host cell containing the vector.

[0111] As used herein, "viral vector" refers to a vector that can be packaged and recombinantly produced into viral particles, which contain a polynucleotide that will be delivered into a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include retroviral vectors, AAV vectors, lentiviral vectors, adenoviral vectors, alphaviral vectors, and the like.

[0112] In this article, the term "cell" generally refers to a plasmid or vector that may or has contained a nucleic acid molecule according to the present invention, or an individual cell, cell line or cell culture that can express the antibody or fusion protein according to the present invention. The cell may include the progeny of a single host cell. Due to natural, accidental or intentional mutations, the progeny cells may not necessarily be identical in morphology or genome to the original parent cell, but they may be able to express the antibody fusion protein described herein. The cell can be obtained by transfecting cells in vitro using the vectors described herein. The cell can be a prokaryotic cell (e.g., Escherichia coli) or a eukaryotic cell (e.g., yeast cell, COS cell, Chinese hamster ovary (CHO) cell, HeLa cell, HEK293 cell, COS-1 cell, NSO cell or myeloma cell). In some cases, the cell can be a mammalian cell. For example, the mammalian cell can be a CHO-K1 cell. In this article, the term "recombinant cell" generally refers to a cell into which a recombinant nucleic acid construct has been introduced. The recombinant host cell includes not only a specific cell, but also the offspring of these cells.

[0113] As used herein, the terms "transduction," "transfection," and "transformation" refer to the process of delivering a heterologous polynucleotide into a host cell for transcription and translation to produce a polypeptide product, including the use of a recombinant virus to introduce a heterologous polynucleotide into a host cell.

[0114] As used herein, the term "infection" refers to the process by which viruses or virus particles containing polynucleotide components deliver polynucleotides into cells and produce their RNA and protein products. It may also refer to the process by which viruses replicate in host cells.

[0115] "Multiplicity of infection" (abbreviated as MOI) herein refers to the ratio of the number of viruses added to cells when infecting cells with a virus.

[0116] The term viral "titer" herein refers to the number of infectious viral vector particles per unit volume of liquid. Specifically, it refers to the number of viral vector particles with a defined transduction capacity per milliliter of viral vector product, i.e., transduction units (TU) per milliliter (TU / ml).

[0117] As used herein, the term "expression cassette" refers to a polynucleotide sequence capable of encoding a protein, which may include a promoter, a coding sequence, a terminator, and optionally, enhancers, untranslated regions (UTRs), introns, polyadenylation signals, and the like.

[0118] "Adeno-associated virus" or "AAV" belongs to the genus Dependoparvovirus and the family Parvoviridae. AAV is a single-stranded DNA virus consisting of a viral genome and a capsid. The AAV genome consists of the rep gene and the cap gene, flanked by two inverted terminal repeats (ITRs). The rep gene encodes the Rep protein, which is involved in the replication and packaging of the virus, and the cap gene encodes the capsid protein of the virus. The "ITRs" or "inverted terminal repeats" can form a T-shaped palindrome that participates in the replication and packaging of AAV, which is usually required to complete the lytic and latent life cycle of AAV. AAV itself is replication-defective and can only be latent in the host cell in the absence of a helper virus. Therefore, the production of AAV vectors usually requires a helper plasmid to provide key genes involved in AAV replication and a serotype plasmid to provide the capsid protein encoding the AAV particles.

[0119] Currently, there are more than a dozen common AAV serotypes and hundreds of variants, which differ primarily in the cap gene encoding the capsid protein. AAV serotypes are primarily determined by the structure of the capsid protein and include, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh10, AAV-DJ, AAV-DJ / B, AAV PHP.B, AAV PHP.eB, AAV PHP.S, and AAVrh74.

[0120] In this article, "AAV vector" and "recombinant AAV (rAAV) vector" are used interchangeably to refer to a vector containing one or more heterologous nucleic acid sequences and one or more ITRs. When an AAV vector is present in a host cell, with the help of a helper plasmid and a serotype plasmid, the AAV vector carrying the target gene can be replicated and packaged into infectious viral particles.

[0121] In this context, lentiviral vectors include viral vectors modified from HIV-1, which can efficiently deliver target genes (or RNAi) into primary animal and human cells or cell lines. The lentiviral vector genome is positive-strand RNA. After entering the cell, the genome is reverse-transcribed into DNA by the lentiviral vector's own reverse transcriptase in the cytoplasm, forming a pre-DNA integration complex. After entering the cell nucleus, the DNA integrates into the cell genome. The integrated DNA is then transcribed into mRNA, which then returns to the cytoplasm to express the target protein.

[0122] Lentiviral vectors can effectively infect and integrate into non-dividing cells. This characteristic distinguishes them from other viral vectors, such as non-integrating adenoviral vectors, adeno-associated viral vectors with low integration rates, and traditional retroviral vectors that only integrate into dividing cells. Numerous studies have shown that tissues or cells in which lentiviral vectors can induce long-term expression of target genes include the brain, liver, muscle, retina, hematopoietic stem cells, bone marrow mesenchymal stem cells, and macrophages. Lentiviral vectors do not express any HIV-1 proteins and have low immunogenicity. There is no cellular immune response at the injection site, and the humoral immune response is also low, which does not affect a second injection of the viral vector.

[0123] As used herein, the terms "patient" and "subject" are used interchangeably and in their conventional sense to refer to an organism suffering from or susceptible to a condition that can be prevented or treated by administering a viral vector or viral particle or composition of the invention, and include humans and non-human animals.

[0124] The subject can be a non-human animal (e.g., chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats, and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats, and guinea pigs; birds including poultry, wild birds, and game birds such as chickens, turkeys, and other chickens, ducks, geese, etc.). In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0125] As used herein, the term "administer" is intended to mean the delivery of a substance to a subject, such as an animal or a human. Administration can be performed in a single dose, continuously, or intermittently throughout the course of treatment. Methods for determining the most effective mode of administration and dosage are known to those skilled in the art and will vary with factors such as the composition used for treatment, the therapeutic purpose, and the age, health, or sex of the subject being treated. In some embodiments, single or multiple administrations may be performed, with the dosage level and pattern being selected by a physician, or in the case of pets and other animals, by a veterinarian.

[0126] As used herein, the term "treating" includes: (1) inhibiting a condition, disease, or disorder, i.e., arresting, reducing, or delaying the development of a disease or its recurrence or the development of at least one clinical or subclinical symptom thereof; or (2) ameliorating a disease, i.e., causing regression of a condition, disease, or disorder, or at least one clinical or subclinical symptom thereof.

[0127] As used herein, the term "improvement" refers to an improvement in a symptom associated with a disease, and may refer to an improvement in at least one parameter that measures or quantifies the symptom.

[0128] As used herein, the term "preventing" a condition, disease or disorder includes preventing, delaying or reducing the incidence and / or likelihood of the development of at least one clinical or subclinical symptom of a condition, disease or disorder in a subject who may have or be susceptible to the condition, disease or disorder but does not yet experience or exhibit the clinical or subclinical symptoms of the condition, disease or disorder.

[0129] The term "pharmaceutically acceptable" refers to a carrier, excipient or diluent that is, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0130] The term "pharmaceutical composition" generally refers to a preparation that is in a form that permits the biological activity of the active ingredient to be effective and that contains no additional ingredients that are unacceptably toxic to the subject to which the composition is administered. The composition is sterile. A "sterile" composition is sterile, or free of all living microorganisms and their spores.

[0131] The exemplary carrier used for pharmaceutical composition of the present invention comprises saline, buffered saline, glucose and water.The exemplary excipient used for composition of the present invention comprises filler, binding agent, disintegrant, coating agent, adsorbent, antiadherent, glidant, preservative, antioxidant, flavoring, coloring agent, sweetener, solvent, cosolvent, buffer, chelating agent, viscosity imparting agent, surfactant, diluent, wetting agent, carrier, diluent, preservative, emulsifying agent, stabilizer and tension regulator.It is known to those skilled in the art that suitable excipient is selected to prepare composition of the present invention.Usually, the selection of suitable excipient especially depends on the desired dosage form of employed activating agent, disease to be treated and composition.

[0132] The term "kit" generally refers to a packaged product comprising components for administering a nucleic acid construct, viral vector or pharmaceutical composition of the present invention to treat or prevent a related disease. The components of the kit may be contained in separate vials (i.e., a kit with separate parts), or provided in a single vial. The kit may include reagents such as a buffer, a protein stabilizing agent, a signal generating system (e.g., a fluorescent signal generating system), an antibody, a control protein, and a test container. The kit may also include instructions for implementing the method. In some embodiments of the present invention, the kit may also include an application device that can administer the active pharmaceutical ingredient (e.g., an antibody of the present invention or its antigen-binding fragment) in the kit to a subject in a suitable manner.

[0133] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described below in conjunction with specific examples and accompanying drawings, and the advantages and features of the present invention will become clearer as the description progresses. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are carried out according to conventional conditions in the art, for example, the conditions described in Sambrook and Russeii et al., Molecular Cloning: A Laboratory Manual (3rd Edition) (2001), CSHL Press, or according to the conditions recommended by the manufacturer. Unless otherwise stated, the experimental materials and reagents used in the following examples are all commercially available.

[0134] Example

[0135] Example 1: rAAV construct design of anti-PCSK9 antibody monoclonal antibody structure

[0136] The gene expression cassette for the target protein was designed and optimized, and then inserted into the adeno-associated virus vector pAAV-Amp to obtain a recombinant adeno-associated virus construct plasmid capable of expressing the desired protein (Figure 1). The pAAV-Amp vector, sourced from Kanglin Biotechnology (Hangzhou) Co., Ltd., contains elements such as the SV40 virus polyadenylation signal (SV40SL) and inverted terminal repeats (ITRs).

[0137] Based on the heavy chain amino acid sequence (SEQ ID NO: 17) and light chain amino acid sequence (SEQ ID NO: 18) of the anti-PCSK9 antibody alirocumab, and the heavy chain amino acid sequence (SEQ ID NO: 23) and light chain amino acid sequence (SEQ ID NO: 24) of evolocumab, the amino acid sequences were decoded into nucleotide sequences and sequence optimization was performed. The GC content of the nucleotide sequences encoding the heavy and light chains can be approximately 52% before optimization, or a high GC content (denoted by (GC)) of approximately 62% after optimization. Before sequence optimization, the nucleotide sequences encoding the heavy and light chains of alirocumab are SEQ ID NO: 19 and SEQ ID NO: 20, respectively; the nucleotide sequences encoding the heavy and light chains of evolocumab are SEQ ID NO: 25 and SEQ ID NO: 26, respectively. After sequence optimization, the nucleotide sequences encoding the heavy chain and light chain of Alirocumab are SEQ ID NO: 21 and SEQ ID NO: 22, respectively; the nucleotide sequences encoding the heavy chain and light chain of Evolocumab are SEQ ID NO: 27 and SEQ ID NO: 28, respectively.

[0138] A gene expression cassette comprising a nucleotide sequence encoding alirocumab or evolocumab is designed. The expression cassette may include: a promoter, a kozak sequence, a heavy chain signal peptide, a heavy chain sequence, a cleavable 2A peptide, a light chain signal peptide, a light chain sequence, WPRE (SEQ ID NO: 29), and a UTR (SEQ ID NO: 40).

[0139] Among them, the promoter can be CMV promoter (GenBank: MN996867.1, 235-818), CBH promoter (SEQ ID NO: 1), EF1α promoter (GenBank: KY447299.1, 529-1710), CAG promoter (GenBank: KC152483.1, 200-1096), CAGG promoter (GenBank: GU299216.1, 63-1664), CASI promoter (GenBank: ON512571.1, 80-1104), desmin promoter (GenBank: M63391.1, 2194-3233), TMCK promoter (SEQ ID NO: 2), MCK promoter (SEQ ID NO: 3), MHCK7 promoter (SEQ ID NO: 4). NO: 4), PGK promoter (GenBank: JF313343.1, 683-1192), TTR promoter (SEQ ID NO: 5). The signal peptide may be any of SAP signal peptide (SEQ ID NO: 6), IHC signal peptide (SEQ ID NO: 7), ILC signal peptide (SEQ ID NO: 8), AP signal peptide (SEQ ID NO: 9), CSP signal peptide (SEQ ID NO: 10), IL2 signal peptide (SEQ ID NO: 11), TPA signal peptide (SEQ ID NO: 12), L1 signal peptide (SEQ ID NO: 13), H7 signal peptide (SEQ ID NO: 14), SP1 signal peptide (SEQ ID NO: 15), and H1 signal peptide (SEQ ID NO: 16). The 2A peptide may be any of T2A (SEQ ID NO: 30), F2A (SEQ ID NO: 31), E2A (SEQ ID NO: 32), and P2A (SEQ ID NO: 33).

[0140] Example 2: Construction of anti-PCSK9 antibody rAAV construct plasmid

[0141] The gene expression cassette of the anti-PCSK9 antibody designed in Example 1 was cloned into the rAAV vector. The rAAV construct backbone was derived from pAAV-Amp from Kanglin Biotechnology (Hangzhou) Co., Ltd.

[0142] Obtaining the sequence fragments of the gene expression cassette of the anti-PCSK9 antibody designed in Example 1: The sequences of Alirocumab and Evolocumab were synthesized by General Biosystems (Anhui) Co., Ltd., and the sequence fragments of elements such as the promoter, signal peptide, and WPRE were obtained by polymerase chain reaction (PCR) amplification well known in the art.

[0143] The obtained fragment was cloned into the multiple cloning sites MluI / XhoI on the adeno-associated virus nucleic acid construct pAAV-Amp by homologous recombination methods well known in the art. After cloning, the sequence information was confirmed by sequencing, and the rAAV was named according to the combination of different elements, such as pAAV-amp-CBH-Alirocumab, etc. (rAAV without a signal peptide was named using the signal peptide H7).

[0144] The obtained rAAV construct plasmid was transiently transfected into 293T cells. 48 hours later, 20 μL of the 293T cell supernatant was obtained and subjected to SDS-PAGE electrophoresis. The expressed antibody was then transferred to a PVDF membrane. Western blotting was performed using an HRP-labeled goat anti-human IgG Fc antibody (purchased from KPL, Cat. No. 01-10-06) as a secondary antibody. The experimental results (Figure 2) showed that the rAAV construct plasmid effectively expressed the target protein after transient transfection of cells in vitro, and the mature antibody protein was secreted into the cell culture supernatant.

[0145] Example 3: Viral packaging of anti-PCSK9 antibody monoclonal antibody rAAV

[0146] The rAAV construct plasmid constructed in Example 2 (such as pAAV-amp-CBH-Alirocumab, etc.), the AAV serotype plasmid (pAAV-RC8, whose nucleotide sequence is shown in SEQ ID NO: 34 or pAAV-RC6.2FF, whose nucleotide sequence is shown in SEQ ID NO: 35) and the auxiliary plasmid (pAAV-Helper, whose nucleotide sequence is shown in SEQ ID NO: 36) are co-transfected into 293T cells (purchased from the American Type Culture Collection (ATCC), with a deposit number of CRL-3216), and rAAV virus packaging is performed in the 293T cell line. The transfection method is PEI cationic polymer-mediated transient transfection of eukaryotic cells. The PEI cationic polymer is PEI-Max transfection reagent purchased from Polysciences (purchased from Polysciences, product number: 24765-1). The transfection operation is carried out according to the manufacturer's recommended standardized operation, and the transfection scale is 15 cm 2 Cell culture dish.

[0147] 72 hours after transfection, collect the cell supernatant and cells into a 50 mL centrifuge tube. First, separate the cells and supernatant by centrifugation at 4200 rpm for 10 minutes at room temperature on a benchtop swing-bucket centrifuge. Transfer the supernatant to a new 50 mL centrifuge tube, add MgCl2 and the ribozyme, and mix thoroughly until ready to use. The remaining cells were added with ribozymes and cell lysate, allowed to stand at room temperature for 1 h, and then centrifuged at 10,000 g for 10 min at room temperature. The supernatant was transferred to the original cell supernatant, mixed, and affinity purified and concentrated. A 5 mL chromatography column was filled with affinity filler (POROS AAVX affinity resin, Thermo, product number A36743), and the column was equilibrated with equilibration solution (20 mmol / L PB, 0.15 mol / L NaCl, pH 7.4±0.2). After equilibration, the sample was loaded. After loading, the equilibration solution was re-equilibrated for 5 column volumes. Approximately 8 mL of AAV sample was eluted with elution buffer (0.1 mol / L glycine, 0.15 mol / L NaCl, pH 2±0.1), and concentrated to 1 mL using a 100KD ultrafiltration tube (Milipore, product number UFC8100). After the solution was replaced, the AAV solvent was 180 mM NaCl, 10 mM PB, and 0.001% F-68. After purification, the samples were aliquoted and stored in a -80°C freezer.

[0148] The physical titer of the rAAV virus was calculated using methods well known in the art based on the quantitative PCR results and an AAV standard as a reference. The rAAV standard was AAV2 of known titer containing the CMV-EGFP gene (purchased from ATCC, catalog number VR-1616). The AAV standard was lysed with AAV lysis buffer and serially diluted as a standard. The sample rAAV was also lysed with the lysis buffer and diluted to the range included in the standard curve according to the estimated titer. The titer was determined by qPCR and converted to VG / mL.

[0149] The primer and probe sequences used for quantitative PCR are:

[0150] ITR-forward primer: GGAACCCCTAGTGATGGAGTT (SEQ ID NO: 37)

[0151] ITR probe: 5'-CACTCCCTCTCTGCGCGC-3' (SEQ ID NO: 38)

[0152] ITR-reverse primer: CGGCCTCAGTGAGCGA (SEQ ID NO: 39)

[0153] The ITR probe has a FAM fluorescent group at the 5' end and a BHQ1 fluorescent group at the 3' end.

[0154] Example 4: Detection of expression of anti-PCSK9 monoclonal antibody rAAV virus

[0155] The rAAV virus obtained after the packaging and purification process in Example 3 was verified in the C2C12 cell line for its intracellular expression. The C2C12 cell line is a substrain of the mouse myoblast cell line established by YaffeD and SaxelO. The cells differentiate rapidly and can differentiate into multinucleated myotubes under low horse serum induction conditions. According to the titer of the rAAV vector resuspension, rAAV was inoculated into the C2C12 cell line pre-plated in a 24-well cell culture plate at a multiplicity of infection (MOI) of 5E4. Cell supernatants were collected 3 days after infection for the following experiments:

[0156] Supernatant from rAAV-infected C2C12 cells was collected, and 20 μL of the supernatant was subjected to SDS-PAGE electrophoresis. The expressed antibody was then transferred to a PVDF membrane. Western blotting was performed using an HRP-labeled goat anti-human IgG Fc antibody (purchased from KPL, Cat. No. 01-10-06) as a secondary antibody. The results (Figure 3) showed that the recombinant adeno-associated virus efficiently expressed the target protein after in vitro cell transduction and secreted the mature antibody protein into the cell culture supernatant.

[0157] The rAAV virus obtained after the packaging and purification process in Example 3 was used to verify its expression in 57bl / 6 mice. The mice were purchased from Weitonglihua and injected with the same dose of rAAV by intramuscular injection. Blood samples were collected from the eye sockets regularly after injection and the following tests were performed:

[0158] Blood samples were collected from the orbital cavity and centrifuged at 4200 rpm for 5 minutes to obtain serum. Serum was then added to an hPCSK9-coated ELISA plate at 5 μL / well. Purified alirocumab or evolocumab protein was used as the standard. Serum concentrations were measured by ELISA. The results showed that recombinant adeno-associated viruses with different signal peptides (Table 1, Figure 4A), different serotypes (Table 2, Figure 4B), and different promoters (Table 3, Figure 4C) were able to effectively express the target protein in mice and secrete the mature antibody protein into the serum.

[0159] Table 1. Expression levels of antibody proteins using different signal peptides

[0160] Table 2. Antibody protein expression levels of different rAAV serotypes

[0161] Table 3. Expression levels of antibody proteins using different promoters

[0162] Example 5: In vitro lipid-lowering effect of anti-PCSK9 antibody monoclonal antibody rAAV

[0163] The rAAV product AAV8-CAGG-(GC)Alirocumab-WPRE produced by packaging the construct pAAV-amp-CAGG-(GC)Alirocumab-WPRE was used to infect HepG2 cells that can highly express hPCSK9-flag at different viral infection multiplicities (MOIs). After 72 hours, the cell culture supernatant was collected, and the concentration changes of free hPCSK9-flag in the cell culture medium were detected by ELISA methods well known in the art. The primary antibody was anti-PCSK9 rabbit antibody (purchased from Sino, catalog number: 10594-T24), and the secondary antibody was HRP-labeled goat anti-rabbit IgG (H+L) antibody (purchased from KPL, catalog number: 5220-0283). At the same time, HepG2 cells were lysed using protein lysis buffer, and the changes in LDLR / GAPDH in the cell lysate were detected by Western blotting methods well known in the art. The primary antibodies were anti-LDLR rabbit antibody (purchased from Sino, Cat.10231-R202) and anti-GAPDH mouse antibody (purchased from BBI, Cat. No.: D190090-0100), and the secondary antibodies were HRP-labeled goat anti-rabbit IgG (H+L) antibody (purchased from KPL, Cat. No.: 5220-0283) and HRP-labeled goat anti-mouse IgG Fc antibody (purchased from KPL, Cat. No.: 5220-0341). The grayscale value of the bands was obtained by ImageJ software analysis. The results showed that the rAAV product could reduce the concentration of free hPCSK9-flag in the cell culture medium (Table 4, Figure 5A) and increase the LDLR content (Table 5, Figure 5B) at different MOIs. In other words, the rAAV product has a good lipid-lowering effect, and this effect is proportional to the dose within a certain range.

[0164] Table 4. Free hPCSK9-flag concentration in cell culture medium at different MOI infection conditions

[0165] Table 5. Changes in LDLR content in HepG2 cells at different MOI infection conditions

[0166] Example 6: In vivo lipid-lowering effect of anti-PCSK9 antibody monoclonal antibody rAAV

[0167] The rAAV product, AAV6.2FF-CAG-UTR-IL2-(GC)Alirocumab-WPRE, produced by packaging pAAV-amp-CAG-UTR-IL2-(GC)Alirocumab-WPRE, was injected into golden hamsters at different doses (5E12 vg / kg for the high-dose group and 5E11 vg / kg for the low-dose group). A commercially available finished drug, Praluent, was injected at 10 mg / kg as a positive control in weeks 1 and 2. The hamsters were then regularly monitored for changes in blood lipids. In terms of antibody concentration, the low-dose group of the rAAV product produced alirocumab concentrations comparable to those of the positive control, while the high-dose group produced alirocumab concentrations that were consistently higher than those in the positive control (Figure 6A). In terms of efficacy, from week 1 to week 4, the high-dose group of the rAAV product achieved an effect similar to that of the finished drug Praluent. At week 12, the finished drug Praluent had become ineffective, but the rAAV product in the high-dose group still maintained its effect (Figure 6B).

[0168] The rAAV product AAV6.2FF-CAG-UTR-IL2-(GC)Evolocumab-WPRE, produced by packaging pAAV-amp-CAG-UTR-IL2-(GC)Evolocumab-WPRE, was injected into golden hamsters at a high dose (30 mg / kg). The purchased finished drug Repatha was injected at 10 mg / kg and 30 mg / kg, and the hamsters' blood lipid levels were subsequently monitored regularly. The results showed that the high-dose group (30 mg / kg) of the rAAV product could reduce the concentrations of low-density lipoprotein cholesterol and total cholesterol (Figure 7), with an effect similar to that of the finished drug Repatha. After 14 days, the finished drug Repatha lost its effectiveness due to its short half-life, but the rAAV product still maintained its effect.

[0169] Studies have shown that maintaining alirocumab concentrations at 5 μg / mL in patients can achieve the effect of lowering free PCSK9 and LDL-C (Jennifer G Robinson, Michel Farnier, John JP Kastelein, et al. Relationship between alirocumab, PCSK9, and LDL-C levels in four phase 3 ODYSSEY trials using 75 and 150 mg doses. J Clin Lipidol. 2019 Nov-Dec; 13(6): 979-988.e10.). The rAAV product of the present invention can achieve long-term maintenance of concentrations above 5 μg / mL by low-dose intravenous (IV) and intramuscular (IM) injection (Table 6, Figure 8).

[0170] Table 6. Antibody concentrations in serum of C57 mice after rAAV injection (μg / mL)

Claims

1. A nucleic acid construct for gene therapy, comprising a nucleotide sequence encoding an anti-PCSK9 antibody or an antigen-binding fragment thereof, wherein the nucleotide sequence encoding the anti-PCSK9 antibody or an antigen-binding fragment thereof comprises a first coding region encoding the heavy chain variable region of the antibody and a second coding region encoding the light chain variable region of the antibody, and the first coding region and the second coding region are connected by a nucleotide sequence encoding a linker or an internal ribosome entry site (IRES).

2. The nucleic acid construct of claim 1, wherein the anti-PCSK9 antibody is selected from the group consisting of Alirocumab and Evolocumab.

3. The nucleic acid construct of claim 1, wherein the antigen binding fragment is selected from the group consisting of: Fab, Fab', F(ab')2, Fv, scFv and ds-scFv.

4. The nucleic acid construct of claim 1, wherein the first coding region encodes the heavy chain of the antibody and the second coding region encodes the light chain of the antibody.

5. The nucleic acid construct of claim 1, wherein the nucleic acid construct encodes the following structure from the 5' end to the 3' end: (1) Alirocumab heavy chain-linker-Alirocumab light chain; (2) Alirocumab light chain-linker-Alirocumab heavy chain; (3) Evolocumab heavy chain-linker-Evolocumab light chain; or (4) Evolocumab light chain-linker-Evolocumab heavy chain; in, The linker is a nucleotide sequence encoding a linker or an internal ribosome entry site (IRES).

6. The nucleic acid construct of claim 5, wherein the Alirocumab heavy chain has the amino acid sequence shown in SEQ ID NO: 17, and the Alirocumab light chain has the amino acid sequence shown in SEQ ID NO: 18; and / or the Evolocumab heavy chain has the amino acid sequence shown in SEQ ID NO: 23, and the Evolocumab light chain has the amino acid sequence shown in SEQ ID NO:

24. The nucleic acid construct of claim 1 , wherein the linker is a 2A peptide linker.

8. The nucleic acid construct of claim 7, wherein the 2A peptide linker comprises a 2A peptide selected from the group consisting of foot-and-mouth disease virus 2A peptide (F2A), porcine teschovirus 2A peptide (P2A), Thosea asign virus 2A peptide (T2A) and equine rhinitis virus 2A peptide (E2A).

9. The nucleic acid construct of claim 8, wherein the 2A peptide linker comprises an amino acid sequence selected from any one of SEQ ID NOs: 30-33.

10. The nucleic acid construct of claim 1, wherein the 5' ends of the first coding region and the second coding region further comprise a nucleotide sequence encoding a signal peptide, and the signal peptides encoded by the first coding region and the second coding region may be the same or different.

11. The nucleic acid construct of claim 10, wherein the signal peptide is selected from the group consisting of: SAP signal peptide, IHC signal peptide, ILC signal peptide, AP signal peptide, CSP signal peptide, IL2 signal peptide, TPA signal peptide, L1 signal peptide, H7 signal peptide, SP1 signal peptide and H1 signal peptide.

12. The nucleic acid construct of claim 11, wherein the signal peptide is selected from the group consisting of: IL2 signal peptide, TPA signal peptide, SP1 signal peptide, H7 signal peptide, H1 signal peptide, CSP signal peptide and L1 signal peptide.

13. The nucleic acid construct of claim 1, wherein the nucleic acid construct comprises the nucleotide sequence shown in any one of SEQ ID NOs: 41-51.

14. The nucleic acid construct of claim 13, wherein the nucleic acid construct comprises the nucleotide sequence shown in SEQ ID NO:41 or 42.

15. The nucleic acid construct of claim 1, wherein the nucleic acid construct further comprises a promoter operably linked to the nucleotide sequence encoding the anti-PCSK9 antibody or antigen-binding fragment thereof.

16. The nucleic acid construct of claim 15, wherein the promoter is selected from the group consisting of a CAG promoter, a CAGG promoter, and a CBH promoter.

17. The nucleic acid construct of claim 1, wherein the nucleic acid construct is a viral vector.

18. The nucleic acid construct of claim 17, wherein the viral vector is an adeno-associated viral vector.

19. The nucleic acid construct of claim 18, wherein the adeno-associated virus vector further comprises one or more elements selected from the group consisting of a polyadenylation signal (SV40SL) of SV40 virus, a woodchuck hepatitis B virus post-transcriptional regulatory element (WPRE), and an inverted terminal repeat sequence (ITR).

20. The nucleic acid construct of claim 17, wherein the viral vector is a lentiviral vector.

21. The nucleic acid construct of claim 20, wherein the lentiviral vector further comprises one or more elements selected from the group consisting of a chimeric LTR promoter, an HIV-1 packaging signal (ψ), a central polypurine tract (cPPT), a Rev response element (RRE), a polypurine fragment (PPT), a woodchuck hepatitis B virus post-transcriptional regulatory element (WPRE), a polyadenylation signal of SV40 virus (SV40SL), an SV40 virus replication origin (SV40 ori), and a self-inactivating long terminal repeat sequence.

22. A viral particle comprising the nucleic acid construct of claim 1.

23. The viral particle of claim 22, wherein the viral particle is an adeno-associated viral particle or a lentiviral particle.

24. The viral particle of claim 23, wherein the adeno-associated viral particle is of the AAV8 or AAV6 serotype.

25. A cell comprising the nucleic acid construct of claim 1.

26. The cell of claim 25, wherein the nucleic acid construct is an adeno-associated viral vector, and the cell further comprises a serotype plasmid and / or a helper plasmid for assembling the nucleic acid construct into viral particles.

27. The cell of claim 26, wherein the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

28. The cell of claim 25, wherein the nucleic acid construct is a lentiviral vector, and the cell further comprises an envelope plasmid and / or a packaging plasmid for assembling the nucleic acid construct into viral particles.

29. A vector system comprising the nucleic acid construct of claim 1.

30. The vector system of claim 29, wherein the vector system further comprises one or more additional vectors.

31. The vector system of claim 30, wherein the nucleic acid construct is an adeno-associated virus vector, and the vector system further comprises a serotype plasmid and / or a helper plasmid for assembling the nucleic acid construct into viral particles.

32. The vector system of claim 31, wherein the serotype plasmid is an AAV8 or AAV6 serotype plasmid.

33. The vector system of claim 30, wherein the nucleic acid construct is a lentiviral vector, and the vector system further comprises an envelope plasmid and / or a packaging plasmid for assembling the nucleic acid construct into viral particles.

34. The vector system of claim 29, further comprising a host cell.

35. The vector system of claim 34, wherein the host cell is a 293T cell.

36. A composition comprising the nucleic acid construct of any one of claims 1-21, the viral particle of any one of claims 22-24, the cell of any one of claims 25-28, or the vector system of any one of claims 29-35.

37. The composition of claim 36, wherein the composition further comprises a pharmaceutically acceptable carrier and / or excipient.

38. A kit comprising a nucleic acid construct according to any one of claims 1 to 21, a viral particle according to any one of claims 22 to 24, a cell according to any one of claims 25 to 28, or a vector system according to any one of claims 29 to 35, and a device for intramuscular or intravenous injection.

39. A method for preventing, ameliorating or treating a hyperlipidemic disease in a subject, the method comprising the step of administering to the subject a nucleic acid construct of any one of claims 1 to 21, a viral particle of any one of claims 22 to 24, a cell of any one of claims 25 to 28, or a vector system of any one of claims 29 to 35.

40. The method of claim 39, wherein the hyperlipidemic disorder is selected from the group consisting of familial hypercholesterolemia and atherosclerosis.

Images