Non-antibiotic selectable marker for filamentous fungi

Abstract

The present invention relates to a strain of filamentous fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which a gene coding for an arginine permease (CAN1), or a variant or an orthologous gene, has been knocked out. The invention also relates to the various uses of the strain and to the genetic modification method allowing a strain according to the invention to be obtained. The invention also relates to the use of L-canavanine as a selectable marker for transformants in which a gene coding for an arginine permease (CAN1), or a variant or an orthologous gene, has been knocked out.

Description

Description Title: NON-ANTIBIOTIC SELECTION MARKER FOR FILAMENTOUS FUNGI

[0001] The present invention relates to a strain of filamentous fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which a gene coding for an arginine permease (CAN1), in particular gene ID 18487637 (TRI67806), or a variant or an orthologous gene, has been invalidated. The invention also relates to the various uses of this strain, as well as the method of genetic modification making it possible to obtain a strain according to the invention. The invention also relates to the use of L-canavanine as a marker for selecting transformants in which said gene coding for an arginine permease CAN1, or a variant or an orthologous gene, has been invalidated. Background to the invention

[0002] Filamentous fungal strains, such as the Trichoderma reesei fungus, are now increasingly used for the production of proteins of interest.

[0003] The development of industrial fungal strains requires the use of selection markers to select transformed strains carrying the genetic mark of interest. Transformed strains are traditionally selected using marker genes such as an antibiotic resistance gene. However, the use of such antibiotic markers is sometimes prohibited or undesirable.

[0004] The auxotrophic marker URA can be used instead of an antibiotic marker to screen transformed fungal strains, as can the dominant marker amdS. However, the latter have disadvantages: using the URA gene as a selection marker is recyclable, but this leads to an accumulation of invalid gene copies, and the amdS marker is practically not recyclable.

[0005] There is thus a need for a new non-antibiotic selection marker.

[0006] L-canavanine, the guanidinooxy structural analog of L-arginine, is a non-protein amino acid synthesized by higher plants. It was first isolated in 1932 from gray bean (Kitagawa et al.), and has provided insight into the biological effects and mode of action of non-protein amino acids that act as analogs of protein amino acids. Arginyl-tRNA synthetases in many species lacking L-canavanine utilize it and incorporate it into the nascent polypeptide chain. The production of L-canavanine-containing proteins disrupts critical reactions in RNA and DNA metabolism and protein synthesis. L-canavanine also affects regulatory and catalytic reactions in arginine metabolism and alters essential biochemical reactions. It becomes a potent antimetabolite of arginine in a wide range of species. These properties The deleterious properties of L-canavanine make it a highly toxic secondary plant constituent that likely functions as an allelochemical that deters the feeding activity of phytophagous insects and other herbivores.

[0007] As early as 1946, L-canavanine was successfully used as an antimetabolite to limit growth in bacteria (Volcani et al.), then in 1948 in fungi (Horowitz and SRB, 1948). Its first use in the yeast Saccharomyces cerevisiae (SRB, 1955) was reported in 1954. The study of yeast will allow us to understand the mechanism of action of L-canavanine (Grenson et al.). The latter is imported from the culture medium into the interior of the cell via the arginine permease whose gene is called CAN1. L-canavanine, upon entering the cytoplasm, will be incorporated into nascent proteins and render them non-functional, leading to cell death. Inactivation of the permease by mutation prevents L-canavanine from penetrating the cell and thus makes it resistant. In 1979, L-canavanine was used for the first time in yeast as a selection marker (Broach et al.), by invalidating the CAN1 gene.In 1986, the complete nucleic sequence of the CAN1 gene (Broach et al.; Ahmad and Bussey) was published.

[0008] The CAN1 gene has already been used as a selection marker in yeast (Broach et al.; Wong et al.) but never in other fungi, and even less so in fungi belonging to the genus Trichoderma.

[0009] The present invention is thus based on the results of the inventors who have shown that L-canavanine could be used as a marker for selecting strains of fungi belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. Brief description of the invention

[0010] The present invention therefore relates to a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene, has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0011] The present invention also relates to a method for genetic modification of a fungal strain according to the invention, belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, comprising an invalidation step: - of gene ID 18487637 (CAN1), or a variant or an orthologous gene, or - of the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein.

[0012] The present invention also relates to the use of L-canavanine as a marker for selecting a fungal strain belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0013] The present invention also relates to a method for selecting a fungal strain belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated comprising: - (i) bringing a strain into contact with a culture medium comprising L-canavanine, and - (ii) the selection of the strain if it is capable of growing in the culture medium.

[0014] The present invention also relates to a method for producing mushroom biomass, comprising a step of culturing, in a culture medium comprising a suitable substrate, a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0015] The present invention also relates to a method for producing proteins of interest, in particular enzymes, comprising a step of culturing, in a culture medium comprising a suitable substrate, a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0016] The present invention further relates to a method for producing bio-sourced products from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0017] The present invention also relates to a process for producing a sweet juice or sugars from cellulosic or lignocellulosic substrates comprising a step of producing cellulolytic enzymes by a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0018] The present invention also relates to a method for producing a biofuel from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - gene ID 18487637 (CAN1), or a variant or orthologous gene has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0019] The present invention also relates to various uses of the strain according to the invention, belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, -in which gene ID 18487637 (CAN1), or a variant or an orthologous gene, or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated-, for the production of biomass, for the production of proteins of interest, for the hydrolysis of cellulose or lignocellulose into glucose, for the production of bio-sourced products from cellulosic or lignocellulosic substrates, or for the production of a sweet juice or sugars from cellulosic or lignocellulosic substrates, or for the production of biofuel from cellulosic or lignocellulosic substrates. Statement of the invention

[0020] In a first aspect, the present invention thus relates to a strain of fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which (a) the gene ID 18487637 (CAN1), or a variant, or an orthologous gene of this gene or (b) the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. Thus, in the strain according to the invention, the gene ID 18487637 (CAN1), or a variant or an orthologous gene or the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein is never expressed or is no longer functional. This also means that in the strain according to the invention the gene ID 18487637 (CAN1), or a variant or an orthologous gene or the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or a orthologous protein is invalidated. The present invention thus relates to a fungal variant strain, in which (a) the gene ID 18487637 (CAN1), or a variant or an orthologous gene has been invalidated or (b) the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein has been invalidated. In other words, this means for example that in the strain according to the invention the protein corresponding to the gene ID 18487637 (CAN1), or a variant or an orthologous gene or a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein is not produced. Alternatively, the protein corresponding to the gene ID 18487637 (CAN1), or a variant or an orthologous gene or a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein may be produced, but it is not functional. The strain according to the invention is thus a strain having a permease at deficient arginine.

[0021] According to the invention, the term "variant strain" means a strain genetically modified with respect to a parent strain. According to the invention, the term "parent strain" thus means a strain from which the variant strain originates or is derived, and in which gene ID 18487637 (CAN1), or a variant or an orthologous gene has not been invalidated, or in which the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein has not been invalidated. The strain according to the invention thus corresponds to a variant strain derived from a parent strain, said variant strain being capable of growing in a minimal medium comprising L-canavanine while the parent strain is not capable of growing in a minimal medium comprising L-canavanine.

[0022] According to the invention, the term “functional gene” means in particular a gene which makes it possible to produce a functional protein.

[0023] According to the invention, the term "functional protein" is understood in particular to mean a protein which has an activity, for example with the protein encoded by gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene encoding a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, it is an arginine permease activity.

[0024] According to the invention, a fungal strain is understood to be a fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes. According to one embodiment, the fungal strain according to the invention is understood to be a fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes or to the class Eurotiomycetes. According to one embodiment, the fungal strain according to the invention is understood to be a fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes or to the class Eurotiomycetes or to the order Sordariales. Preferably, it is a strain belonging to the order Hypocreales, in particular to the genus Trichoderma, and more particularly to the species Trichoderma reesei.

[0025] When the fungus belongs to the species Trichoderma reesei, according to the invention, the parent strain of Trichoderma reesei may be the strain QM6a (deposited under the number ATCC 13631), or a strain derived from the natural isolate QM6a (in particular obtained by random or site-directed mutagenesis), such as the strain Rut-C30 (deposited under the number ATCC 56765), the strain NG14 (deposited under the number ATCC 56767) or the strain QM9414 (deposited under the number ATCC 26921). Typically, the strains according to the invention may be selected in a medium comprising L-canavanine while retaining their capacity to produce proteins of interest.

[0026] The CAN1 gene, which is annotated gene ID 18487637 in the Trichoderma reesei reference genome (TRIREDRAFT_67806 or TRI67806), encodes a protein that belongs to the arginine permease family. These permeases allow L-canavanine to be imported into cells. In such a case, L-canavanine will then be incorporated into the synthesized proteins, rendering them non-functional and leading to cell death. In the strains according to the invention, L-canavanine cannot be incorporated and therefore does not lead to cell death.

[0027] According to the invention, gene ID 18487637 (CAN1) is represented by SEQ ID NO: 1, but may also correspond to a variant of this gene or to an orthologous gene. Preferably, gene ID 18487637 (CAN1) is only represented by SEQ ID NO: 1.

[0028] According to the invention, "a gene variant or an orthologous gene" means a gene which also codes for a protein which belongs to the arginine permease family. The variant of gene ID 18487637 (CAN1) or an orthologous gene of gene ID 18487637 (CAN1) is preferably represented by a sequence having at least 80% identity with the gene of SEQ ID NO: 1. The variant of gene ID 18487637 (CANT) or an orthologous gene of gene ID 18487637 (CAN1) thus corresponds to a gene derived from the sequence represented by SEQ ID NO: 1. More particularly, the variant of gene ID 18487637 (CAN1) or an orthologous gene of ID 18487637 (CAN1) is represented by a sequence having at least 90% identity with the gene of SEQ ID NO: 1, in particular at least 95%, preferably at least 98% or 99%.

[0029] According to the invention, the protein of SEQ ID NO: 2 corresponds to an arginine permease. The terms "variant protein, or an orthologous protein", thus mean proteins also having this arginine permease activity. Preferably, a variant protein of a protein represented by SEQ ID NO: 2, or an orthologous protein of a protein represented by SEQ ID NO: 2, thus corresponds to a protein having at least 80% identity with said SEQ ID NO: 2, in particular at least 90%, more particularly at least 95%, 98% or 99%.

[0030] Gene ID 18487637 (CAN1) is represented by SEQ ID NO: 1, and the protein encoded by gene ID 18487637 (CAN1) is represented by SEQ ID NO: 2. Thus, the variant of gene ID 18487637 (CAN1) or an orthologous gene of gene ID 18487637 (CAN1) may encode either the protein of SEQ ID NO: 2, or a protein having at least 80% identity with said SEQ ID NO: 2, in particular at least 90%, more particularly at least 95%, 98% or 99%.

[0031] According to the invention, the term "at least 80%" means all values ​​between 80% and 100%, in particular the values ​​of 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% and 100%. A person skilled in the art knows how to calculate a percentage identity between two sequences. For example, according to the invention, the percentage identity of a given sequence with respect to SEQ ID NO: 1 or SEQ ID NO: 2 is understood to mean the percentage identity with respect to the total length of the sequences. The percentage thus corresponds to the number of identical nucleotides / residues between this given sequence and SEQ ID NO: 1 or 2 divided by the number of nucleotides or residues in the longer of the two sequences.

[0032] Thus, in one embodiment, in said strain according to the invention, the invalidated gene ID 18487637 (CAN1) corresponds to a gene represented by SEQ ID NO: 1 or to a gene having at least 80% identity with the gene of SEQ ID NO: 1, in particular at least 90% and more particularly at least 95%. In an even more preferred embodiment, in said strain according to the invention, the invalidated gene ID 18487637 (CAN1) corresponds to a gene represented by SEQ ID NO: 1. According to this latter embodiment, the strain according to the invention thus comprises a deletion of the gene coding for the protein represented by SEQ ID NO: 2.

[0033] According to one embodiment, said strain of the invention thus corresponds to a strain in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1, has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2, has been invalidated.

[0034] According to a preferred embodiment, the invention relates to a strain of filamentous fungus belonging to the order Hypocreales, in particular to the genus Trichoderma, and more particularly to the species Trichoderma reesei, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1, has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2, has been invalidated.

[0035] According to the invention, gene ID 18487637 (CANT), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. All gene invalidation techniques can be used to obtain a strain according to the invention. As non-limiting examples, the invalidation can be carried out by PCR mutagenesis, oligonucleotide-directed mutagenesis, RNA interference, using meganucleases or zinc finger nucleases, TALEN (Transcription activator-like effector nucleases), or CRISPR / cas technology, etc. Preferably, the invalidation of gene ID 18487637 (CAN1), or a variant or an orthologous gene, or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, is carried out by genome editing. Such genome editing can be performed with or without a repair template.

[0036] According to one embodiment, the invalidation is a deletion of all or part of the gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein. Preferably, the invalidation is a deletion of all or part of the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1 or a deletion of all or part of the gene coding for a protein represented by SEQ ID NO: 2.

[0037] In a second aspect, the invention also relates to a method for genetically modifying a fungal strain belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, comprising a step of invalidating gene ID 18487637 (CAN1) or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein. The genetic modification method according to the invention thus makes it possible to obtain strains which can be selected in a medium comprising L-canavanine compared to the parent fungal strain.

[0038] According to one embodiment, the invention thus relates to a method for genetic modification of a fungal strain belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, comprising an invalidation step: - of the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2.

[0039] In a third aspect, the present invention also relates to the use of L-canavanine as a marker for selecting a fungal strain according to the invention belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

[0040] According to one embodiment, the invention thus relates to the use of L-canavanine as a marker for selecting a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0041] Preferably, the invention relates to the use of L-canavanine as a marker for selecting a strain in which gene ID 18487637 (CAN1) or a gene coding for a protein represented by SEQ ID NO: 2 has been invalidated.

[0042] According to the invention, L-canavanine is understood to be the non-proteinogenic amino acid represented by the semi-developed formula: (NH2)2C=NO-CH2-CH2-CH(NH2)-COOH, or by the following chemical formula: [Chem 1] This also refers to L-canavanine in salt form.

[0043] The expression "selection marker" here means that L-canavanine makes it possible to select strains that have integrated a genetic modification compared to those that have not integrated it (in this case the invalidation of gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein).

[0044] Preferably, L-canavanine is present in a culture medium of a fungal strain. Preferably, the culture medium is free of arginine, optionally also free of alanine, aspartate and / or glutamate. The culture medium may thus be free of arginine, alanine, aspartate and / or glutamate. According to a preferred embodiment, L-canavanine is present in a minimal culture medium of a fungal strain, in particular a minimal medium free of arginine, optionally also free of alanine, aspartate and / or glutamate. According to another preferred embodiment, L-canavanine is present in a synthetic culture medium of a fungal strain free of arginine, optionally also free of alanine, aspartate and / or glutamate.

[0045] According to the invention, a "minimal medium" means a medium comprising only the elements necessary for the growth of the fungal strain, and a "synthetic medium" means a medium in which the quantity and quality of each element present in the medium is well defined. The synthetic medium may comprise elements not necessary for the growth of the microorganism. The minimum and synthetic media are opposed to a "rich medium", which does not contain only elements necessary for the growth of the fungal strain, and in which the quantity and quality of the elements are not well defined. A minimum medium for Trichoderma is described for example by Penttilâ et al.

[0046] According to one embodiment, L-canavanine is used at a concentration of between 50 and 200 pg / mL in the culture medium.

[0047] In a fourth aspect, the present invention also relates to a method for selecting a fungal strain, belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated, comprising: - (i) bringing a strain into contact with a culture medium comprising L-canavanine, and - (ii) the selection of the strain if it is capable of growing in the culture medium.

[0048] According to one embodiment, the present invention thus relates to a method for selecting a strain of fungus, belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated, comprising: - (i) bringing a strain into contact with a culture medium comprising L-canavanine, and - (ii) the selection of the strain if it is capable of growing in the minimal culture medium or a synthetic medium devoid of arginine, optionally also devoid of alanine, aspartate and / or glutamate.

[0049] According to one embodiment, said method comprises before step (i) a step of invalidating the gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, in a fungal strain, belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes. According to this embodiment, said fungus preferably belongs to the order Hypocreales.

[0050] According to a preferred embodiment, the present invention thus relates to a method for selecting a strain in which the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1 or the gene coding for a protein represented by SEQ ID NO: 2, has been invalidated, comprising: - a step of invalidating the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1 or the gene coding for a protein represented by SEQ ID NO: 2 in a strain, - bringing said strain into contact with a culture medium comprising L-canavanine, and - the selection of the strain if it is capable of growing in the culture medium, in particular the minimum culture medium or said synthetic culture medium devoid of arginine, optionally also devoid of alanine, aspartate and / or glutamate.

[0051] The selection method according to the invention thus makes it possible to select correctly transformed strains.

[0052] In a fifth aspect, the present invention also relates to a method for producing biomass of a fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, comprising a step of culturing, in a culture medium comprising a suitable substrate, a fungal strain according to the invention, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. This step thus allows the growth of the fungal strain according to the invention, in particular allowing the biomass to be obtained. Those skilled in the art know the substrates suitable for the growth of fungal strains.

[0053] According to one embodiment, the present invention thus relates to a method for producing biomass of fungi belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, comprising a step of culturing, in a culture medium comprising a suitable substrate, a strain of fungus according to the invention, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0054] In a sixth aspect, the present invention also relates to a method for producing proteins of interest, in particular enzymes, comprising a step of culturing, in a culture medium comprising a suitable substrate, a fungal strain according to the invention belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein has been invalidated. The invention thus relates to the use of a fungal strain according to the invention, for the production of proteins of interest.

[0055] According to one embodiment, the present invention thus relates to a method for producing proteins of interest, in particular enzymes, comprising a step of culturing, in a culture medium comprising a suitable substrate, a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0056] Advantageously, said method thus comprises a phase of growth of a strain of fungus according to the invention, then a phase of growth and production of proteins of interest by said strain. Even more preferably, said growth phase is carried out in the presence of a growth substrate and said growth and production phase of proteins of interest is carried out in the presence of an inducing substrate. The growth substrate and the inducing substrate are preferably carbon substrates.

[0057] Thus, the carbon growth substrate is preferably chosen from lactose, glucose, xylose, residues obtained after ethanolic fermentation of monomeric sugars from enzymatic hydrolysates of cellulosic biomass, and / or a crude extract of water-soluble pentoses from the pretreatment of cellulosic biomass.

[0058] The inducing carbon substrate is thus preferably chosen from lactose, cellobiose, sophorose, residues obtained after ethanolic fermentation of monomeric sugars from enzymatic hydrolysates of cellulosic biomass, and / or a crude extract of water-soluble pentoses originating from the pretreatment of cellulosic biomass.

[0059] According to the invention, the proteins of interest are all the proteins that can be produced by a fungus, naturally or by genetic modification (for example after transformation using an appropriate vector).

[0060] Advantageously, the proteins of interest according to the invention are enzymes, in particular cellulolytic enzymes such as cellulases or hemicellulases. Preferably, the enzymes are cellulases. According to the invention, the term "cellulases" more particularly refers to enzymes chosen from endoglucanases, exoglucanases and glucosidases, and more particularly p-glucosidase. The term "cellulase" more particularly refers to an enzyme adapted to the hydrolysis of cellulose and allowing the microorganisms (such as Trichoderma reesei) which produce them to use cellulose as a carbon source, by hydrolyzing this polymer into simple sugars (glucose). According to one embodiment, the invention thus relates to the use of a fungal strain according to the invention, for the production of proteins of interest, more particularly enzymes, in particular cellulolytic enzymes such as cellulases.

[0061] In a seventh aspect, the present invention also relates to a method for producing bio-sourced products from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to the invention belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. The invention therefore also relates to the use of a fungal strain according to the invention, for the production of bio-sourced products from cellulosic or lignocellulosic substrates.

[0062] According to one embodiment, the present invention thus relates to a method for producing bio-sourced products from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes, by a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0063] In an eighth aspect, the present invention also relates to a method for producing a sweet juice or sugars from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to the invention belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. The invention therefore also relates to the use of a fungal strain according to the invention, for the production of sweet juice or sugars from cellulosic or lignocellulosic substrates.

[0064] According to one embodiment, the present invention thus relates to a method for producing a sweet juice or sugars from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a strain of fungus belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0065] In a preferred aspect, the process for producing a sweet juice or sugars from cellulosic or lignocellulosic substrates according to the invention comprises: i) a step of pretreatment of a cellulosic or lignocellulosic substrate in order to obtain a pretreated substrate, ii) a step of production of cellulolytic enzymes by a strain according to the invention, iii) a step of enzymatic hydrolysis of the pretreated substrate obtained in step i), in the presence of the cellulolytic enzymes obtained in step ii), in order to obtain a hydrolysate.

[0066] Sugars (or sweet juice, sugars generally being in the form of an aqueous solution) are thus obtained at the end of the hydrolysis step. Preferably, these are sugars with 5 carbons (called C5 sugars) and / or sugars with 6 carbons (called C6 sugars).

[0067] The process according to the invention thus makes it possible to treat (ligno)cellulosic biomass to produce so-called second-generation (2G) sweet juices. These sweet juices can be used to produce other products biochemically, in particular by fermentation (for example alcohols such as ethanol, butanol), or other molecules, for example solvents such as acetone, etc.), or be recovered as is, after possible separation / treatment steps, for example in the chemical / food industry.

[0068] In a ninth aspect, the present invention relates to a method for producing a biofuel from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to the invention belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which gene ID 18487637 (CAN1), or a variant or an orthologous gene or a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated. The invention thus relates to the use of a fungal strain according to the invention, for the production of biofuel from cellulosic or lignocellulosic substrates.

[0069] According to one embodiment, the present invention relates to a method for producing a biofuel from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to the invention belonging to the Ascomycetes division, excluding a fungus belonging to the Saccharomycetes class, in which: - the gene ID 18487637 (CAN1) represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1 has been invalidated, or - the gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2 has been invalidated.

[0070] According to the invention, the term "biofuel" is more particularly understood to mean a second-generation biofuel, i.e. derived from non-food resources. According to the invention, the term "biofuel" can also be defined as any product resulting from the transformation of biomass and which can be used for energy purposes. On the one hand, and without wishing to be limited, examples include biogas, products which can be incorporated (possibly after further transformation) into a fuel or be a fuel in their own right, such as alcohols (ethanol, butanol and / or isopropanol depending on the type of fermentation organism used), solvents (acetone), acids (butyric), lipids and their derivatives (short- or long-chain fatty acids, fatty acid esters), as well as hydrogen. Preferably, the biofuel according to the invention is an alcohol, for example ethanol, butanol and / or isopropanol.More preferably, the biofuel according to the invention is ethanol. In another embodiment, the biofuel is biogas. In another embodiment, the product is a molecule of interest to the chemical industry, such as, for example, another alcohol such as 1,2-propane diol, the. 1,3-propanediol, 1,4-butanediol, 2,3-butanediol, organic acids such as acetic, propionic, acrylic, butyric, succinic, malic, fumaric, citric, itaconic acid, or hydroxy acids such as glycolic, hydroxypropionic, or lactic acid.

[0071] In a preferred aspect, the process for producing a biofuel from cellulosic or lignocellulosic substrates according to the invention comprises: i) a step of pretreatment of a cellulosic or lignocellulosic substrate in order to obtain a pretreated substrate, ii) a step of production of cellulolytic enzymes by a strain according to the invention, iii) a step of enzymatic hydrolysis of the pretreated substrate obtained in step i), in the presence of the cellulolytic enzymes obtained in step ii), in order to obtain a hydrolysate, iv) a step of alcoholic fermentation of the hydrolysate obtained, v) a separation step, in particular by distillation.

[0072] In an even more preferred aspect, the process for producing a biofuel from cellulosic or lignocellulosic substrates, according to the invention, comprises: i) a step of pretreatment of a cellulosic or lignocellulosic substrate in order to obtain a pretreated substrate, ii) a step of production of cellulolytic enzymes by a strain according to the invention iii) a step of enzymatic hydrolysis of the pretreated substrate obtained in step i), in the presence of the cellulolytic enzymes obtained in step ii), in order to obtain a hydrolyzate, iv) a step of alcoholic fermentation of the hydrolyzate obtained, v) a separation step, in particular by distillation, said steps iii) and iv) being carried out simultaneously. This is typically the case in so-called "SSF" (Simultaneous Saccharification and Fermentation) production processes.

[0073] According to a particular embodiment, the step of pretreatment of a cellulosic or lignocellulosic substrate is a step of suspending said cellulosic or lignocellulosic substrate in aqueous phase.

[0074] According to a particular embodiment, the hydrolyzate obtained in step iii) is a hydrolyzate containing glucose.

[0075] According to a particular embodiment, the step of alcoholic fermentation of the hydrolyzate obtained is a step of fermentation, in the presence of a fermentative organism, of the glucose from the hydrolyzate so as to produce a fermentation must. A fermentative organism is for example a yeast.

[0076] According to a particular embodiment, the separation step is a separation of the biofuel and the fermentation must, in particular by distillation.

[0077] According to an even more preferred embodiment, the cellulosic or lignocellulosic substrate to be hydrolyzed is suspended in aqueous phase at a rate of 6 to 40% of dry matter, preferably 20 to 30%. The pH is adjusted to between 4 and 5.5, preferably between 4.8 and 5.2 and the temperature to between 40°C and 60°C, preferably between 45°C and 50°C. The hydrolysis reaction is started by adding enzymes acting on the pretreated substrate. The quantity of enzymes usually used is 10 to 30 mg of excreted protein per gram of pretreated substrate or less. The reaction generally lasts from 15 to 48 hours. The reaction is monitored by measuring the released sugars, especially glucose. The sugar solution is separated from the non-hydrolyzed solid fraction, essentially consisting of lignin, by filtration or centrifugation and then treated in a fermentation unit.

[0078] According to another even more preferred embodiment, when the hydrolysis and fermentation step are carried out jointly, the enzymes and the fermentative organism are added simultaneously and then incubated at a temperature between 30°C and 35°C to produce a fermentation must. According to this embodiment, the cellulose present in the pre-treated substrate is converted into glucose, and at the same time, in the same reactor, the fermentative organism (for example a yeast) converts the glucose into the final product according to an SSF (Simultaneous Saccharification and Fermentation) process known to those skilled in the art. Depending on the metabolic and hydrolytic capacities of the fermentative organism, the proper conduct of the operation may require the addition of a greater or lesser quantity of exogenous cellulolytic mixture.

[0079] In a tenth aspect, the invention also relates to the use of a fungal strain according to the invention belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, for the hydrolysis of cellulose or lignocellulose into glucose.

[0080] In the present description, the definitions and preferences indicated in one aspect apply mutatis mutandis to the other aspects. For example, all the definitions and preferences indicated in the first aspect of the invention above also apply to the second, third, fourth, fifth, sixth, seventh, eighth, ninth and tenth aspects. Brief description of the Figures

[0081] Other characteristics, details and advantages of the invention will appear on reading the attached Figures. Fig. 1

[0082] [Fig. 1] represents the susceptibility test of Trichoderma spores in PDA medium (left column, without L-Canavanine; right column, with 200 pg / mL L-canavanine) and minimal medium (MM) (left column, without L-Canavanine; right column, with 50 pg / mL L-canavanine). The numbers represent the number of spores plated on each medium. Fig. 2

[0083] [Fig. 2] shows the schematic of the repair matrix used in Example 2.

[0084] MR5' and MR3' represent the two 1 kb flanks of sequences identical to the two 1 kb regions flanking the targeted gene, here ID 18487637 (67806-TrF1047C); Prom cpc represents the CPC promoter; IM7 represents the IM7 promoter; Term TrpC represents the TrPC terminator and Hygromycin represents the hygromycin resistance gene. The term "Cas9 437" refers to the CRISPR-Cas9 tool used.

[0085] Sequences of the present invention

[0086] [Table 1] List of references cited in this patent application

[0087] Kitagawa, M., and Yamada, H., Studies on the diamino acid, canavanin (II). J. Biochem. (Tokyo) 16, 339-349 (1932).

[0088] Benjamin E. Volcani, Esmond E. Snell - THE EFFECTS OF CANAVANINE, ARGININE, AND RELATED COMPOUNDS ON THE GROWTH OF BACTERIA - J. Biol. Chem. 174:893-901

[0089] Horowitz (NH), SRB (AM), Growth inhibition of Neurospora by canavanine and its reversal. Journal biol. Cbem., 1948, 174, 371

[0090] SRB, A. M., 1954 Effect antibiotique de la canavanine sur la levure. Academie de Sciences Paris Compt. Rend. 239: 447-448. - ,1955 Spontaneous and chemically-induced mutations giving rise to canavanine-resistance in yeast. Compt. Rend. Lab Carlesberg, Ser. Physiol. 23: 363

[0091] Grenson M, Mousset M, Wiame JM, Bechet J. - Multiplicity of the amino acid permeases in Saccharomyces cerevisiae. I. Evidence for a specific arginine-transporting system. Biochim Biophys Acta 127(2):325-38

[0092] Broach JR, Strathern JN, Hicks JB. Transformation in yeast: development of a hybrid cloning vector and isolation of the CAN1 gene. Gene. 1979 Dec;8(1 ):121 -33. doi: 10.1016 / 0378- 1119(79)90012-x

[0093] Ahmad M, Bussey H. Yeast arginine permease: nucleotide sequence of the CAN1 gene. Curr Genet. 1986;10(8):587-92. doi: 10.1007 / BF00418125. PMID: 3327612.

[0094] Wong L, Holdridge B, Engel J, Xu P. Genetic Tools for Streamlined and Accelerated Pathway Engineering in Yarrowia lipolytica. Methods Mol Biol. 2019;1927:155-177. doi:10.1007 / 978-1-4939-9142-6_11

[0095] M. Penttila, H. Nevalainen, M. Ratto, E. Salminen, J. Knowles. A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene, 61 (1987), pp. 155-164, https: / / doi.Org / 10.1016 / 0378-1119(87)90110-7 Examples

[0096] Example 1: L-canavanine sensitivity test of Trichoderma reesei strains

[0097] This test consists of verifying whether the growth of Trichoderma reesei is altered in culture on a medium containing L-canavanine, in order to validate the use of L-canavanine as a selection marker.

[0098] Varying quantities of Trichoderma reesei spores, from a fresh culture made on PDA (Potatoe Dextrose Agar) are spread on two different media: - a rich medium called PDA containing in particular arginine, in which L-canavanine at a concentration of 200 pg / mL is added. - a minimal medium used for the culture of Trichoderma without arginine in which L-canavanine at a concentration of 50 pg / mL is added.

[0099] The spore culture is observed and the results are presented in Figure 1. The results are observed at 4 days for the rich medium and at 8 days for the minimal medium.

[0100] Spores grow normally on PDA medium (which is a rich medium). On PDA medium, supplemented by the addition of L-canavanine at 200 pg / mL, the spores are not affected by the presence of L-canavanine. The rich medium therefore does not allow for growth inhibition following the addition of the antimetabolite.

[0101] On minimal medium, spores grow less quickly than on PDA medium. This result is expected. On minimal medium, supplemented by the addition of L-canavanine at 50 pg / mL, growth is very different from controls on minimal medium (MM) alone. The thalli are very small, frail, and the higher the L-canavanine concentration, the greater the growth inhibition. MM medium, a minimal medium notably devoid of arginine, allows us to observe an effect significant on the growth of thalli following the addition of L-canavanine, even at a low concentration (50 pg / mL).

[0102] This result confirms that the addition of L-canavanine to a minimal medium, particularly one devoid of arginine, does indeed have a deleterious effect on the growth of Trichoderma reesei.

[0103] The addition of L-canavanine can thus be used as a selection marker, provided that strains sensitive or not sensitive to the addition of L-canavanine in the medium are distinguished.

[0104] Example 2: Transformation and selection of transformed strains using L-canavanine

[0105] The aim of this experiment is to invalidate the gene ID 18487637 of Trichoderma reesei, and to verify whether its invalidation allows the selection of TRI67806- transformants (strains in which gene ID 18487637 has been invalidated) from TRI67806+ strains (strains in which gene ID 18487637 has not been invalidated).

[0106] Invalidation is performed using the CRISPR-Cas9 tool, with the following components: - A nuclease: Alt-R™ Sp HiFi Cas9 Nuclease V3 - A guide: Alt-R™ CRISPR-Cas9 sgRNA (represented by SEQ ID NO: 3, CATCCAGTACTGGACCGAGT CGG) A repair template (SEQ ID NO: 4) is also used. This is composed of: - A selection marker: a Hygromycin cassette composed of [CPC Promoter (SEQ ID NO: 6), IM7 Promoter (SEQ ID NO: 7), Hygromycin Resistance Gene (SEQ ID NO: 9), TrpC Terminator (SEQ ID NO: 9)], - Two 1 kb flanks of sequences identical to the two 1 kb regions flanking the targeted gene, here ID 18487637 (SEQ ID NO: 5 and SEQ ID NO: 10).

[0107] Any other techniques allowing the invalidation of gene ID 18487637, in particular those mentioned above, can also be used instead of the CRISPR-Cas9 tool.

[0108] The protocol and result of the transformation are presented in Table 2.

[0109] [Table 2]

[0110] Protocol and summary

[0111] CTS50 corresponds to a dilution solution comprising 50 mM CaCl2; 0.1 M Tris-HCl; 0.4M Sucrose, pH 7.5.

[0112] The regeneration witness allows the toxicity of the transformation protocol to be assessed.

[0113] The produced protoplasts are not subjected to mutagenic agents (the CRISPR-Cas9 RNP complex (nuclease and guide of SEQ ID NO: 3) and the repair matrix as indicated above), nor to growth on selective medium. Its study reported and compared to other transformations allows to provide information on the quality of the transformation protocol.

[0114] Sensitivity controls allow the number of false positives on the selection medium to be assessed.

[0115] The produced protoplasts are not subjected to mutagenic agents (the CRISPR-Cas9 RNP complex (nuclease and guide of SEQ ID NO: 3) and the repair matrix as indicated above), but they are cultured on the selective medium set up to select genetic mutants. These controls make it possible to evaluate the false positive rate, i.e. the number of spontaneous mutants allowing growth on the screen. For the two sensitivity controls and in the context of the above transformation, no protoplast was able to grow on a medium containing Hygromycin or L-canavanine.

[0116] Transformation

[0117] The produced protoplasts are transformed so that the mutation of gene ID 18487637 transporting arginine and its antimetabolite is no longer functional. Thus the transport of arginine and its antimetabolite, from the culture medium within the cell is no longer possible. The mutation at site ID 18487637 relies on the action of the RNP complex (CRISPR-Cas9 tool: nuclease and guide of SEQ ID NO: 3 as indicated above)) and on the insertion of the repair template (SEQ ID NO: 4), in place of gene ID 18487637.

[0118] By selecting transformants on minimal medium (MM) + L-canavanine, only those carrying a deleterious mutation in gene ID 18487637 were able to grow on medium containing the antimetabolite. The L-canavanine sensitivity control showed no thallus, confirming that the transformants corresponded to the expected genetic mutation (invalidation of gene ID 18487637 by its eviction by the repair matrix). 142 transformants were obtained.

Claims

Claims

1. A strain of filamentous fungus belonging to the division Ascomycetes, excluding a fungus belonging to the class Saccharomycetes, wherein: - gene ID 18487637, or a variant or orthologous gene, has been invalidated, or - a gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein, has been invalidated.

2. Strain of fungus according to the preceding claim, in which the fungus belongs to the order of Hypocreales, in particular to the genus Trichoderma, and even more particularly to the species Trichoderma reesei.

3. A fungal strain according to any one of claims 1 to 2, wherein gene ID 18487637, or a variant or an orthologous gene, corresponds to a gene represented by SEQ ID NO: 1, or a gene having at least 80% identity with the gene of SEQ ID NO: 1, in particular at least 90% and more particularly at least 95%.

4. A fungal strain according to any one of claims 1 to 2, wherein the gene coding for a protein represented by SEQ ID NO: 2, or a variant protein, or an orthologous protein corresponds to a gene coding for a protein represented by SEQ ID NO: 2, or a protein having at least 80% identity with the protein of SEQ ID NO: 2, in particular at least 90% and more particularly at least 95%.

5. A method of genetically modifying a fungal strain according to any one of claims 1 to 4, comprising a step of invalidating said gene, a variant or an orthologous gene.

6. Use of L-canavanine as a strain selection marker according to any one of claims 1 to 4.

7. Use of L-canavanine according to claim 6, in the presence of a minimal medium or a synthetic medium devoid of arginine, optionally also devoid of alanine, aspartate and / or glutamate.

8. A method of selecting a strain according to any one of claims 1 to 4 comprising: - bringing a strain into contact with a culture medium comprising L-canavanine, - the selection of the strain if it is capable of growing in the culture medium.

9. A method of producing mushroom biomass, comprising a step of culturing a mushroom strain according to any one of claims 1 to 4 in a culture medium comprising a suitable substrate.

10. Method for producing proteins of interest, in particular enzymes, comprising a step of culturing a fungal strain according to any one of claims 1 to 4 in a culture medium comprising a suitable substrate.

11. Process for producing bio-sourced products from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to any one of claims 1 to 4.

12. A process for producing a sweet juice or sugars from cellulosic or lignocellulosic substrates, comprising: - i) a step of pretreatment of a cellulosic or lignocellulosic substrate in order to obtain a pretreated substrate, - ii) a step of producing cellulolytic enzymes by a strain according to any one of claims 1 to 4, - iii) a step of enzymatic hydrolysis of the pretreated substrate, in the presence of the cellulolytic enzymes obtained in step ii) and of an appropriate substrate, in order to obtain a hydrolysate.

13. A method of producing a biofuel from cellulosic or lignocellulosic substrates, comprising a step of producing cellulolytic enzymes by a fungal strain according to any one of claims 1 to 4.

14. A method of producing a biofuel from cellulosic or lignocellulosic substrates according to claim 13, comprising: - i) a step of pretreatment of a cellulosic or lignocellulosic substrate in order to obtain a pretreated substrate, - ii) a step of producing cellulolytic enzymes by a strain according to any one of claims 1 to 4, - iii) a step of enzymatic hydrolysis of the pretreated substrate, in the presence of the cellulolytic enzymes obtained in step ii) and of an appropriate substrate, in order to obtain a hydrolysate, - iv) a step of alcoholic fermentation of the hydrolyzate obtained, step iv) being optionally carried out simultaneously with step iii). - v) a separation step, in particular by distillation.

15. Use of a fungal strain according to any one of claims 1 to 4, for the hydrolysis of cellulose or lignocellulose into glucose, for the production of bio-sourced products, biofuel, sweet juice or sugars, from cellulosic or lignocellulosic substrates, and / or for the production of proteins of interest, more particularly enzymes, in particular cellulolytic enzymes such as cellulases.

Images