Autoantibody produced by autoreactive DN2b cells and use thereof

Abstract

The present invention provides an autoantibody, or an antigen-binding fragment thereof, produced by autoreactive DN2B cells. Also provided is an antibody, or an antigen-binding fragment thereof, that contains an antigen-binding site of the autoantibody. Further provided is a diagnostic agent for systemic lupus erythematosus, the diagnostic agent including the autoantibody or the antibody or an antigen-binding fragment of the autoantibody or the antibody. Furthermore provided is a blood sample test method that includes a step for measuring the expression of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from a subject. The expression of the autoantibody being higher than a reference value indicates that the subject is likely to be suffering from systemic lupus erythematosus.

Description

Autoantibodies produced by autoreactive dn2b cells and uses thereof

[0001] The present invention relates to an autoantibody produced by autoreactive DN2B cells and its use. More specifically, the present invention relates to an autoantibody produced by autoreactive DN2B cells or an antigen-binding fragment thereof, an antibody having the antigen-binding site of the autoantibody, a diagnostic agent for systemic lupus erythematosus, and a method for testing a blood sample. This application claims priority to U.S. Provisional Application No. 63 / 542,310, filed in the U.S. on October 4, 2023, the contents of which are incorporated herein by reference.

[0002] Systemic lupus erythematosus (SLE) is a chronic autoimmune disease characterized by the presence of multiple autoantibodies in the blood, which are thought to play a pathogenic role through their deposition in organ tissues by forming immune complexes.

[0003] It has been reported that double negative 2 (DN2) cells are increased in SLE patients (Non-Patent Document 1).

[0004] Jenks SA, Cashman KS, Zumaquero E, Marigorta UM, Patel AV, Wang Xiaoqian, et al. Distinct Effector B Cells Induced by Unregulated Toll-like Receptor 7 Contribute to Pathogenic Responses in Systemic Lupus Erythematosus. Immunity. 2018 Oct 16;49(4):725-739.e6; doi 10.1016 / j.immuni.2018.08.015

[0005] An objective of the present disclosure is to provide an antibody or antigen-binding fragment thereof useful for diagnosing systemic lupus erythematosus, a diagnostic agent for systemic lupus erythematosus using the antibody or antigen-binding fragment, and a method for testing blood samples useful for diagnosing systemic lupus erythematosus.

[0006] The present disclosure includes the following aspects: [1] An autoantibody or an antigen-binding fragment thereof produced by autoreactive DN2B cells. [2] The autoantibody or antigen-binding fragment thereof according to [1], wherein the autoantibody is an antinuclear antibody. [3] An antibody or antigen-binding fragment thereof comprising the antigen-binding site contained in the autoantibody according to [1] or [2]. [4] An antibody or antigen-binding fragment thereof selected from the group consisting of (a) to (c) below: (a) an antibody comprising a heavy-chain variable region having HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1, in any combination of Nos. 1 to 10 in Table 1; (b) an antibody comprising a light-chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2, in any combination of Nos. 1 to 10 in Table 1; (c) an antibody comprising HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1, in any combination of Nos. 1 to 10 in Table 1. and a light chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2 in any combination of Nos. 1 to 10 in Table 1.

[0007]

[0008]

[0009] [5] A diagnostic agent for systemic lupus erythematosus, comprising the autoantibody or antigen-binding fragment thereof according to [1] or [2]. [6] A diagnostic agent for systemic lupus erythematosus, comprising the antibody or antigen-binding fragment thereof according to [3] or [4]. [7] A method for testing a blood sample, comprising a step of measuring the expression level of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from a test subject, wherein a higher expression level of the autoantibody than a reference value indicates a high possibility that the test subject is suffering from systemic lupus erythematosus.

[0010] According to the present disclosure, it is possible to provide an antibody or an antigen-binding fragment thereof useful for diagnosing systemic lupus erythematosus, a diagnostic agent for systemic lupus erythematosus using the antibody or antigen-binding fragment, and a method for testing a blood sample useful for diagnosing systemic lupus erythematosus.

[0011] Bar graph (n=1) showing PLD4 expression in immune cells of healthy donors (HD) and patients with systemic lupus erythematosus (SLE). PLD4 in human plasmacytoid dendritic cells (pDCs) and B cells from HD and SLE patients. ＋ Representative flow cytometry plots showing cells. BDCA-2 ＋ The cells represent pDC. ＋ Cells indicate B cells. PLD4 in HD (n = 19) and SLE patients (n = 40) ＋ Boxplot showing the proportion of B cells. CD19 in SLE patients (SLE21, SLE17) ＋ cell, PLD4 ＋ The results of FSC-A analysis of CD19 cells and plasmablasts (PB) are shown. ＋ Flow cytometry plots of B cells compartmentalized into "PLD4+ blast" and "PLD4+ small." Box plots showing the proportion of PLD4+ blast in SLE patients. Box plots comparing SLEDAI scores between SLE patients with a high (H) and low (L) proportion of PLD4+ blast. ＋ Box plots comparing the SLEDAI scores between the high (H) and low (L) B cell ratio groups. Plots evaluating the correlation between the ratio of PLD4+ blasts and the ratio of plasmablasts in SLE patients. ＋ Plots evaluating the correlation between the proportion of B cells and the proportion of plasmablasts. ＋ DN2 B cells (CD27 － , CXCR5 － Flow cytometry plots evaluating the ratio of PLD4 to PLD4 in a representative SLE patient. ＋Histogram showing intracellular T-bet positivity in each cell population: B cells, PLD4+ small, and PLD4+ blast. Plot showing the correlation between the proportion of DN2B cells and the proportion of PLD4+ blast. Representative pro-cytometry plots of DN2B cells assessed by PLD4 and FSC-A. Bar graph comparing the incidence of nephritis between groups with a high (H) and low (L) proportion of PLD4+ blast. ***P<0.005. Fisher's exact test and Mann-Whitney U test. Bar graph comparing anti-Sm antibody titers between groups with a high (H) and low (L) proportion of PLD4+ blast. ***P<0.005. Fisher's exact test and Mann-Whitney U test. Bar graph comparing anti-dsDNA antibody titers between the group with a high (H) and group with a low (L) ratio of PLD4+ blasts. ns, not significant. Fisher's exact test and Mann-Whitney U test. Figure analyzing the ratio of PLD4+ blasts before and after immunosuppressive therapy in 11 patients with newly developed SLE. ***P<0.005. Wilcoxon signed-rank test. Representative flow cytometry plots of HD PBMCs cultured in vitro with stimuli (anti-IgG / IgM (BCR cross-linking), TLR7 ligands, and TLR9 ligands). PLD4 induced in HD PBMCs cultured in vitro with stimuli (anti-IgG / IgM (BCR cross-linking), TLR7 ligands, and TLR9 ligands). ＋ Box plot comparing the proportion of B cells. ***P<0.005. Mann-Whitney U test. Graph showing the results of RT-qPCR measurement of PLD4 mRNA expression in naive B cells isolated from three HD patients, after culturing them with or without a TLR9 ligand for two days. *P<0.05. Wilcoxon signed-rank test. Graph showing the results of IgG ELISpot after direct seeding of plasmablasts and PLD4+ blasts collected from two SLE patients (SLE13, SLE28) onto a PVDF membrane. CD19 collected from two SLE patients (SLE13, SLE28) ＋This figure shows the results of IgG ELISpot analysis performed on B cells and PLD4+ blast cells cultured in vitro for 4 days with a TLR7 or TLR9 ligand. This graph shows the number of spots per 1,000 B cells calculated from the ELISpot results in Figure 4B. This bar graph shows OD450 measurements obtained by ELISA using recombinant monoclonal antibodies prepared from a repertoire of cultured PLD4+ blast cells. I: H1+L1, II: H2+L2, III: H3+L3, IV: randomly amplified monoclonal antibody from one HD patient, V: HD serum, VI: SLE patient serum. ND, not detected. This bar graph shows the results of quantification of PLD4 mRNA by RT-qPCR using cDNA (n=1) from multiple organ tissues. The relative expression level of PLD4 mRNA was normalized by GAPDH gene expression. Br: brain, Col: colon, Hrt: heart, Kid: kidney, Leu: leukocyte, Liv: liver, Mu: muscle, Ov: ovary, Pan: pancreas, Pla: placenta, Pro: prostate, S. Int: small intestine, Spl: spleen, Tes: testis, Thy: thymus. Figure showing the gating strategy for flow cytometry. pDCs were defined as CD14-, CD3-, CD19-, and CD11c-negative, and BDCA-2-positive. B cells were defined as CD19-, CD2-, CD14-, and CD16-negative. CD3 cells collected from HD were analyzed. ＋ CD4 ＋ T cells, CD3 ＋ CD8 ＋ T cells, CD14 ＋ Cells and CD16 ＋Representative histogram showing PLD4 positivity in cell subpopulations. Diagram showing the flow cytometry gating strategy to define transitional B cells (Transitional), naive B cells (Naive), double-negative B cells (DN), memory B cells (Memory), and plasmablasts (Plasmablasts). Boxplot showing the results of comparing the proportion of each B cell subpopulation between HD (n=6) and SLE patients (n=36). *P<0.05, ***P<0.005. Mann-Whitney U test. Tr: transitional B cells, NAV: naive B cells, Mem: memory B cells, DN: double-negative B cells, PB: plasmablasts. The proportion of each B cell subpopulation was compared with that of CD19 ＋ B cells and PLD4 ＋ Box plot showing the results of comparing B cells. *P<0.05, ***P<0.005. Mann-Whitney U test. Tr: transitional B cells, NAV: naive B cells, Mem: memory B cells, DN: double-negative B cells, PB: plasmablasts. CD27 contained in PLD4+blast ＋ Memory cells and IgD ＋ For a subpopulation of naive cells, CD11c ＋ Cells and CXCR5 －Flow cytometry plots analyzing the proportion of cells. Plots evaluating the correlation between the proportion of PLD4+ blasts and serum C3 levels (left) and serum C4 levels (right) in SLE patients. Spearman rank correlation coefficient (ρ) and p-value are shown. Amplification plots of RT-PCR performed using index-head (internal control) primers on cDNA obtained from a positive control, SLE patient PBMCs, and HD PBMCs. Melt curve plots of RT-PCR performed using index-head (internal control) primers on cDNA obtained from a positive control (2H), SLE patient PBMCs (4H), and HD PBMCs (6H). Amplification plot of RT-PCR using primers for H1 on cDNA obtained from a positive control (2H), SLE patient PBMCs (4H), and HD PBMCs (6H). Melt curve plot of RT-PCR using primers for H1 on cDNA obtained from a positive control (2H), SLE patient PBMCs (4H), and HD PBMCs (6H). Fluorescent immunostaining images performed using a recombinant monoclonal antibody prepared using the nucleic acid sequence of H1 (VH1-18-01-J4-02). DAPI: DAPI staining. Alexa 488: A recombinant monoclonal antibody was used as the primary antibody, purified anti-human CD16 (mouse IgG) was used as the secondary antibody, and goat anti-mouse IgG (Alexa Fluor 488) was used as the tertiary antibody.

[0012] A numerical range expressed using "to" means a range that includes the numerical values ​​before and after "to" as the lower and upper limits.

[0013] Unless otherwise specified, "a," "an," and "the" are inclusive of singular and plural and are understood to mean "one or more."

[0014] The term "comprise" means that it may contain components other than the target component. The term "consist of" means that it does not contain components other than the target component. The term "consist essentially of" means that it does not contain components other than the target component in a manner that would exert a special function (such as a manner that would completely lose the effects of the invention). In this specification, when "comprise" is used, it includes both "consist of" and "consist essentially of" embodiments.

[0015] Proteins, peptides, nucleic acids, vectors, and cells may be isolated. "Isolated" means in a natural state or separated from other components. "Isolated" may be substantially free of other components. "Substantially free of other components" means that the content of other components contained in the isolated component is negligible. The content of other components contained in the isolated component may be, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less, or 0.1% by mass or less. The proteins, peptides, nucleic acids, vectors, and cells described herein may be isolated proteins, isolated peptides, isolated nucleic acids, isolated vectors, and isolated cells, respectively.

[0016] Nucleic acid sequences are written in their generally accepted single-letter code unless otherwise indicated. Nucleic acid sequences are written 5' to 3' unless otherwise indicated.

[0017] Amino acid sequences are written in the commonly accepted one-letter or three-letter code unless otherwise specified, and are written from N- to C-terminal unless otherwise specified.

[0018] The sequence identity (or homology) between nucleic acid sequences or amino acid sequences is determined by aligning the two nucleic acid sequences or amino acid sequences with gaps at the insertion and deletion sites so that the most corresponding bases or amino acids are identical, and calculating the percentage of identical bases or amino acids relative to the entire nucleic acid sequence or the entire amino acid sequence, excluding gaps in the resulting alignment. Sequence identity between nucleic acid sequences or amino acid sequences can be determined using various homology search software known in the art. For example, the sequence identity value of nucleic acid sequences can be calculated based on the alignment obtained using the known homology search software BLASTN, and the sequence identity value of amino acid sequences can be calculated based on the alignment obtained using the known homology search software BLASTP.

[0019] "Antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that specifically binds an antigen. Antibodies can be polyclonal, monoclonal, or chimeric.

[0020] The basic antibody structural unit is known to comprise a tetramer. Each tetramer has two identical pairs of polypeptide chains, each pair having one light chain (approximately 25 kDa) and one heavy chain (approximately 50-70 kDa). The amino-terminal portion of each chain contains a variable region primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. Antibody molecules obtained from humans generally belong to one of the classes IgG, IgM, IgA, IgE, and IgD, which differ from one another depending on the nature of the heavy chains present in the molecule. Some classes have subclasses, such as IgG1 and IgG2. In humans, the light chains may be kappa or lambda chains.

[0021] The antibody may be derived from any organism, including, but not limited to, mammals (human, mouse, rat, rabbit, horse, cow, pig, monkey, dog, etc.), birds (chicken, ostrich), etc.

[0022] "Specifically binds" means that an antibody reacts with one or more antigenic determinants of a particular antigen, but does not react with other antigens or binds with a much lower affinity. When an antibody specifically binds to a particular antigen, the dissociation constant (KD) between the antibody and the particular antigen is greater than or equal to 10. －８ mol / L or less, and －１３ mol / L or more 10 －９ The dissociation constant (KD) between an antibody and a specific antigen can be measured by a plasmon resonance assay (for example, BIAcore, GE-Healthcare Uppsala, Sweden, etc.) using purified antigen.

[0023] The complementarity-determining region (CDR) is the site in an antibody that is involved in binding to an antigen and is the site in an antibody molecule where the amino acid sequence varies most depending on the antigen. Generally, three CDRs are present in the heavy chain variable region and three in the light chain variable region. In this specification and claims, the three CDRs present in the heavy chain variable region are referred to as HCDR1, HCDR2, and HCDR3, in order from the N-terminus. The three CDRs present in the light chain variable region are referred to as LCDR1, LCDR2, and LCDR3, in order from the N-terminus. CDRs can be determined according to known definitions. CDRs can be determined, for example, according to the definitions of Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991))) or Chothia (Chothia & Lesk, J. Mol. Biol. 196:901-917 (1987) and Chothia et al., Nature 342:877-883 (1989)).

[0024] CDRs defined on the ImMunoGeneTics (http: / / imgt.org) website may be used. At the heavy chain locus of a human antibody, a V gene segment, a D gene segment, and a J gene segment are rearranged to form a heavy chain variable region coding region. At the light chain locus of a human antibody, a J gene segment and a J gene segment are rearranged to form a light chain variable region coding region. HCDR3 is usually located in a region extending from the 3' end of the V region to the 5' end of the J region. The region extending from the 104th cysteine ​​residue (C) from the N-terminus encoded by the V region to the 5th tryptophan residue (W) from the N-terminus encoded by the J region may be defined as HCDR3. LCDR3 is usually located in a region extending from the 3' end of the V region to the 5' end of the J region. The region from the cysteine ​​residue (C) located at the most C-terminal end of the amino acid sequence encoded by the J region to the tryptophan residue (W) or phenylalanine residue (F) located at the most N-terminal end of the amino acid sequence encoded by the J region may be defined as LCDR3.

[0025] The term "antigen-binding site" refers to the site of an antibody that is involved in binding to an antigen. The antigen-binding site preferably comprises HCDR3 of an antibody, more preferably comprises the three CDRs of the heavy chain variable region (HCDR1 to HCDR3), and even more preferably comprises the three CDRs of the heavy chain variable region (HCDR1 to HCDR3) and the three CDRs of the light chain variable region (LCDR1 to LCDR3). Antibodies that contain the same antigen-binding site bind to the same epitope.

[0026] An "antigen-binding fragment" refers to a polypeptide comprising a portion of an antibody, which maintains the antigen-binding ability of the original antibody. The antigen-binding fragment preferably comprises the antigen-binding site of the original antibody, more preferably comprises the HCDR3 of the original antibody, and even more preferably comprises all six CDRs (HCDR1 to HCDR3, LCDR1 to LCDR3) of the original antibody. Examples of antigen-binding fragments include Fab, Fab', F(ab') ２ , variable region fragment (Fv), disulfide-linked Fv, single-chain Fv (scFv), sc(Fv) ２ etc.

[0027] The term "autoantibody" refers to an antibody that specifically binds to an antigen produced in the body itself. Examples of autoantibodies include antinuclear antibodies.

[0028] "Anti-nuclear antibodies" refer to autoantibodies that target components constituting the cell nucleus present in one's own cells as antigens. Examples of anti-nuclear antibodies include anti-dsDNA antibodies that target double-stranded DNA as antigens, anti-Sm antibodies that target non-histone nuclear proteins as antigens, and anti-histone antibodies that target histones as antigens.

[0029] "DN2B cells" refer to double-negative 2B cells. DN2B cells are IgD-negative and CD27-negative B cells. "Autoreactive DN2B cells" are DN2B cells that produce autoantibodies. In one embodiment, autoreactive DN2B cells are strongly CD11c-positive, CD21-negative, strongly CD19-positive, and CXCR5-negative. IgD (Immunoglobulin D) is composed of one pair of heavy chains and one pair of light chains. CD27 is a member of the TNF receptor superfamily. Examples of the amino acid sequence of human CD27 include those registered under NCBI Reference Sequence: NP_001233.2, NP_001400192.1, NP_001400193.1, NP_001400194.1, NP_001400195.1, NP_001400196.1, or NP_001400197.1. CD11c (ITGAX integrin subunit alpha X) is a member of the integrin family and covalently associates with the integrin β2 chain. Examples of the amino acid sequence of human CD11c include those registered under NCBI Reference Sequence: NP_000878.2 or NP_001273304.1. CD21 (CR2 complement C3d receptor 2) is a complement regulatory protein. Examples of the amino acid sequence of human CD21 include those registered under NCBI Reference Sequence: NP_001006659.1 or NP_001868.2. CD19 is a member of the immunoglobulin superfamily and is known as a B cell marker. Examples of the amino acid sequence of human CD19 include those registered under NCBI Reference Sequence: NP_001171569.1, NP_001372661.1, or NP_001761.3. CXCR5 (CXC motif chemokine receptor 5) is a member of the CXC chemokine receptor family.Examples of the amino acid sequence of human CXCR5 include those registered under NCBI Reference Sequence: NP_001707.1 or NP_116743.1.

[0030] When a cell is "positive" for a protein, it means that the cell expresses the protein in a detectable amount. When a cell is positive for a membrane protein, it means that the protein is present in a detectable amount on the cell membrane of the cell. When a cell is "negative" for a protein, it means that the cell does not express the protein in a detectable amount. When a cell is negative for a membrane protein, it means that the protein is not present in a detectable amount on the cell membrane of the cell. When the protein is a membrane protein, whether a cell is positive or negative for the protein can be determined by flow cytometry analysis using an antibody that specifically binds to the protein.

[0031] When a cell is "strongly positive" for a protein, it means that the cell expresses a high level of that protein compared to the average expression level of that protein in cells of the same type. B cells that are strongly positive for CD11c express a high level of CD11c compared to the average expression level of CD11c in B cells. B cells that are strongly positive for CD19 express a high level of CD19 compared to the average expression level of CD19 in B cells.

[0032] "PLD4" (phospholipase D family member 4) is an enzyme that catalyzes the reaction of hydrolyzing phosphatidylcholine to produce phosphatidic acid and choline, causing various intracellular signal transduction. The amino acid sequence of human PLD4 is registered in the NCBI Reference Sequence database as NP_001295103.1 (SEQ ID NO: 131) and NP_620145.2 (SEQ ID NO: 132).

[0033] [Autoantibody or antigen-binding fragment thereof produced by DN2B cells] A first aspect of the present disclosure is an autoantibody or antigen-binding fragment thereof produced by DN2B cells.

[0034] DN2B cells are IgD-negative and CD27-negative B cells. In one embodiment, autoreactive DN2B cells are strongly CD11c-positive, CD21-negative, strongly CD19-positive, and CXCR5-negative. In one embodiment, autoreactive DN2B cells are PLD4-positive. Autoreactive DN2B cells can be obtained by obtaining IgD-negative and CD27-negative B cells by flow cytometry analysis, and then sorting from this B cell fraction cells that are strongly CD11c-positive, CD21-negative, strongly CD19-positive, and CXCR5-negative. Alternatively, autoreactive DN2B cells can be obtained by sorting PLD4-positive B cells by flow cytometry analysis.

[0035] "PLD4-positive B cells" refer to B cells that express PLD4 as a surface antigen. PLD4-positive B cells can be obtained by selecting B cells by flow cytometry analysis using an anti-PLD4 antibody. In the examples described below, PLD4-positive B cells are referred to as "PLD4 ＋ Also referred to as "B cells."

[0036] The animal from which the autoreactive DN2B cells are derived is not particularly limited, and examples of animals from which the autoreactive DN2B cells are derived include mammals (humans, mice, rats, rabbits, horses, cows, pigs, monkeys, dogs, etc.), birds (chickens, ostriches), etc.

[0037] B cells can be isolated from peripheral blood mononuclear cells (PBMCs) by known methods, for example, using a commercially available B cell isolation kit.

[0038] Autoreactive DN2B cells may be induced by stimulating B cells with a TLR ligand. Examples of TLR ligands include TLR7 ligands and TLR9 ligands. Examples of TLR7 ligands include R-848 (Resiquimod), Gardiquimod, Imiquimod, and Loxoribine. Examples of TLR9 ligands include oligonucleotides containing a CpG motif. In addition to a TLR ligand, an agent that induces BCR cross-linking signaling may be used to induce autoreactive DN2B cells. Examples of agents that induce BCR cross-linking signaling include an anti-IgG antibody or an antigen-binding fragment thereof, an anti-IgM antibody or an antigen-binding fragment thereof, and the like.

[0039] The autoreactive DN2B cells that produce autoantibodies may be autoreactive DN2B cells of a size similar to that of plasmablasts (approximately 8 to 20 μm in diameter). For example, the 25th percentile of the FSC-A of plasmablasts obtained by flow cytometry analysis may be used as a threshold (e.g., 60K), and autoreactive DN2 cells (hereinafter also referred to as "DN2B+blast" or "PLD4+blast") that are larger than this FSC-A may be used. "FSC" represents forward scattered light when a cell is irradiated with a laser. "FSC-A" represents the voltage pulse area where the FSC is detected by an optical detector.

[0040] Autoantibodies can be produced from autoreactive DN2B cells by known methods. For example, autoantibodies can be produced from autoreactive DN2B cells by culturing P autoreactive DN2B cells in the presence of a TLR ligand (e.g., a TLR7 ligand, a TLR9 ligand, etc.).

[0041] The medium used to culture autoreactive DN2B cells can be a medium typically used for culturing B cells. Specific examples of the medium include RPMI 1640 medium, Doulbecco's modified Eagle's Medium (DMEM) medium, DMEM / F12 medium, Advanced DMEM / F12 medium, IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Ham's F12 medium, Fischer's medium, and mixtures thereof. These media may also contain serum (fetal bovine serum (FBS)), serum substitutes, etc. Autoreactive DN2B cells can be cultured in the presence of a TLR ligand in the medium described above to produce autoantibodies.

[0042] The culture conditions for autoreactive DN2B cells can be the same as those typically used for culturing B cells. Examples of temperature conditions include 37°C, which is close to body temperature. Examples of carbon dioxide concentrations include 0.03 to 10%, and a specific example is 5%.

[0043] Autoantibodies produced from autoreactive DN2B cells can be purified by combining known purification techniques such as salting out, ion exchange chromatography, affinity chromatography, and gel filtration chromatography.

[0044] Examples of autoantibodies produced by autoreactive DN2B cells include antibodies selected from the group consisting of (a) to (c) below: (a) an antibody comprising a heavy chain variable region having HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1 above, in any combination of Nos. 1 to 10 in Table 1; (b) an antibody comprising a light chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2 above, in any combination of Nos. 1 to 10 in Table 1; (c) an antibody comprising a heavy chain variable region having HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1 above, in any combination of Nos. 1 to 10 in Table 1, and a light chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2 above, in any combination of Nos. 1 to 10 in Table 1.

[0045] In Table 1, the heavy chain variable region defined by combination No. 1 has CDR1 and CDR2 derived from the V chain VH1-18-01 and HCDR3 No. 1 (CAREQLGLIDYW: SEQ ID NO: 10). In Table 1, the heavy chain variable region defined by combination No. 2 has CDR1 and CDR2 derived from the V chain VH4-34-01 and HCDR3 No. 2 (CARAGATLNRFDPW: SEQ ID NO: 11). In Table 1, the heavy chain variable region defined by combination No. 3 has CDR1 and CDR2 derived from the V chain VH1-18-01 and HCDR3 No. 3 (CPRGIVVNWFDPW: SEQ ID NO: 12). The same applies to the heavy chain variable regions defined by combinations No. 4 to No. 10 in Table 1.

[0046] In Table 2, the light chain variable region defined by combination No. 1 has CDR1 and CDR2 derived from the V chain of KV1-16-02 and LCDR3 No. 1 (CQQYSSYPRTF: SEQ ID NO: 20). In Table 2, the light chain variable region defined by combination No. 2 has CDR1 and CDR2 derived from the V chain of KV2-30-02 and LCDR3 No. 2 (CMQGTHWPPDPHTF: SEQ ID NO: 21). In Table 2, the light chain variable region defined by combination No. 3 has CDR1 and CDR2 derived from the V chain of KV2-30-02 and HCDR3 No. 3 (CQQYNSYPLTF: SEQ ID NO: 22). The same applies to the light chain variable regions defined by combinations No. 4 to No. 10 in Table 2.

[0047] The V chain sequences in Tables 1 and 2 can be obtained from the ImMunoGeneTics (http: / / imgt.org) website. The V chains in Tables 1 and 2 are human V chains. Amino acid sequences encoded by nucleic acid sequences that share 60% or more sequence identity with nucleic acid sequences registered with ImMunoGeneTics can be used as the amino acid sequences of the V chains listed in Tables 1 and 2.

[0048] Examples of the amino acid sequence of the V chain of VH1-18-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 112. Examples of the amino acid sequence of the V chain of VH4-34-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 113. Examples of the amino acid sequence of the V chain of VH1-8-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 114. Examples of the amino acid sequence of the V chain of VH1-8-02 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 115. Examples of the amino acid sequence of the V chain of VH7-4-1-02 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 116. Examples of the amino acid sequence of the V chain of VH5-51-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 117. Examples of the amino acid sequence of the V chain of VH3-30-04 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 118. Examples of the amino acid sequence of the V chain of VH3-30-3-03 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 119. The amino acid sequence of the V chain of VH3-74-01 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 120. The amino acid sequence of the V chain of VH2-70-01 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 121.The amino acid sequence of the V chain of VH3-64-01 includes an amino acid sequence having 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO:122.

[0049] The amino acid sequence of the V chain of KV1-16-02 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 123. The amino acid sequence of the V chain of KV2-30-02 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 124. The amino acid sequence of the V chain of KV1-5-03 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 125. The amino acid sequence of the V chain of KV3-15-01 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 126. Examples of the amino acid sequence of the V chain of KV1-6-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 127. Examples of the amino acid sequence of the V chain of KV3-20-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 128. Examples of the amino acid sequence of the V chain of KV1-27-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 129. Examples of the amino acid sequence of the V chain of KV1-NL1-01 include amino acid sequences that share 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 130.

[0050] The heavy chain variable region of combination No. 1 in Table 1 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 59. The heavy chain variable region of combination No. 2 in Table 1 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 60. The heavy chain variable region of combination No. 3 in Table 1 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 61.

[0051] The light chain variable region of combination No. 1 in Table 2 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 65. The light chain variable region of combination No. 2 in Table 2 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 66. The heavy chain variable region of combination No. 3 in Table 2 includes an amino acid sequence that has 60% or more, 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 67.

[0052] An example of the amino acid sequence of HCDR1 contained in the heavy chain variable region of No. 1 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 77. An example of the amino acid sequence of HCDR2 contained in the heavy chain variable region of No. 1 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 78. An example of the amino acid sequence of HCDR1 contained in the heavy chain variable region of No. 2 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 80. An example of the amino acid sequence of HCDR2 contained in the heavy chain variable region of No. 2 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 81. An example of the amino acid sequence of HCDR1 contained in the heavy chain variable region of No. 3 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 83. An example of the amino acid sequence of HCDR2 contained in the heavy chain variable region of No. 3 in Table 1 is the amino acid sequence set forth in SEQ ID NO: 84.

[0053] An example of the amino acid sequence of LCDR1 contained in the light chain variable region of No. 1 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 97 or 98. An example of the amino acid sequence of LCDR2 contained in the light chain variable region of No. 1 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 99. An example of the amino acid sequence of LCDR1 contained in the light chain variable region of No. 2 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 101. An example of the amino acid sequence of LCDR2 contained in the light chain variable region of No. 1 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 102. An example of the amino acid sequence of LCDR1 contained in the light chain variable region of No. 3 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 104. An example of the amino acid sequence of LCDR2 contained in the light chain variable region of No. 3 in Table 2 is the amino acid sequence set forth in SEQ ID NO: 105.

[0054] Specific examples of autoantibodies produced by PLD4-positive B cells include the following antibodies:

[0055] (1) An antibody comprising a heavy chain variable region including HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 77, 80, or 83, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 78, 81, or 84, and HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 79, 82, or 85. (2) An antibody comprising a light chain variable region including LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 97, 98, 101, or 104, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 99, 102, or 105, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 100, 103, 106, or 107. (3) An antibody comprising the heavy chain variable region defined in (1) above and the light chain variable region defined in (2) above. (4) An antibody comprising a heavy chain variable region including HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 77, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 78, and HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 79. (5) An antibody comprising a heavy chain variable region comprising HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 80, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 81, and HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 82. (6) An antibody comprising a heavy chain variable region comprising HCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 83, HCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 84, and HCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 85. (7) An antibody comprising a light chain variable region comprising LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 97 or 98, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 99, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 100. (8) An antibody comprising a light chain variable region comprising LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 101, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 102, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 103. (9) An antibody comprising a light chain variable region comprising LCDR1 comprising the amino acid sequence set forth in SEQ ID NO: 104, LCDR2 comprising the amino acid sequence set forth in SEQ ID NO: 105, and LCDR3 comprising the amino acid sequence set forth in SEQ ID NO: 106 or 107. (10) An antibody comprising a heavy chain variable region defined in any of (4) to (6) above and a light chain variable region defined in any of (7) to (9) above.(11) An antibody comprising the heavy chain variable region defined in (4) above and the light chain variable region defined in (7) above. (12) An antibody comprising the heavy chain variable region defined in (5) above and the light chain variable region defined in (8) above. (13) An antibody comprising the heavy chain variable region defined in (6) above and the light chain variable region defined in (9) above.

[0056] HCDR1 to HCDR3 and LCDR1 to LCDR3 described in (1) to (9) above preferably consist of the amino acid sequences of the designated SEQ ID NOs.

[0057] (14) An antibody comprising a heavy chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in any of SEQ ID NOs: 59 to 61. (15) An antibody comprising a heavy chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in any of SEQ ID NOs: 65 to 67. (16) An antibody comprising a heavy chain variable region defined in (14) above and a light chain variable region defined in (15) above. (17) An antibody comprising a heavy chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 59. (18) An antibody comprising a heavy chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 60. (19) An antibody comprising a heavy chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 61. (20) An antibody comprising a light chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 65. (21) An antibody comprising a light chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 66. (22) An antibody comprising a light chain variable region comprising an amino acid sequence having 70% or more, 80% or more, 90% or more, or 95% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 67. (23) An antibody comprising the heavy chain variable region defined in (17) above and the light chain variable region defined in (20) above. (24) An antibody comprising the heavy chain variable region defined in (18) above and the light chain variable region defined in (21) above. (25) An antibody comprising the heavy chain variable region defined in (19) above and the light chain variable region defined in (22) above. (26) An antibody comprising the heavy chain variable region defined in (17) above, comprising HCDR1 to HCDR3 defined in (4) above, and the light chain variable region defined in (20) above, comprising LCDR1 to LCDR3 defined in (7) above.(27) An antibody comprising a heavy chain variable region defined in (18) above, the heavy chain variable region comprising HCDR1 to HCDR3 defined in (5) above, and a light chain variable region defined in (21) above, the heavy chain variable region comprising LCDR1 to LCDR3 defined in (8) above. (28) An antibody comprising a heavy chain variable region defined in (19) above, the heavy chain variable region comprising HCDR1 to HCDR3 defined in (6) above, and a light chain variable region defined in (22) above, the heavy chain variable region comprising LCDR1 to LCDR3 defined in (9) above. (29) An antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:59. (30) An antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:60. (31) An antibody comprising a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO:61. (32) An antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO:65. (33) An antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 66. (34) An antibody comprising a light chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 67. (35) An antibody comprising the heavy chain variable region defined in (29) above and the light chain variable region defined in (32) above. (36) An antibody comprising the heavy chain variable region defined in (30) above and the light chain variable region defined in (33) above. (37) An antibody comprising the heavy chain variable region defined in (31) above and the light chain variable region defined in (34) above.

[0058] In the above (14) to (22), when the heavy chain variable region or the light chain variable region has a mutation with respect to the amino acid sequence set forth in the designated SEQ ID NO:, the mutation may be any of substitution, deletion, insertion, and addition, or a combination thereof. The mutation is preferably present in a region (framework region) other than the CDRs (HCDR1 to HCDR3, LCDR1 to LCDR3).

[0059] When an amino acid residue in an amino acid sequence is substituted, it is preferably substituted with an amino acid residue having a side chain with chemical properties similar to those of the original amino acid residue. Such substitutions of amino acid residues are called conservative substitutions. Amino acids with similar chemical properties can be classified into groups of acidic amino acids, basic amino acids, and neutral amino acids. Examples of the acidic amino acid group include aspartic acid and glutamic acid. Examples of the basic amino acid group include lysine, arginine, and histidine. Depending on the side chain, neutral amino acids can be further classified into amino acids with hydrocarbon chains (glycine, alanine, valine, leucine, isoleucine, and proline), amino acids with hydroxyl groups (serine and threonine), amino acids with sulfur atoms (cysteine ​​and methionine), amino acids with amide groups (asparagine and glutamine), amino acids with imino groups (proline), and amino acids with aromatic groups (phenylalanine, tyrosine, and tryptophan).

[0060] The autoantibody produced by autoreactive DN2B cells is preferably an antinuclear antibody. It is believed that the autoantibody produced by autoreactive DN2B cells is involved in the pathology of SLE. As shown in the Examples below, the BCR repertoire of autoreactive DN2B cells (particularly PLD4+blast) is biased. Therefore, the antibody produced by autoreactive DN2B cells has the same base sequence as BCR and is an autoantibody. This autoantibody can be used as a marker for SLE. Furthermore, the autoantibody produced by autoreactive DN2B cells can be used as a diagnostic agent for SLE. For example, it can be used to quantify autoantibodies involved in the pathology of SLE in a blood sample (plasma, serum, etc.) to be tested by competitive ELISA or the like.

[0061] [Antibody or antigen-binding fragment thereof] A second aspect of the present disclosure is an antibody (hereinafter also referred to as an "autoantibody-derived antibody") or an antigen-binding fragment thereof, comprising the antigen-binding site contained in the autoantibody according to the first aspect (hereinafter also referred to as an "autoreactive DN2B cell-derived autoantibody").

[0062] The autoantibody-derived antibody preferably comprises a heavy chain variable region including HCDR3 possessed by an autoreactive DN2B cell-derived autoantibody. The autoantibody-derived antibody more preferably comprises a heavy chain variable region including HCDR1 to HCDR3 possessed by an autoreactive DN2B cell-derived autoantibody. The autoantibody-derived antibody further preferably comprises a heavy chain variable region including HCDR1 to HCDR3 possessed by an autoreactive DN2B cell-derived autoantibody, and a light chain variable region including LCDR1 to LCDR3 possessed by an autoreactive DN2B cell-derived autoantibody.

[0063] Autoantibody-derived antibodies can be obtained, for example, using antibody genes contained in autoreactive DN2B cells. For example, messenger RNA (mRNA) is extracted from autoreactive DN2B cells, complementary DNA (cDNA) is synthesized from the RNA, and the heavy chain VDJ region and light chain VJ region are amplified from the cDNA by nucleic acid amplification (e.g., PCR). The resulting fragments are ligated to constant region-encoding sequences and cloned into an appropriate expression vector. Autoantibody-derived antibodies can be obtained by introducing this expression vector into appropriate cells and culturing them. Autoantibody-derived antibodies can be purified by known purification methods (salting out, ion exchange chromatography, affinity chromatography, gel filtration chromatography, etc.). The constant region-encoding sequences may be derived from the same animal species as the animal from which the autoreactive DN2B cells are derived, or from a different animal species.

[0064] An autoantibody-derived antibody may be obtained by designing an antibody gene or an antigen-binding fragment gene based on the amino acid sequence of an autoreactive DN2B cell-derived autoantibody. For example, a heavy chain variable region coding sequence is designed by ligating a nucleic acid sequence encoding HCDR1 to HCDR3 of an autoreactive DN2B cell-derived autoantibody with a nucleic acid sequence encoding a heavy chain framework (FR). A nucleic acid having a heavy chain variable region coding sequence may be chemically synthesized by the phosphoramidite method or the like. A nucleic acid having a heavy chain variable region coding sequence is ligated to a heavy chain constant region coding sequence and cloned into an appropriate expression vector. Similarly, a light chain variable region coding sequence is designed by ligating a nucleic acid sequence encoding LCDR1 to LCDR3 of an autoreactive DN2B cell-derived autoantibody with a nucleic acid sequence encoding a light chain framework (FR). A nucleic acid having a light chain variable region coding sequence may be chemically synthesized by the phosphoramidite method or the like. A nucleic acid having a light chain variable region coding sequence is ligated to a light chain constant region coding sequence and cloned into an appropriate expression vector. The heavy chain coding sequence and the light chain coding sequence may be cloned into the same expression vector. This expression vector can be introduced into appropriate cells and cultured to obtain an autoantibody-derived antibody. The FR coding sequence and the constant region coding sequence may be derived from the same animal species as the animal species from which the DN2B cells are derived, or may be derived from a different animal species. Furthermore, the entire heavy chain variable region and / or the light chain variable region, including the FCDRs and FRs, may be derived from an autoreactive DN2B cell-derived autoantibody.

[0065] The autoantibody-derived antibody may be obtained by producing a transgenic animal incorporating a gene encoding the autoantibody-derived antibody designed as described above, and by purifying the body fluids (e.g., blood, milk, etc.) of the transgenic animal.

[0066] The nucleic acid sequence encoding the antigen-binding fragment can be designed appropriately depending on the structure of the antigen-binding fragment. For example, scFv has a structure in which a heavy chain variable region and a light chain variable region are linked by a linker. Therefore, a nucleic acid comprising an scFv coding sequence can be obtained by linking a heavy chain variable region comprising HCDR1 to HCDR3 of an autoreactive DN2B cell-derived autoantibody with a light chain variable region comprising LCDR1 to LCDR3 of an autoreactive DN2B cell-derived autoantibody via a linker coding sequence.

[0067] Autoantibody-derived antibodies include antibodies selected from the group consisting of (a) to (c) above, and antibodies selected from the group consisting of (1) to (37) above. Representative examples of nucleic acid sequences encoding the V chains and CDRs of Tables 1 and 2 described in (a) to (c) are shown in Tables 8 to 13. Representative examples of nucleic acid sequences encoding the amino acid sequences of SEQ ID NOs. designated in (1) to (37) are shown in Tables 14 to 17.

[0068] The autoantibody-derived antibody has the same antigen specificity as the autoreactive DN2B cell-derived autoantibody. Therefore, the autoantibody-derived antibody binds to an antigen produced in the body of the individual from which the autoreactive DN2B cell is derived. The autoantibody-derived antibody is preferably an antinuclear antibody. Because the autoantibody-derived antibody has the same antigen specificity as the autoreactive DN2B cell-derived autoantibody, it can be used as a diagnostic agent for SLE, similar to the autoreactive DN2B cell-derived autoantibody.

[0069] [Diagnostic Agent for Systemic Lupus Erythematosus] A third aspect of the present disclosure is a diagnostic agent for systemic lupus erythematosus (hereinafter also referred to as an "SLE diagnostic agent"), which comprises at least one antibody selected from the group consisting of the autoantibody according to the first aspect (autoreactive DN2B cell-derived autoantibody) or an antigen-binding fragment thereof, and the antibody according to the third aspect (antibody derived from an autoantibody) or an antigen-binding fragment thereof.

[0070] The SLE diagnostic agent may contain other components in addition to at least one of an autoreactive DN2B cell-derived autoantibody, an autoantibody-derived antibody, or an antigen-binding fragment thereof. These other components include, but are not limited to, solvents, diluents, vehicles, excipients, glidants, binders, granulating agents, dispersing agents, suspending agents, wetting agents, lubricants, disintegrants, solubilizers, stabilizers, emulsifiers, and fillers. One pharmaceutically acceptable carrier may be used alone, or two or more may be used in combination.

[0071] The SLE diagnostic agent may be prepared by dissolving at least one of an autoreactive DN2B cell-derived autoantibody, an autoantibody-derived antibody, or an antigen-binding fragment thereof in a buffer solution. Alternatively, the SLE diagnostic agent may be prepared by dissolving at least one of an autoreactive DN2B cell-derived autoantibody, an autoantibody-derived antibody, or an antigen-binding fragment thereof in a buffer solution and lyophilizing the solution. Examples of buffer solutions include, but are not limited to, phosphate-buffered saline, Tris buffer, citrate buffer, and acetate buffer.

[0072] Autoreactive DN2B cell-derived autoantibodies, autoantibody-derived antibodies, and antigen-binding fragments thereof may be labeled. Labeling substances for labeling are not particularly limited, and known substances can be used. Examples of labeling substances include enzyme-labeled substances, fluorescent-labeled substances, radioisotope-labeled substances, electrochemiluminescent-labeled substances, and metal nanoparticles. Examples of enzyme-labeled substances include peroxidase (e.g., horseradish peroxidase) and alkaline phosphatase. Examples of fluorescent-labeled substances include carboxyfluorescein (FAM), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), fluorescein isothiocyanate (FITC), tetrachlorofluorescein (TET), 5'-hexachloro-fluorescein-CE phosphoramidite (HEX), Cy3, Cy5, Alexa568, and Alexa647. Examples of radioisotope-labeled substances include iodine-125. Examples of electrochemiluminescent labeling substances include ruthenium complexes. Labeling can be carried out by appropriately selecting a known method depending on the type of labeling substance.

[0073] The SLE diagnostic agent may be combined with other items to form an SLE diagnostic kit. Examples of other items included in the SLE diagnostic kit include instruments and reagents used in competitive ELISA. Instruments used in competitive ELISA include, but are not limited to, solid-phase supports such as well plates, antigens, labeled substance detection reagents, blood sample preparation reagents, diluents, buffer solutions, blocking reagents, and instructions for use. When the autoreactive DN2B cell-derived autoantibody and the autoantibody-derived antibody are antinuclear antibodies, cells of the animal species from which the autoreactive DN2B cells are derived can be used as the antigen.

[0074] [Method for testing a blood sample] A fourth aspect of the present disclosure is a method for testing a blood sample. The method includes a step of measuring the expression level of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from a test subject. A higher expression level of the autoantibody than a reference value indicates a high possibility that the test subject is suffering from systemic lupus erythematosus. Testing of a blood sample can be performed in vitro.

[0075] <Step of measuring the expression level of autoreactive DN2B cell-derived autoantibodies> The test subject is a subject to be tested for the possibility of suffering from SLE. The test subject is not particularly limited as long as it is an animal that may suffer from SLE. Specific examples of the test subject include humans and non-human mammals.

[0076] A "blood sample" refers to a sample derived from blood components collected from a test subject. Blood samples include plasma, serum, and blood cells, as well as samples obtained by processing these. Samples obtained by processing blood cells include cell populations obtained by culturing blood cells and culture supernatants obtained by culturing blood cells.

[0077] Methods for measuring the expression level of an autoreactive DN2B cell-derived autoantibody include a method for measuring mRNA of an autoreactive DN2B cell-derived autoantibody and a method for measuring an autoreactive DN2B cell-derived autoantibody.

[0078] (Method for Measuring mRNA) When measuring the mRNA of an autoreactive DN2B cell-derived autoantibody, a sample containing B cells is used as the blood sample. Examples of samples containing B cells include peripheral blood mononuclear cells (PBMCs). The blood sample may be a cell population obtained by culturing a blood cell sample containing B cells (e.g., PBMCs) in the presence of a TLR ligand (e.g., a TLR7 ligand, a TLR9 ligand, etc.).

[0079] Known methods can be used to measure mRNA. Examples of mRNA measurement methods include RT-qPCR. Primers used in RT-qPCR are primers specific to the mRNA of an autoreactive DN2B cell-derived autoantibody. Such primers can be designed, for example, from any of the nucleic acid sequences set forth in SEQ ID NOS: 50 to 55 (see Tables 8 to 13). Primers are preferably capable of amplifying the heavy chain variable region coding region or light chain variable region coding region of an autoreactive DN2B cell-derived autoantibody, and more preferably, primers capable of amplifying the heavy chain variable region coding region. Primers are preferably capable of amplifying at least a portion of the HCDR3 coding region or LCDR3 coding region, and more preferably, primers capable of amplifying at least a portion of the HCDR3 coding region. For example, a forward primer can be designed to anneal to a region 5' from the HCDR3 coding region. For example, a reverse primer can be designed to anneal to a region including at least a portion of the HCDR3 coding region. Measurement of mRNA can also be used to detect autoantibodies and diagnose SLE.

[0080] As shown in the Examples below, the BCR repertoire of autoreactive DN2B cells is biased. For the heavy chain, the proportions of H1 to H3 shown in Table 4 accounted for 50% of the total. Therefore, primers capable of amplifying nucleic acid sequences encoding H1 to H3 can be used. Specific examples of nucleic acid sequences encoding H1 to H3 are shown in Tables 8 to 10, respectively. It is particularly preferable to design primers based on the nucleic acid sequence shown in Table 8 (the nucleic acid sequence encoding H1). For example, primers can be designed in the region where sequences of H1-1 to H1-5 shown in Table 8 are common.

[0081] (Method for measuring autoreactive DN2B cell-derived autoantibodies) When measuring autoreactive DN2B cell-derived autoantibodies, plasma or serum can be used as a blood sample. Alternatively, a culture supernatant obtained by culturing a blood cell sample containing B cells (e.g., PBMCs) in the presence of a TLR ligand (e.g., a TLR7 ligand, a TLR9 ligand, etc.) can be used as a blood sample.

[0082] Methods for measuring autoreactive DN2B cell-derived autoantibodies include, for example, competitive ELISA using at least one selected from the group consisting of isolated autoreactive DN2B cell-derived autoantibodies, autoantibody-derived antibodies, and antigen-binding fragments thereof (hereinafter also referred to as "test antibody"). For example, an antigen is immobilized on a solid-phase support such as a well plate and reacted with a blood sample and a labeled test antibody. The binding of the test antibody to the antigen is inhibited depending on the amount of autoreactive DN2B cell-derived autoantibody contained in the blood sample. Therefore, the autoreactive DN2B cell-derived autoantibody present in the blood sample can be measured by measuring the test antibody bound to the antigen. When the test antibody is an antinuclear antibody, cells of the same animal species as the test subject can be used as the antigen.

[0083] A higher expression level of autoreactive DN2B cell-derived autoantibodies than the reference value indicates that the test subject is likely to be suffering from SLE. That is, a higher expression level of autoreactive DN2B cell-derived autoantibodies than the reference value indicates that the blood sample is derived from a test subject who is likely to be suffering from SLE. A lower expression level of autoreactive DN2B cell-derived autoantibodies than the reference value indicates that the blood sample is derived from a test subject who is unlikely to be suffering from SLE.

[0084] The reference value may be, for example, a numerical value calculated by performing statistical processing or the like from the expression levels of autoreactive DN2B cell-derived autoantibodies measured in a group of healthy subjects consisting of an arbitrary number of people. The reference value may be, for example, a numerical value calculated by performing statistical processing or the like from the expression levels of autoreactive DN2B cell-derived autoantibodies measured in a group of subjects consisting of an arbitrary number of people suffering from SLE. The reference value may be, for example, a cutoff value calculated by ROC analysis or the like from the expression levels of autoreactive DN2B cell-derived autoantibodies measured in a group of healthy subjects and a group of subjects suffering from SLE.

[0085] The method of this embodiment may include other steps in addition to the measurement step, such as a step of definitively diagnosing SLE in a test subject who is likely to have SLE, and a step of treating SLE in a test subject who is likely to have SLE.

[0086] Diagnosis of SLE can be made, for example, by clinical and immunological findings associated with the symptoms of SLE.

[0087] Methods for treating SLE include, for example, administration of nonsteroidal anti-inflammatory drugs, glucocorticoids, hydroxychloroquine, and immunosuppressants.

[0088] [Other Aspects] The present disclosure may also include the following aspects: (A) a method for diagnosing systemic lupus erythematosus, comprising the step of measuring the expression level of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from a test subject, wherein a finding that the expression level of the autoantibody is higher than a reference value indicates a high possibility that the test subject is suffering from systemic lupus erythematosus; (B) a method for treating systemic lupus erythematosus, comprising the steps of: (a) measuring the expression level of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from the test subject; (b) determining that a test subject in which the expression level of the autoantibody measured in step (a) is higher than a reference value is suffering from systemic lupus erythematosus; and (c) treating the test subject determined to be suffering from systemic lupus erythematosus in step (b). (C) A method for collecting data for diagnosing systemic lupus erythematosus, comprising a step of measuring the expression level of an autoantibody produced by autoreactive DN2B cells in a blood sample collected from a test subject, wherein a higher expression level of the autoantibody than a reference value indicates a high possibility that the test subject is suffering from systemic lupus erythematosus. (D) A systemic lupus erythematosus marker comprising a DN2B cell-derived autoantibody. (E) An isolated polypeptide selected from the group consisting of an isolated DN2B cell-derived autoantibody, an autoantibody-derived antibody, and an antigen-binding fragment thereof, for use in diagnosing systemic lupus erythematosus. (F) Use of an isolated polypeptide selected from the group consisting of an isolated DN2B cell-derived autoantibody, an autoantibody-derived antibody, and an antigen-binding fragment thereof, for producing a diagnostic agent for systemic lupus erythematosus. (G) Use of an isolated polypeptide selected from the group consisting of an isolated DN2B cell-derived autoantibody, an autoantibody-derived antibody, and an antigen-binding fragment thereof, for diagnosing systemic lupus erythematosus.

[0089] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0090] Methods (Experimental Model and Subject Details) Peripheral blood samples were collected from a total of 23 adult healthy donors (HD). Samples from 19 and 9 donors were used for ex vivo flow cytometry analysis and in vitro stimulation assays, respectively. Between 2018 and 2021, 40 systemic lupus erythematosus (SLE) patients who met the ACR1997 criteria, with or without active disease, and consented to participate in this study were recruited. Samples from one SLE patient were used for culture and repertoire analysis assays. The SLE patient was in a disease flare accompanied by active nephritis and elevated anti-dsDNA and anti-Sm antibodies.

[0091] (Generation of monoclonal antibodies against PLD4) The anti-human PLD4 monoclonal antibodies (mAbs), T1S-mAbs, were generated by immunizing female BALB / c mice with a purified recombinant fusion protein (cDNA: SEQ ID NO: 1) in which the extracellular domain of the PLD4 molecule was linked to the Fc region of mouse immunoglobulin (Ig) G2a. The detailed method followed the method described in International Publication No. WO2013 / 115410.

[0092] (Isolation of peripheral blood mononuclear cells (PBMC) and naive B cells) 30 mL of peripheral blood was collected in a heparin-coated tube. PBMC were isolated using Ficoll-Paque. ＴＭ PBMCs were isolated by Ficoll gradient using a Ficoll filter (Thermo Fisher Scientific, Waltham, MA, USA). PBMCs were then suspended in complete RPMI 1640 medium (Sigma-Aldrich, MO, USA) supplemented with ampicillin / streptomycin and 10% fetal bovine serum (FBS, Serana, NY, USA), and red blood cells (RBCs) were lysed using RBC lysis buffer (Sigma-Aldrich). The remaining PBMCs, after RBC removal, were used for flow cytometry, cell culture, or naive B cell isolation. Naive B cells were isolated using the Naive B Cell Isolation Kit ii, human (Miltenyi Biotec, Gladbach, Germany) according to the manufacturer's instructions.

[0093] (Real-time quantitative PCR analysis of PLD4 gene expression) To compare PLD4 gene expression in immune cells and tissues, real-time quantitative PCR (RT-qPCR) was performed using an ABI Prism 7000 (Applied Biosystems). Briefly, cDNA was synthesized from individual cells using the SYBR green qPCR SuperMix-UDG kit (Invitrogen). For immune cell analysis, human PBMCs were isolated from apheresis products of healthy donor blood (Memorial Blood Centers of Minnesota, Minneapolis, MN, USA) (Takeda Y, S, et al. Int J Mol Sci 2017 18:1162.). To examine tissue expression, BD ＴＭAn MTC multiple tissue cDNA panel (Takara Bio) was used. PCR was performed using an ABI Prism 7000 (Applied Biosystems). 50 cycles of 50°C for 2 minutes, 95°C for 10 minutes, 95°C for 15 seconds, and 60°C for 1 minute were performed. To account for sample variations, each transcript was normalized to the value for the human glyceraldehyde-3-phosphohydrogenase (GAPDH) gene. The primer sequences for the PCR reaction are as follows: PLD4 sense primer sequence 1: 5'-AGGACATCCACCGACCTG-3' (SEQ ID NO: 2) PLD4 sense primer sequence 2: 5'-GTGAAAGTCTTCATCGTGCCG-3' (SEQ ID NO: 3) PLD4 antisense primer sequence 1: 5'-GCAAAACCCCTGTGA-3' (SEQ ID NO: 4) PLD4 antisense primer sequence 2: 5'-GTGCTGCTGAAGTAATCCTCC-3' (SEQ ID NO: 5) GAPDH sense primer sequence: 5'-AGCCACATCGCTCAGACAG-3' (SEQ ID NO: 6) GAPDH antisense primer sequence: 5'-GCCCAATACGACCAAATCC-3' (SEQ ID NO: 7) β2MG sense primer sequence: 5'-CCACTGAAAAAGATGAGTATGCCT-3' (SEQ ID NO: 8) β2MG antisense primer sequence: 5'-CCAATCCAAATGCGGCATCTTCA-3' (SEQ ID NO: 9)

[0094] RT-qPCR was performed to estimate PLD4 expression in cultured naive B cells. Total RNA was extracted from cultured naive B cells using the RNeasy® Plus Micro Kit (Qiagen), and cDNA was synthesized using the ReverTra Ace® qPCR RT kit (Toyobo). The relative expression of PLD4 was analyzed by RT-qPCR using the SYBR® Green PCR kit (Qiagen). PCR was performed using a CFX Connect ＴＭPCR was performed using a Real Time System (BioRad). 40 cycles of 50°C for 2 minutes, 95°C for 15 minutes, 94°C for 10 seconds, 55°C for 1 minute, and 72°C for 1 minute were performed. The cDNA copy number for each sample was calculated by dividing the threshold cycle (Ct) by the number of copies of the standard plasmid (10 ６ , 10 ５ , 10 ４ , 10 ３ , 10 ２ and 10). RNA expression was normalized to the housekeeping gene β2MG.

[0095] (Flow cytometry analysis and cell sorting) 1 × 10 cells suspended in staining buffer (PBS containing 1% bovine serum albumin (BSA) and 10% normal mouse serum (Abcam, Cambridge, UK)) were used. ６ PBMCs (each tube) were stained with the following fluorescent antibodies. Set 1: CD43 (FITC), CD19 (PerCP-Cy5.5), CD38 (APC), IgD (PE-Cy7), CD24 (APC-Cy7), CD3CD14CD16 (V450), CD27 (V500). Set 2: CD11c (FITC), CD19 (PerCP-Cy5.5), CD38 (APC) / CD21 (APC), IgD (PE-Cy7), CXCR5 (APC-Cy7), CD3CD14CD16 (V450), CD27 (V500). Set 3: CD11c (FITC), BDCA2 (APC), CD14 (APC-Cy7), CD3CD14 (V450), CD16 (V500). Set 4: CD4 (FITC), CD8 (PerCP-Cy5.5), CD3 (APC-Cy7), CD14, CD19, CD16 (V450)

[0096] After 20 minutes of incubation on ice, the cells in each tube were washed with 1 mL of FACS buffer, suspended in FACS buffer, and divided into two tubes for isotype staining and phospholipase D4 (PLD4) staining. Biotinylated mouse IgG2b (BioLegend, CA, USA) or biotinylated T1S-mAbs were added at 5 μg / mL. After 20 minutes of incubation on ice, both tubes were washed, resuspended, and 1 μg / mL of PE-streptavidin (BD Pharmingen, CA, USA) was added. After 15 minutes of incubation on ice, the stained PBMCs were analyzed using a FACS Canto II (BD Biosciences, NJ, USA).

[0097] For in vitro cultured PBMCs, B cells were defined using CD20 (PE-Cy7) and CD3CD14CD16 (V450). Then, PLD4 staining was performed as described above. To remove dead cells, 5 μL of 7-AAD (BD Pharmingen) was added to 100 μL of cell solution 5 minutes before cytometric analysis. Compensation was performed using anti-mouse Ig, κ / Negative Control Compensation Particle Set (BD Biosciences).

[0098] For intracellular T-bet staining, 2 × 10 ６ PBMCs were fixed and treated with True-Nuclear ＴＭ The cells were permeabilized using Transcription Factor Buffer Set (BioLegend) according to the manufacturer's instructions. Mouse IgG (Peprotech, NJ, USA) was added at a concentration of 100 μg / mL to block nonspecific binding, followed by the addition of fluorescent antibodies against T-bet (APC) or mouse IgG1 (APC). Flow cytometry data were analyzed using FlowJo software (Treestar).

[0099] For the cell culture assays described below, PLD4 + blast or CD19 ＋B cells were sorted using FACS Aria II (BD Biosciences). Because the number of selectable PLD4+ blasts was insufficient (maximum 3,000 cells from 20 mL of peripheral blood), CD19 － and CD3 ＋ , CD14 ＋ or CD16 ＋ Cells (non-B cell PBMCs) were simultaneously sorted as scaffold cells.

[0100] (In vitro cell stimulation and culture) For the PLD4 induction assay, 5 × 10 cells were suspended in complete RPMI 1640 medium (10% FBS). ５ PBMCs or 1 x 10 ５ Naive B cells were seeded in 96-well non-tissue culture-treated plates (Corning, NY, USA) and stimulated with RPMI 1640 (no stimulation), 0.15 μM CpG ODN 2006 (Invivogen), 1 μg / mL R848 (Sigma-Aldrich), or 1 μg / mL, 5 μg / mL, or 25 μg / mL AffiniPure F(ab')2 Fragment Goat Antihuman IgG and IgM (H+L) (Jackson ImmunoResearch, PA, USA). The cells were cultured for 2 days and then analyzed by flow cytometry as described above.

[0101] To differentiate B cells into IgG antibody-secreting cells (IgG-ASCs), 1,000 PLD4+ blast or plasmablast cells were sorted and gated out for CD19 expression. ＋ B cells were plated with 10,000 non-B cell PBMCs, followed by the addition of 1 μg / mL R848 or 0.15 μM CpG ODN 2006. After 4 days of culture, IgG-ASCs were counted by ELISpot.

[0102] (ELISpot of IgG-secreting cells) IgG-secreting cells were detected using the ELISpot Human IgG (HRP) Kit (Mabtech) according to the manufacturer's instructions. Briefly, Multiscreen IP HTS 0.45 μm (Merck Millipore) was coated with 15 μg / mL anti-IgG antibody overnight at 4°C. The wells were washed twice with PBS and then blocked with PBS and 1% BSA for 1 hour. After removing the blocking solution, cultured cells were added to the wells and incubated at 5% CO ２ The mixture was incubated at 37°C for 16 to 20 hours.

[0103] After washing the wells with PBS containing 0.1% Tween 20 (Sigma-Aldrich) (PBS-T), a secondary biotinylated anti-IgG antibody was added at a concentration of 1 μg / mL. The secondary biotinylated anti-IgG antibody included in the kit was filtered through a Millex-HV 0.45 μm (Merck Millipore) prior to use. After 2 hours of incubation, the wells were washed four times with PBS-T, 100 μL of streptavidin-HRP was added, and the plate was incubated for 1 hour. After washing the plate, 100 μL of ELISpot substrate (Mabtech) was added. The spots were developed for 15-20 minutes, and the wells were rinsed with tap water to stop the development. The plate was sent to MINERVATECH, where the number of spots was counted.

[0104] (BCR Repertoire Analysis of Cultured B Cells) B cell receptor (BCR) repertoire analysis was performed using a method similar to that previously described for T cell repertoire analysis (Cho M, Ishida K, et al. Int Immunol. 2008 Jan;20(1):155-64). Briefly, cultured B cells were harvested and washed with PBS by centrifugation. First-strand cDNA was synthesized using oligo(dT) primers and Superscript™ III Reverse Transcriptase (Invitrogen), and second-strand cDNA was synthesized using RNase H and T4 DNA polymerase (Invitrogen). A short adapter in which "T" was replaced with "U" was ligated to the cDNA library. Uracil DNA Glycosylase (Takara) was added to digest the short strands, and single-stranded adapters were ligated. The adapter-tagged library was amplified by PCR. The amplified product (BCR library) was sequenced using a next-generation sequencer (Illumina) according to the manufacturer's instructions. Sequencing results were analyzed using IMGT-V-QUEST (https: / / www.imgt.org / IMGT_vquest / input). Sequences sharing the same V- and J-gene segments and the same CDR3 sequence were identified as identical.

[0105] (Synthesis of recombinant monoclonal antibodies) Vector cloning, transfection, and antibody purification were performed. The V(D)J and constant region (IgG1) sequences were amplified separately by PCR, and sequences overlapping the vector cloning site were added. The PCR products were individually inserted into the pHEK Ultra expression vector (Takara Bio) using the NEBuilder HiFi DNA Assembly cloning kit (New England BioLabs). The closed vector containing the V(D)J + constant region sequence was transformed into One Shot Top10 chemically competent Escherichia coli cells (Invitrogen), and after overnight culture, the plasmid was purified using a Plasmid Midi kit (Qiagen). This plasmid was transfected into Expi293FTM cells using a ScreenFectTMUP-293 kit (FUJIFILM Wako). Expi293 cells were cultured at a density of 7.5 × 10 ７ The cells were grown to 100 μL. After 5 days of culture, secreted mAbs were purified using Protein G Sepharose 4 Fast Flow Lab Packs (Cytiva). Specifically, the cultured cell supernatant was added to a Pierce™ Disposable 5 mL Polypropylene Column (Thermo Fisher Scientific) loaded with 500 μL of Protein G Sepharose. After washing the column with 20 mM sodium phosphate, the antibodies were eluted with 100 mM Tris-HCl (pH 9.0).

[0106] As control antibodies for enzyme-linked immunosorbent assay (ELISA), one IgG sequence was randomly selected from B cells isolated from a normal donor and subcloned, followed by synthesis and purification of mAbs.

[0107] (ELISA for measuring antinuclear antibody activity) To examine the autoreactivity of the recombinant mAb, a Human Antinuclear Antibody (ANA) ELISA Kit (CUSABIO) was used according to the manufacturer's instructions. ＋Sera from SLE patients and healthy donors, known to be resistant to SLE, were used at a 101-fold dilution. The healthy donor serum was supplemented with 50 μg / mL of mAbs derived from PLD4+blast or mAbs derived from a control sample. OD450 was measured for each sample.

[0108] (Statistical Analysis) Values ​​between groups were compared using the nonparametric Mann-Whitney test. Spearman's rank correlation coefficient was calculated to analyze the correlation between cell frequency and clinical measurements. Fisher's exact test was used to analyze the significance of the relative risk of specific clinical symptoms between groups. For several values ​​measured in the same patient or specimen at different time points or under different conditions, a Wilcoxon signed-rank test was performed. All analyses were performed using R version 4.1.2 (The R Foundation for Statistical Computing, Vienna, Austria). P values ​​were indicated as *P<0.05, **P<0.01, and ***P<0.005.

[0109] Results: (PLD4 is Predominantly Expressed in pDCs, followed by B Cells) Synaptic Analysis of Gene Expression (SAGE), which compared gene transcription in human plasmacytoid dendritic cells (pDCs) and monocytes, detected that the PLD4 gene was predominantly transcribed in pDCs (Takeda Y, et al. Int J Mol Sci 2017 18:1162). RT-qPCR was performed using pDCs, B cells, T cells, monocytes, and natural killer cells to examine PLD4 mRNA expression in peripheral immune cells. PLD4 expression was highest in pDCs, followed by B cells. PLD4 expression in B cells was much lower than in pDCs (Figure 1A). Next, we examined PLD4 expression by organ. RT-qPCR was performed using a cDNA panel collected from multiple tissues, revealing that PLD4 mRNA expression was highest in the spleen and peripheral leukocytes (Figure 5A). These results confirmed that PLD4 is highly expressed in pDCs, but is expressed at lower levels in B cells than in pDCs, and that its expression is concentrated in immune-related organs.

[0110] (PLD4 ＋(B cells are significantly increased in SLE patients.) We investigated the cell surface expression of PLD4 in PBMCs. We generated a monoclonal antibody (T1S-mAb) against PLD4. Using this antibody, we first performed flow cytometry on PBMCs from healthy donors (HD) (Figure 5B). The majority of pDCs were PLD4-positive, but PLD4 ＋ B cells are CD19 ＋ Only a few percent of B cells expressed PLD4 (Fig. 1B). Surface PLD4 expression was not detected in other immune cells (n = 3, Fig. 5C), consistent with the mRNA expression analysis. Next, PBMCs from SLE patients were examined. 40 SLE patients were examined, most of whom (32, 80%) had new-onset, untreated SLE (Table 3). PLD4 ＋ The frequency of pDC was similar to that of HD, but PLD4 ＋ B cells were significantly increased in SLE patients (Fig. 1C). B cells in SLE patients have various characteristics. For example, transitional B cells, double-negative (DN) cells, and plasmablasts are increased in SLE patients compared with healthy controls (Akita K, et al, Front Immunol. 2020;11:498703; doi 10.3389 / fimmu.2020.498703; Wardowska A, et al. Int Immunopharmacol. 2020 Jun 1;83:106451; doi 10.1016 / j.intimp.2020.106451; Dieudonne Y, et al. J Autoimmun. 2019 Aug;102:150-8; doi 10.1016 / j.jaut.2019.05.002). Consistent with previous reports, DN cells and plasmablasts were significantly more abundant in our cohort than in HD. Furthermore, although not statistically significant, the frequency of transitional B cells was higher in SLE patients, with some patients showing a dramatic increase of up to 30% (Fig. 6A, B). PLD4 was increased in SLE patients. ＋ Looking at the cellular composition of B cells, the proportions of transitional B cells, memory B cells, and DN cells were greater than the total B cells. ＋B cells contained almost no plasmablasts (Fig. 6C). ＋ B cells were found to be expanded in SLE patients and to be unique in terms of cellular composition.

[0111]

[0112] ("PLD4+blast" overlaps phenotypically and functionally with DN2B cells) PLD4 ＋ To analyze the specificity of B cells, we focused on cell size, which is expressed by FSC-A, which is thought to roughly reflect the activation state of the cells (Akita K, et al., Front Immunol. 2020;11:498703; doi 10.3389 / fimmu.2020.498703). Among the entire B cell population, plasmablasts showed the largest cell size. In some SLE patients, PLD4 ＋ The B cell fraction was comparable in size to plasmablasts (Fig. 1D). ＋ Since B cells contain few plasmablasts, this PLD4 ＋ Considering that B cells are more activated than other cells, we focused on cells of similar size to plasmablasts. Therefore, we set the 25th percentile of FSC-A of plasmablasts as the threshold and analyzed such PLD4 ＋ The larger fraction of B cells was defined as "PLD4+ blast," and the rest as "PLD4+ small" (Fig. 1E). The proportion of PLD4+ blast ranged from nearly 0% to over 10% (mean = 3.1%, SD = 2.6) in SLE patients (Fig. 1F). When SLE patients were divided into two groups based on the proportion of PLD4+ blast (higher or lower than the mean [3.1%]), the high group (H) had significantly higher SLEDAI scores than the low group (L), but the PLD4+ blast proportion was significantly higher than the low group (L). ＋ This difference disappeared when dividing by the proportion of B cells (blast + small) (Fig. 1G, H). Furthermore, the proportion of plasmablasts and PLD4 + blasts was significantly correlated, but the proportion of PLD4 ＋ The proportion of B cells was not significantly correlated (Fig. 1I, J). This suggests that PLD4+blast is associated with PLD4 ＋They should be viewed as a distinct population among B cells, suggesting that they reflect disease activity in SLE patients.

[0113] Further characterization of PLD4+ blast revealed that it was phenotypically IgD － , CD27 － , CD11c ＋＋ , and CXCR5 － In addition, PLD4+ blasts were found to overlap with the DN2 cell population (IgD ＋ or CD27 ＋ cells), and most of them are CD11c ＋＋ And CXCR5 － The PLD4+ blasts were predominantly T-bet cells, suggesting that they were highly homogeneous in terms of cell ontology (Fig. 7A). Consistent with this, intracellular staining of the transcription factor T-bet revealed that most of the PLD4+ blasts were T-bet++, a key characteristic of DN2B cells (Fig. 2B). As expected, the proportion of PLD4+ blasts and DN2B cells was significantly correlated (Fig. 2C). Furthermore, within the DN2B cell population, PLD4 ＋ DN2B cells are PLD4 － The PLD4+ blast cells showed larger cell size than the DN2B cells (Fig. 2D). Regarding clinical symptoms, the high-expression PLD4+ blast group (PLD4+ blast H) had a higher incidence of nephritis and higher anti-Sm antibody titers, but not anti-dsDNA antibodies, compared with the low-expression PLD4+ blast group (PLD4+ blast L) (Fig. 2E-G). Furthermore, the proportion of PLD4+ blast cells was significantly inversely correlated with serum C3 and C4 levels (Fig. 7B). In some cases, a significant decrease in PLD4+ blast cells was observed after immunosuppressive therapy (n = 11, Fig. 2H). These results suggest that the increase in PLD4+ blast cells, like the increase in DN2B cells, reflects a certain type of disease activity.

[0114] (TLR7 or TLR9 stimulation reduces PLD4 in HD. ＋We investigated whether the surface PLD4 expression level of B cells differed depending on the activation state. PBMCs isolated from HD were stimulated with anti-IgG / IgM (BCR cross-linking), TLR7 ligand alone, TLR9 ligand alone, or BCR + TLR9 ligand, and analyzed by flow cytometry on the second day. ＋ B cells were not induced by BCR signaling alone, but PLD4 was induced by TLR alone or BCR + TLR stimulation. ＋ B cells were significantly induced (Fig. 3A, B). When naive B cells were isolated and stimulated with a TLR9 ligand, PLD4 mRNA levels were significantly elevated compared to unstimulated B cells (Fig. 3C). Therefore, the increase in PLD4 expression after TLR7 or TLR9 stimulation was due to intrinsic de novo synthesis in B cells in response to TLR stimulation, rather than due to external factors such as cytokines from stimulated pDCs. In most samples, the combination of BCR + TLR9 stimulation significantly increased PLD4 expression compared to TLR9 alone. ＋ B cells, suggesting a synergistic effect of downstream signaling pathways (Fig. 3B).

[0115] (The IgG antibody synthesized from the largest repertoire of PLD4+blast showed antinuclear activity.) Since PLD4+blast correlates with certain disease states and overlaps with DN2B cells, it was speculated that it is highly autoreactive and likely involved in autoantibody production in SLE patients. First, the IgG antibody production ability of PLD4+blast collected from two SLE patients was evaluated by ELISpot. Although PLD4+blast did not show IgG production ability (Figure 4A), when cultured with TLR7 or TLR9 ligands, it showed antinuclear activity against CD19. ＋ The IgG antibody production was more robust than that of the total B cells (Fig. 4B, C).

[0116] Next, we attempted to examine the autoreactivity of PLD4+ blasts. To examine the autoreactivity of a target B cell population, a method of culturing cells and measuring the antibodies produced is often used. However, this method has problems in terms of reproducibility and sensitivity, especially when the cell number is small. To circumvent these problems, we performed BCR repertoire analysis of cultured PLD4+ blasts. PLD4+ blasts were obtained from a patient with an SLE flare who had elevated antibody titers of anti-dsDNA antibodies (>400 IU / mL), anti-Sm antibodies (>46 IU / mL), and anti-SS-A antibodies (>1200 IU / mL) and had developed class IV lupus nephritis. PLD4+ blasts were identified as CD19 ＋ The obtained PLD4+ blasts were stimulated with TLR7 ligands and inflammatory cytokines for 4 days to promote the differentiation of B cells into antibody-secreting cells (ASCs). The repertoire of TLR-stimulated PLD4+ blasts was biased. As a result, the ratio of the top three repertoires accounted for more than 50% of the total, which was probably due to the stimulation and culture, and was not significantly different from the ratio of the CD19 cells cultured in the same way. ＋ These amplified repertoires were not included in the B cell repertoire (Tables 2-5). We reasoned that these amplified repertoires likely represent the repertoire of antibodies secreted in vitro, and synthesized recombinant monoclonal antibodies from the sequences of the three largest repertoires. Of the three synthesized antibodies, two showed antinuclear activity in ELISA (Figure 4D). Therefore, PLD4+ blasts likely contain autoreactive cells.

[0117] Table 4 shows the top 10 heavy chain sequences obtained in the repertoire analysis of cultured PLD4+blast.

[0118]

[0119] Table 5 shows the top 10 κ chain sequences obtained by repertoire analysis of cultured PLD4+blast.

[0120]

[0121] Table 6 shows the cultured CD19 ＋ The top 10 heavy chain sequences obtained from the B cell repertoire analysis are shown.

[0122]

[0123] Table 7 shows the cultured CD19 ＋ The top 10 κ chain sequences obtained from the B cell repertoire analysis are shown.

[0124]

[0125] The amino acid sequences of the V chains in Tables 2 and 4 above can be obtained from the ImMunoGeneTics (IMGT) IMGT Repertoire (IG and TR) site (https: / / www.imgt.org / IMGTrepertoire / Proteins / #h2_4).

[0126] An example of a nucleic acid sequence for H1 is shown in Table 8.

[0127]

[0128] An example of a nucleic acid sequence for H2 is shown in Table 9.

[0129]

[0130] An example of a nucleic acid sequence for H3 is shown in Table 10.

[0131]

[0132] Examples of nucleic acid sequences for L1 are shown in Table 11.

[0133]

[0134] Examples of nucleic acid sequences for L2 are shown in Table 12.

[0135]

[0136] An example of a nucleic acid sequence for L3 is shown in Table 13.

[0137]

[0138] In Tables 7 to 13, the boxed "atg" indicates the translation initiation point of BCR mRNA. The signal peptide is located between this "atg" and the underlined sequence. The underlined sequence indicates the start of the BCR variable region. The double underlines indicate, from the 5' side, CDR1, CDR2, and CDR3.

[0139] The sequences of the H1, H2 and H3 variable regions are shown in Table 14. The sequences of the L1, L2 and L3 variable regions are shown in Table 15.

[0140]

[0141]

[0142] The sequences of the CDRs of H1, H2 and H3 are shown in Table 16. The sequences of the CDRs of L1, L2 and L3 are shown in Table 17.

[0143]

[0144]

[0145] [Diagnosis of SLE by Real-Time (RT)-PCR] We investigated whether SLE can be diagnosed by selectively amplifying and detecting autoantibody genes.

[0146] A fraction of cells thought to be autoantibody-producing cells was obtained from the peripheral blood of an SLE patient and used as a positive control cell population. The autoantibody gene (H1) was amplified by RT-PCR for the cell populations isolated from the peripheral blood of an SLE patient, the cell populations isolated from the peripheral blood of a healthy individual, and the positive control. The RT-PCR method is described below.

[0147] Equipment: QuantStudio 3 (Applied Biosystems) Reagents used: Applied Biosystems ＴＭ Power SYBR ＴＭ Green PCR Master Mix

[0148] Primer sequences: <Index-head (internal control)> Forward: AATGATACGGCGACCACCGAGATCTAC (SEQ ID NO: 108) Reverse: GGAATTCCTGTCCGGTG (SEQ ID NO: 109) Forward: AGCCTACATGGAGCTGAGGA (SEQ ID NO: 110) Reverse: GGCCCCCAGTAGTCAATGAGA (SEQ ID NO: 111)<h1>

[0149] The PCR reaction conditions are shown in Table 18.

[0150]

[0151] Each cell population was stimulated with a TLR ligand, followed by extraction of total RNA and cDNA synthesis. After cDNA synthesis, an index sequence was assigned for next-generation sequence analysis. Based on this, the amount of cDNA was quantified using an index head (internal control). RT-PCR was performed using H1 primers, and amplification of the H1 gene was evaluated based on the amplification rate (number of PCR cycles) per amount of cDNA.

[0152] Details of each cell population used are as follows. 2H: SLE (positive control): PLD4-positive cells and peripheral blood mononuclear cells not containing B cells were stimulated with R848 (TLR7 / 8 ligand). Antibody-producing cells were PLD4-positive cells only. 4H: SLE: PBMCs (mononuclear cells obtained from peripheral blood containing PLD4-positive cells) were stimulated with CpG (TLR9 ​​ligand). 6H: Peripheral blood mononuclear cells from healthy subjects were stimulated with CpG (TLR9 ​​ligand).

[0153] The Amplification Plot and Melt Curve Plot when the index-head (internal control) primer was used are shown in FIG. 8A and FIG. 8B, respectively.

[0154] The Amplification Plot and Melt Curve Plot when the primers for H1 were used are shown in Figures 9A and 9B, respectively.

[0155] In the positive control (2H), amplification products were detectable at a low PCR cycle number (approximately 7 cycles) (Figure 9A). In the SLE patient sample (4H), amplification products were detectable at 32 cycles (Figure 9A). In the healthy subject sample (6H), amplification products appeared to be detectable at 28 cycles (Figure 9A). However, Melt curve plots confirmed that a product distinct from the H1 gene amplification product was amplified (Figure 9B).

[0156] The above results demonstrate that SLE can be diagnosed by RT-PCR using the Amplification Plot and Melt Curve Plot in combination.

[0157] [Fluorescent immunostaining using recombinant monoclonal antibodies] The antinuclear activity of recombinant monoclonal antibodies (constant region: human Fc IgG) produced using the nucleic acid sequences of H1 (V chain: VH1-18-01, J chain: 4-02) and L1 (V chain: KV1-16-02, J chain: 1-01) was examined by fluorescent immunostaining. Details of the fluorescent immunostaining are shown below.

[0158] Cells used: Hep-2 (derived from human pharyngeal carcinoma) Fixation: 4% paraformaldehyde Permeabilization: 0.2% Triton X Blocking: 1% BSA-PBS, room temperature (approximately 25°C), 1 hour Primary antibody: recombinant monoclonal antibody (H1 (V chain: VH1-18-01, J chain: 4-02); L1 (V chain: KV1-16-02, J chain: 1-01); Fc-Human IgG), room temperature (approximately 25°C), 1 hour Secondary antibody: Purified anti-human CD16 (Mouse IgG), room temperature (approximately 25°C), 1 hour Tertiary antibody: Goat anti-Mouse IgG (Alexa Fluor 488), room temperature (approximately 25°C), 1 hour

[0159] The results of the fluorescent immunostaining are shown in Figure 10. It was confirmed that the nuclei were stained by the recombinant monoclonal antibody. This result confirmed that the recombinant monoclonal antibody has antinuclear activity.

[0160] According to the present disclosure, it is possible to provide an antibody or an antigen-binding fragment thereof useful for diagnosing systemic lupus erythematosus, a diagnostic agent for systemic lupus erythematosus using the antibody or antigen-binding fragment, and a method for testing a blood sample useful for diagnosing systemic lupus erythematosus.

[0161] Although the preferred embodiments of the present invention have been described above, the present invention is not limited to these embodiments. Addition, omission, substitution, and other modifications of the configuration are possible within the scope of the spirit of the present invention. The present invention is not limited by the above description, but is limited only by the scope of the appended claims.

Claims

1. An autoantibody or an antigen-binding fragment thereof produced by autoreactive DN2B cells.

2. The autoantibody or antigen-binding fragment thereof described in claim 1, wherein the autoantibody is an antinuclear antibody.

3. An antibody or an antigen-binding fragment thereof comprising the antigen-binding site of the autoantibody described in claim 1 or 2.

4. An antibody or an antigen-binding fragment thereof selected from the group consisting of (a) to (c) below: (a) an antibody comprising a heavy chain variable region having HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1 in any combination of Nos. 1 to 10 of Table 1; (b) an antibody comprising a light chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2 in any combination of Nos. 1 to 10 of Table 1; (c) an antibody comprising a heavy chain variable region having HCDR1, HCDR2, and HCDR3 derived from a V chain listed in Table 1 in any combination of Nos. 1 to 10 of Table 1, and a light chain variable region having LCDR1, LCDR2, and LCDR3 derived from a V chain listed in Table 2 in any combination of Nos. 1 to 10 of Table 1.

5. A diagnostic agent for systemic lupus erythematosus, comprising the autoantibody or its antigen-binding fragment according to claim 1 or 2.

6. A diagnostic agent for systemic lupus erythematosus comprising the antibody or antigen-binding fragment thereof described in claim 3.

7. A method for testing a blood sample, comprising a step of measuring the expression level of an autoantibody produced by DN2B cells in a blood sample collected from a test subject, wherein a higher expression level of the autoantibody than a reference value indicates a high possibility that the test subject is suffering from systemic lupus erythematosus.

Images