Method for designing wide range of RNA modification library including all surrounding sequences of RNA modification and use thereof

Abstract

The present invention relates to a method for designing a wide range of RNA modification libraries including all surrounding sequences of RNA modification and a use thereof. The present invention can construct a modified RNA library by introducing various types of RNA modifications and can reflect all possible combinations of surrounding sequences on both sides of the modified RNA library, thereby differing from the previously reported modified RNA library construction method. In addition, when single-molecule RNA sequencing is performed using a modified RNA library according to the present invention, a high-quality reference data set including all combinatorially possible motifs can be generated. Using this dataset as training data for deep learning (or machine learning) makes it possible not only to develop new RNA modification detection software with higher accuracy, but also to simultaneously detect multiple RNA modifications in a single analysis, beyond the limitations of existing software, which are often restricted within specific RNA modifications or exhibit reduced prediction accuracy for other modifications.

Description

Design and use of a comprehensive RNA modification library encompassing all surrounding sequences of RNA modifications

[0001] The present invention relates to a method for designing a broad RNA modification library comprising all surrounding sequences of RNA modifications and its use.

[0002] RNA modification is a form in which a specific base in RNA is chemically changed. All biological RNAs have m 6 A (N6-methyladenosine), m 5 There are approximately 170 different RNA modifications, including C (5-methylcytidine). RNA modifications are distributed at various locations in various RNAs and have diverse biological roles. For example, they change base pairing, secondary structure, and binding affinity with RNA-binding proteins. They also play a key role in gene expression regulation by being involved in RNA metabolism, including splicing and stability regulation. It has been reported that abnormalities in the regulation of RNA modifications can lead to various diseases, including cancer (RNA 23.12 (2017): 1754-1769) and Nature Cell Biology 21.5 (2019): 552-559). Additionally, RNA modifications have been reported as regulators that play an important role in biological processes such as fertilization ability, development, and cell fate determination (Cell research 27 (2017): 1100-1114) and Cell stem cell 15.6 (2014): 707-719).

[0003] As the biological roles and importance of RNA modifications are reported, attempts to detect specific RNA modifications are increasing. However, due to the experimental and practical limitations of existing next-generation sequencing methods using antibodies, no method has been reported to accurately and broadly detect various RNA modifications at once.

[0004] Recently, synthetic RNA sequences or RNA sequences extracted from cells are used as RNA modification data for training in various models that aim to detect RNA modifications.

[0005] The synthesized RNA sequence refers to RNA created by in-vitro transcription (IVT). In order to create RNA containing RNA modification using IVT, a specific type of RNA-modified-NTP (e.g., m) is used instead of NTP (ATP, CTP, GTP, UTP). 6 ATP, m 5 CTP) is used, for example, m 6 When using ATP, all the A's on DNA are replaced by A's on RNA. 6 Because it is transcribed as A, the RNA synthesized by IVT will be different from the biological sequence that actually exists. That is, it will have m at every A position, which is different from the sequence that actually exists in nature. 6 An RNA sequence in which A exists is created. In fact, in the case of the model in the literature Nucleic acids research 49.2 (2021): e7 that used this sequence as learning data, the accuracy of finding RNA modifications actually existing in cells was very low, as confirmed in the literature Nature communications 14 (2023): 1906. To overcome this shortcoming, the literature Nature communications 10.1 (2019): 4079 and Nature biotechnology 39 (2021): 1278-1291 used the middle m6 5-mer sequences containing other As other than A were excluded from the training data, and the model was trained using only sequences that did not contain other As. However, this is also a natural m 6 The drawback of not considering all RNA sequences where canonical A exists around A still exists, and we confirmed that the accuracy is still low. When trained using data created using synthetic RNA that is different from naturally existing RNA or does not consider all naturally existing sequences, the model is able to generate m with various surrounding sequences. 6 There is a limitation that the A location cannot be successfully predicted.

[0006] Meanwhile, when applying RNA extracted from cells to learning data, m present in a specific motif 6 A will be used. For example, m 6 A is known to be mainly present in the middle A position of the DRACH (D = A / G / U, R = A / G, H = A / C / U) motif, and these DR(m 6 A) In the case of the model of RNA 26.1 (2020): 19-28 or Nature methods 19.12 (2022): 1590-1598, which was trained using only CH sequences as training data, m present in the corresponding motif 6 Only A can be predicted to a limited extent, which means that it is not possible to predict m that actually exists in nature. 6 It has the limitation that it cannot find A widely. Also, m 6 For RNA modifications other than A, the predominant motifs, such as DRACH, are largely unknown, so strategies that utilize RNA extracted from cells or use RNA modification data on specific motifs based on information derived from them are not applicable to other RNA modifications.

[0007] In this way, when using RNA modification sequences synthesized through IVT as suggested in existing papers and models, or RNA modification sequences extracted from cells or sequences limited to specific motifs, it is impossible to consider all RNA modifications present in the entire organism, and when using this as data for model learning, there may be limitations in predicting the modification locations of the entire RNA. Accordingly, the inventors of the present invention have made great efforts to design a modified RNA library that can reflect all RNA modifications present in the entire organism, and as a result, have developed a design method for synthesizing RNA oligomers containing various types of RNA modifications and all random sequences surrounding them at a desired location by a chemical or template-independent enzymatic synthesis method and using this to produce an RNA modification library, thereby completing the present invention.

[0008] The present invention aims to provide a method for producing a modified RNA library based on a broad library design method of RNA modifications including combinations of all surrounding sequences of RNA modifications, and a use thereof.

[0009] To achieve the above purpose, the present invention provides a method for producing a modified RNA library comprising the following steps:

[0010] (a) a step of producing one or more modified RNA blocks in which 4 to 50 random nucleotides are randomly linked to the 5' and 3' directions of the modified RNA, respectively;

[0011] (b) a step of producing a modified RNA oligomer such that 1 to 9 modified RNA blocks are randomly arranged among the one or more modified RNA blocks;

[0012] (c) a step of ligating the modified RNA oligomer to produce a modified RNA oligomer condensate;

[0013] (d) a step of selecting a modified RNA oligomer condensate in which 2 to 20 of the modified RNA oligomers are ligated;

[0014] (e) attaching an RNA tail consisting of 5 to 150 random ribonucleotides to the selected modified RNA oligomer condensate; and

[0015] (f) A step of recovering a modified RNA oligomer condensate having the above RNA tail attached.

[0016] In the present invention, the modified RNA is

[0017] (1) Modification A of [Table 1] below:

[0018] [Table 1]

[0019]

[0020]

[0021] (2) Modification C of [Table 2] below:

[0022] [Table 2]

[0023]

[0024] (3) Modification G of [Table 3] below:

[0025] [Table 3]

[0026]

[0027]

[0028] and

[0029] (4) Modification U of [Table 4] below:

[0030] [Table 4]

[0031]

[0032]

[0033]

[0034] It may be any one modified RNA selected from the group consisting of .

[0035] In the present invention, the step (b)

[0036] (i) between each modified RNA block constituting the modified RNA oligomer;

[0037] (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or

[0038] (iii) It may be possible to produce a modified RNA oligomer that additionally includes an anchor sequence at the 3' end of a modified RNA block located at the 3' end among the modified RNA blocks constituting the modified RNA oligomer.

[0039] In the present invention, the anchor sequence has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence may have a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence may have a length of 20 to 30% of the length of the modified RNA block.

[0040] In the present invention, the step (c) may be ligation with RNA ligase.

[0041] In the present invention, the step (b) may be produced by additionally introducing 2 to 4 specific nucleotide combinations to the 5' end and 3' end of the modified RNA oligomer, respectively.

[0042] In the present invention, the RNA ligase is T4 RNA ligase 1, the two specific nucleotide combinations are any one of the combinations listed in Table 5 below, the three specific nucleotide combinations are any one of the combinations listed in Table 6 below, and the four specific nucleotide combinations are any one of the combinations listed in Table 7 below, or

[0043] [Table 5]

[0044]

[0045] [Table 6]

[0046]

[0047] [Table 7]

[0048]

[0049] The above RNA ligase is T4 RNA ligase 2 truncated KQ, the two specified nucleotide combinations may be any one of the combinations listed in Table 8 below, the three specified nucleotide combinations may be any one of the combinations listed in Table 9 below, and the four specified nucleotide combinations may be any one of the combinations listed in Table 10 below.

[0050] [Table 8]

[0051]

[0052] [Table 9]

[0053]

[0054] [Table 10]

[0055]

[0056] In the present invention, steps (a) and (b) may be produced by a chemical or template-independent enzymatic synthesis method, and step (b) may be produced as a separate process after step (a), or steps (a) and (b) may be produced as a single process.

[0057] In the present invention, the step (c) may be ligation at 29°C to 37°C for 8 to 40 hours.

[0058] In the present invention, the step (c) may be ligation in a reaction solution containing 13 to 21% (v / v) of PEG8000.

[0059] In the present invention, the RNA tail of step (e) may be a poly(A) tail, poly(U) tail or poly(I) tail composed of 5 to 40 ribonucleotides.

[0060] In the present invention, the poly(A) tail, poly(U) tail or poly(I) tail of step (e) may be reacted in a reaction solution containing 5 to 50 uM of ATP, UTP or ITP, respectively.

[0061] The present invention also provides a modified RNA library comprising a plurality of modified RNA oligomer condensates in the form of 2 to 20 ligated modified RNA oligomers,

[0062] The above modified RNA oligomer provides a modified RNA library characterized in that 1 to 9 modified RNA blocks are randomly arranged consecutively in the form of 4 to 50 random nucleotides randomly linked in the 5' and 3' directions, respectively, with the modified RNA as the center.

[0063] In the present invention, the modified RNA is

[0064] (1) Modification A of the above [Table 1]:

[0065] (2) Modification C of the above [Table 2]:

[0066] (3) Modification G of the above [Table 3]: and

[0067] (4) U modification of the above [Table 4]:

[0068] A library of modified RNAs, wherein any one modified RNA is selected from the group consisting of:

[0069] In the present invention, the modified RNA oligomer is

[0070] (i) between each modified RNA block constituting the modified RNA oligomer;

[0071] (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or

[0072] (iii) An anchor sequence may be additionally included at the 3' end of the modified RNA block located at the 3' end of the modified RNA block constituting the modified RNA oligomer.

[0073] In the present invention, the anchor sequence has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence may have a length of 20 to 30% of the length of the modified RNA block.

[0074] In the present invention, 2 to 4 specific nucleotide combinations may be additionally introduced to the 5' end and the 3' end of the modified RNA oligomer, respectively.

[0075] In the present invention, the modified RNA oligomer condensate may additionally have an RNA tail composed of 5 to 150 random ribonucleotides attached to the 3' end.

[0076] The present invention also provides the modified RNA library; and

[0077] A set of RNA libraries for training an RNA modification detection model is provided, comprising a general RNA library comprising a plurality of general RNA oligomer condensates having the same structure as a plurality of modified RNA oligomer condensates included in the modified RNA library, except that the modified RNA is replaced with a corresponding general RNA.

[0078] The present invention also provides a sequencing data set generated using a set of RNA libraries for training the RNA modification detection model.

[0079] In the present invention, the sequencing may be single molecule RNA sequencing.

[0080] In the present invention, the sequencing data set may be for deep learning and / or machine learning.

[0081] The present invention is recognized as different from previously reported methods for producing modified RNA libraries in that it is possible to produce a modified RNA library by introducing various types of RNA modifications, and can reflect all possible combinations of surrounding sequences on both sides of the modified RNA. In addition, if single-molecule RNA sequencing is performed using the modified RNA library according to the present invention, a high-quality reference data set containing all combinatorially possible motifs can be generated, and if this is utilized as training data for deep learning (or machine learning), it will be possible to overcome the limitations of existing software that are limited to specific RNA modifications or have low prediction accuracy for other modifications, and not only will it be possible to develop new RNA modification detection software with higher accuracy, but it will also be possible to detect multiple RNA modifications simultaneously.

[0082] FIG. 1 illustrates an example of a modified RNA oligomer produced according to some embodiments of the present invention and a corresponding general RNA oligomer.

[0083] Figure 2 schematically illustrates an experiment for producing a modified RNA library according to the present invention and a corresponding general RNA library.

[0084] Figure 3a shows the ranking of ligation efficiency according to the sequence combination of both ends of the RNA oligomer in the step of ligating the RNA oligomer according to the present invention with T4 RNA ligase1.

[0085] Figure 3b shows the ranking of ligation efficiency according to the sequence combination of both ends of the RNA oligomer in the step of ligating the RNA oligomer according to the present invention with T4 RNA ligase 2 truncated KQ.

[0086] Figure 4a schematically illustrates an experiment in which an RNA oligomer according to the present invention is ligated with several RNA ligases; RNA ligase 1, RNA ligase 2 truncated KQ, and RNA ligase 2.

[0087] Figure 4b is a PAGE result after ligation of an RNA oligomer according to the present invention with several RNA ligases; RNA ligase 1, RNA ligase 2 truncated KQ, and RNA ligase 2.

[0088] Figure 5a shows the results of confirming the ligation efficiency according to the reaction temperature in the step of ligating an RNA oligomer according to the present invention with T4 RNA ligase1.

[0089] Figure 5b shows the results of confirming the ligation efficiency according to the concentration of PEG8000 in the step of ligating the RNA oligomer according to the present invention with T4 RNA ligase1.

[0090] Figure 5c shows the results of confirming the ligation efficiency according to the concentration of DMSO in the step of ligating the RNA oligomer according to the present invention with T4 RNA ligase1.

[0091] Figure 5d shows the results of confirming the ligation efficiency according to the reaction time in the step of ligating the RNA oligomer according to the present invention with T4 RNA ligase1.

[0092] Figure 5e shows the results of comparing the RNA oligomer ligation efficiency of the optimized conditions established for ligating the RNA oligomer according to the present invention and the conventional conditions for ligation using T4 RNA ligase1.

[0093] Figure 6 shows the results of confirming the optimized length of poly(A) tailing in nanopore sequencing using a modified RNA library produced according to the present invention.

[0094] Figure 7a shows the results of confirming the ATP concentration for poly(A) tailing of an optimized length in a modified RNA library produced according to the present invention.

[0095] Figure 7b shows the results of confirming the amount of E-PAP added and the reaction time for poly(A) tailing of an optimized length in a modified RNA library produced according to the present invention.

[0096] Figure 7c is a result confirming that attachment of an RNA tail of an accurate length through ligation is possible in the production of a modified RNA library of the present invention.

[0097] Figure 7d shows the result of producing a modified RNA library by attaching an RNA tail through ligation of App-RNA to a modified RNA oligomer condensate produced according to the present invention.

[0098] Figure 8a is an m manufactured according to the present invention. 6 A library and a general A library are actual examples of single-molecule sequencing performed using them, and the results (number of reads, number of bases).

[0099] Figure 8b is an m manufactured according to the present invention. 5 This is a real-world example of single-molecule sequencing using the C library and the general C library, and the results (number of reads, number of bases).

[0100] Figure 9a is an m manufactured according to the present invention. 6 This is the result of checking the base quality according to the position of the variant RNA in the motifs extracted from the sequencing data of the A library and the general A library.

[0101] Figure 9b is an m manufactured according to the present invention. 6 This is the result of confirming the average value of the current signal according to the position of the modified RNA in the motif extracted from the sequencing data of the A library and the general A library.

[0102] Figure 9c is an m manufactured according to the present invention.6 This is the result of confirming the difference in current signal according to motif in motifs extracted from sequencing data of A library and general A library.

[0103] Figure 10a shows the results comparing the degree of improvement in RNA oligomer design according to the anchor insertion method.

[0104] Figure 10b shows the results of comparing motif extraction accuracy according to the number of RNA blocks and the length of the anchor sequence.

[0105] Figure 10c is an example of inserting derived anchor sequences between blocks in a modified RNA oligomer and a corresponding general RNA oligomer design.

[0106] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In general, the nomenclature used herein and the experimental methods described below are well known and commonly used in the art.

[0107] In the present invention, it should be understood that terms such as “include” or “have” are intended to specify the presence of a feature, number, step, operation, component, part or combination thereof described in the specification, but do not exclude in advance the possibility of the presence or addition of one or more other features, numbers, steps, operations, components, parts or combinations thereof.

[0108] In the present invention, we developed a method for designing a comprehensive library of RNA modifications encompassing all combinations of surrounding sequences of RNA modifications. Specifically, we designed and chemically synthesized RNA oligomers containing various types of RNA modifications at desired locations and all surrounding random sequences, and used these to construct a library of RNA modifications.

[0109] Accordingly, the present invention relates to a method for producing a modified RNA library, comprising the following steps in one aspect:

[0110] (a) a step of producing one or more modified RNA blocks in which 4 to 50 random nucleotides are randomly linked to the 5' and 3' directions of the modified RNA, respectively;

[0111] (b) a step of producing a modified RNA oligomer such that 1 to 9 modified RNA blocks are randomly arranged among the one or more modified RNA blocks;

[0112] (c) a step of ligating the modified RNA oligomer to produce a condensate of the modified RNA oligomer ligates;

[0113] (d) a step of selecting a modified RNA oligomer condensate in which 2 to 20 of the modified RNA oligomers are ligated.

[0114] (e) attaching an RNA tail consisting of 5 to 150 random ribonucleotides to the selected modified RNA oligomer condensate; and

[0115] (f) A step of recovering a modified RNA oligomer condensate having the above RNA tail attached.

[0116] In one embodiment, the method for producing the modified RNA library may include the following steps:

[0117] (a) a step of producing a plurality of modified RNA blocks in which 4 to 50 random nucleotides are randomly linked to the 5' and 3' directions of the modified RNA, respectively;

[0118] (b) a step of producing a modified RNA oligomer such that 2 to 9 modified RNA blocks are randomly arranged among the plurality of modified RNA blocks;

[0119] (c) a step of ligating the above modified RNA oligomers to produce modified RNA oligomer condensates;

[0120] (d) a step of selecting a modified RNA oligomer condensate in which 2 to 20 of the modified RNA oligomers are ligated.

[0121] (e) attaching an RNA tail consisting of 5 to 150 random ribonucleotides to the 3' end of the selected modified RNA oligomer condensate; and

[0122] (f) A step of recovering a modified RNA oligomer condensate having the above RNA tail attached.

[0123] In the present invention, the modified RNA is

[0124] (1) Modification A of [Table 1] below:

[0125] [Table 1]

[0126]

[0127]

[0128] (2) Modification C of [Table 2] below:

[0129] [Table 2]

[0130]

[0131] (3) Modification G of [Table 3] below:

[0132] [Table 3]

[0133]

[0134]

[0135] and

[0136] (4) Modification U of [Table 4] below:

[0137] [Table 4]

[0138]

[0139]

[0140]

[0141] It can be characterized by being any one modified RNA selected from the group consisting of.

[0142] That is, in the present invention, the modified RNA may be any one of the various modified RNAs listed in Tables 1 to 4 above.

[0143] In the step (a) above, any number of nucleotides, identical or different, can be randomly combined in both directions of the modified RNA, and the nucleotides can be any one of A, G, C, and U, which are general RNAs, and the number of nucleotides combined in each of the two directions can be 4 to 50. Through this process, countless combinations of modified RNA blocks can be produced centered on RNA modification.

[0144] In the above step (b), a modified RNA oligomer can be produced so that 1 to 9 modified RNA blocks are randomly arranged among the countless combinations of modified RNA blocks produced in the above step (a), and through such an arrangement, the diversity of the library according to the present invention can be further improved.

[0145] In one embodiment, the modified RNA oligomer may be a modified RNA library characterized in that 2 to 9 modified RNA blocks are randomly arranged in a continuous manner, each having 4 to 50 random nucleotides randomly linked in the 5' and 3' directions centered on the modified RNA.

[0146] In the present invention, the step (b)

[0147] (i) between each modified RNA block constituting the modified RNA oligomer;

[0148] (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or

[0149] (iii) It may be characterized by producing a modified RNA oligomer that additionally includes an anchor sequence at the 3' end of a modified RNA block located at the 3' end among the modified RNA blocks constituting the modified RNA oligomer.

[0150] In the present invention, the anchor sequence may be characterized in that it has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 20 to 30% of the length of the modified RNA block.

[0151] As the length of the modified RNA block increases, the accuracy of the motif decreases. At this time, the length of the anchor sequence can be adjusted as described above to maintain a high level of motif accuracy.

[0152] For example, if there are three or more modified RNA blocks in the modified RNA oligomer and the length of the modified RNA blocks is 21, an anchor length of about 6 is appropriate, and if the length of the modified RNA blocks is 31, an anchor length of about 9 is appropriate.

[0153] However, if the number of modified RNA blocks is less than 2, the motif extraction accuracy decreases, so at this time, the length of the anchor sequence can be additionally increased to maintain a high motif accuracy.

[0154] For example, if the length of the modified RNA block is 21 and the number of modified RNA blocks is 2, an anchor length of approximately 12 is appropriate. If the number of modified RNA blocks is 1, an anchor length of approximately 18 is appropriate. If the length of the modified RNA block is 31 and the number of modified RNA blocks is 2, an anchor length of approximately 18 is appropriate. If the number of modified RNA blocks is 1, an anchor length of approximately 27 is appropriate.

[0155] It is desirable to select the sequence of anchors by considering the following factors:

[0156] (1) The Levenshtein distance between each anchor must be at least 50% of the anchor length.

[0157] (2) When all anchors are combined, the ratio of each nucleotide must be equal, and the ratio of nucleotides within each anchor must also be equal. An equal ratio means a ratio obtained by dividing the length of each anchor into four integer ratios closest to 1:1:1:1.

[0158] (3) The average alignment error occurring during nanopore sequencing of all 5-mers constituting each anchor must be less than or equal to the 10th percentile.

[0159] (4) When partially random oligomers are generated using all anchors and sampled random blocks, the average minimum free energy (MFE) of these oligomers must be at least 90 percentile. This is to minimize the formation of RNA secondary structures.

[0160] (5) When partially random oligomers are formed as in (4), the average value of the minimum dimer free energy (dimer MFE) occurring in all possible pairs must be above the 90th percentile. This is to minimize RNA dimer formation.

[0161] (6) When all subsequences with 50% of the anchor length are extracted from all anchors, there should be no pairs that are reverse complementary among all possible pairs created from them. This is to minimize RNA duplex formation.

[0162] Therefore, the anchor may preferably satisfy one or more of the following conditions:

[0163] (1) The Levenshtein distance between each anchor shall be at least 50% of the anchor length;

[0164] (2) The ratio of each nucleotide (A, G, C, U) within each anchor shall not differ by more than 10% from 1:1:1:1;

[0165] (3) The average alignment error occurring during nanopore sequencing of all 5-mers constituting each anchor shall be less than or equal to the 10th percentile.

[0166] (4) When partially random oligomers are created using all anchors and sampled random blocks, the average value of their minimum free energy (MFE) should be at least 90 percentile.

[0167] (5) When partially random oligomers are created using all anchors and sampled random blocks, the average value of the dimer minimum free energy (dimer MFE) occurring in all possible pairs must be at least 90 percentile, and

[0168] (6) When all subsequences with 50% of the anchor length are extracted from all anchors, there will be no pairs that are reverse complementary among all possible pairs created from them.

[0169] For example, a set of four anchor sequences of 6 nucleotides in length that satisfy the above conditions include {CGACAU, CAGUUA, GUCCAG, GUAGUC}, {CGACAU, AGUCCG, CAGUUA, GUAGUC}, {CGACAU, GUAUCC, UUGACG, AGAGUC}.

[0170] In the present invention, the plurality of anchors in the modified RNA oligomer may have the same length or different lengths, and may have the same sequence or different sequences.

[0171] In the present invention, the step (c) may be characterized by producing a modified RNA oligomer condensate (ligates) by ligating the modified RNA oligomer with RNA ligase, and the RNA ligase may be used without limitation in type.

[0172] In this case, step (b) produces a modified RNA oligomer in which 1 to 9 random modified RNA blocks are arranged randomly among one or more modified RNA blocks produced in step (a), and 2 to 4 specific nucleotide combinations may be additionally introduced to the 5' end and 3' end of the modified RNA oligomer produced in this manner, respectively.

[0173] For example, in step (b), a modified RNA oligomer is produced so that 2 to 9 random modified RNA blocks are arranged randomly among the plurality of modified RNA blocks produced in step (a), and 2 to 4 specific nucleotide combinations may be additionally introduced to the 5' end and the 3' end of the modified RNA oligomer produced in this manner, respectively.

[0174] When such a specific nucleotide combination is introduced, the ligation efficiency can be increased in the subsequent step of (c) ligating the modified RNA oligomer to produce a modified RNA oligomer condensate.

[0175] In one embodiment, the RNA ligase is T4 RNA ligase 1, the two specified nucleotide combinations are any one of the combinations listed in Table 5 below, the three specified nucleotide combinations are any one of the combinations listed in Table 6 below, and the four specified nucleotide combinations may be any one of the combinations listed in Table 7 below, but are not limited thereto:

[0176] [Table 5]

[0177]

[0178] [Table 6]

[0179]

[0180] [Table 7]

[0181]

[0182] In another embodiment, the RNA ligase is T4 RNA ligase 2 truncated KQ, the two specified nucleotide combinations are any one of the combinations listed in Table 8 below, the three specified nucleotide combinations are any one of the combinations listed in Table 9 below, and the four specified nucleotide combinations may be any one of the combinations listed in Table 10 below, but are not limited thereto:

[0183] [Table 8]

[0184]

[0185] [Table 9]

[0186]

[0187] [Table 10]

[0188]

[0189] The present invention enables the production of a modified RNA library with a single ligation reaction.

[0190] In the present invention, steps (a) and (b) can be produced by chemical or template-independent enzymatic synthesis methods known in the art. In this case, step (b) can be produced as a separate process after step (a), or steps (a) and (b) can be produced as a single process.

[0191] That is, in the present invention, steps (a) and (b) may be produced in one process, such as a step of producing a modified RNA oligomer such that 1 to 9 modified RNA blocks are randomly arranged among one or more modified RNA blocks in which 4 to 50 random nucleotides are randomly linked in the 5' and 3' directions of the modified RNA, respectively;

[0192] In one embodiment of the present invention, steps (a) and (b) were produced by chemical synthesis, but it is apparent to those skilled in the art that template-independent enzymatic synthesis can also be used. Template-independent enzymatic synthesis is described in detail in, for example, Wiegand, Daniel J., et al. "Template-independent enzymatic synthesis of RNA oligonucleotides." Nature Biotechnology (2024), and those skilled in the art can implement the present invention by using template-independent enzymatic synthesis by referring to the above document instead of chemical synthesis.

[0193] In another aspect, in the present invention, steps (a) and (b) may be produced in one process, such as a step of producing a modified RNA oligomer such that 2 to 9 modified RNA blocks are randomly arranged among a plurality of modified RNA blocks in which 4 to 50 random nucleotides are randomly linked in the 5' and 3' directions of the modified RNA, respectively;

[0194] In this case, the additional process in step (b) above can be applied as is to step (a') above, as long as they are not mutually contradictory.

[0195] In the present invention, the step (c) may be characterized by performing ligation at a temperature of about 29°C to about 37°C, for example, about 31°C to about 34°C, preferably about 32°C to about 33°C, for about 4 hours or more, for example, about 8 hours to 40 hours, preferably, about 10 hours to about 24 hours, to improve ligation efficiency.

[0196] In the present invention, the step (c) may also be characterized by performing ligation in a reaction solution containing about 11 to about 23% (v / v) of PEG8000, for example, about 13 to about 21% (v / v), preferably about 15 to 19% (v / v), to improve ligation efficiency.

[0197] In the present invention, the step (c) may also be performed in a reaction solution containing DMSO to improve ligation efficiency, and in this case, the ligation may be performed in a reaction solution containing DMSO in an amount of about 20% (v / v) or less, for example, about 5 to about 15% (v / v), preferably about 8 to about 12% (v / v).

[0198] Thereafter, in step (d), a modified RNA oligomer condensate having a length of 2 to 20 ligated units suitable for RNA sequencing can be selected.

[0199] The step of selecting a modified RNA oligomer condensate of a specific length is known in the art, and in one embodiment, may be performed by electrophoresing the modified RNA oligomer condensate on a PAGE gel and extracting a modified RNA oligomer condensate of a desired size, but is not limited thereto.

[0200] Thereafter, in step (e), an RNA tail can be attached to the 3' end of the selected specific length modified RNA oligomer condensate.

[0201] In this case, the RNA tail is attached to improve RNA sequencing efficiency, and means any sequence that has already been clearly specified so that the creator of the modified RNA library can know the exact sequence, and the RNA tail may be a homo or heteropolynucleotide in which about 5 to 150 random ribonucleotides (A, G, C, U, I) are combined.

[0202] The RNA tail may be, for example, a homo or heteropolynucleotide of 25 to 100, preferably about 25 to 50, more preferably about 25 to 40 homopolynucleotides or heteropolynucleotides, composed of ribonucleotides selected from any ribonucleotides (A, G, C, U, I).

[0203] In one embodiment, the RNA tail may be a poly(A) tail, which may be a poly(A) tail composed of 5 to 150 adenines, for example, 25 to 100 adenines, preferably about 25 to 50 adenines, more preferably about 25 to 40 adenines.

[0204] In another embodiment, the RNA tail may be a poly(U) tail, which may be a poly(U) tail composed of 5 to 150 uracils, for example, 25 to 100 uracils, preferably about 25 to 50 uracils, more preferably about 25 to 40 uracils.

[0205] In another embodiment, the RNA tail may be a poly(I) tail, which may be a poly(I) tail composed of 5 to 150 inosines, for example, 25 to 100 inosines, preferably about 25 to 50 inosines, more preferably about 25 to 40 inosines.

[0206] In the present invention, the RNA tail may be introduced as a poly(A) tail, a poly(U) tail, or a poly(I) tail for the convenience of production, but if the manufacturer clearly specifies the sequence and can easily produce an adapter or primer based on it and utilize it for sequencing, the type is not particularly limited, and any ribonucleotide selected from any ribonucleotide (A, G, C, U, I) can be combined to produce a length in the range of about 5 to 150.

[0207] In the present invention, in order to poly(A) tailor about 25 to 40 adenines, the poly(A) tailing reaction solution may be characterized by containing about 5 to 50 uM, for example, about 5 to 25 uM, and preferably about 5 to 15 uM, of ATP.

[0208] In this case, the poly(A) tailing reaction may be characterized by reacting for about 30 minutes to about 1 hour, for example, about 40 minutes to about 50 minutes, using about 2.5 U to 4 U of E-PAP, for example, about 3 to 3.5 U of E-PAP.

[0209] In one embodiment of the present invention, poly(A) tailing using E-PAP enzyme was performed, but it is apparent to those skilled in the art that poly(U) tailing or poly(I) tailing using poly(U) polymerase can also be performed. Poly(U) tailing or poly(I) tailing is described in detail in, for example, RNA 27 (2021): 1497-1511 and Molecular and Cellular Biology 27.10 (2007): 3612-3624.

[0210] Meanwhile, when the RNA tail according to the present invention is a homopolynucleotide or heteropolynucleotide other than a poly(A) tail, a poly(U) tail, or a poly(I) tail, the RNA tail may be manufactured to have a phosphate group at the 5' and 3' ends of 25 to 100 homo or heteropolynucleotides, preferably about 25 to 50 homo or heteropolynucleotides, and more preferably about 25 to 40 homopolynucleotides or heteropolynucleotides (5'p-RNA-3'p), and after pre-adenylation of 5'-p (generation of 5' App-RNA-3'p), it may be attached to the modified RNA oligomer condensate by ligation.

[0211] Meanwhile, a method for producing a general RNA library comprising a plurality of general RNA oligomer condensates having the same structure as a plurality of modified RNA oligomer condensates included in the modified RNA library, except that the modified RNA is replaced with a corresponding general RNA, will be apparent to a person skilled in the art from the above-described method for producing a modified RNA library.

[0212] In the present invention, having the same structure means having a structure corresponding to the modified RNA library by producing a general RNA library through the same steps and conditions, except that the modified RNA is replaced with general RNA.

[0213] From another perspective, the present invention relates to a modified RNA library produced by the above method.

[0214] In another aspect, the present invention provides a modified RNA library comprising a plurality of modified RNA oligomer condensates in the form of 2 to 20 ligated modified RNA oligomers,

[0215] The above modified RNA oligomer relates to a modified RNA library, characterized in that 1 to 9 modified RNA blocks are randomly arranged in a continuous manner, each having 4 to 50 random nucleotides randomly linked in the 5' and 3' directions centered on the modified RNA.

[0216] For example, the modified RNA oligomer may be a modified RNA block in which 4 to 50 random nucleotides are randomly linked in the 5' and 3' directions, respectively, with the modified RNA as the center, and 2 to 9 blocks are randomly arranged consecutively.

[0217] In the present invention, the modified RNA may be any one modified RNA selected from the group consisting of various modified RNAs described in [Table 1] to [Table 4], but is not limited thereto.

[0218] In the present invention, the modified RNA oligomer is

[0219] (i) between each modified RNA block constituting the modified RNA oligomer;

[0220] (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or

[0221] (iii) It may additionally include an anchor sequence at the 3' end of the modified RNA block located at the 3' end among the modified RNA blocks constituting the modified RNA oligomer.

[0222] In the present invention, the anchor sequence has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence may have a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence may have a length of 20 to 30% of the length of the modified RNA block.

[0223] In the present invention, 2 to 4 specific nucleotide combinations may be additionally introduced to the 5' end and the 3' end of the modified RNA oligomer, respectively.

[0224] In the present invention, the modified RNA oligomer condensate may additionally include an RNA tail composed of 5 to 150 random ribonucleotides at its 3' end.

[0225] The above RNA tail has been described in detail above, so the repeated description is omitted.

[0226] In another aspect, the present invention relates to the modified RNA library; and

[0227] A general RNA library comprising a plurality of general RNA oligomer condensates having the same structure as a plurality of modified RNA oligomer condensates included in the modified RNA library, except that the modified RNA is replaced with a corresponding general RNA;

[0228] This relates to a set of RNA libraries for training RNA modification detection models.

[0229] In another aspect, the present invention relates to the modified RNA library; and

[0230] The present invention relates to a method for learning an RNA modification detection model using a set of RNA libraries, which comprises a general RNA library including a plurality of general RNA oligomer condensates having the same structure as a plurality of modified RNA oligomer condensates included in the modified RNA library, except that the modified RNA is replaced with a corresponding general RNA.

[0231] In one embodiment, the modified RNA library and the general RNA library corresponding to the modified RNA library can be provided as components of a kit.

[0232] In this case, the kit may include the modified RNA library and a general RNA library corresponding to the modified RNA library, and may include instructions explaining the principles and experimental methods for generating sequencing data using the library set.

[0233] In another aspect, the present invention relates to a sequencing data set generated using a set of RNA libraries for training the above RNA modification detection model.

[0234] In the present invention, the sequencing may be single molecule RNA sequencing, but is not limited thereto.

[0235] The above single molecule RNA sequencing method may be any method known in the art, and reference may be made to Nature methods 15 (2018): 201-206, but is not limited thereto.

[0236] For example, the sequencing data set may be for deep learning and / or machine learning training.

[0237] Therefore, the present invention, from another perspective, relates to a deep learning or machine learning method using the above sequencing data set.

[0238] In another aspect, the present invention relates to the above sequencing data set for use in deep learning or machine learning.

[0239] The oligomers in the modified RNA library according to the present invention have the following advantages. (1) They overcome the disadvantage of RNA produced by IVT (the presence of specific RNA modifications at all base positions) and can construct a library in which RNA modifications exist only at desired positions. (2) The sequences on either side of the RNA modification are composed of random sequences of the desired length in all combinations that are not limited to specific motifs. This enables the creation of a library of a specific type of RNA modification and its corresponding general base, encompassing all surrounding sequences. This overcomes the disadvantages of libraries using RNA extracted from cells or RNA synthesized by inserting only a few specific motif sequences. (3) The present invention can be applied to the production of various types of RNA modification libraries by simply replacing a specific base in the center with a different type of RNA modification and synthesizing it.

[0240] The present invention is different from previously reported modified RNA libraries in that it is a modified RNA library that can reflect various types of RNA modifications and all surrounding sequences.

[0241] That is, the modified RNA library according to the present invention has the advantage of not being limited to specific RNA modifications and their well-known surrounding motifs, but including various RNA modifications and all possible surrounding sequences existing in nature. In addition, it can be designed so that RNA modifications are located only at desired positions, overcoming the limitations of RNA produced by IVT, and the surrounding sequences can also be designed as random or specific sequences. Furthermore, since only one RNA modification can be positioned at the center, there is also the advantage of not having to inevitably exclude certain combinations of surrounding sequences to prevent the inclusion of two or more RNA modifications in a library produced through IVT, as in previous papers.

[0242] That is, the modified RNA library designed according to the present invention contains a wide range of combinations of modified RNA oligomer condensates, and can be used to generate sequencing data (e.g., single-molecule RNA sequencing data) and then use it as training data for an RNA modification prediction model.

[0243] Furthermore, since the modified RNA library according to the present invention can introduce RNA modifications at desired locations, it has the advantage of being more similar to the transcriptome of actual organisms and being capable of learning (e.g., deep learning or machine learning) generalizable knowledge to actual organisms compared to previously known modified RNA libraries (e.g., produced by IVT). That is, since the modified RNA library according to the present invention can produce a data set containing all combinatorially possible motifs surrounding the modified RNA, bias according to motifs can be eliminated during learning.

[0244] Meanwhile, software trained using sequencing data using the modified RNA library according to the present invention as training data can detect new RNA modifications with very high accuracy, overcoming the limitation that software trained using existing modified RNA library-based data is limited to specific RNA modifications and may have low prediction accuracy for other modifications.

[0245] In addition, software trained using various types of modified RNA library data designed according to the present invention will not only be able to accurately detect RNA modifications present in all surrounding sequences, but will also be able to simultaneously detect multiple RNA modifications at once.

[0246] It is known that RNA modifications play a role in regulating biological processes such as development, modification, and cell fate determination, and given that dysregulation of RNA modifications has been consistently reported to be associated with various diseases, including cancer, software utilizing the modified RNA library according to the present invention will be applicable to molecular diagnostics and medical fields related to various diseases. For example, if RNA modifications are detected in RNA obtained from various patient samples, the location of the disease-specific RNA modification can be identified, and by comparing this with the location of RNA-binding proteins, new RNA modification proteins can be identified. Furthermore, based on the identified RNA modification protein data, biomarker candidates for diagnosing RNA modification-related diseases and disease-specific drug targets can be discovered, thereby actively utilizing the system in the diagnosis and treatment of RNA modification-related diseases.

[0247] Furthermore, software that detects or predicts modified RNAs using various data sets derived from the modified RNA library according to the present invention can be utilized to newly identify associations between various RNA modifications and specific biological phenomena and to analyze their underlying mechanisms. For example, applying software trained using the modified RNA library according to the present invention to cells undergoing the maternal-to-aggregate transition during embryonic development could identify new associations between these changes over time and various RNA modifications, providing new directions for understanding their underlying mechanisms.

[0248]

[0249] Example

[0250] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0251]

[0252] Example 1. Production of a modified RNA library

[0253] In the present invention, we designed a library that considers all surrounding sequences for various RNA modifications (Fig. 1), and the specific production process is as follows (Fig. 2).

[0254]

[0255] (1) Production of a modified RNA oligomer with repeated modified RNA blocks and a corresponding general RNA oligomer.

[0256] A block was constructed by combining a specific type of RNA modification (or its corresponding common base) with a random sequence of 4 to 50 nucleotides (N = A / G / C / U) on both sides. A modified RNA oligomer containing this modified RNA block, repeated 1 to 9 times, was produced by chemical RNA synthesis (manufacturer: IDT). However, this modified RNA block can also be produced by template-independent enzymatic synthesis.

[0257] The 5' and 3' ends of the modified RNA oligomers were designed to incorporate specific combinations of 2 to 4 nucleotides, respectively. The optimal nucleotides for the 5' and 3' ends of the modified RNA oligomers were determined through additional experiments.

[0258] Specifically, an RNA adapter consisting of random nucleotides at the 3' end was designed, and then RNA ligation was performed at the 5' end of the modified RNA oligomer using T4 RNA ligase 1 (NEB) (Fig. 3a). cDNA was synthesized using only the ligated RNA, and then NGS sequencing was performed. The sequence of the ligated position was analyzed to select the combination of the sequence of the 5' end of the modified RNA oligomer of the most abundant RNA and the 3' end of the adapter. Since these combinations have better reactivity with the T4 RNA ligase 1 enzyme, it was judged that designing both ends of the RNA oligomer with these combinations could maximize the ligation efficiency and yield in the library construction step using the enzyme. In addition, this can serve as a marker used to find the position of a specific base (X) in the middle after single-molecule sequencing.

[0259] The number of reads for the top 10 combinations was measured, and the enrichment (how much more compared to a random combination) for each combination was analyzed to see if it was statistically significant. For the two-nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that the increase was more than 5.7 times compared to a random combination in both replicates 1 and 2. For the three-nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that the increase was more than 68 times compared to a random combination in both replicates 1 and 2. For the four nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that the increase was more than 814 times compared to the random combination in both replicates 1 and 2 (Fig. 3a).

[0260] Similarly, an App-RNA adapter consisting of random nucleotides at the 5' end was designed, and ligation was performed to the 3' end of the modified RNA oligomer using T4 RNA ligase 2 truncated KQ (NEB) (Fig. 3b). The sequences of the ligated positions were analyzed to select the combination of the 3' end of the modified RNA oligomer of the most abundant RNA and the 5' end sequence of the adapter. Since these combinations have better reactivity with the T4 RNA ligase 2 truncated KQ enzyme, they were judged to be combinations that can maximize ligation efficiency and yield in the library construction step using the enzyme.

[0261] The number of reads for the top 10 combinations was measured, and the enrichment (how much more compared to a random combination) for each combination was analyzed to see if it was statistically significant. For the two-nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that the increase was more than 2.2 times compared to a random combination in both replicates 1 and 2. For the three-nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that the increase was more than 4.47 times compared to a random combination in both replicates 1 and 2. For the four nucleotide combinations, all of the top 10 combinations showed significant differences (p-value, q-value ≒ 0), and it was confirmed that both replicates 1 and 2 showed a more than 12-fold increase compared to random combinations (Fig. 3b).

[0262] In this way, we identified 10 terminal combinations that maximized ligation efficiency depending on the enzyme to be used for ligation, and inserted 2 to 4 specific nucleotide combinations into the ends of the modified RNA oligomers for subsequent processes.

[0263]

[0264] (2) RNA oligomer ligation

[0265] The above-mentioned modified RNA oligomers and general RNA oligomers were ligated to various lengths using T4 RNA ligase 1 (NEB), T4 RNA ligase 2 (NEB), or T4 RNA ligase 2 truncated KQ (NEB), respectively, according to the manufacturer's instructions.

[0266]

[0267] (3) Selection of RNA oligomer condensates (ligates)

[0268] The above-mentioned ligated modified RNA oligomers and normal RNA oligomers were loaded onto an 8% denaturing urea gel, and the RNA was separated by length through PAGE (polyacrylamide gel electrophoresis). Among them, bands corresponding to the range of at least 2 to 20 ligated RNA oligomer condensates were selectively excised, all were collected, and then eluted to recover the RNA from the gel.

[0269]

[0270] (4) RNA tailing including poly(A) tailing

[0271] Poly(A) tailing was performed on RNA oligomer condensates of the selected lengths using a poly(A) tailing kit (Invitrogen) according to the manufacturer's instructions. The poly(A)-tailed RNA oligomer condensates were then recovered using Dynabeads Oligo(dT) (Invitrogen). Through this process, only linear RNAs with poly(A) tails were selectively recovered.

[0272]

[0273] In the same manner as above, a library of modified RNAs containing modified RNA condensates containing all the various surrounding sequences was constructed.

[0274]

[0275] Example 2. Optimization of the Modified RNA Library Production Process

[0276]

[0277] 2-1. Selecting the Ligase Type

[0278] Depending on the type of RNA ligase, the ligation mechanism and required substrate type differ. Therefore, ligation was performed using various RNA ligases and the most appropriate RNA ligase was selected through confirmation of the results. Tests were conducted using three enzymes: T4 RNA ligase 1 (NEB), T4 RNA ligase 2 (NEB), and T4 RNA ligase 2 truncated KQ (NEB) (Fig. 4a).

[0279] T4 RNA ligase 1 is a single-stranded RNA ligase that catalyzes the reaction between the 5' phosphate group and the 3' hydroxyl group of RNA, so the reaction was performed using modified RNA oligomers without any pretreatment. On the other hand, T4 RNA ligase 2 truncated KQ catalyzes the reaction between the pre-adenylated 5' end and the 3' end of RNA, so the modified RNA oligomers were first 5' adenylated using Mth RNA ligase (NEB) and then the reaction was performed. Finally, T4 RNA ligase 2 is a double-stranded RNA ligase that catalyzes the reaction between the 5' phosphate group and the 3' hydroxyl group in double-stranded RNA or RNA-DNA hybrids. Therefore, after synthesizing single-stranded DNA complementary to the terminal sequence of the modified RNA oligomer, the ligation reaction was performed by adding the DNA together. Each reaction was performed according to the manufacturer's instructions.

[0280] The following modified RNA oligomers were used in reactions comparing T4 RNA ligase 1 and T4 RNA ligase 2 truncated KQ.

[0281] [NNNN(m 6 A)NNNNNNNN(m 6A)NNNNNNNN(m 6 A)NNNNNNNN(m 6 A)NNNN](where N represents any RNA sequence.)

[0282] As a result of examining the ligation pattern using the oligomers, it was confirmed through PAGE that relatively more long-length RNA oligomer condensates were generated when T4 RNA ligase 1 was used. Conversely, in the experiment using T4 RNA ligase 2 truncated KQ, it was confirmed that more short-length condensates were generated (Fig. 4b).

[0283] Additionally, the following modified RNA oligomers were used in reactions to compare T4 RNA ligase 1 and T4 RNA ligase 2.

[0284] [CGACAGAUGAGUUCCNNNNNNNNNN(Um)NNNNNNNNNNNCCUUGAUAGACAGUC]

[0285] In addition, experiments were conducted by synthesizing the following single-stranded DNA having a sequence complementary to the terminal sequence of the corresponding modified RNA oligomer for RNA ligase 2 reaction.

[0286] [TCATCTGTCGGACTGTCTAT]

[0287] As a result of examining the ligation pattern using the oligomer, it was confirmed through PAGE that a relatively larger number of long-length RNA oligomer condensates were generated when T4 RNA ligase 1 was used. Compared to the RNA ligase 2 experiment, the bands were darker in the long size region, and the amount of remaining input (51mer) was confirmed to be smaller (Fig. 4b).

[0288]

[0289] 2-2. Ligation Optimization

[0290] Although T4 RNA ligase 1 (NEB) was selected as the RNA ligase in the above experiments, we observed that ligation efficiency and yield remained low when performed according to the manufacturer's instructions. Therefore, we sought to establish new ligation conditions suitable for designing modified RNA libraries.

[0291] Accordingly, the reaction temperature, reaction time, PEG (polyethylene glycol) 8000 concentration, and DMSO (dimethyl sulfoxide) concentration were varied, and the amount of poly(A)+ RNA was calculated relative to the amount of input RNA oligomer, and the conditions showing the highest yield were selected.

[0292]

[0293] (Condition 1) Reaction temperature

[0294] Ligation was performed at temperature conditions of 16, 25, 29, 33, 37, and 41°C for reactants of the same composition. The yield was calculated, and it was confirmed that the highest yield was achieved at 33°C (Fig. 5a).

[0295]

[0296] (Condition 2) PEG8000 concentration.

[0297] Experiments were conducted under conditions where the concentration of PEG8000 in the reaction composition was 10, 15, 19, 23, and 30%. As a result of calculating the yield, it was confirmed that the highest yield was achieved at 15% or 19% (Fig. 5b).

[0298]

[0299] (Condition 3) DMSO concentration

[0300] Experiments were conducted with DMSO concentrations of 0, 10, and 20% among the reaction components. The yield was calculated, and it was confirmed that the highest yield was achieved at 10% DMSO (Fig. 5c).

[0301]

[0302] (Condition 4) Reaction time

[0303] To find the most suitable reaction time at an optimal temperature of 33°C, experiments were conducted under conditions of 4, 16, and 40 hours. The yield was calculated, and it was confirmed that the highest yield was achieved with a 16-hour reaction (Fig. 5d).

[0304]

[0305] (Condition 5) Final condition comparison

[0306] Experiments were conducted using the conditions provided by NEB and the optimized conditions of the present invention. The yield was calculated and confirmed to have increased 3.8-fold, from 3% to 11.5% (Fig. 5e).

[0307]

[0308] 2-3. Optimization of RNA tailing, including poly(A) tailing

[0309] To stabilize the RNA oligomer condensate and complete it in the form of a sequence-ready library, an RNA tailing process including poly(A) tailing (addition of non-template nucleotides to the 3' end of RNA) is required. Since the modified RNA oligomer condensate produced in the present invention is different from mRNA and has a relatively large number of short-length RNAs, it was determined that a process of finding a poly(A) tail of a length appropriate for the library was necessary first. Therefore, 1) a process of finding the optimal poly(A) tail length was performed, and 2) an optimization process of finding experimental conditions to match the length was performed.

[0310] In the process of finding the appropriate poly(A) tail length, poly(A) tails of 20, 30, 40, 100, and 300 nucleotides in length were generated at the 3' end of the same length of experimental RNA with different indices. Afterwards, sequencing was performed using samples in which each RNA molecule was mixed in an equal molar number. From the sequencing results, the poly(A) tail length of the RNA with the highest base quality and mapping degree was selected as the optimal poly(A) tail length.

[0311] As a result, the base quality showed high results in 30 and 100 nucleotide poly(A) tails, and the ratio of mapped reads was confirmed to be the highest in the 30 nucleotide poly(A) tail (Fig. 6). Since the condition that showed the highest value in both results was the poly(A) tail length of 30 nucleotides, that length was set as the most suitable length for the library of the present invention.

[0312] Next, we conducted an experiment to attach a poly(A) tail of approximately 30 nucleotides using E-PAP (E. coli Poly(A) Polymerase) enzyme. When Invitrogen's poly(A) tailing kit was used according to the manufacturer's method, it was confirmed that a very long poly(A) tail was added (Fig. 7a). Accordingly, conditions for attaching a 30-nucleotide poly(A) tail were established by changing the ATP concentration, E-PAP enzyme amount, and reaction time. The results were confirmed on a denaturing gel through PAGE.

[0313] As a result, there was no significant difference even when the amount of E-PAP enzyme was changed when 1 mM ATP was used, and it was confirmed that the length of the poly(A) tail decreased rapidly when ATP was reduced to 1 mM, 100 uM, and 10 uM. When the reaction time was reduced to 45 minutes using 3.2 U E-PAP under the 10 uM ATP condition, the result closest to a poly(A) tail of approximately 30 nucleotides was obtained (Fig. 7b). Based on these results, 10 uM ATP, 3.2 U E-PAP, and a 45-minute reaction at 37°C were determined to be the optimal conditions for poly(A) tailing for the production of the RNA modification library of the present invention.

[0314] This process can be performed using poly(U) polymerase enzyme (NEB) to achieve poly(U) tailing or poly(I) tailing. This process can be performed by replacing ATP with the same concentration of UTP or ITP. Afterwards, tailed RNA oligomer condensates can be recovered using Oligo(dA) or Oligo(dC).

[0315]

[0316] 2-4. Attachment of RNA tail through ligation

[0317] Poly(A) tailing using the E-PAP enzyme is used to create a library composed of RNA with a similar structure to mRNA. This is because the adapters or RT primers used in the library preparation process generally contain oligo(dT). However, if the attachment of RNA tails of a precise length is required, the ligation method may be preferable and may be a more appropriate method for testing various specific experimental conditions (e.g., slight differences in RNA tail length). Furthermore, ligation is the only method that can be used to attach tails composed of heteropolynucleotides rather than homopolynucleotides. In this case, the sequencing preparation process is performed by directly designing an adapter or RT primer with a complementary sequence.

[0318] An RNA oligomer consisting of 20 to 40 nucleotides of A and having phosphate groups attached to both the 5' and 3' ends was designed to be used as an RNA tail. To prevent the tails from ligating to each other during the ligation reaction to form a circular RNA or to prevent multiple tails from being attached to the oligomer condensate, a phosphate group was also attached to the 3' end. Afterwards, a pre-adenylated App-RNA oligomer was prepared using Mth RNA ligase (NEB) and the reaction was performed. To confirm the attachment of the tail of the correct length, RNA tails were attached through ligation to the 3' end of an oligomer having a length of 240 nucleotides.

[0319] For the Mth RNA ligase reaction, 100 pmol of enzyme per 100 pmol of RNA oligomer and 100 μM ATP were added to the reaction solution, and the reaction was carried out at 65°C for 1 hour and 85°C for 5 minutes, according to the manufacturer's instructions. Subsequently, for the ligation reaction between the oligomer condensate and the App-RNA oligomer, 40 pmol of App-RNA oligomer, 10% PEG8000, and 200 U of T4 RNA ligase 2 truncated KQ enzyme were added per 20 pmol of RNA substrate, and the reaction was carried out at 25°C for 2 hours, according to the manufacturer's instructions. As a result of the experiment, it was confirmed that the lengths of the oligomer condensates with various lengths increased precisely by 20, 30, and 40 nucleotides, and it was confirmed that the degree of length increase could be distinguished from each other. Therefore, it was determined that the attachment of RNA tails of the exact length through ligation was successfully achieved (Fig. 7c).

[0320] Next, in order to attach a tail that is a heteropolynucleotide rather than a homopolynucleotide, attachment of the RNA tail was performed through ligation.

[0321] [GGUACCCGGGCGAAUUCCAAGCUUGAUCGC]

[0322] We designed an RNA oligomer having the sequence and phosphate groups attached to both the 5' and 3' ends. Afterwards, pre-adenylated App-RNA oligomers were produced using Mth RNA ligase (NEB), and RNA tailing was performed through ligation to the 3' end of oligomer condensates of various lengths in the same process as described above. As a result of the experiment, it was confirmed that the oligomer condensates of various lengths increased by 30 nucleotides, and therefore, it was determined that the attachment of RNA tails through heteropolynucleotide ligation was successfully achieved (Fig. 7d).

[0323] The recovery of RNA tails through ligation was performed through PAGE, and the band of the oligomer condensate with increased length was selectively cut and eluted for recovery. The yield was approximately 10%, which was lower than the yield of approximately 30% for the poly(A) tailing method of Example 2-3. However, this experiment confirmed that it was possible to attach RNA tails in the form of heteropolynucleotides. After tailing, the 3' phosphate group was removed through PNK treatment to change it to a 3' hydroxyl group form, and the tail was completed in a form that could be used in the subsequent sequencing preparation process.

[0324]

[0325] Example 3. Sequencing using a modified RNA library

[0326] As a first example of the present invention, m among the modified RNAs 6Various combinations of RNA blocks were designed by randomly combining 12 random nucleotides (A, G, C, U) in both directions around A and its corresponding general base, A, and various combinations of RNA oligomers were designed so that the various combinations of RNA blocks were randomly arranged twice consecutively. In this experiment, 5'-CGAC and 3'-AGUC were additionally introduced to the 5' end and 3' end of each RNA oligomer, respectively, to design RNA oligomers with a total of 58 nucleotides, and the RNA oligomers were produced by a chemical synthesis method.

[0327] General A oligomer and m 6 Each oligomer was ligated using T4 RNA ligase 1 (NEB) enzyme. In this case, the ligation reaction was performed by changing the following conditions from the manufacturer's (NEB) instructions: 16 hours of reaction at 33°C in a reaction solution containing 15% PEG8000 and 10% DMSO.

[0328] RNA oligomer condensates with a length of 232 nucleotides or more, in which four or more of the above RNA oligomers were ligated, were selectively recovered from the gel via PAGE. Subsequently, poly(A) tailing was performed using a poly(A) tailing kit (Invitrogen). In this case, the reaction was performed under the following conditions modified from the manufacturer's (Invitrogen) instructions: 10 μM ATP, 3.2 U E-PAP added, reaction at 37°C for 45 minutes.

[0329] Afterwards, only linear RNA with a poly(A) tail of approximately 30 nucleotides was selectively obtained using Dynabeads oligo(dT) (Invitrogen).

[0330] m production completed 6Sequencing was performed using the A library and the general A library. Nanopore sequencing was selected among single-molecule RNA sequencing methods. Sequencing was performed according to the manufacturer's instructions (Oxford Nanopore). m 6 For the A library, 1.32 million reads were obtained from a single sequencing run, yielding a total of 0.59 Gb of sequencing data. For the general A library, 2.00 million reads were obtained, yielding a total of 0.98 Gb of sequencing data (Fig. 8a).

[0331] As a second example of the present invention, m among the modified RNAs 5 We designed various combinations of RNA blocks in which five random nucleotides (A, G, C, U) were randomly combined in both directions around C and its corresponding general base C, and designed various combinations of RNA oligomers so that the RNA blocks of the various combinations were randomly arranged five times consecutively. RNA oligomers of a total of 59 nucleotides were produced by chemical synthesis by additionally introducing 5'-GG and 3'-GG at the 5' and 3' ends of each RNA oligomer. Experiments were performed under the same conditions described above using the RNA oligomers, and through this, m 5 We created a C library and a general C library.

[0332] Sequencing was performed using the two libraries, and nanopore sequencing was selected and performed according to the manufacturer's instructions. m 5 For the C library, 1.30 million reads were obtained from a single sequencing run, yielding a total of 0.59 Gb of sequencing data. For the general C library, 2.15 million reads were obtained, yielding a total of 0.93 Gb of sequencing data (Fig. 8b).

[0333]

[0334] Example 4. Utilization of sequencing data sets as learning data.

[0335] The modified RNA library designed according to the present invention has the characteristic of containing a variety of modified RNAs and a wide range of surrounding sequences. Therefore, the sequencing data (e.g., single-molecule RNA sequencing data) of this library was intended to be utilized as training data for an RNA modification prediction model.

[0336] Motifs (RNA blocks consisting of modified RNA or a normal base and its surrounding sequence) were extracted from sequencing reads obtained from each modified RNA and normal base library. This process was performed using a motif extraction algorithm using a Directed Acyclic Graph (DAG). The algorithm consists of the following steps.

[0337] (1) k-mer indexing and matching

[0338] First, k-mers (sequences of length k, where k is the length of a specific nucleotide at the end of the oligomer) are indexed from the sequenced reads. During this process, sequence modifications, deletions, and insertions are allowed, but penalties are imposed for each case. The summed penalty for each k-mer is called the specific-sequence penalty. Then, the indexed k-mers are matched against each specific sequence.

[0339] (2) DAG composition

[0340] A DAG is constructed where nodes represent specific sequences and edges represent valid transitions between specific sequences. The validity of each transition is determined by whether the actual transition interval matches, within a certain margin of error, the closest transition interval among several transition intervals expected from the specified sequence and motif length. The penalty calculated from the difference between the actual and expected transition intervals is called the transition penalty.

[0341] (3) Apply edge weight

[0342] (2) A weight is calculated and applied to each edge of the DAG created in (1). The weight is calculated by adding the specific-sequence penalty calculated in (1), the transition penalty calculated in (2), and the central base penalty. The central base penalty is the minimum number of deletions and insertions required to find the designated central base (one of A, C, G, or U) in the center of the motif.

[0343] (4) Finding the longest path

[0344] (3) Find the longest path in the weighted DAG created. The path length is defined as the sum of the weights of each edge. Finding the longest path is accomplished through topology sorting and dynamic programming. After finding the longest path, motifs are extracted from leads along the path and stored.

[0345]

[0346] Using the above algorithm, general A and m of Example 3 6 After extracting motifs from the sequencing reads of Library A, we verified whether the motifs were included. We confirmed that there was sufficient sequencing depth for combinations of 5-mer motifs (256 cases), 7-mer motifs (1,024 cases), and 9-mer motifs (65,536 cases). We confirmed that the sequencing data of both libraries showed at least 10x depth for all motifs.

[0347] To utilize the above data, which includes a wide range of motifs, as training data for an RNA modification prediction model, we sought to determine the influence of the location of the modified RNA on the motif. Compared to normal RNA, the base quality of the modified RNA was found to be lower, with a significant decrease around the modified RNA and a gradual decrease in the surrounding sequences (Fig. 9a). Furthermore, we confirmed that the current signals in normal RNA, modified RNA, and their surrounding sequences also showed different patterns (Fig. 9b). In particular, we confirmed that the current signal patterns showed different aspects depending on the surrounding motif, and we confirmed that each type of motif showed a unique pattern (Fig. 9c).

[0348] Through this analysis, it was confirmed that the library and sequencing data produced in the present invention can be utilized as learning data because they contain data having various motifs (surrounding sequences) and motif-specific patterns.

[0349]

[0350] Example 5. Improvement of RNA oligomer design through anchor sequence insertion.

[0351] To improve the design of modified RNA oligomers, we conducted experiments to increase the accuracy of motifs (modified RNA or general base and its surrounding sequence) that can be obtained from sequencing data of each RNA modification and general base library.

[0352] First, in order to evaluate the degree of improvement in the design of modified RNA oligomers when inserting anchor sequences, the motif extraction ability was compared through simulations assuming the case of RNA oligomers with different anchor sequence configurations (Fig. 10a).

[0353] As an example, using the sequencing data of the previous sample, we tested the case where a specific anchor sequence of 4 to 6 nucleotides was inserted between blocks.

[0354] The data used in this test is the sequencing data of IVT RNA with a length of 274 nucleotides, and the sequence is as follows.

[0355]

[0356] These data are sequencing data generated to simulate the case of a condensate of modified RNA oligomers containing three 21-nucleotide-long modified RNA blocks (i.e., three ligated modified RNA oligomers). Motif extraction was simulated using only specific sequence portions of these data. The specific sequence portions used for extraction under each condition are indicated in bold below.

[0357]

[0358] (Condition 1) When there is no anchor sequence between the modified RNA blocks (a specific sequence of 4 nucleotides was added to the 5' and 3' ends to match the same number of nucleotides as in (Condition 2))

[0359]

[0360] (Condition 2) When there is an anchor sequence of 4 nucleotides between the modified RNA blocks.

[0361]

[0362] (Condition 3) When there is an anchor sequence of 6 nucleotides between the modified RNA blocks.

[0363]

[0364] To calculate the motif selection accuracy for a total of three conditions, a precision-recall curve (PR curve) was derived using the following method. The sequencing data of the IVT RNA above was aligned to the IVT original reference sequence, and the motif extraction algorithm was run on the IVT sequencing data. The motif extraction results were compared with the alignment results, and whether the motif extraction results and the anchor coordinates in the alignment results matched for each anchor position was confirmed. Next, a precision-recall curve was derived by taking the extraction score of each anchor derived from the motif extraction algorithm as the predicted value and whether the alignment of the anchor coordinates was true as the true value.

[0365] From the precision-recall curves, we confirmed that motif extraction performance was superior in the order of Condition 3 > Condition 2 > Condition 1. For example, at the same recall of 0.2, Condition 1 showed a precision below 0.65, while Condition 3 showed a precision exceeding 0.90. From these results, we confirmed that inserting a 6-nucleotide anchor sequence in the middle of a block in sequencing data resulted in the greatest improvement in finding specific bases and motifs.

[0366] Next, we evaluated whether it was necessary to adjust the length of the anchor sequence according to the number of modified RNA blocks. Since motif extraction accuracy may decrease when the number of modified RNA blocks decreases below 2, we wanted to determine whether we could maintain a high motif accuracy by further increasing the length of the anchor sequence. As previously conducted, we compared the motif extraction capability through simulations assuming the case of RNA oligomers with different numbers of RNA blocks and anchor sequence lengths (Fig. 10b). As in the previous experiment, we assumed a case containing a modified RNA block with a length of 21 nucleotides, and confirmed the motif extraction performance according to the condition of decreasing the number of RNA blocks.

[0367] (Condition 1) When there are three modified RNA blocks and an anchor sequence of 6 nucleotides

[0368] (Condition 2) When there are two modified RNA blocks and an anchor sequence of 6 nucleotides

[0369] (Condition 3) When there are two modified RNA blocks and an anchor sequence of 8 nucleotides

[0370] (Condition 4) When there is one modified RNA block and an anchor sequence of 12 nucleotides

[0371] (Condition 5) When there is one modified RNA block and an anchor sequence of 15 nucleotides

[0372] As a result of calculating the precision-recall curve for a total of five conditions, it was confirmed that when the number of RNA blocks actually decreased, the motif extraction performance decreased significantly when anchor sequences of the same length were used (Condition 1 > Condition 2), and that the performance increased when the anchor sequence length was increased (Condition 2 > Condition 3, Condition 4 > Condition 5). In addition, it was confirmed that the motif extraction performance could be maintained to some extent by increasing the length of the anchor sequence as the number of RNA blocks decreased (Condition 3 ≒ Condition 4). Finally, it was confirmed that the motif extraction accuracy could be maintained by increasing the length of the anchor sequence by about three times even when the number of RNA blocks was reduced to 1 / 3 (Condition 1 ≒ Condition 5).

[0373] Therefore, it is desirable that the anchor length be 20 to 30% of the length of the modified RNA block, but when the number of RNA blocks is 2 or less, it was confirmed that the motif extraction accuracy can be maintained by increasing the length of the anchor sequence inversely proportional to the number of RNA blocks.

[0374] Next, the sequence composition of the anchors was selected by considering the following factors.

[0375] (1) The Levenshtein distance between each anchor must be at least 50% of the anchor length.

[0376] (2) When all anchors are combined, the ratio of each nucleotide must be equal, and the ratio of nucleotides within each anchor must also be equal. An equal ratio means a ratio obtained by dividing the length of each anchor into four integer ratios closest to 1:1:1:1.

[0377] (3) The average alignment error occurring during nanopore sequencing of all 5-mers constituting each anchor must be less than or equal to the 10th percentile.

[0378] (4) When partially random oligomers are created using all anchors and sampled random blocks, the average minimum free energy (MFE) of these oligomers must be at least 90 percentile. This is to minimize the formation of RNA secondary structures.

[0379] (5) When partially random oligomers are formed as in (4), the average value of the minimum dimer free energy (dimer MFE) occurring in all possible pairs must be above the 90th percentile. This is to minimize RNA dimer formation.

[0380] (6) When all subsequences with 50% of the anchor length are extracted from all anchors, there should be no pairs that are reverse complementary among all possible pairs created from them. This is to minimize RNA duplex formation.

[0381] The following set of examples of anchor sequences of 6 nucleotides in length that satisfy the above conditions was derived.

[0382]

[0383] Using the derived anchor sequence, an anchor sequence with a specific sequence was inserted between the modified RNA blocks in the modified RNA oligomer design of Example 1 (Fig. 10c). Using the design with the anchor sequence inserted, it was confirmed that the motif extraction accuracy increased from 66.5% to 99.7%.

[0384]

[0385] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

[0386]

[0387] [National Research and Development Project Supporting This Invention]

[0388] [Project ID] 1711186079

[0389] [Assignment Number] 2020R1A2C3007032

[0390] [Ministry Name] Ministry of Science and ICT

[0391] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0392] [Research Project Name] Individual Basic Research (Ministry of Science and ICT) - Mid-career Research Project

[0393] [Research Project Title] Discovery of a New Type of Cancer-Caused Noncoding Mutation by Identification of the Regulatory Mechanism of MicroRNA Targeting by RNA-Binding Proteins

[0394] [Name of Project Performing Organization] Seoul National University

[0395] Research Period: June 1, 2020 - February 28, 2025

[0396] [National Research and Development Project Supporting This Invention]

[0397] [Project ID] 1711200977

[0398] [Assignment Number] 2022M3A9I2082294

[0399] [Ministry Name] Ministry of Science and ICT

[0400] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0401] [Research Project Name] Biomedical Technology Development Project

[0402] [Research Project Name] (Joint 3) Establishment of a model to predict the occurrence of COVID-19 virus variants and

[0403] Development of a preventive platform technology based on integrated mechanism analysis

[0404] [Name of Project Performing Organization] Seoul National University

[0405] Research Period: April 1, 2022 - December 31, 2026

[0406] [National Research and Development Project Supporting This Invention]

[0407] [Project ID] 1711200846

[0408] [Assignment Number] 2019M3E5D3073104

[0409] [Ministry Name] Ministry of Science and ICT

[0410] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0411] [Research Project Name] Omics-Based Precision Medical Technology Development Project - Biomedical Technology Development Project

[0412] [Research Project Name] Development of an Exosome Multi-Omics Analysis Platform for Precision Medicine for Diabetic Complications

[0413] [Name of Project Performing Organization] Seoul National University

[0414] Research Period: July 1, 2019 - December 31, 2024

[0415] [National Research and Development Project Supporting This Invention]

[0416] [Project ID] 1711188895

[0417] [Assignment Number] 2020R1A5A1018081

[0418] [Ministry Name] Ministry of Science and ICT

[0419] [Name of Project Management (Specialist) Institution] National Research Foundation of Korea

[0420] [Research Project Name] Group Research Support

[0421] [Research Project Name] Systems Aging Mechanism Research Center

[0422] [Name of Project Performing Organization] Seoul National University

[0423] Research Period: July 1, 2020 - February 28, 2027

Claims

1. Method for producing a modified RNA library comprising the following steps: (a) a step of producing one or more modified RNA blocks in which 4 to 50 random nucleotides are randomly linked to the 5' and 3' directions of the modified RNA, respectively; (b) a step of producing a modified RNA oligomer such that 1 to 9 modified RNA blocks are randomly arranged among the one or more modified RNA blocks; (c) a step of ligating the modified RNA oligomer to produce a modified RNA oligomer condensate; (d) a step of selecting a modified RNA oligomer condensate in which 2 to 20 of the modified RNA oligomers are ligated; (e) attaching an RNA tail consisting of 5 to 150 random ribonucleotides to the selected modified RNA oligomer condensate; and (f) A step of recovering a modified RNA oligomer condensate having the above RNA tail attached.

2. In the first paragraph, the modified RNA is (1) Modification A of [Table 1] below: [Table 1] (2) Modification C of [Table 2] below: [Table 2] (3) Modification G of [Table 3] below: [Table 3] and (4) Modification U of [Table 4] below: [Table 4] A method for producing a modified RNA library, wherein the modified RNA is one selected from a group consisting of:

3. In paragraph 1, step (b) (i) between each modified RNA block constituting the modified RNA oligomer; (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or (iii) A method for producing a modified RNA library, comprising producing a modified RNA oligomer that additionally includes an anchor sequence at the 3' end of a modified RNA block located at the 3' end among the modified RNA blocks constituting the modified RNA oligomer.

4. A method for producing a modified RNA library, wherein in the third paragraph, the anchor sequence has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 20 to 30% of the length of the modified RNA block.

5. A method for producing a modified RNA library in the first paragraph, wherein step (c) comprises ligating with RNA ligase.

6. In the first paragraph, the step (b) is a method for producing a modified RNA library by additionally introducing 2 to 4 specific nucleotide combinations to the 5' end and 3' end of the modified RNA oligomer, respectively.

7. In the 6th paragraph, the RNA ligase is T4 RNA ligase 1, the two specified nucleotide combinations are any one of the combinations listed in Table 5 below, the three specified nucleotide combinations are any one of the combinations listed in Table 6 below, and the four specified nucleotide combinations are any one of the combinations listed in Table 7 below, or [Table 5] [Table 6] [Table 7] A method for producing a modified RNA library, wherein the RNA ligase is T4 RNA ligase 2 truncated KQ, the two specified nucleotide combinations are any one of the combinations listed in Table 8 below, the three specified nucleotide combinations are any one of the combinations listed in Table 9 below, and the four specified nucleotide combinations are any one of the combinations listed in Table 10 below: [Table 8] [Table 9] [Table 10] 8. A method for producing a modified RNA library in the first paragraph, wherein steps (a) and (b) are produced by a chemical or template-independent enzymatic synthesis method, and step (b) is produced as a separate process after step (a), or steps (a) and (b) are produced as a single process.

9. A method for producing a modified RNA library, wherein in the first paragraph, step (c) is performed by ligating at 29°C to 37°C for 8 to 40 hours.

10. A method for producing a modified RNA library, wherein step (c) comprises ligating in a reaction solution containing 13 to 21% (v / v) of PEG8000 in the first paragraph.

11. A method for producing a modified RNA library, characterized in that in the first paragraph, the RNA tail of step (e) is a poly(A) tail, poly(U) tail or poly(I) tail composed of 5 to 40 ribonucleotides.

12. A method for producing a modified RNA library, characterized in that in the 11th paragraph, the poly(A) tail, poly(U) tail or poly(I) tail of the step (e) is reacted in a reaction solution containing 5 to 50 uM of ATP, UTP or ITP, respectively.

13. A library of modified RNAs comprising a plurality of modified RNA oligomer condensates in the form of 2 to 20 ligated modified RNA oligomers, The above modified RNA oligomer is a modified RNA library characterized in that 1 to 9 modified RNA blocks are randomly arranged in a continuous manner, each having 4 to 50 random nucleotides randomly linked in the 5' and 3' directions centered on the modified RNA.

14. In the 13th paragraph, the modified RNA is (1) Modification A of [Table 1] below: [Table 1] (2) Modification C of [Table 2] below: [Table 2] (3) Modification G of [Table 3] below: [Table 3] and (4) Modification U of [Table 4] below: [Table 4] A library of modified RNAs, wherein any one modified RNA is selected from the group consisting of:

15. In the 13th paragraph, the modified RNA oligomer, (i) between each modified RNA block constituting the modified RNA oligomer; (ii) the 5' end of a modified RNA block located at the 5' end of the modified RNA block constituting the modified RNA oligomer, and / or (iii) A modified RNA library characterized in that it additionally includes an anchor sequence at the 3' end of a modified RNA block located at the 3' end among the modified RNA blocks constituting the modified RNA oligomer.

16. A modified RNA library according to claim 15, wherein the anchor sequence has a sequence of 4 nucleotides or more, and when there are 2 or fewer modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 40 to 90% of the length of the modified RNA block, and when there are 3 to 9 modified RNA blocks in the modified RNA oligomer, the anchor sequence has a length of 20 to 30% of the length of the modified RNA block.

17. A modified RNA library according to claim 13, wherein 2 to 4 specific nucleotide combinations are additionally introduced to the 5' end and the 3' end of the modified RNA oligomer, respectively.

18. A modified RNA library in accordance with claim 13, wherein the modified RNA oligomer condensate further has an RNA tail composed of 5 to 150 random ribonucleotides attached to the 3' end.

19. A modified RNA library according to any one of claims 13 to 18; and A set of RNA libraries for training an RNA modification detection model, comprising a general RNA library comprising a plurality of general RNA oligomer condensates having the same structure as a plurality of modified RNA oligomer condensates included in the modified RNA library, except that the modified RNA is replaced with a corresponding general RNA.

20. A sequencing data set generated using a set of RNA libraries for training the RNA modification detection model of Article 19.

21. A sequencing data set according to claim 20, wherein the sequencing is single molecule RNA sequencing.

22. In the 20th paragraph, the sequencing data set is a sequencing data set for deep learning and / or machine learning.

Images