Gene therapy for treatment of retinal degeneration
By reducing PRLΔE1 expression in the eye using targeted nucleic acid molecules and AAV vectors, this method addresses the challenges of treating retinal degeneration with existing gene-specific therapies, achieving effective photoreceptor survival and treatment of multiple retinal degeneration forms.
Patent Information
- Application Number
- PCT/US2024/052518
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-10-23
- Filing Date
- 2024-10-23
- Publication Date
- 2025-06-12
AI Technical Summary
Current treatments for retinal degeneration, such as inherited retinal degeneration (RD), are limited by the need for gene-specific therapies due to mutational heterogeneity and low prevalence of these orphan diseases, making them impractical and cost-prohibitive.
A method of treating retinal degeneration by reducing PRLΔE1 expression or activity in the eye, using nucleotide sequences that encode nucleic acid molecules such as siRNA, miRNA, shRNA, ASO, or guide RNA, which target specific sequences of human or canine PRLΔE1, administered via subretinal or intravitreal injection using AAV vectors.
The approach effectively prolongs photoreceptor survival and treats multiple forms of retinal degeneration by targeting common biological pathways, rather than individual genes, thereby overcoming the limitations of current gene-specific therapies.
Smart Images

Figure US2024052518_12062025_PF_FP_ABST
Abstract
Description
[0001]GENE THERAPY FOR TREATMENT OF RETINAL DEGENERATION REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The electronic sequence listing filed herewith named “24-10520.xml” (35,246 bytes, created on October 18, 2024) is incorporated herein by reference in its entirety. BACKGROUND OF THE INVENTION There is currently no universal cure for retinal degenerations, inherited or age related. Inherited retinal degeneration (RD) has a complex genetic etiology and mutations in over 250 different genes. Most of these genes are expressed in the light-sensing photoreceptor cells (rods and cones) and a few others are expressed in retinal pigment epithelium cells. Retinitis pigmentosa (RP) is the most common form of inherited RD, with a worldwide prevalence of 1 in 4,000 individuals. Onset of RP is marked by night-blindness and peripheral vision loss, followed by a progressive shrinking of the visual field, loss of visual acuity, and eventual blindness. Current efforts have focused on gene-specific therapies, with one FDA approved gene therapy (voritegene-neparvovec or Luxturna for RPE65-LCA) on the market, and therapies targeting 10 other genes currently in clinical trials. However, due to the extreme mutational heterogeneity and low prevalence of these orphan diseases, developing individual gene therapies for each causative gene remains impractical and cost prohibitive. What is needed are therapies that target common biological pathways and biomolecules in order to prolong photoreceptor survival and treat multiple forms of RD. SUMMARY OF THE INVENTION In one aspect, provided herein is a method of treating retinal degeneration in a subject in need thereof, the method comprising reducing PRLΔE1 expression or activity in an eye of the subject. In certain embodiments, the method comprises administering a nucleotide sequence that encodes a nucleic acid molecule that targets a portion of PRLΔE1. In certain embodiments, the nucleic acid molecule is an siRNA, miRNA, shRNA, ASO, or guide RNA. In certain embodiments, the nucleic acid molecule is an siRNA that targets a sequence comprising nucleotides 277-302, 292-317, 267-317, 162-187, 622-647, 305-330, 320-345, 295-320, 188-231, 194-219, or 333-358 of human PRLΔE1. In certain embodiments, the nucleic acid molecule is an siRNA, miRNA, shRNA, ASO, or guide RNA that targets a sequence of canine PRLΔE1. In certain embodiments, the nucleic acid molecule that targets a sequence of canine PRLΔE1 comprises a sequence set forth in Table 1 or 2. In certain embodiments, the method further comprises administering a sequence that encodes a nuclease that targets a portion of PRLΔE1. In certain embodiments, the nuclease is a Cas enzyme. In certain embodiments, the nuclease is a Cas9 or Cas13 enzyme. In certain embodiments, the method comprises delivering a vector that encodes the nucleic acid molecule. In certain embodiments, the vector is an AAV vector. In certain embodiments, the method further comprises administering a vector that comprises a nucleotide sequence that encodes a functional ocular protein. In certain embodiments, the nucleotide sequences that encode the nucleic acid molecule and the functional ocular protein are comprised in the same vector. In certain embodiments, the nucleotide sequences that encode the nucleic acid molecule and the functional ocular protein are comprised in different vectors. In certain embodiments, the AAV vector has an AAV2, AAV5, AAV7m8, or AAV8 capsid. In certain embodiments, the subject has retinitis pigmentosa (autosomal dominant, autosomal recessive, X-linked), Leber's congenital amaurosis, cone or cone-rod dystrophy, Usher syndrome, macular degeneration, Stargardt's disease, age-related macular degeneration, trauma-induced retinal degeneration, or retinal detachment. In certain embodiments, a composition comprising the nucleotide sequence that encodes the nucleic acid molecule is administered to an eye of the subject. In certain embodiments, the composition is administered via subretinal injection or intravitreal injection. In another aspect, provided herein is a composition comprising a nucleotide sequence that encodes a nucleic acid molecule that targets a portion of PRLΔE1. In certain embodiments, the nucleic acid molecule is an siRNA, miRNA, shRNA, ASO, or guide RNA. In certain embodiments, the nucleic acid molecule is an siRNA that targets a sequence comprising nucleotides 277-302, 292-317, 267-317, 162-187, 622-647, 305-330, 320-345, 295-320, 188-231, 194-219, or 333-358 of human PRLΔE1. In certain embodiments, the composition comprises a nucleic acid molecule that is an siRNA, miRNA, shRNA, ASO, or guide RNA that targets a sequence of canine PRLΔE1. In certain embodiments, the nucleic acid molecule that targets a sequence of canine PRLΔE1 comprises a sequence set forth in Table 1 or 2. In certain embodiments, the composition further comprises a sequence that encodes a nuclease that targets a portion of PRLΔE1. In certain embodiments, the nuclease is a Cas enzyme. In certain embodiments, the nuclease is a Cas9 or Cas13 enzyme. In certain embodiments, the composition comprises a vector that encodes the nucleic acid molecule. In certain embodiments, the vector is an AAV vector. In certain embodiments, the vector further comprises a nucleic acid that encodes a functional ocular protein. In certain embodiments, the AAV vector has an AAV2, AAV5, AAV7m8, or AAV8 capsid. In certain embodiments, the composition further comprises one or more pharmaceutically acceptable carriers, adjuvants, excipients, or diluents. Other aspects and advantages of the invention will be readily apparent from the following detailed description of the invention. BRIEF DESCRIPTION OF THE DRAWINGS FIG.1A – FIG.1B show PRLΔE1 expression in two additional canine models of inherited retinopathies and specifically in rods. (FIG.1A) PRLΔE1 mRNA identified by RNA in situ hybridization (magenta punctate staining, see black arrows) in the PRs in RPGR- XLPRA1 (left) and NPHP5-LCA (middle), but not in CNGB3-ACHM3, a cone-specific disease (right). (FIG.1B) PRLΔE1 expression observed by RNA-ISH (white) only in the degenerating NPHP5-LCA ONL containing both rods and cones and not in the adjacent cone-only ONL. Rhodopsin (RHO) staining for rods in green, Arrestin-3 (ARR3) staining for cones in red. Each panel represents observations from a single dog for the specified genotype. ONL: Outer nuclear layer; INL: Inner nuclear layer; GCL: Ganglion cell layer. FIG.2 shows PRLΔE1 expression overlaps with areas of PR degeneration in carriers of RPGR mutations. Retinal cellular layers identified by Hoechst staining of nuclei. Patchy areas of degeneration (white dashed boxes) resulting from random X-inactivation identified by rhodopsin mislocalization to PR cell bodies in RPGR-XLPRA1 carriers (age: 24 weeks) and RPGR-XLPRA2 (age: 24 weeks) carrier female dogs. PRLΔE1 transcript identified by RNA-ISH. Merged image show rhodopsin immunostaining in green and PRLΔE1 in magenta. Retinas from one RPGR-XPRA1 carrier dog and two RPGR-XLPRA2 carrier dogs were examined. ONL: Outer nuclear layer; INL: Inner nuclear layer; GCL: Ganglion cell layer. FIG.3 shows PRLΔE1 expression is not associated with acute PR cell death in RHO- T4R ADRP but correlates with protracted rod degeneration. PRLΔE1 expression is absent in acute light-induced RD in RHO-T4R retinas 24 hours and 2 weeks after light-induced damage but is observed in the more slowly degenerating PDE6β-RCD1 retina (age: 14 weeks). Retinal nuclear layers identified by Hoechst staining, TUNEL staining, PRL-ISH. Merged images show nuclei in blue, TUNEL staining in green and PRLΔE1 in white. Retinas from one RHO-T4R dog for each time point and one PDE6β-RCD1 dog were examined. ONL: Outer nuclear layer; INL: Inner nuclear layer; GCL: Ganglion cell layer. FIG.4A – FIG.4C show specific corrective gene augmentation therapy is associated with suppression of PRLΔE1 expression in treated areas. (FIG.4A) PRLΔE1 RNA-ISH in a RPGR-XLPRA1 dog (treated at 28 weeks of age, assessed 49 weeks post-treatment) shows PRLΔE1 expression in the untreated retina but the transcript is not expressed in AAV-RPGR treated area. PRLΔE1 RNA-ISH in a RPGR-XLPRA2 (treated at 5 weeks of age, assessed 33 weeks post-treatment) dogs shows PRLΔE1 expression in the untreated retina but none in the AAV-RPGR treated area. Transition zone presents a clear demarcation in PRLΔE1 expression between treated and untreated regions. PRLΔE1 RNA-ISH: White punctate staining; RPGR immunostaining in green. (FIG.4B) PRLΔE1 RNA-ISH in a NPHP5-LCA dog (treated at 6 weeks of age, assessed 27 weeks post-treatment) shows abundant PRLΔE1 in the ONL of the untreated area but markedly reduced levels in the AAV-NPHP5 treated region. PRLΔE1 and NPHP5 RNA-ISH in pink (Fast Red) and green (HRP-Green) staining, respectively in panels and observed by brightfield microscopy. Only Fast Red dye, and thus PRLΔE1 RNA-ISH, staining is observed by fluorescence microscopy in the same regions as panel C. (FIG.4C) Schematic representation of the en face fundus image of the retina, dotted line corresponds to the area of treatment (bleb) injected with a corrective gene therapy AAV vector. A single retina for each specified genotype was examined. ONL: Outer nuclear layer; INL: Inner nuclear layer. FIG.5 shows in vivo assessment of ONL thickness after treatment with shRNAPRLΔE1in PDE6β-RCD1 and RPGR-XLPRA2 retinas. Topographical pseudocolor maps (left) and reconstituted horizontal b-scans spanning through (red arrow) the treated (Tx) and untreated (Un-Tx) retinal areas (right) of a normal untreated retina, two RPGR-XLPRA2 treated retinas, and a PDE6β-RCD1 treated retina. Dashed lines on maps (left) encircle the area of the subretinal bleb, dashed vertical lines on b-scans (right) demarcate the transition between Tx and Un-Tx. ONL layer thickness on b-scans is highlighted in blue. Calibration bars and pseudocolor scale shown are applicable to all. FIG.6A – FIG.6E show assessment of AAV2 / 5- shRNAPRLΔE1-mediated PRLΔE1 knockdown and effect on photoreceptors. (FIG.6A) Percentage of PRLΔE1 remaining as quantified by qPCR in RPGR-XLPRA2 retinas 5 weeks and 11 weeks post injection (PI). (FIG.6B) Schematic representation of RPGR-XLPRA2 retinas with treated area demarcated by dotted lines and 3 mm retinal punches used for qPCR analysis shown with green (treated area) or red (untreated area) circles. (FIG.6C) Representative RNA-ISH (magenta dots, arrows) image showing PRLΔE1 expression in ONL of untreated and shRNAPRLΔE1-treated retinal areas in PDE6β-RCD1. (FIG.6D) Immunohistochemical staining for rods (Rhodopsin, RHO, green) and cones (Arrestin-3, ARR3, red) with PRLΔE1-ISH (white) in untreated and treated regions of a RPGR-XLPRA2 retina 5-weeks PI. (FIG.6E) Immunohistochemical staining for rods (Rhodopsin, RHO, green) and cones (Arrestin-3, ARR3, red) with PRLΔE1-ISH (white) in untreated and, treated regions of a PDE6β-RCD1 retina 9 weeks PI. Note: Only PRL and ARR3 are shown in and to emphasize the loss of cones in the retina following the shRNA treatment. Data presented is from one PDE6β-RCD1 and 2 RPGR-XLPRA2 dogs treated with shRNAPRLΔE1. ONL: Outer nuclear layer; INL: Inner nuclear layer; GCL: Ganglion cell layer. FIG.7A – FIG.7B show effects of subretinal injection of AAV2 / 5-shRNAPRLΔE1 in normal dog retina. (FIG.7A) cSLO en face image and OCT b-scan of the retina showing the treated (Tx) and the untreated (UnTx) areas. (FIG.7B) Immunohistochemical staining of rods (RHO, green) and cones (ARR3, red) in untreated and treated retinal areas 8 weeks post injection. Mislocalization of rhodopsin (RHO) protein to the cell bodies and loss of cone specific Arrestin-3 (ARR3) staining is observed in the treated retina. OS outer segment layer, IS inner segment layer, ONL outer nuclear layer, INL inner nuclear layer. FIG.8A – FIG.8B show induction of PRLΔE1 expression in NPHP5-LCA and RPGR-XLPRA1 retinas with disease progression. Photomicrographs of H&E stained retinal cryosection labeled with RNA-ISH to visualize PRLΔE1 expression in the NPHP5-LCA (FIG.8A) and RPGR-XLPRA1 (FIG.8B) dogs at various ages. One dog was used for each genotype and age. ONL: Outer nuclear layer; INL: Inner nuclear layer; GCL: Ganglion cell layer. FIG.9 shows rods but not cone PRs express PRLΔE1. Single cell RNAseq data showing RHO, OPN1 LW and PRLΔE1 expression in PDE6β-RCD1 and RPGR-XLPRA2 retinas. Representative data from two dogs for each genotype. FIG.10A – FIG.10B show expression of PRLΔE1 isoform is not observed in the rapidly degenerating RHO-T4R retinas post light exposure (LE). (FIG.10A) Photomicrographs of H&E stained retinal cryosections labeled with RNA-ISH to visualize PRLΔE1 expression at 24 hours (FIG.10A) and 2 weeks (FIG.10B) post light exposure (LE) to 3 different intensities. Photomicrographs of retinal cryosections co-labeled with TUNEL (green) and RNA-ISH for PRLΔE1 at 24 hours and 2 weeks post light exposure (LE) to 3 different intensities. Representative images from one dog assessed per time point and LE condition. FIG.11A – FIG.11B show identification of optimal shRNA for PRLΔE1 knockdown. (FIG.11A) PRLΔE1 sequence with the three shRNA target sequences highlighted. (FIG. 11B) qPCR analysis data comparing the percentage of transcript remaining in HEK293 cells co-transfected with pCMV-Tag5a PRLΔE1 and one of the three PRLΔE1-targeting shRNAs or a non-specific control shRNA (n = 3). shRNA2 was selected for in vivo silencing studies. FIG.12 shows knockdown of human PRLΔE1 (hPRLΔE1) using DsiRNAs in HEK293 cells. The bar graph illustrates the knockdown efficiencies of five different DsiRNAs tested on HEK293 cells exogenously expressing hPRLΔE1. Each bar represents the mean fold change in hPRLΔE1 expression (represented as percentage of hPRLαE1 remaining) relative to the control group, which consisted of cells expressing hPRLΔE1 without any DsiRNA treatment. DsiRNA-NS: Non-specific DsiRNA. FIG.13 shows a vector genome for delivery of an shRNA for PRLΔE1 knockdown. DETAILED DESCRIPTION OF THE INVENTION Provided herein are compositions and methods for silencing or reducing expression of the PRLΔE1 isoform of prolactin in the retina to promote photoreceptor survival. The compositions and methods are useful for treatment of a wide of range ocular conditions, including, for example, inherited retinal degenerations (RD) and age-related macular degeneration (AMD). In certain embodiments, the compositions and methods are combined with gene replacement or gene augmentation therapies for treatment of an ocular disease. Prolactin (PRL) is a pleiotropic hormone that contributes to multiple physiologic and homeostatic functions in the body including maturation of mammary glands and initiation of lactation, metabolic regulation, angiogenesis, immunomodulation, neuroprotection and neurogenesis(1-6). Full-length PRL activates the JAK / STAT pathway through its transmembrane receptor PRL-R, which is expressed on multiple cell-types(7). PRL plays a protective role in light-induced retinal degeneration and in diabetic retinopathy(3, 8-12). Its anti-apoptotic and antioxidant effects promote survival of both the photoreceptors (PR) and the retinal pigment epithelium (RPE)(10, 13, 14). PRL modulates neurotrophin signaling from glial cells to protect PRs from light-induced damage in the rodent retina(10). Clinically, elevated circulating levels of PRL have been associated with a reduced risk of proliferative diabetic retinopathy in diabetic patients, largely due to the antiangiogenic properties of vasoinhibins, a family of bioactive peptides generated from the N-terminus of PRL by proteolytic cleavage. These peptides are currently being investigated as a therapeutic target to regulate ocular angiogenesis and prevent disease progression in diabetic retinopathy and diabetic macular edema(9, 15-18). Although mainly synthesized by lactotrophic cells of the anterior pituitary gland, PRL is also expressed in other tissues(19, 20), including normal retinas from rats, green monkeys, and baboons(15, 21, 22). Notably, we previously identified PRLΔE1, a novel isoform of PRL that lacks the first exon, expressed in the retinas of two non-allelic, naturally occurring canine models of early-onset inherited retinal degeneration (IRD), PDE6β-RCD1 and RPGR- XLPRA2(23). In these two models, a large number of PRs die acutely between 5 and 7 weeks of age, marking the early phase of disease(24, 25). Immediately after this burst of cell death, PRLΔE1 expression is induced in the remaining rods and increases through the protracted phase of disease / degeneration, even as the rate of cell death declines(23). Expression of PRLΔE1 is not observed in healthy young or adult dog retinas. However, this PRL isoform is found in the aged human retina(23). As described herein, PRLΔE1 expression correlates with protracted RD and not acute PR cell death. The present inventors have identified a function of PRLΔE1 in RD and demonstrated that PRLΔE1 is a therapeutic target for promoting PR cell survival. Provided herein are compositions and methods for delivering a nucleic acid construct that reduces or inhibits expression of PRLΔE1 in a target cell. As used herein “PRLΔE1” refers to an isoform of prolactin (PRL) that lacks the first exon and, unless specified, may refer to a gene of a variety of mammals including, but not limited to, humans, canines, non- human primates, and mice. As used herein, “disease”, “disorder”, and “condition” are used interchangeably, to indicate an abnormal state in a subject. The term “expression” is used herein in its broadest meaning and comprises the production of RNA, of protein, or of both RNA and protein. With respect to RNA, the term “expression” or “translation” relates in particular to the production of peptides or proteins. Expression may be transient or may be stable. “Patient” or “subject”, as used herein interchangeably, means a male or female mammalian animal, including a human, a veterinary or farm animal, a domestic animal or pet, and animals normally used for clinical research such as canines, non-human primates, and mice. In certain embodiments, the subject is a human patient. In certain embodiments, the subject, in a canine. In certain embodiments, the subject has or is suspected of having one or more conditions, diseases, or disorders of the eye. It is to be noted that the term “a” or “an” refers to one or more. As such, the terms “a” (or “an”), “one or more,” and “at least one” are used interchangeably herein. While various embodiments in the specification are presented using “comprising” language, under other circumstances, a related embodiment is also intended to be interpreted and described using “consisting of” or “consisting essentially of” language. The words “comprise”, “comprises”, and “comprising” are to be interpreted inclusively rather than exclusively. The words “consist”, “consisting”, and its variants, are to be interpreted exclusively, rather than inclusively. As used herein, the term “about” means a variability of 10 % from the reference given, unless otherwise specified. Nucleic Acids and Expression Cassettes As used herein, an “expression cassette” refers to a nucleic acid molecule which comprises a biologically useful nucleic acid sequence for reducing PRLΔE1 expression (e.g., encodes a sequence that silences a gene via RNA interference (i.e. a nucleic acid molecule) or sequence that encodes one or more elements of a gene editing system) and regulatory sequences operably linked thereto which direct or modulate transcription, translation, and / or expression of the nucleic acid sequence. Such an expression cassette may be administered to a subject for therapeutic purposes. Expression cassettes can also be used for generating a viral vector for therapeutic delivery of the nucleotide sequences described. In certain embodiments, the compositions provided reduce expression of PRLΔE1 by RNA interference. In certain embodiments, the nucleic acids provided include small interfering nucleic acids (e.g., RNAs) that target PRLΔE1 mRNA. In certain embodiments, small interfering RNAs that digest PRLΔE1 mRNA are provided for the purpose of reducing or depleting endogenously produced PRLΔE1. Interfering RNA includes, but is not limited to, RNA enzymes (ribozymes), small interfering RNA (siRNA), small hairpin RNA (shRNA), or artificial microRNAs (miRNA). In certain embodiments, the nucleic acids target a sequence comprising nucleotides 277-302, 292-317, 267-317, 162-187, 622-647, 305-330, 320-345, 295-320, 188-231, 194-219, or 333-358 of SEQ ID NO: 1. In certain embodiments, the nucleic acid targets a sequence of SEQ ID NO: 1, for example a sequence comprising a 10-20 nucleotide portion of SEQ ID NO: 1. In certain embodiments, the nucleic acid sequence that targets a sequence of SEQ ID NO: 1 comprises a sequence set forth below in Table 3 or 4. In certain embodiments, the nucleic acid targets a sequence of SEQ ID NO: 2, for example a sequence comprising a 10-20 nucleotide portion of SEQ ID NO: 2. In certain embodiments, the nucleic acid that targets a sequence of SEQ ID NO: 2 comprises a sequence set forth in Table 1 or Table 2 below. In certain embodiments, one or more of the interfering RNAs are encoded by a sequence delivered by an adeno-associated virus (AAV) vector. The sequence encodes a short hairpin RNAs (shRNAs) driven by a promoter (e.g., an RNA polymerase III promoter or other suitable constitutive or inducible promoter), an artificial microRNAs (miRNAs) driven by a promoter (e.g., using an RNA polymerase II promoter or other suitable constitutive or inducible promoter), or an siRNA driven by a promoter (e.g., an RNA polymerase III promoter or other suitable constitutive or inducible promoter). As used herein, an “Antisense Oligonucleotide” (ASO) refers to a chemically synthesized, single-stranded oligomeric compound, typically comprising deoxyribonucleotides (DNA), ribonucleotides (RNA), or analogs thereof, that is designed to hybridize in a sequence-specific manner to a target nucleic acid sequence, such as mRNA, pre-mRNA, or other RNA molecules, through complementary base pairing. The binding of the ASO to the target sequence interferes with the expression of a gene by blocking translation, splicing, or causing degradation of the target RNA, thereby modulating gene expression. ASOs are typically between 10 and 30 nucleotides, though other ranges may be specified. ASOs often include chemical modifications (e.g., phosphorothioate backbones, 2'- O-methyl modifications) to enhance stability, binding affinity, or cellular uptake. As used herein, “small Interfering RNA” (siRNA) refers to a double-stranded RNA molecule, typically 19 to 30 nucleotides in length, consisting of a guide strand and a passenger strand. The guide strand is complementary to a specific target RNA (RNA) sequence, which it directs for degradation or translational inhibition via the RNA-induced silencing complex (RISC). Upon binding to the target RNA, the siRNA induces gene silencing through sequence-specific cleavage or repression of translation, thereby downregulating the expression of the corresponding gene. The siRNA can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA can be chemically synthesized or recombinantly produced using methods known in the art, such as the Drosophila in vitro system described in U.S. published application 2002 / 0086356 of Tuschl et al., the entire disclosure of which is herein incorporated by reference. Preferably, the siRNA are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA / RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA from a plasmid include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly. The siRNA or ASO may be modified to provide enhanced delivery to the subject. Such modifications include, without limitation, PS-ASOs, ribose sugar modifications, nucleobase modifications, bridged nucleic acids, and alternative backbones. See, e.g., Gagliardi M, Ashizawa AT. The Challenges and Strategies of Antisense Oligonucleotide Drug Delivery. Biomedicines.2021 Apr 16;9(4):433. doi: 10.3390 / biomedicines9040433. PMID: 33923688; PMCID: PMC8072990. human PRLΔE1 (SEQ ID NO: 1) GGTCCCTCCTGCTGCTGCTGGTGTCAAACCTGCTCCTGTGCCAGAGCGTGGCCCC CTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTG TTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTCTCCTCAGAAATGTT CAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACCAAGGCCAT CAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCCCA ACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGG AATGAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCG GAGGCTATCCTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTA GAGGGCATGGAGCTGATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAG ATCTACCCTGTCTGGTCGGGACTTCCATCCCTGCAGATGGCTGATGAAGAGTCTC GCCTTTCTGCTTATTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAAAATC GACAATTATCTCAAGCTCCTGAAGTGCCGAATCATCCACAACAACAACTGCTAAG CCCACATCCATTTCATCTATTTCTGAGAAGGTCCTTAATGATCCGTTCCATTGCAA GCTTCTTTTAGTTGTATCTCTTTTGAATCCATGCTTGGGTGTAACAGGTCTCCTCTT AAAAAATAAAAACTGACTCCTTAGAGACATCAAAATCTAAAA canine PRLΔE1 (SEQ ID NO: 2) ATGTTCAACGAATTTGATAAAAGGTATGCCCAGGGCCGGGGGTTCATTACCAAG GCCATCAACAGCTGTCACACCTCCTCCCTCTCTACCCCTGAAGACAAGGAGCAAG CCCAACAGATCCACCATGAAGACCTTCTGAATCTGATACTGAGGGTGCTGCGCTC CTGGAATGACCCCCTGTATCATCTAGTCACAGAAGTGCGGGGGATGCAAGAAGC CCCAGATGCAATTCTATCCAGAGCCATAGAGATTGAAGAACAAAACAGAAGACT TCTAGAGGGTATGGAGAAGATAGTTGGCCAGGTTCATCCTGGAATCAGAGAAAA TGAGGTCTACTCTGTCTGGTCAGGACTTCCATCCCTGCAGATGGCGGATGAAGAC ACTCGCCTTTTTGCTTTTTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAA GATTGACAATTATCTCAAGCTCCTGAAGTGCCGAATCGTCTACGACAGCAACTGC TAAGCCCACATCCATTCTATCTATTTCTGGGAAGGTTCTTAATGATCCGTCCCATC GCAACCTTCTCTTAGCTTTATAGCTTTTTAATGCATGCTTGGGTGTAATGGGTCTC ATCTTAAAAAATAAAAACTGACTCCTTAGAGATGTCGAAACAGAAAAAAAAATC AAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Non-limiting examples of interfering RNAs are provided in the tables below. Table 2: shRNAs 5 Table 3: siRNA for targeting PRLΔE1 (human) Table 4: DsiRNAs targeting human PRLΔE1 Gene-Editing / Disruption of PRLΔE1 expression In certain embodiments, provided herein are expression cassettes that include a nucleic acid sequence encoding one or more elements of a gene editing system that targets and / or disrupts PRLΔE1 expression. As used herein, “gene editing system” refers to technologies or molecular machinery for modifying genetic material, typically with specificity for a particular gene or nucleic acid sequence (including, e.g., target sequences or motifs). Such gene editing systems are designed to modify a target site in the genome or introduce a mutation. As used herein, a “mutation” or “modification”, unless otherwise stated, can refer to any alteration of a genomic sequence, including but not limited to small nucleotide insertions or deletions (indels) or a larger deletion, insertion, or inversion. In certain embodiments, the introduction of a mutation or modification is referred to as “editing” or “gene editing”. Terms such as “target site” and “target sequence”, unless indicated otherwise, are used herein to refer to a sequence that is recognized by one or more elements of a gene- editing system. For example, a sgRNA includes a sequence that binds (i.e., is complementary to) a target site or target sequence in the genome. In certain embodiments, the gene editing system is a Clustered Regulatory Interspaced Short Palindromic Repeats (CRISPR) system that edits a PRLΔE1 sequence. In one embodiment, provided herein is a CRISPR / Cas dual vector system (see, e.g. WO 2016 / 176191, which is incorporated herein by reference). Alternatively, in certain embodiments, a suitable gene editing system includes a zinc-finger nuclease (ZFN) to induce DNA double-strand breaks, which may or may not be in conjunction with delivery of an exogenous DNA donor substrate (See, e.g., Ellis et al, Gene Therapy (epub January 2012) 20:35-42 which is incorporated herein by reference). In other embodiments, a suitable gene editing system includes a meganuclease (see, e.g., in US Patent 8,445,251; US 9,340,777; US 9,434,931; US 9,683,257, and WO 2018 / 195449, each of which is incorporated herein by reference) or transcription activator‐like (TAL) effector nucleases (TALENs). In certain embodiments, a suitable CRISPR gene editing system includes, at a minimum, a Cas9 enzyme and an sgRNA specific for a target site in a PRLΔE1 sequence. Accordingly, in one embodiment, the gene editing vector comprises a Cas9 gene as the editing enzyme and an sgRNA which is at least 20 nucleotides in length and specifically binds to a selected site in PRLΔE15 ' to a protospacer- adjacent motif (PAM) that is specifically recognized by the Cas9. In certain embodiments, the expression cassette or vector genome includes a nucleic acid sequence encoding the sgRNA molecule and a nucleic acid sequence encoding a Cas9 enzyme. In certain embodiments, the gene editing system also includes a donor or repair template. The expression cassette providing the donor template may be the same as the expression cassettes encoding the sgRNA and Cas9, or a different expression cassette. Thus, in certain embodiments, a dual-vector system (as described for example in WO 2016 / 176191) is provided, wherein the gene editing system includes an expression cassette comprising a Cas9 gene under control of regulatory sequences which direct its expression and a second expression cassette comprising a sgRNA and a donor template. “Cas9” (CRISPR associated protein 9) refers to family of RNA-guided DNA endonucleases which is characterized by two signature nuclease domains, RuvC (cleaves non-coding strand) and HNH (coding strand). Suitable bacterial sources of Cas9 include Staphylococcus aureus (SaCas9), Staphylococcus pyogenes (SpCas9), and Neisseria meningitides (KM Estelt et al, Nat Meth, 10:1116-21 (2013)). The wild-type coding sequences may be utilized in the constructs described herein. Alternatively, bacterial codons are optimized for expression in humans, e.g. using any of a variety of known human codon optimizing algorithms. Other endonucleases with similar properties may optionally be substituted. See, e.g., the public CRISPR database (db) accessible at crispr.u-psud.fr / crispr. CRISPR / Cas9 gene targeting requires a single guide RNA (sgRNA) that contains a targeting sequence (crRNA sequence) and a Cas9 nuclease-recruiting sequence (tracrRNA). The crRNA region is a 20-nucleotide sequence that is homologous to a target site and will direct Cas9 nuclease activity. Strategies for identifying suitable target sites in the genome while also eliminating off target effects are known to those of skill in the art (see, e.g., ChopChop available online at chopchop.cbu.uib.no / ). Provided in the table below are sequences for the design of sgRNA suitable for use in a SaCas9 / CRISPR gene editing system for targeting PRLΔE1, as described herein. In another embodiment, the CRISPR nuclease may be Cpf1 (CRISPR from Prevotella and Francisella). Cpf1's preferred PAM is 5 '-TTN; this contrasts with that of SpCas9 (5'- NGG) and SaCas9 (5 '-NNGRRT; N=any nucleotide; R=adenine or guanine) in both genomic location and GC-content. While at least 16 Cpf1 nucleases have been identified, two humanized nucleases (AsCpf1 and LbCpf1) are particularly useful. See, www.addgene.Org / 69982 / sequences / #depositor-full (AsCpf1 sequences; and www.addgene.Org / 69988 / sequences / #depositor-full (LbCpf1 sequences), which are incorporated herein by reference. Further, Cpfl1 does not require a tracrRNA; allowing use of shorter guide RNAs (about 42 nucleotides) as compared to Cas9. Plasmids may be obtained from Addgene, a public plasmid database. As described herein, a gene editing system is utilized to introduce a mutation in PRLΔE1 allele in target cell. In some embodiments, the target PRLΔE1 polynucleotide sequence is cleaved such that a double-strand break results. In some embodiments, the target polynucleotide sequence is cleaved such that a single-strand break results. In certain embodiments, the alteration is an insertion or deletion (indel), which can result in random insertion / deletion mutations at the site of junction as a result of non-homologous end joining. Indel mutations occurring within the coding region of a gene can result in frame-shift and a premature stop codon, and disrupt transcription. In certain embodiments, the gene editing system one or more elements of a RNA- targeting CRISPR system, such as a member of the Cas13 enzyme family and / or crRNA construct. The diverse Cas13 family contains at least four known subtypes, including Cas13a (formerly C2c2), Cas13b, Cas13c, and Cas13d. The Cas13 family is the only family of class 2 Cas enzymes known to exclusively target single-stranded RNA. Cas13 enzymes and systems are known in the art, see, e.g., US Patent No.10,362,616, Abudayyeh, et al, C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 353, aaf5573 (2016); S. Shmakov, et al, Discovery and functional characterization of diverse class 2 CRISPR-Cas systems. Mol. Cell 60, 385–397 (2015); S. Shmakov, et al, Diversity and evolution of class 2 CRISPR-Cas systems. Nat. Rev. Microbiol.15, 169–182 (2017). A. A. Smargon, et al, Cas13b is a type VI-B CRISPR-associated RNA-guided RNase differentially regulated by accessory proteins Csx27 and Csx28. Mol. Cell 65, 618–630.e7 (2017); J. S. Gootenberg, et al, Nucleic acid detection with CRISPR-Cas13a / C2c2. Science 356, 438–442 (2017); O. O. Abudayyeh, et al, RNA targeting with CRISPR-Cas13. Nature 550, 280–284 (2017). Each of these documents is incorporated herein. A Cas13 protein uses a short crRNA that interacts with the Cas13 molecule through a stem loop and facilitates target binding and cleavage through a series of conformational changes in the Cas13 molecule. In certain embodiments, the Cas13 protein is Cas13a, Cas13b, Cas13c, or Cas13d. In one embodiment, the Cas13 comprises one or more mutations the HEPN domain(s). The Cas13d protein is a Class 2, Type VI CRISPR effector guided by a crRNA. Two higher eukaryotes and prokaryotes nucleotide-binding (HEPN) domains have been found in the Cas13d, flanking a helical domain. See, for example, WO 2019 / 010384 Al, US 2019 / 0169595A1, Zhang C, et al. (2018). Structural Basis for the RNA-Guided Ribonuclease Activity of CRISPR-Cas13d. Cell 175, 212–223.e217, golden.com / wiki / CRISPR-Cas13d, and zlab.bio / cas13, which publication is incorporated herein by reference in its entirety. While the term Class 2, Type VI is a broader genus, of which Cas13d is exemplary, throughout the Specification, one of skill in the art would appreciate that the use of the terms “Cas13d” or “Cas13d and a variant thereof” also encompass other Class 2, Type VI proteins, and the terms can be interchangeable. Cas13d and a variant thereof includes, e.g., a wild type or naturally occurring Cas13d protein, an ortholog of a Cas13d, a functional variant thereof, or another modified variant as disclosed. Orthologs are genes in different species that evolved from a common ancestral gene by speciation. Normally, orthologs retain the same function in the course of evolution. In some embodiments, the Cas13d is selected from a RfxCas13d from Ruminococcus flavefaciens strain XPD3002, an AdmCas13d from Anaerobic digester metagenome 15706, EsCas13d from Eubacterium siraeum DSM15702, P1E0Cas13d from Gut metagenome assembly P1E0-k21, UrCas13d from Uncultured Ruminoccocus sp., RffCas13d from Ruminoccocus flavefaciens FD1, and RaCas13d from Ruminoccocus albus. In one embodiment, the Cas13d protein is a RfxCas13d or a variant thereof. The amino acid sequences of the Cas13d orthologs are publicly available. In one embodiment, the Cas13d has an amino acid sequence as provided by a Protein Data Bank (PDB) accession number 6OAW_B or 6OAW_A or 6E9F_A or 6E9E_A or 6IV9_A, or an amino acid sequence as provided by the UniProtKB identifier B0MS50 (B0MS50_9FIRM) or A0A1C5SD84 (A0A1C5SD84_9FIRM). Each of the sequences of these references is incorporated by reference herein in its entirety. The term “target RNA” refers to an RNA polynucleotide being or comprising the target sequence, including coding and non-coding transcripts. In other words, the target RNA may be an RNA polynucleotide or a part of a RNA polynucleotide to which a part of a clustered regularly interspaced short palindromic repeats (CRISPR) RNA (crRNA) is designed to have complementarity and to which the effector function mediated by the complex comprising CRISPR enzyme and a guide RNA (gRNA) is to be directed. In certain embodiments, a viral vector is used to deliver one more elements of a gene editing system. While the examples below describe use of AAV vectors and the following discussion focuses on AAV vectors, it will be understood that a different, partially or wholly integrating vector or virus may be used in the system in place of the gene editing vector and / or the vector carrying template. See, e.g., Jinek, M.; Chilynksi, K.; Fonfara, I.,; Hauer, M.,; Doudna, J.,; Charpentier, E., (August 17, 2012). “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity”. Science.337 (6069): 816–821. Bibcode:2012 Sci..337..816J. doi:10.1126 / science.1225829. PMID 22745249; US Patent 8,697,359; US 9,909,122, US 2017 / 0051312; US 2017 / 0137801; US 2017 / 0166893; US2017 / 0360048; US 2018 / 0002682, which are incorporated by reference in their entirety. In certain embodiments, a viral vector delivers one or more components of a genome editing system, such as CRISPR / Cas9 or CRISPR / Cas13. In another embodiment, a combination or dual AAV vector system is provided to deliver the components of the CRISPR system when co-administered to a subject (see, e.g. WO 2016 / 176191, which is incorporated by reference herein in its entirety). The vectors may be formulated together or separately and delivered essentially simultaneously, preferably by the same route. As used herein, the term “regulatory sequence”, or “expression control sequence” refers to nucleic acid sequences, such as initiator sequences, enhancer sequences, and promoter sequences, which induce, repress, or otherwise control the transcription of protein encoding nucleic acid sequences to which they are operably linked. As used herein, “operably linked” sequences include both expression control sequences that are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest. The regulatory control elements typically contain a promoter sequence as part of the expression control sequences. In certain embodiments, the promoter is a chicken beta actin promoter with CMV enhancer elements, e.g., the CB7 promoter. In certain embodiments, a cell-specific promoter for ocular cells is selected. For example, the promoter may be human G-protein-coupled receptor protein kinase 1 (GRK1) promoter (Genbank Accession number AY327580) (See also, Beltran et al, Gene Therapy 201017:1162-74, which is hereby incorporated by reference herein). In other embodiments, the promoter is human interphotoreceptor retinoid-binding protein proximal (IRBP) promoter. In certain embodiments, the promoter is rod opsin (mOps) promoter, or rhodopsin-mOP500 promoter. Other suitable promoters include, e.g., constitutive promoters, regulatable promoters [see, e.g., WO 2011 / 126808 and WO 2013 / 04943], or a promoter responsive to physiologic cues. The promoter can be selected from different sources, e.g., human cytomegalovirus (CMV) immediate-early enhancer / promoter, the SV40 early enhancer / promoter, the JC polymovirus promoter, myelin basic protein (MBP) or glial fibrillary acidic protein (GFAP) promoters, herpes simplex virus (HSV-1) latency associated promoter (LAP), rouse sarcoma virus (RSV) long terminal repeat (LTR) promoter, neuron-specific promoter (NSE), platelet derived growth factor (PDGF) promoter, melanin-concentrating hormone (MCH) promoter, CBA, matrix metalloprotein promoter (MPP), and the chicken beta-actin promoter. In addition to a promoter a vector may contain one or more other appropriate transcription initiation, termination, enhancer sequences, efficient RNA processing signals such as splicing and polyadenylation (poly A) signals; sequences that stabilize cytoplasmic mRNA for example WPRE; sequences that enhance translation efficiency (i.e., Kozak consensus sequence); sequences that enhance protein stability; and when desired, sequences that enhance secretion of the encoded product. An example of a suitable enhancer is the CMV enhancer. Other suitable enhancers include those that are appropriate for desired target tissue indications. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, the expression cassette contains two or more expression enhancers. These enhancers may be the same or may differ from one another. For example, an enhancer may include a CMV immediate early enhancer. This enhancer may be present in two copies which are located adjacent to one another. Alternatively, the dual copies of the enhancer may be separated by one or more sequences. In still another embodiment, the expression cassette further contains an intron, e.g., the chicken beta-actin intron. Other suitable introns include those known in the art, e.g., such as are described in WO 2011 / 126808. Examples of suitable poly A sequences include, e.g., rabbit beta globin, SV40, SV50, bovine growth hormone (bGH), human growth hormone, HSV TK, and synthetic poly As. Optionally, one or more sequences may be selected to stabilize mRNA. An example of such a sequence is a modified WPRE sequence, which may be engineered upstream of the poly A sequence and downstream of the coding sequence (see, e.g., MA Zanta-Boussif, et al, Gene Therapy (2009) 16: 605-619). As described herein, regulatory elements comprise but not limited to: promoter; enhancer; transcription factor; transcription terminator; efficient RNA processing signals such as splicing and polyadenylation signals (poly A); sequences that stabilize cytoplasmic mRNA, for example Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE); sequences that enhance translation efficiency (i.e., Kozak consensus sequence). In certain embodiments, a suitable promoter may include without limitation, an elongation factor 1 alpha (EF1 alpha) promoter (see, e.g., Kim DW et al, Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene.1990 Jul 16;91(2):217-23) or a CB6 promoter (see, e.g., Large-Scale Production of Adeno- Associated Viral Vector Serotype-9 Carrying the Human Survival Motor Neuron Gene, Mol Biotechnol.2016 Jan;58(1):30-6. doi: 10.1007 / s12033-015-9899-5). Other suitable promoters include CAG promoter, which comprises (C) the cytomegalovirus (CMV) early enhancer element, (A) the promoter, the first exon and the first intron of chicken beta-actin gene, and (G) the splice acceptor of the rabbit beta-globin gene. See, e.g., Alexopoulou, Annika N., et al. BMC cell biology 9.1 (2008): 2. Although less desired, other promoters, such as viral promoters, constitutive promoters, inducible promoters, regulatable promoters (see, e.g., WO 2011 / 126808 and WO 2013 / 04943), or a promoter responsive to physiologic cues may be used may be utilized in the vectors described herein. In certain embodiments, the expression cassette includes an U6 promoter. In another embodiment, the regulatory elements comprise an enhancer. In a further embodiment, the enhancer(s) is selected from one or more of an APB enhancer, an ABPS enhancer, an alpha mic / bik enhancer, a TTR enhancer, an en34 enhancer, an ApoE enhancer, a CMV enhancer, or an RSV enhancer. In yet another embodiment, the regulatory elements comprise an intron. In a further embodiment, the intron is selected from CBA, human beta globin, IVS2, SV40, bGH, alpha-globulin, beta-globulin, collagen, ovalbumin, or p53. In one embodiment, the regulatory elements comprise a polyA. In a further embodiment, the polyA is a synthetic polyA or from bovine growth hormone (bGH), human growth hormone (hGH), SV40, rabbit β-globin (RGB), or modified RGB (mRGB). In another embodiment, the regulatory elements may comprise a WPRE sequence. In yet another embodiment, the regulatory elements comprise a Kozak sequence. Expression cassettes can be delivered via any suitable delivery system. Suitable non- viral delivery systems are known in the art (see, e.g., Ramamoorth and Narvekar. J Clin Diagn Res.2015 Jan; 9(1):GE01-GE06, which is incorporated herein by reference) and can be readily selected by one of skill in the art and may include, e.g., naked DNA, naked RNA, dendrimers, PLGA, polymethacrylate, an inorganic particle, a lipid particle (e.g., a lipid nanoparticle or LNP), or a chitosan-based formulation. In certain embodiments, the vector is a non-viral plasmid that comprises an expression cassette described thereof, e.g., “naked DNA”, “naked plasmid DNA”, RNA, and mRNA; coupled with various compositions and nano particles, including, e.g., micelles, liposomes, cationic lipid - nucleic acid compositions, poly-glycan compositions and other polymers, lipid and / or cholesterol-based - nucleic acid conjugates, and other constructs such as are described herein. See, e.g., X. Su et al, Mol. Pharmaceutics, 2011, 8 (3), pp 774–787; web publication: March 21, 2011; WO2013 / 182683, WO 2010 / 053572 and WO 2012 / 170930, all of which are incorporated herein by reference. A “self-complementary nucleic acid” refers to a nucleic acid capable of hybridizing with itself (i.e., folding back upon itself) to form a single-stranded duplex structure, due to the complementarity (e.g., base-pairing) of the nucleotides within the nucleic acid strand. Self-complementary nucleic acids can form a variety of secondary structures, such as hairpin loops, loops, bulges, junctions and internal bulges. Certain self-complementary nucleic acids (e.g., miRNA or a-miRNA (artificial miRNA)) perform regulatory functions, such as gene silencing. The term “substantial homology” or “substantial similarity,” when referring to a nucleic acid, or fragment thereof, indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or an open reading frame thereof, or another suitable fragment which is at least 15 nucleotides in length. Examples of suitable fragments are described herein. The terms “sequence identity”, “percent sequence identity”, or “percent identical” in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over the full-length of the genome, the full-length of a gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides, is desired. However, identity among smaller fragments, e.g. of at least about nine nucleotides, usually at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, at least about 36 or more nucleotides, may also be desired. Similarly, “percent sequence identity” may be readily determined for amino acid sequences, over the full-length of a protein, or a fragment thereof. Suitably, a fragment is at least about 8 amino acids in length and may be up to about 700 amino acids. Examples of suitable fragments are described herein. The term “substantial homology” or “substantial similarity,” when referring to amino acids or fragments thereof, indicates that, when optimally aligned with appropriate amino acid insertions or deletions with another amino acid (or its complementary strand), there is amino acid sequence identity in at least about 95 to 99% of the aligned sequences. Preferably, the homology is over full-length sequence, or a protein thereof, e.g., a cap protein, a rep protein, or a fragment thereof which is at least 8 amino acids, or more desirably, at least 15 amino acids in length. Examples of suitable fragments are described herein. By the term “highly conserved” is meant at least 80% identity, preferably at least 90% identity, and more preferably, over 97% identity. Identity is readily determined by one of skill in the art by resort to algorithms and computer programs known by those of skill in the art. Generally, when referring to “identity”, “homology”, or “similarity” between two different adeno-associated viruses, “identity”, “homology” or “similarity” is determined in reference to “aligned” sequences. “Aligned” sequences or “alignments” refer to multiple nucleic acid sequences or protein (amino acids) sequences, often containing corrections for missing or additional bases or amino acids as compared to a reference sequence. In the examples, AAV alignments are performed using the published AAV9 sequences as a reference point. Alignments are performed using any of a variety of publicly or commercially available Multiple Sequence Alignment Programs. Examples of such programs include, “Clustal Omega”, “Clustal W”, “CAP Sequence Assembly”, “MAP”, and “MEME”, which are accessible through Web Servers on the internet. Other sources for such programs are known to those of skill in the art. Alternatively, Vector NTI utilities are also used. There are also a number of algorithms known in the art that can be used to measure nucleotide sequence identity, including those contained in the programs described above. As another example, polynucleotide sequences can be compared using Fasta™, a program in GCG Version 6.1. Fasta™ provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. For instance, percent sequence identity between nucleic acid sequences can be determined using Fasta™ with its default parameters (a word size of 6 and the NOPAM factor for the scoring matrix) as provided in GCG Version 6.1, herein incorporated by reference. Multiple sequence alignment programs are also available for amino acid sequences, e.g., the “Clustal Omega”, “Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, any of these programs are used at default settings, although one of skill in the art can alter these settings as needed. Alternatively, one of skill in the art can utilize another algorithm or computer program which provides at least the level of identity or alignment as that provided by the referenced algorithms and programs. See, e.g., J. D. Thomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999). It should be understood that the expression cassettes described herein are intended to be applied to the compositions and methods described across the Specification. Vectors In certain embodiments, one or more nucleic acid sequences provided herein are delivered to ocular cells by a vector or a viral vector, of which many are known and available in the art. In one embodiment, provided is a vector comprising an expression cassette as described herein. In one embodiment, the vector is a non-viral vector. In a further embodiment, the non-viral vector is a plasmid. In another embodiment, the vector is a viral vector. Viral vectors include any virus suitable for gene therapy, including but not limited to a bocavirus, adenovirus, adeno-associated virus (AAV), herpes virus, lentivirus, retrovirus, or parvovirus. However, for ease of understanding, the adeno-associated virus is referenced herein as an exemplary viral vector. A “vector” as used herein is a biological or chemical moiety comprising a nucleic acid sequence which can be introduced into an appropriate target cell for replication or expression of a nucleic acid sequence. Examples of a vector include but are not limited to a recombinant virus, a plasmid, Lipoplexes, a Polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate, a magnetic particle, or a nanoparticle. In one embodiment, a vector is a nucleic acid molecule having an exogenous or heterologous engineered nucleic acid encoding a functional gene product, which can then be introduced into an appropriate target cell. Such vectors preferably have one or more origins of replication, and one or more site into which the recombinant DNA can be inserted. Vectors often have means by which cells with vectors can be selected from those without, e.g., they encode drug resistance genes. Common vectors include plasmids, viral genomes, and “artificial chromosomes”. Conventional methods of generation, production, characterization, or quantification of the vectors are available to one of skill in the art. As used herein, a recombinant viral vector is any suitable viral vector which targets the desired cell(s). Thus, the recombinant viral vectors described herein preferably target one or more of the cells and tissues affected by an ocular condition, including rods and / or cones of the eye. The examples provide illustrative recombinant adeno-associated viruses (rAAV). However, other suitable viral vectors may include, e.g., a recombinant adenovirus, a recombinant parvovirus such a recombinant bocavirus, a hybrid AAV / bocavirus, a recombinant herpes simplex virus, a recombinant retrovirus, or a recombinant lentivirus. In preferred embodiments, these recombinant viruses are replication-defective. As used herein, the terms “recombinant AAV”, “rAAV”, and “AAV vector” used interchangeably, mean, without limitation, an AAV vector comprising a capsid protein and a vector genome packaged therein, wherein the vector genome comprises a nucleic acid heterologous to the AAV. In one embodiment, the capsid protein is a non-naturally occurring capsid. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV, non-contiguous portions of the same AAV, from a non-AAV viral source, or from a non-viral source. An artificial AAV may be, without limitation, a pseudotyped AAV, a chimeric AAV capsid, a recombinant AAV capsid, or a “humanized” AAV capsid. Pseudotyped vectors, wherein the capsid of one AAV is replaced with a heterologous capsid protein, are useful in the invention. In one embodiment, AAV2 / 5 and AAV2 / 8 are exemplary pseudotyped vectors. The selected genetic element may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Green and Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012). A “replication-defective” virus or viral vector refers to a synthetic or artificial viral particle in which an expression cassette containing a gene of interest is packaged in a viral capsid or envelope, where any viral genomic sequences also packaged within the viral capsid or envelope are replication-deficient; i.e., they cannot generate progeny virions but retain the ability to infect target cells. In one embodiment, the genome of the viral vector does not include genes encoding the enzymes required to replicate (the genome can be engineered to be “gutless” - containing only the gene of interest flanked by the signals required for amplification and packaging of the artificial genome), but these genes may be supplied during production. Therefore, it is deemed safe for use in gene therapy since replication and infection by progeny virions cannot occur except in the presence of the viral enzyme required for replication. Such replication-defective viruses may be adeno-associated viruses (AAV), adenoviruses, lentiviruses (integrating or non-integrating), or another suitable virus source. “Plasmid” or “plasmid vector” generally is designated herein by a lower-case p preceded and / or followed by a vector name. Plasmids, other cloning and expression vectors, properties thereof, and constructing / manipulating methods thereof that can be used in accordance with the present invention are readily apparent to those of skill in the art. In certain embodiments, the expression cassettes described herein are engineered into a suitable genetic element (a vector) useful for generating viral vectors and / or for delivery to a host cell, e.g., naked DNA, phage, transposon, cosmid, episome, etc., which transfers the sequences carried thereon. The selected vector may be delivered by any suitable method, including transfection, electroporation, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. The methods used to make such constructs are known to those with skill in nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. As used herein, the term “host cell” may refer to the packaging cell line in which a vector (e.g., a recombinant AAV) is produced from a production plasmid. In the alternative, the term “host cell” may refer to any target cell in which expression an expression cassette or a miRNA or modified snRNA described herein is desired. Thus, a “host cell,” refers to a prokaryotic or eukaryotic cell that contains exogenous or heterologous DNA that has been introduced into the cell by any means, e.g., electroporation, calcium phosphate precipitation, microinjection, transformation, viral infection, transfection, liposome delivery, membrane fusion techniques, high velocity DNA-coated pellets, viral infection and protoplast fusion. In certain embodiments herein, the term “host cell” refers to cultures of cells of various mammalian species for in vitro assessment of the compositions described herein. In other embodiments herein, the term “host cell” refers to the cells employed to generate and package the viral vector or recombinant virus. As used herein, a “vector genome” refers to the nucleic acid sequence packaged inside a viral vector. In one example, a vector genome contains, at a minimum, from 5’ to 3’, a vector-specific sequence, a nucleic acid sequence as provided herein for reducing PRLΔE1 expression in a target cell, where the vector-specific sequence may be a terminal repeat sequence that specifically packages the vector genome into a viral vector capsid or envelope protein. In certain embodiments, the vector genome contains, at a minimum, from 5’ to 3’, a 5’ AAV ITR sequence, an expression cassette, and a 3’ AAV inverted terminal repeat (ITR) sequence, including intervening sequences. In certain embodiments, For example, AAV inverted terminal repeats are utilized for packaging into AAV and certain other parvovirus capsids. Lentivirus long terminal repeats may be utilized where packaging into a lentiviral vector is desired. Similarly, other terminal repeats (e.g., a retroviral long terminal repeat), or the like may be selected. An AAV vector is an AAV nuclease (e.g., DNase)-resistant particle having an AAV protein capsid into which is packaged expression cassette flanked by AAV inverted terminal repeat sequences (ITRs) for delivery to target cells. A nuclease-resistant recombinant AAV (rAAV) indicates that the AAV capsid has fully assembled and protects these packaged vector genome sequences from degradation (digestion) during nuclease incubation steps designed to remove contaminating nucleic acids which may be present from the production process. In many instances, the rAAV described herein is DNase resistant. An AAV capsid is composed of 60 capsid (cap) protein subunits, VP1, VP2, and VP3, that are arranged in an icosahedral symmetry in a ratio of approximately 1:1:10 to 1:1:20, depending upon the selected AAV. Various AAVs may be selected as sources for capsids of AAV vectors as identified above. See, e.g., US Published Patent Application No.2007- 0036760-A1; US Published Patent Application No.2009-0197338-A1; EP 1310571. See also, WO 2003 / 042397 (AAV7 and other simian AAV), US Patent 7790449 and US Patent 7282199 (AAV8), WO 2005 / 033321 and US 7,906,111 (AAV9), and WO 2006 / 110689, and WO 2003 / 042397 (AAVrh10). These documents also describe other AAV which may be selected for generating AAV and are incorporated by reference. Among the AAVs isolated or engineered from human or non-human primates (NHP) and well characterized, human AAV2 is the first AAV that was developed as a gene transfer vector; it has been widely used for efficient gene transfer experiments in different target tissues and animal models. Unless otherwise specified, the AAV capsid, ITRs, and other selected AAV components described herein, may be readily selected from among any AAV, including, without limitation, the AAVs commonly identified as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV8bp, AAV7m8 and AAVAnc80. See, e.g., WO 2005 / 033321, which is incorporated herein by reference. The rAAV particles provided herein may be of any AAV serotype, including any derivative or pseudotype (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 2 / 1, 2 / 5, 2 / 8, or 2 / 9). As used herein, the serotype of an rAAV viral vector (e.g., an rAAV particle) refers to the serotype of the capsid proteins of the recombinant virus. In some embodiments, the rAAV particle is not AAV2. In certain embodiments, the rAAV particle is AAV2. In some embodiments, the rAAV particle is AAV6. In some embodiments, the rAAV particle is an AAV6 serotype comprising an rAAV capsid protein as described herein. Non-limiting examples of derivatives and pseudotypes include rAAV2 / l , rAAV2 / 5, rAAV2 / 8, rAAV2 / 9, AAV2-AAV3 hybrid, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAV-HSC15, AAV-HSC17, AAVhu.37, AAVrh.8, CHt-P6, AAV2.5, AAV6.2, AAV2i8, AAV-HSC15 / 17, AAVM41, AAV9.45, AAV6(Y445F / Y731F), AAV2.5T, AAV-HAE1 / 2, AAV clone 32 / 83, AAVShHIO, AAV2 (Y->F), AAV8 (Y733F), AAV2.15, AAV2.4, AAVM41, and AAVr3.45. Such AAV serotypes and derivatives / pseudotypes, and methods of producing such derivatives / pseudotypes are known in the art (see, e.g., Mol Ther.2012 Apr;20(4):699- 708. doi: 10.1038 / mt.2011.287. Epub 2012 Jan 24. The AAV vector toolkit: poised at the clinical crossroads. Asokan Al, Schaffer DV, Samulski RJ.). In certain embodiments, the rAAV particle is a pseudotyped rAAV particle, which comprises (a) a nucleic acid vector comprising ITRs from one serotype (e.g., AAV2) and (b) a capsid comprised of capsid proteins derived from another serotype (e.g., AAVl, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV10). Methods for producing and using pseudotyped rAAV vectors are known in the art (see, e.g., Duan et al., J. Virol., 75:7662-7671, 2001; Halbert et al., J. Virol., 74: 1524-1532, 2000; Zolotukhin et al., Methods, 28: 158-167, 2002; and Auricchio et al., Hum. Molec. Genet., 10:3075-3081, 2001). As used herein, a “stock” of rAAV refers to a population of rAAV. Despite heterogeneity in their capsid proteins due to deamidation, rAAV in a stock are expected to share an identical vector genome. A stock can include rAAV having capsids with, for example, heterogeneous deamidation patterns characteristic of the selected AAV capsid proteins and a selected production system. The stock may be produced from a single production system or pooled from multiple runs of the production system. A variety of production systems, including but not limited to those described herein, may be selected. As used herein, relating to AAV, the term “variant” means any AAV sequence which is derived from a known AAV sequence, including those sharing at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% or greater sequence identity over the amino acid or nucleic acid sequence. In another embodiment, the AAV capsid includes variants which may include up to about 10% variation from any described or known AAV capsid sequence. That is, the AAV capsid shares about 90% identity to about 99.9% identity, about 95% to about 99% identity or about 97% to about 98% identity to an AAV capsid provided herein and / or known in the art. In one embodiment, the AAV capsid shares at least 95% identity with an AAV capsid. When determining the percent identity of an AAV capsid, the comparison may be made over any of the variable proteins (e.g., vp1, vp2, or vp3). In one embodiment, the AAV capsid shares at least 95% identity with the AAV8 vp3. In another embodiment, a self-complementary AAV is used. The ITR sequences or other AAV components may be readily isolated or engineered using techniques available to those of skill in the art from an AAV. Such AAV may be isolated, engineered, or obtained from academic, commercial, or public sources (e.g., the American Type Culture Collection, Manassas, VA). Alternatively, the AAV sequences may be engineered through synthetic or other suitable means by reference to published sequences such as are available in the literature or in databases such as, e.g., GenBank, PubMed, or the like. AAV vectors may be engineered by conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus, etc. In one aspect, provided herein is an AAV vector comprising an AAV capsid and an expression cassette, wherein the expression cassette comprises a nucleic acid sequence that encodes an RNA interference construct (e.g., siRNA, shRNA, miRNA, or ASO) for inhibiting or reducing PRLΔE1 expression or activity in a target cell. In certain embodiments, an AAV vector comprises an AAV capsid and an expression cassette, wherein the expression cassette comprises one or more components of a gene editing system (e.g., CRISPR / Cas enzyme, guide RNA, crRNA) for inhibiting or reducing PRLΔE1 expression or activity in a target cell. The nucleic acid packaged in the AAV capsid sequence includes AAV ITR sequences flanking the expression cassette. The ITRs are the genetic elements responsible for the replication and packaging of the genome during vector production and are the only viral cis elements required to generate rAAV. In one embodiment, the ITRs are from an AAV different than that supplying a capsid. In a preferred embodiment, the ITR sequences from AAV2, or the deleted version thereof (ΔITR), which may be used for convenience and to accelerate regulatory approval. However, ITRs from other AAV sources may be selected. Where the source of the ITRs is from AAV2 and the AAV capsid is from another AAV source, the resulting vector may be termed pseudotyped. Typically, AAV vector genome comprises an AAV 5’ ITR, the nucleic acid sequences encoding the gene product(s) and any regulatory sequences, and an AAV 3’ ITR. However, other configurations of these elements may be suitable. In one embodiment, a self- complementary AAV is provided. A shortened version of the 5’ ITR, termed ΔITR, has been described in which the D-sequence and terminal resolution site (trs) are deleted. In certain embodiments, the vector genome includes a shortened AAV2 ITR of 130 base pairs, wherein the external “a” element is deleted. The shortened ITR is reverted back to the wild-type length of 145 base pairs during vector DNA amplification using the internal A element as a template. In other embodiments, the full-length AAV 5’ and 3’ ITRs are used. In certain embodiments, the regulatory sequences are selected such that the total rAAV vector genome is about 2.0 to about 5.5 kilobases in size. In certain embodiments, the regulatory sequences are selected such that the total rAAV vector genome is about 2.9 to about 5.5 kilobases in size. In certain embodiments, the regulatory sequences are selected such that the total rAAV vector genome is about 2.9 kb in size. In certain embodiments, it is desirable that the rAAV vector genome approximate the size of the native AAV genome. Thus, in certain embodiments, the regulatory sequences are selected such that the total rAAV vector genome is about 4.7 kb in size. In certain embodiments, the total rAAV vector genome is less about 5.2 kb in size. The size of the vector genome may be manipulated based on the size of the regulatory sequences including the promoter, enhancer, intron, poly A, etc. See, Wu et al., Mol Ther, Jan 2010, 18(1):80-6, which is incorporated herein by reference. The recombinant adeno-associated virus (AAV) described herein may be generated using techniques which are known. See, e.g., WO 2003 / 042397; WO 2005 / 033321, WO 2006 / 110689; US 7588772 B2. Such a method involves culturing a host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; an expression cassette as described herein flanked by AAV inverted terminal repeats (ITRs); and sufficient helper functions to permit packaging of the expression cassette into the AAV capsid protein. Also provided herein is the host cell which contains a nucleic acid sequence encoding an AAV capsid; a functional rep gene; a vector genome as described; and sufficient helper functions to permit packaging of the vector genome into the AAV capsid protein. In one embodiment, the host cell is a HEK 293 cell. These methods are described in more detail in WO2017160360 A2, which is incorporated by reference herein. Other methods of producing rAAV available to one of skill in the art may be utilized. Suitable methods may include without limitation, baculovirus expression system or production via yeast. See, e.g., Robert M. Kotin, Large-scale recombinant adeno-associated virus production. Hum Mol Genet.2011 Apr 15; 20(R1): R2–R6. Published online 2011 Apr 29. doi: 10.1093 / hmg / ddr141; Aucoin MG et al., Production of adeno-associated viral vectors in insect cells using triple infection: optimization of baculovirus concentration ratios. Biotechnol Bioeng.2006 Dec 20;95(6):1081-92; SAMI S. THAKUR, Production of Recombinant Adeno-associated viral vectors in yeast. Thesis presented to the Graduate School of the University of Florida, 2012; Kondratov O et al. Direct Head-to-Head Evaluation of Recombinant Adeno-associated Viral Vectors Manufactured in Human versus Insect Cells, Mol Ther.2017 Aug 10. pii: S1525-0016(17)30362-3. doi: 10.1016 / j.ymthe.2017.08.003. [Epub ahead of print]; Mietzsch M et al, OneBac 2.0: Sf9 Cell Lines for Production of AAV1, AAV2, and AAV8 Vectors with Minimal Encapsidation of Foreign DNA. Hum Gene Ther Methods.2017 Feb;28(1):15-22. doi: 10.1089 / hgtb.2016.164.; Li L et al. Production and characterization of novel recombinant adeno-associated virus replicative-form genomes: a eukaryotic source of DNA for gene transfer. PLoS One.2013 Aug 1;8(8):e69879. doi: 10.1371 / journal.pone.0069879. Print 2013; Galibert L et al, Latest developments in the large-scale production of adeno-associated virus vectors in insect cells toward the treatment of neuromuscular diseases. J Invertebr Pathol.2011 Jul;107 Suppl:S80-93. doi: 10.1016 / j.jip.2011.05.008; and Kotin RM, Large- scale recombinant adeno-associated virus production. Hum Mol Genet.2011 Apr 15;20(R1):R2-6. doi: 10.1093 / hmg / ddr141. Epub 2011 Apr 29. Conventional methods for characterization or quantification of rAAV are available to one of skill in the art. To calculate empty and full particle content, VP3 band volumes for a selected sample (e.g., in examples herein an iodixanol gradient-purified preparation where # of GC = # of particles) are plotted against GC particles loaded. The resulting linear equation (y = mx+c) is used to calculate the number of particles in the band volumes of the test article peaks. The number of particles (pt) per 20 µL loaded is then multiplied by 50 to give particles (pt) / mL. Pt / mL divided by GC / mL gives the ratio of particles to genome copies (pt / GC). Pt / mL–GC / mL gives empty pt / mL. Empty pt / mL divided by pt / mL and x 100 gives the percentage of empty particles. Generally, methods for assaying for empty capsids and AAV vector particles with packaged genomes have been known in the art. See, e.g., Grimm et al., Gene Therapy (1999) 6:1322-1330; Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsid, the methods include subjecting the treated AAV stock to SDS- polyacrylamide gel electrophoresis, consisting of any gel capable of separating the three capsid proteins, for example, a gradient gel containing 3-8% Tris-acetate in the buffer, then running the gel until sample material is separated, and blotting the gel onto nylon or nitrocellulose membranes, preferably nylon. Anti-AAV capsid antibodies are then used as the primary antibodies that bind to denatured capsid proteins, preferably an anti-AAV capsid monoclonal antibody, most preferably the B1 anti-AAV-2 monoclonal antibody (Wobus et al., J. Viral. (2000) 74:9281-9293). A secondary antibody is then used, one that binds to the primary antibody and contains a means for detecting binding with the primary antibody, more preferably an anti-IgG antibody containing a detection molecule covalently bound to it, most preferably a sheep anti-mouse IgG antibody covalently linked to horseradish peroxidase. A method for detecting binding is used to semi-quantitatively determine binding between the primary and secondary antibodies, preferably a detection method capable of detecting radioactive isotope emissions, electromagnetic radiation, or colorimetric changes, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, samples from column fractions can be taken and heated in SDS-PAGE loading buffer containing reducing agent (e.g., DTT), and capsid proteins were resolved on pre-cast gradient polyacrylamide gels (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions or other suitable staining method, i.e. SYPRO ruby or Coomassie stains. In one embodiment, the concentration of AAV vector genomes (vg) in column fractions can be measured by quantitative real time PCR (Q-PCR). Samples are diluted and digested with DNase I (or another suitable nuclease) to remove exogenous DNA. After inactivation of the nuclease, the samples are further diluted and amplified using primers and a TaqMan™ fluorogenic probe specific for the DNA sequence between the primers. The number of cycles required to reach a defined level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism 7700 Sequence Detection System. Plasmid DNA containing identical sequences to that contained in the AAV vector is employed to generate a standard curve in the Q-PCR reaction. The cycle threshold (Ct) values obtained from the samples are used to determine vector genome titer by normalizing it to the Ct value of the plasmid standard curve. End-point assays based on the digital PCR can also be used. In one aspect, an optimized q-PCR method is used which utilizes a broad-spectrum serine protease, e.g., proteinase K (such as is commercially available from Qiagen). More particularly, the optimized qPCR genome titer assay is similar to a standard assay, except that after the DNase I digestion, samples are diluted with proteinase K buffer and treated with proteinase K followed by heat inactivation. Suitably samples are diluted with proteinase K buffer in an amount equal to the sample size. The proteinase K buffer may be concentrated to 2-fold or higher. Typically, proteinase K treatment is about 0.2 mg / mL, but may be varied from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally conducted at about 55 °C for about 15 minutes, but may be performed at a lower temperature (e.g., about 37 °C to about 50 °C) over a longer time period (e.g., about 20 minutes to about 30 minutes), or a higher temperature (e.g., up to about 60 °C) for a shorter time period (e.g., about 5 to 10 minutes). Similarly, heat inactivation is generally at about 95 °C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90 °C) and the time extended (e.g., about 20 minutes to about 30 minutes). Samples are then diluted (e.g., 1000 fold) and subjected to TaqMan analysis as described in the standard assay. Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, methods for determining single-stranded and self-complementary AAV vector genome titers by ddPCR have been described. See, e.g., M. Lock et al, Hu Gene Therapy Methods, Hum Gene Ther Methods.2014 Apr;25(2):115-25. doi: 10.1089 / hgtb.2013.131. Epub 2014 Feb 14. It should be understood that the vectors described herein are intended to be applied to other compositions and methods described across the Specification. Pharmaceutical Compositions In certain embodiments, the compositions provided herein are included in a final formulation suitable for delivery to a subject, e.g., is an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate which is diluted for administration to a subject. In other embodiments, the composition may be lyophilized and reconstituted at the time of administration. In certain embodiments, the suspension further comprises a surfactant, preservative, excipients, and / or buffer dissolved in the aqueous suspending liquid. In one embodiment, the buffer is PBS. Various suitable solutions are known including those which include one or more of: buffering saline, a surfactant, and a physiologically compatible salt or mixture of salts adjusted to an ionic strength equivalent to about 100 mM sodium chloride (NaCl) to about 250 mM sodium chloride, or a physiologically compatible salt adjusted to an equivalent ionic concentration. A suitable surfactant, or combination of surfactants, may be selected from among Poloxamers, i.e., nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) flanked by two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), SOLUTOL HS 15 (Macrogol-15 Hydroxystearate), LABRASOL (Polyoxy capryllic glyceride), polyoxy 10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid esters), ethanol and polyethylene glycol. In one embodiment, the formulation contains a poloxamer. The pH may be in the range of 6.5 to 8.5, or 7 to 8.5, or 7.5 to 8. As the pH of the cerebrospinal fluid is about 7.28 to about 7.32, for intrathecal delivery, a pH within this range may be desired; whereas for intravenous delivery, a pH of 6.8 to about 7.2 may be desired. However, other pHs within the broadest ranges and these subranges may be selected for other routes of delivery. Additionally provided is a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a vector comprising a nucleotide sequence encoding a miRNA or modified snRNA operatively linked to regulatory elements therefor as described herein. As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the compositions. The phrase “pharmaceutically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, and the like, may be used for the introduction of the compositions of the present invention into suitable host cells. Suitable carriers may be readily selected by one of skill in the art in view of the indication for which the vector is directed. For example, one suitable carrier includes saline, which may be formulated with a variety of buffering solutions (e.g., phosphate buffered saline). Other exemplary carriers include sterile saline, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, and water. The selection of the carrier is not a limitation of the present invention. Other conventional pharmaceutically acceptable carrier, such as preservatives, or chemical stabilizers. Suitable exemplary preservatives include chlorobutanol, potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable chemical stabilizers include gelatin and albumin. As used herein, the term “dosage” or “amount” can refer to the total dosage or amount delivered to the subject in the course of treatment, or the dosage or amount delivered in a single unit (or multiple unit or split dosage) administration. The aqueous suspension or pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes. The pharmaceutical compositions described herein are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes. In one aspect, provided herein is a pharmaceutical composition comprising a dosage of a vector as described herein in a formulation buffer. As used herein, the term “dosage” can refer to the total dosage delivered to the subject in the course of treatment, or the amount delivered in a single unit (or multiple unit or split dosage) administration. The pharmaceutical virus compositions can be formulated in dosage units to contain an amount of replication- defective AAV vector carrying a nucleic acid sequence as described herein that is in the range of about 1.0 x 109vg (vector genomes) / mL to about 1.0 x 1015vg / mL including all integers or fractional amounts within the range. In one embodiment, the compositions are formulated to contain at least 1x109, 2x109, 3x109, 4x109, 5x109, 6x109, 7x109, 8x109, or 9x109vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1010, 2x1010, 3x1010, 4x1010, 5x1010, 6x1010, 7x1010, 8x1010, or 9x1010vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1011, 2x1011, 3x1011, 4x1011, 5x1011, 6x1011, 7x1011, 8x1011, or 9x1011vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1012, 2x1012, 3x1012, 4x1012, 5x1012, 6x1012, 7x1012, 8x1012, or 9x1012vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1013, 2x1013, 3x1013, 4x1013, 5x1013, 6x1013, 7x1013, 8x1013, or 9x1013vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1014, 2x1014, 3x1014, 4x1014, 5x1014, 6x1014, 7x1014, 8x1014, or 9x1014vg / mL including all integers or fractional amounts within the range. In another embodiment, the compositions are formulated to contain at least 1x1015, 2x1015, 3x1015, 4x1015, 5x1015, 6x1015, 7x1015, 8x1015, or 9x1015vg / mL including all integers or fractional amounts within the range. In one embodiment, for human application the dose can range from 1x1010to about 1x1012vg / mL including all integers or fractional amounts within the range. All dosages may be measured by any known method, including as measured by qPCR or digital droplet PCR (ddPCR) as described in, e.g., M. Lock et al, Hum Gene Ther Methods. 2014 Apr;25(2):115-25. doi: 10.1089 / hgtb.2013.131, which is incorporated herein by reference. These above doses may be administered in a variety of volumes of carrier, excipient or buffer formulation, ranging from about 25 to about 1000 microliters, including all numbers within the range, depending on the size of the area to be treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of carrier, excipient or buffer is at least about 25 µL. In one embodiment, the volume is about 50 µL. In another embodiment, the volume is about 75 µL. In another embodiment, the volume is about 100 µL. In another embodiment, the volume is about 125 µL. In another embodiment, the volume is about 150 µL. In another embodiment, the volume is about 175 µL. In yet another embodiment, the volume is about 200 µL. In another embodiment, the volume is about 225 µL. In yet another embodiment, the volume is about 250 µL. In yet another embodiment, the volume is about 275 µL. In yet another embodiment, the volume is about 300 µL. In yet another embodiment, the volume is about 325 µL. In another embodiment, the volume is about 350 µL. In another embodiment, the volume is about 375 µL. In another embodiment, the volume is about 400 µL. In another embodiment, the volume is about 450 µL. In another embodiment, the volume is about 500 µL. In another embodiment, the volume is about 550 µL. In another embodiment, the volume is about 600 µL. In another embodiment, the volume is about 650 µL. In another embodiment, the volume is about 700 µL. In another embodiment, the volume is about 800 µL. In another embodiment, the volume is about or at least 100 µL. In another embodiment, the volume is between about 100 to 250 µL. In another embodiment, the volume is between about 150 and 800 µL. In another embodiment, the volume is between about 700 and 1000 µL. In another embodiment, the volume is between about 250 and 500 µL. In the case of AAV vectors, quantification of the genome copies (“GC”), vector genomes (“VG”), or virus particles may be used as the measure of the dose contained in the formulation or suspension. Any method known in the art can be used to determine the genome copy (GC) number of the replication-defective virus compositions of the invention. One method for performing AAV GC number titration is as follows: Purified AAV vector samples are first treated with DNase to eliminate un-encapsulated AAV genome DNA or contaminating plasmid DNA from the production process. The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genomes are then quantitated by real-time PCR using primer / probe sets targeting specific region of the viral genome (usually the transgene or the poly A signal). See, e.g.,S.K. McLaughlin et al, 1988 J. Virol., 62:1963, which is incorporated by reference in its entirety. In certain embodiments, nucleic acid compositions described herein are formulated in a nanoparticle. In certain embodiments, nucleic acid compositions described herein are formulated in a lipid nanoparticle. In certain embodiments, nucleic acid compositions described herein are formulated in a lipid-polycation complex, referred to as a cationic lipid nanoparticle. The formation of the lipid nanoparticle may be accomplished by methods known in the art and / or as described in U.S. Pub. No.20120178702, herein incorporated by reference in its entirety. As a non-limiting example, the polycation may include a cationic peptide or a polypeptide such as, but not limited to, polylysine, polyomithine and / or polyarginine and the cationic peptides described in International Pub. No. WO 2012 / 013326 or US Patent Pub. No. US 2013 / 0142818; each of which is herein incorporated by reference in its entirety. In certain embodiments, nucleic acid compositions described herein are formulated in a lipid nanoparticle that includes a non-cationic lipid such as, but not limited to, cholesterol or dioleoyl phosphatidylethanolamine (DOPE). One skilled in the art can also readily determine an appropriate dosage regimen for administering the siRNA or ASO to a given subject. For example, the siRNA or ASO can be administered to the subject once, such as by a single injection or deposition at or near a tumor. Alternatively, the siRNA or ASO can be administered to a subject multiple times daily or weekly. For example, the siRNA or ASO can be administered to a subject once weekly for a period of from about three to about twenty-eight weeks, more preferably from about seven to about ten weeks. In a preferred dosage regimen, the siRNA or ASO is injected at or near the site of neovascularization (e.g., intravitreally) once a week for seven weeks. It is understood that periodic administrations of the siRNA or ASO for an indefinite length of time may be necessary. Where a dosage regimen comprises multiple administrations or the administration of two or more siRNA or ASO, each of which comprise a different target sequence, it is understood that the effective amount of siRNA or ASO administered to the subject can comprise the total amount of siRNA administered over the entire dosage regimen. The siRNA or ASO are preferably formulated as pharmaceutical compositions prior to administering to a subject, according to techniques known in the art. Pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen- free. As used herein, “pharmaceutical formulations” include formulations for human and veterinary use. Methods for preparing pharmaceutical compositions are within the skill in the art, for example as described in Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference. In certain embodiments, the composition comprises an siRNA or ASO (e.g., 0.1 to 90% by weight), or a physiologically acceptable salt thereof, mixed with a physiologically acceptable carrier medium. Preferred physiologically acceptable carrier media are water, buffered water, normal saline, 0.4% saline, 0.3% glycine, hyaluronic acid and the like. Pharmaceutical compositions can also comprise conventional pharmaceutical excipients and / or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions can be packaged for use in liquid form or can be lyophilized. It should be understood that the pharmaceutical compositions described herein are intended to be applied to other compositions and methods described across the Specification. Methods In certain embodiments, an expression cassette, nucleic acid, or a viral or non-viral vector is used in preparing a medicament. In certain embodiments, uses of the same for treatment of an ocular disease in a subject in need thereof are provided. As used herein, the term “treatment” or “treating” is defined encompassing administering to a subject one or more compositions described herein for the purposes of amelioration of one or more symptoms of an ocular disease. “Treatment” can thus include one or more of reducing onset or progression of disease, preventing disease, reducing the severity of the disease symptoms, retarding their progression, removing the disease symptoms, delaying progression of disease, or increasing efficacy of therapy in a given subject. The desired result will depend upon the active agent being administered. For example, an effective amount of a rAAV particle may be an amount of the particle that is capable of transferring a heterologous nucleic acid to a host organ, tissue, or cell. A “therapeutically effective amount” of a composition provided herein is delivered to a subject to achieve a desired result or to reach a therapeutic goal. By “administering” or “route of administration” is delivery of a therapy described herein (e.g. a rAAV comprising an RNA interference sequence), with or without a pharmaceutical carrier or excipient, of the subject. In certain embodiments, the administration is repeated periodically. In certain embodiments, a composition is administered direct to an eye. In certain embodiments, the route of administration is ocular delivery, subretinal injection, intra-retinal injection, or intravitreal injection. Routes of administration may be combined, if desired. In certain embodiments, the methods provide herein include administration of nucleic acid molecules and / or vectors described herein in a single composition or multiple compositions. Optionally, two or more different AAV may be delivered, or multiple viruses [see, e.g., WO202011 / 126808 and WO 2013 / 049493]. In another embodiment, multiple viruses may contain different replication-defective viruses (e.g., AAV and adenovirus), alone or in combination with proteins. In another embodiment, the amount of the vectors, the virus and the replication- defective virus described herein are administered in a range of about 1.0 x 107vector genomes (VG) per eye to about 1.0 x 1015VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x107, 2x107, 3x107, 4x107, 5x107, 6x107, 7x107, 8x107, or 9x107VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x108, 2x108, 3x108, 4x108, 5x108, 6x108, 7x108, 8x108, or 9x108VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x109, 2x109, 3x109, 4x109, 5x109, 6x109, 7x109, 8x109, or 9x109VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1010, 2x1010, 3x1010, 4x1010, 5x1010, 6x1010, 7x1010, 8x1010, or 9x1010VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1011, 2x1011, 3x1011, 4x1011, 5x1011, 6x1011, 7x1011, 8x1011, or 9x1011 VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1012, 2x1012, 3x1012, 4x1012, 5x1012, 6x1012, 7x1012, 8x1012, or 9x1012VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1013, 2x1013, 3x1013, 4x1013, 5x1013, 6x1013, 7x1013, 8x1013, or 9x1013VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1014, 2x1014, 3x1014, 4x1014, 5x1014, 6x1014, 7x1014, 8x1014, or 9x1014VG per eye including all integers or fractional amounts within the range. In one embodiment, the amount thereof is at least 1x1015, 2x1015, 3x1015, 4x1015, 5x1015, 6x1015, 7x1015, 8x1015, or 9x1015VG per eye including all integers or fractional amounts within the range. In certain embodiments, the method comprises delivery of a dose ranging from 1x109to about 1x1013VG per eye per dose including all integers or fractional amounts within the range. In certain embodiments, the method comprises delivery of the vector in an aqueous suspension. In another embodiment, the method comprises administering the rAAV described herein in a dosage of from about 1 x 1012to 1 x 1013VG in a volume about or at least 150 microliters. As used herein, the term “ocular cells” refers to any cell in, or associated with the function of, the eye. The term may refer to any one of photoreceptor cells, including rod, cone and photosensitive ganglion cells or retinal pigment epithelium (RPE) cells. In certain embodiments, the ocular cells are the photoreceptor cells. In other embodiments, the ocular cells are cones, rods, or cones and rods. In certain embodiments, the compositions provided herein are administered to a subject in need of treatment. In certain embodiments, the subject has or is suspected of having one or more conditions, diseases, or disorders of the eye. In certain embodiments, the subject has, or is at risk of developing retinitis pigmentosa (autosomal dominant, autosomal recessive, or X-linked), Leber's congenital amaurosis, cone or cone-rod dystrophy, Usher syndrome, macular degeneration, Stargardt's disease, age-related macular degeneration, trauma-induced retinal degeneration, or retinal detachment. In certain embodiments, the subject has been identified as having expression of PRLΔE1 in cells of the eye. In certain embodiments, the subject has been identified as having a mutation that causes retinitis pigmentosa, including, but not limited to, a mutation in RPGR, RPE65, PDE6β, or NPHP5. In certain embodiments, the composition is administered before disease onset. In another embodiment, the composition is administered prior to the initiation of vision impairment or loss. In another embodiment, the composition is administered after initiation of vision impairment or loss. In certain embodiments, the composition is readministered at a later date. Optionally, more than one readministration is permitted. Such readministration may be with the same type of vector, a different viral vector, or via non-viral delivery as described herein. In certain embodiments, the vector is readministered to the patient to a different portion of the initially injected retina. In one embodiment, the vector is readministered to the patient to the same portion of the initially injected retina. In certain embodiments, the subject has about 10% or more photoreceptor damage / loss. In another embodiment, the subject has about 20% or more photoreceptor damage / loss. In another embodiment, the subject has about 30% or more photoreceptor damage / loss. In another embodiment, the subject has about 40% or more photoreceptor damage / loss. In another embodiment, the subject has about 50% or more photoreceptor damage / loss. In another embodiment, the subject has about 60% or more photoreceptor damage / loss. In another embodiment, the subject has about 70% or more photoreceptor damage / loss. In another embodiment, the subject has about 80% or more photoreceptor damage / loss. In another embodiment, the subject has about 90% or more photoreceptor damage / loss. In certain embodiments, the subject has, or is at risk of developing, RP and more particularly, XLRP. In another embodiment, the subject is a “carrier” for XLRP, i.e., has at least one RPGR mutation in at least one X chromosome. Because XLRP is an X-linked disease, females, which normally have two X chromosomes, may be homozygous or heterozygous for a specific mutation in the RPGR gene, or compound heterozygotes, which have a different mutation in the RPGR gene on each X chromosome. Normal males, having only one X chromosome, with a mutation in the RPGR gene are termed hemizygous. In one embodiment, the subject having, or at risk of developing XLRP is a hemizygous male. In another embodiment, the subject having, or at risk of developing XLRP, is a homozygous female or a heterozygous female. In other embodiments, subjects at risk of developing XLRP include those with a family history of XLRP, those with one or more confirmed mutations in the RPGR gene, offspring of female carriers of an RPGR mutation (heterozygous females), or offspring of females carrying an RPGR mutation on both X chromosomes. In another embodiment, the subject has shown clinical signs of XLRP. Clinical signs of XLRP include, but are not limited to, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, reduction in visual acuity, decreased photoreceptor function, pigmentary changes. In another embodiment, the subject has been diagnosed with XLRP. In yet another embodiment, the subject has not yet shown clinical signs of XLRP. In an embodiment, the retinitis pigmentosa is an X-linked retinitis pigmentosa (XLRP). XLRP is one of the most severe forms of RP, demonstrating an early age of onset (usually within the first decade) and rapid progression of disease. Because the disease is X- linked, homozygous females are rare, usually only manifesting in small, isolated populations. Thus, the disease primarily affects males, although carrier (heterozygous) females are also affected, demonstrating various levels of retinal degeneration. The disease demonstrates a broad spectrum of disease severity, between and within families. The retinitis pigmentosa GTPase regulator (RPGR) is an 815 aa protein which is implicated in XLRP (Meindl et al, Nature Genetics, 13:35-42 (May 1996) and Vervoort et al, Nature Genetics, 25:462-6 (2000), which are hereby incorporated by reference herein). Greater than 290 mutations in RPGR (http: / / rpgr.hgu.mrc.ac.uk / supplementary / , and document entitled “Summary of RPGR mutation and polymorphism”, which is incorporated herein by reference) account for over 70% of XLRP patients. The protein contains a RCC-1 like domain, characteristic of the highly conserved guanine nucleotide exchange factors. The constitutive transcript of RPGR, containing 19 exons, is expressed in a wide variety of tissues (Hong and Li, Invest Opthalmology Vis Sci, 43(11):3373-82, incorporated by reference herein). An RPGR variant terminates in intron 15 of the RPGR gene. The alternative terminal exon consists of the constitutive exon 15 and part of intron 15, and is termed ORF15. This protein isoform that is encoded by exons 1 through ORF15 is used prevalently in photoreceptors and a large number of disease causing mutations have been found in ORF15 (Vervoort and Wright, Hum Mutat.2002 May, 19(5):486-500; Aguirre et al, Exp Eye Res, 2002, 75:431-43; and Neidhardt et al, Hum Mutat.2007, 28(8):797-807, each of which is hereby incorporated by reference herein). The term “RPGR” as used herein, refers to the full length gene itself or a functional fragment, as further defined below. The nucleic acid sequence encoding a normal RPGR gene may be derived from any mammal which natively expresses the RPGR gene, or homolog thereof. In another embodiment, the RPGR gene sequence is derived from the same mammal that the composition is intended to treat. In another embodiment, the RPGR is derived from a human. In another embodiment, the RPGR sequence is the sequence of the full length human RPGRORF15 clone, which includes exons 1 though ORF15 (Vervoort R, et al. (2000), Nat Genet 25:462-466, which is incorporated by reference herein). See also, WO 2014 / 011210 A1, which is incorporated herein in its entirety. In certain embodiments, the subject has, or is at risk of developing, Leber congenital amaurosis (LCA). In certain embodiments, the subject has or is at risk of developing LCA caused by a mutation in RPE65. In certain embodiments, the subject has or is at risk of developing LCA caused by a mutation in IQCB1 / NPHP5 (nephrocystin-5). In certain embodiments, the subject has, or is at risk of developing, Senior-Løken syndrome. In certain embodiments, the subject has or is at risk of developing Senior-Løken syndrome caused by a mutation in IQCB1 / NPHP5. In certain embodiments, the subject has shown clinical signs of LCA-ciliopathy. Clinical signs of LCA-ciliopathy include, but are not limited to, nystagmus, decreased peripheral vision, decreased central (reading) vision, decreased night vision, loss of color perception, reduction in visual acuity, decreased photoreceptor function, pigmentary changes. In another embodiment, the subject has been diagnosed with LCA-ciliopathy. In certain embodiments, the method includes delivery of a nucleic acid sequence that reduces or inhibits PRLΔE1 expression and a nucleic acid sequence encoding a functional gene product, or fragment thereof. The nucleic acid sequences may be delivered in a single construct (e.g., a vector genome wherein the sequences are operably linked) or in separated constructs that may be delivered using more than one vector delivered by one or more routes of administration. In certain embodiments, the method includes delivery of a functional gene product, or fragment thereof, that the gene RPGR, RPE65, PDE6β, or NPHP5. In certain embodiments, the subject has been previously treated with a gene therapy, specifically a gene augmentation therapy, prior to administration of a composition for delivery of a nucleic acid sequence that reduces or inhibits PRLΔE1 expression. In certain embodiments, the subject is administered of a composition for delivery of a nucleic acid sequence that reduces or inhibits PRLΔE1 expression prior to administration of a gene augmentation therapy. In certain embodiments, the gene augmentation therapy is LUXTURNA® (voretigene neparvovec- rzyl). In certain embodiments, the methods of treatment for In certain embodiments, treatment of a subject having an ocular disease with a composition described herein to reducing or inhibiting PRLΔE1 expression or activity does not require re-administration. The methods of treatment described herein may be used in conjunction with other treatments (secondary therapy), i.e., the standard of care for the subject’s diagnosis and condition. As used herein, the term “secondary therapy” refers to the therapy that could be combined with the gene therapy described herein for the treatment of an ocular disease. In certain embodiments, the methods of treatment described herein may be used in conjunction with other gene therapies, including, for example those for choroideremia (REP- 1), retinitis pigmentosa (RPGR, RPE65, Abca4, Ar12bp, Arl6, Bbs2, Best1, C2orf71, C8orf37, Ca4, Cc2d2a, Cerkl, Clrn1, Cnga1, Cngb1, crb1, Crx, Cyp4v2, Dhdds, Dhx38, Emc1, Eys, Fam161a, Flvcr1, Fscn2, Gnptg, Gpr125, Guca1b, Idh3b, Ifg140, Impdh1, Impg2, Kiaa1549, Klh17, Lrat, Mak, Mertk, Myk, Nek2, Nr2e3, Nrl, Ofc1, Pde6a, Pde6b, Pde6g, Pex1, Pex7, Pgk1, Phyh, Prom1, Prpf3, Prpf31, Prpf4, Prpf8, Prph2, Rbp3, Rdh12, Rgr, Rho, Rlbp1, Rom1, Rp1, Rp111, Rp2, Rp9, Rs1, Sag, Sema4a, Slc7a14, Snrnp200, Spata7, Topors, Ttc8, Tulp1, Ush2a, Znf513), Leber Congenital Amaurosis (LCA) (CEP290, CRB1, CRX, GDF6, GUCY2d, RPE65, PRPH2, AIPL1, IMPDH1, IQCB1, KCNJ13, LCA5, NMNAT1, RD3, RDH12, RPGRIP1, SPATA7, TULP1, USP45), macular degeneration (VEGF antibodies, RORA), achromatopsia (CNGA3, CNGB3), and others. In certain embodiments, the method of treatment reduces COS elongation, thinning, and / or curving. In another embodiment, the treatment reduces ROS elongation, thinning, and / or curving. In another embodiment, the treatment reduces glial activation. In another embodiment, the treatment reduces ELM-RPE distance, in another embodiment, treatment reduces accumulation of retinal debris. In another embodiment, treatment reduces abnormal POS-RPE apposition and microarchitecture of RPE-PR interface. In another embodiment, treatment reduces subretinal debris at RPE apical surface, or within subretinal space. In another embodiment, treatment reduces compromised IPM and defective ELM. In another embodiment, treatment reduces fluctuation of ONL thickness associated with reactive gliosis and cell migration. In another embodiment, treatment reduces schistic changes in the inner / outer retina. In another embodiment, treatment reduces formation of subretinal & intraretinal scars. In another embodiment, treatment reduces RPE monolayer hypertrophy. In another embodiment, treatment reduces occasional severe deformation of individual RPE cells associated with ONL & INL thickness fluctuations. In another embodiment, treatment reduces and Muller Glial trunks / projections penetrating ONL layer. In one embodiment, treatment reduces gross macular lesion. In yet another embodiment, treatment reduces bullous detachment. In certain embodiments, it is desirable to perform non-invasive retinal imaging and functional studies to identify areas of the retina to be targeted for therapy and / or to evaluate efficacy of treatment. In certain embodiments, clinical diagnostic tests are employed to determine the precise location(s) for one or more subretinal injection(s). The non-invasive retinal imaging and functional studies may include electroretinography (ERG), perimetry, topographical mapping of the layers of the retina and measurement of the thickness of its layers by means of confocal scanning laser ophthalmoscopy (cSLO) and optical coherence tomography (OCT), topographical mapping of cone density via adaptive optics (AO), functional eye exam, etc., depending upon the species of the subject being treated, their physical status and health and treatment. In view of the imaging and functional studies, in some embodiments one or more injections are performed in the same eye in order to target different areas of the affected eye. The volume and viral titer of each injection is determined individually, as further described herein, and may be the same or different from other injections performed in the same, or contralateral, eye. In another embodiment, a single, larger volume injection is made in order to treat the entire eye. In one embodiment, the volume and concentration of the rAAV composition is selected so that only the region of damaged ocular cells is impacted. In another embodiment, the volume and / or concentration of the rAAV composition is a greater amount, in order reach larger portions of the eye, including non-damaged ocular cells. In another embodiment, the method includes performing additional studies, e.g., functional and imaging studies to determine the efficacy of the treatment. For examination in animals, such tests include retinal and visual function assessment via electroretinograms (ERGs) looking at rod and cone photoreceptor function, optokinetic nystagmus, pupillometry, water maze testing, light-dark preference, optical coherence tomography (to measure thickness of various layers of the retina), histology (retinal thickness, rows of nuclei in the outer nuclear layer, immunofluorescence to document transgene expression, cone photoreceptor counting, staining of retinal sections with peanut agglutinin - which identifies cone photoreceptor sheaths). Specifically for human subjects, following administration of a dosage of a composition described in this specification, the subject is tested for efficacy of treatment using electroretinograms (ERGs) to examine rod and cone photoreceptor function, pupillometry visual acuity, contrast sensitivity color vision testing, visual field testing (Humphrey visual fields / Goldmann visual fields), perimetry mobility test (obstacle course), and reading speed test. Other useful post-treatment efficacy test to which the subject is exposed following treatment with a pharmaceutical composition described herein are functional magnetic resonance imaging (fMRI), full-field light sensitivity testing, retinal structure studies including optical coherence tomography, fundus photography, fundus autofluorescence, adaptive optics laser scanning ophthalmoscopy, mobility testing, test of reading speed and accuracy, microperimetry and / or ophthalmoscopy. These and other efficacy tests are described in US Patent No.8,147,823; in co-pending International patent application publication WO 2014 / 011210 or WO 2014 / 124282, incorporated by reference. In certain embodiments, provided are methods of generating a recombinant rAAV comprises obtaining a plasmid containing an AAV expression cassette as described above and culturing a packaging cell carrying the plasmid in the presence of sufficient viral sequences to permit packaging of the AAV viral genome into an infectious AAV envelope or capsid. Specific methods of rAAV vector generation are described above and may be employed in generating an rAAV vector that can deliver the sequences of the expression cassettes and genomes described above and in the examples below. It should be understood that the methods of treatment described herein are intended to be applied to other compositions and methods described across the Specification. The invention is now described with reference to the following examples. These examples are provided for the purpose of illustration only and the invention should in no way be construed as being limited to these examples but rather should be construed to encompass any and all variations that become evident as a result of the teaching provided herein. EXAMPLES Example 1: Materials and Methods In vitro PRLΔE1 shRNA screening Three shRNA constructs targeting different regions of the PRLΔE1 were screened in vitro in HEK293 cells overexpressing PRLΔE1-mCherry transgene. Briefly, HEK293 cells were seeded in 12 well plates and co-transfected the following day at 70-90% confluence with a PRLΔE1-mCherry plasmid and one of the three PRLΔE1-targetting shRNAs, or a non- specific shRNA. Transfections were performed in triplicates using Lipofectamine 2000. The cells were incubated for 24 hours at 37°C in a 5% CO2incubator. Following incubation, the cells were collected, total RNA was extracted using the Qiagen RNeasy Plus Mini kit and reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, ThermoFisher Scientific). qPCR analysis was performed using PowerUp SYBR Green Mastermix (Applied Biosystems, ThermoFisher Scientific) in either Applied Biosystems 7500 Real Time PCR System or Applied Biosystems ViiA 7 Real Time PCR System in a 96-well or 384-well format. Subretinal AAV-shRNAPRLdE1injections AAV vector was delivered subretinally in the supertemporal quadrant using a 25 / 38G PolyTip cannula (MedOne®Sarasota, FL, U.S.A.) attached to a 1mL Luer-Lok™ syringe (Beckton, Dickinson and Company, NJ, U.S.A.) under general anesthesia. Injections were performed using a Stellaris PC injection system (Bausch and Lomb, Rochester, NY, USA) and visualized through a Zeiss operating microscope (Carl Zeiss Meditec, Inc., Dublin, CA, U.S.A.) with the image projected on a NGenuity®3D screen (Alcon, Geneva, Switzerland). Optimal dose of AAV2 / 5-shRNAPRLΔE1was determined in a pilot study by subretinally injecting 150 µL of two different doses (5 x1011and 5 x 1012vg / ml) of the vector in each eye of one RPGR-XLPRA2 dog (age ~40 weeks) when ample PRLΔE1 expression in the PRs is observed. Subsequently, AAV2 / 5-shRNAPRLΔE1was delivered at a dose of 5 x 1012vg / ml in one PDE6β-RCD1 (age: 5 weeks) and two RPGR-XLPRA2 (age: 7 weeks) dogs (subretinal, volume: 70 µLs), and in one normal adult (age: 4 years and 6 months) dog (subretinal, volume: 150 µLs). In vivo retinal imaging Optical coherence tomography (OCT) and confocal scanning laser ophthalmoscopy (cSLO) was performed for in-vivo retinal assessment (HRA + OCT Spectralis®, Heidelberg Engineering Inc, MA, USA performed. Using a). Autofluorescence cSLO images were taken using a 130ofield-of-view lens, 55oinfra-red and blue-light. Sequential OCT scans of the bleb and bleb-adjacent areas were obtained to check for retinal changes over time. Ocular tissue collection Ocular tissue was collected after euthanasia with intravenous sodium pentobarbital injection. After enucleation, 3 mm diameter retinal punches were obtained within and outside the area injection bleb. The posterior eyecup was fixed in 4% paraformaldehyde (PFA) for 3 hours, followed by 2% PFA for 24 hours. Tissue was dissected, cryopreserved by sequential 24-hour incubations in 15% and 30% sucrose-PBS solutions, and then embedded in Optimal Cutting Temperature (OCT) medium. RNA in situ hybridization, immunohistochemistry, and TUNEL Assay PRLΔE1 mRNA was visualized by RNA-in situ hybridization (RNA-ISH) using the RNAscope assay 2.5 HD Assay-Red (Advanced Cell Diagnostics, ACD-Bio, BioTechne, Newark, CA, USA) as described previously23. Briefly, 10 µm thick sections were cut from PFA-fixed OCT-embedded canine retinas. Target retrieval was performed by heating the slides at 88°C for 10 min in Target Retrieval buffer, followed by 15 min of protease treatment. PRLΔE1 probe (RNAscope cat no.535781) binding and visualization were performed as described in the kit protocol Slides were then either counterstained with hematoxylin or used for immunohistochemistry / TUNEL assay. RNAscope 2.5 HD Duplex Assay was performed following kit recommendations for co-visualization of PRLΔE1 and NPHP5 (RNAscope probe cat no.462841) RNAs. PRLΔE1 was visualized using Fast Red dye and NPHP5 was stained with HRP-Green. When performing dual staining with RNA-ISH and immunohistochemistry (IHC), the retinal sections were treated with a blocking buffer for 1h (5% BSA and 4.5% fish gelatin in PBS) immediately following RNA-ISH, and then incubated overnight with the primary antibodies (RHO, Millipore MAB5316, 1:200; ARR3, C.Craft, Univ. of Southern California, LUMIF; RPGR, Sigma HPA001593, 1:100) at 4°C. Antigen antibody complexes were visualized with Alexa-stained secondary antibodies. Hoechst 33342 stain (Thermo Fisher Scientific) was used to label cell nuclei. TUNEL assay was performed to assess cell death in the retinal sections as previously reported37. Slides were mounted in Gelvatol mounting medium and examined with an epifluorescence microscope (Axioplan, Carl Zeiss Meditec). Images were captured with the Axiocam 305 camera and Zeiss Zen Microscopy software and processed using the Adobe Photoshop and Illustrator programs for display. Table 5 PE: Exposure interval; PI: Post AAV injection Example 2: Involvement of Retinal Prolactin Isoform PRLΔE1 in Rod Disease in Inherited Retinal Degenerations Rod-specific expression of PRLΔE1 in canine IRD with protracted PR degeneration. We previously described the expression of PRLΔE1 transcript in the PRs in PDE6β- RCD1(26-28) and RPGR-XLPRA2(24, 29) dogs. To determine whether PRLΔE1 expression is common to other forms of IRD, we examined additional canine models of IRD. We now show that this shorter PRL transcript is also expressed in RPGR-XLPRA1 (X-Linked Progressive Retinal Atrophy 1, caused by a five-nucleotide deletion in the RPGR exon ORF15)(29, 30) and NPHP5-LCA (Leber Congenital Amaurosis, caused by a single nucleotide insertion in exon 10 of the IQCB1 / NPHP5 gene)(31, 32) (FIG.1A). Both diseases affect rods and cones, however, with varying age of onset and disease severity. In the rapidly degenerating NPHP5-LCA model, PRLΔE1 transcript was detected at 14 weeks of age. This time point is characterized by early stages of PR loss and moderate thinning of the ONL, consistent with the early phase of degeneration in this model(31). In contrast, in the RPGR- XLPRA1 model, degenerative changes in the PR are observed before onset of cell death(33). PRLΔE1 expression was observed starting at 26 weeks of age, which notably precedes the onset of noticeable PR loss. This early upregulation of PRLΔE1 expression prior to extensive PR cell death, indicates a potential role in the initial response to degenerative stress (FIG.8A and FIG.8B). To determine whether PR dysfunction without ongoing degeneration also induces PRLΔE1 expression, we examined a model of achromatopsia (CNGB3-ACHM3; mutation in Cyclic Nucleotide Gated Channel Subunit Beta 3), a disease with impaired cone function and structure, but no rod degeneration(34, 35). Notably, in the absence of rod degeneration, retinal PRLΔE1 expression was not observed (FIG.1B). Taken together, these results suggest that PRLΔE1 expression is associated with ongoing rod disease. Identification of PR cell subclass (rods and / or cones) that express PRLΔE1 by RNA- in situ hybridization (RNA-ISH) within the outer nuclear layer (ONL, the cellular layer containing the PR cell bodies) is challenging due to the dense packing of rod and cone nuclei in this area. To determine the PR cell type-that specifically expresses PRLΔE1, we took advantage of NPHP5-LCA retinas in which degeneration results in adjacent areas containing both rods and cones, or only cones. PRLΔE1 RNA-ISH staining was found in regions containing both PR cell types but not in cone only areas (FIG.1B), supporting rod-specific expression in degenerating retina. We further confirmed PRLΔE1 expression in rods, and not cones using data from single cell RNAseq analysis. (FIG.9). Thus, our study now firmly establishes the expression of PRLΔE1 in diseased rods in four different canine models of IRD. PRLΔE1 expression colocalizes with areas of PR disease in RPGR-XLPRA carriers. To determine whether PRLΔE1 expression is restricted to degenerating rods, we examined its expression in the two RPGR-XLPRA carriers, XLPRA1 and XLPRA2. In female dogs with a single mutant copy of RPGR, random X-chromosome inactivation creates a mosaic of normal and mutant PRs(36). Consequently, degeneration within the ONL occurs in patches that can be identified by opsin mislocalization to the PR cell bodies(36). In both carrier retinas, PRLΔE1 expression overlapped with the patchy areas of degeneration identified by rhodopsin mislocalization and was not observed in the intervening patches with normal PRs (FIG.2). Thus, PRLΔE1 expression is limited to mutant rods with active disease. PRLΔE1 expression is not directly associated with acute PR cell death. To assess whether PRLΔE1 is associated with PR cell death, we examined its expression in the RHO-T4R dog, a large animal model of acute light induced rod cell death caused by the T4R mutation in rhodopsin(37, 38). In this model, rapid rod OS fragmentation occurs within hours of a one-minute exposure to white light at a corneal irradiance of 1 mW / cm2, and significant rod cell death is observed by extensive TUNEL labeling in the ONL at 24 hours(39, 40). However, no PRLΔE1 expression was detected at this time point (FIG. 3). By two weeks post light exposure, the retina was reduced to one to two rows of PR with ongoing cell death, yet no PRLΔE1 was observed. In contrast, the PDE6β-RCD1 model, characterized by a protracted disease course, showed extensive PRLΔE1 expression at 14 weeks of age, a time when minimal TUNEL staining was present. To further explore the dynamics of PRLΔE1 expression in the RHO-T4R light sensitive dog, we assessed its levels following exposure to two different light exposure intensities (0.5 mW / cm2and 0.3 mW / cm2for 1 minute). These lower light intensities result in fewer TUNEL-labeled cells at 24 hours post-exposure and a greater survival of PRs at the two-week mark, though cell death is ongoing(39). Nonetheless, PRLΔE1 was not expressed in the PRs at any time point under these conditions (FIG.10A and FIG.10B). Thus, our results suggest that PRLΔE1 expression is not associated with the acute rod cell death that can be experimentally triggered in this model but is instead linked to the chronic degenerative state observed in models with prolonged disease. PRLΔE1 expression is suppressed in RPGR and NPHP5 mutant retinas after corrective gene augmentation therapy. Since we found that PRLΔE1 expression was restricted to unhealthy / diseased rods, we predicted that PRLΔE1 expression would be downregulated or abrogated if degeneration was halted, and PR homeostasis restored therapeutically. To test this hypothesis, we examined PRLΔE1 expression in two non-allelic diseases (RPGR-XLPRA and NPHP5-LCA) that have been previously successfully treated by AAV mediated gene augmentation therapy(33, 41, 42). Notably, in stark contrast to the high-level of expression in untreated regions in retinas of the two RPGR-XLPRA models (XLPRA1 and XLPRA2), PRLΔE1 was not expressed within the AAV-RPGR treated area (treated at 28- and 5-weeks of age, assessed at 49- and 33- weeks post-treatment, respectively) (FIG.4A). Similarly, in the NPHP5-LCA retinas, PRLΔE1 expression was remarkably reduced within the AAV-NPHP5 treated (at 6 weeks of age) retinal area when assessed 27 weeks post-treatment, compared to the untreated retina (FIG. 4B). As expression of PRLΔE1 is associated with rod disease in the protracted phase of IRDs and can be suppressed by restoring PR to normal state following gene therapy, it raised the intriguing possibility that PRLΔE1 itself could be contributing to disease. Knockdown of PRLΔE1 expression confers transient protection to photoreceptors. To determine if PRLΔE1 expression is a cause or an effect of the disease process, we used RNA interference to knockdown PRLΔE1 expression in PDE6β-RCD1 and RPGR- XLPRA2 retinas. Three different targeting shRNAs driven by the ubiquitous H1 promoter were tested in vitro in HEK293 cells co-transfected with a plasmid expressing PRLΔE1 (FIG.11A and FIG.11B). The shRNA showing the highest efficacy (shRNA2, ~70% knockdown) was selected for packaging in AAV2 / 5 vector for sustained expression after subretinal delivery in canine retinas. AAV2 / 5-shRNAPRLΔE1was delivered subretinally in one PDE6β-RCD1 (age: 5 weeks) and two RPGR-XLPRA2 (age: 7 weeks) dogs at ages corresponding to the early acute phase of cell death and start of PRLΔE1 expression in surviving PRs in these models(23-25). To assess the impact of shRNA-mediated PRLΔE1 knockdown on retinal structure and gene expression, we used in vivo imaging and histochemical analysis at two time points. Confocal scanning laser ophthalmoscopy and spectral domain optical coherence (cSLO / OCT) were utilized to monitor retinal structure. In normal retinas, a hyporeflective layer corresponding to the ONL was evident in cross-sectional OCT images (FIG.5). Quantitative ONL thickness maps were generated across wide expanses of the retina. These maps revealed preserved ONL in the treated areas for all three dogs at 5 weeks post injection (PI). The ONL was thicker in the treated regions, clearly demarcated from untreated areas both on topographic representation as well as on representative cross-sections. However, we noted a thinning of the inner segment / outer segment (IS / OS or EZ) layer within the treated areas. One RPGR-XLPRA2 dog was terminated at this point for structural / expression analysis. For extended evaluation, cSLO / OCT imaging was continued up to 9 weeks PI in the PDE6β- RCD1 dog and up to 11 weeks PI in the remaining RPGR-XLPRA2 dog. Over time, there appeared to be progressive thinning of the ONL layer both in treated and untreated areas, prompting termination of the study at these timepoints. Quantitative-PCR analysis showed approximately 80% knockdown at 5-weeks PI and nearly 95% reduction in PRLΔE1 mRNA at 11-weeks PI in the shRNA treated area in the two RPGR-XLPRA2 dogs (FIG.6A). This reduction was confirmed by RNA-ISH in the PDE6β- RCD1 dog (FIG.6C). Immunohistochemistry performed in the RPGR-XLPRA2 dog terminated at 5 weeks PI confirmed that the ONL was thicker in the shRNA-treated area compared to the untreated areas. PRL-ISH indicated a qualitative reduction in PRLΔE1 expression in the treated area where the ONL thickness was maintained. However, knockdown of PRLΔE1 was associated with a shortening of IS and OS and did not correct opsin mislocalization in rods. Surprisingly, in the dogs treated for longer duration, we noted a loss of arrestin-3 (ARR3) staining, a marker of cone PRs, within the treated area, suggesting that PRLΔE1 knockdown caused a loss of cone cell viability (FIG.7B). Thus, while shRNAPRLΔE1mediated PRLΔE1 knockdown was protective at first, its longer-term protection was compromised by an unexpected loss of cones in treated retinas. PRLΔE1 shRNA has a potential non-specific toxic effect that is detrimental to photoreceptor survival. Since cones do not express PRLΔE1, we hypothesized that cone cell death following shRNA treatment was due to either the loss of PRLΔE1 in the diseased rods, or a non-specific effect of this particular shRNAPRLΔE1. To distinguish between these two possibilities, we subretinally injected a normal adult dog with AAV2 / 5-shRNAPRLΔE1at the same dose used in the mutant dogs. We presumed that since rods in the normal retina do not express PRLΔE1, shRNA injection would have no effect. However, at eight weeks PI, we observed a disruption in the ONL and loss of the IS / OS line by in vivo OCT imaging, as seen in the mutants (FIG. 7A). After termination, we also observed mislocalization of rod opsin and loss of cones (FIG. 7B). These results suggest that the cone cell death observed in the normal and mutant retinas after shRNA treatment is not due to silencing of PRLΔE1 in rods but is instead due to a non- specific toxic effect of our current shRNA. As PRLΔE1 knockdown early after injection preserved the ONL, future studies are warranted to determine if therapeutic targeting of PRLΔE1 has the potential to be protective in multiple forms of IRD when implemented with an improved gene silencing strategy. A defining feature of most IRDs is that despite being genetically identical, PRs do not die at the same time. Instead, as is observed in many animal models of RD(24, 25, 43, 44), there is a surge in PR cell death in the early stages of disease followed by a protracted phase of PR cell loss that provides a potential window for therapeutic intervention. Notably, this initial burst of cell death also promotes transcriptional changes in the surviving PRs that leads to upregulation of both pro-survival and pro-inflammatory molecules(24, 45-47), the balance of which may determine the fate of each PR in the later phase of degeneration. To identify factors that impact PR survival during the protracted phase of disease, we analyzed retinal transcripts and pathways that are altered in two early onset canine diseases, PDE6β-RCD1 and RPGR-XLPRA2, when more than 50% of the PRs are lost(46). One of the top upregulated transcripts in both diseases was PRL(46) which we subsequently showed to be the novel PRLΔE1 isoform(23). Furthermore, our previous studies showed that neither the full-length PRL nor the short isoform is expressed in normal retinas (Sudharsan et al., 2021, FIG.8A and FIG.8B) (23). In the current study, PRLΔE1 was consistently upregulated in rods during chronic stages of disease progression across several IRDs. This expression pattern implies that PRLΔE1 may play a role in the cellular response to prolonged stress and degeneration rather than being a direct mediator of cell death. The early preservation of ONL following PRLΔE1 knockdown further supports the notion that PRLΔE1 is not merely a byproduct of degeneration but may actively contribute to the progression of the disease. Its expression during the chronic phase of degeneration hints at a role in sustaining or exacerbating the degenerative process, potentially through mechanisms related to cellular stress responses or inflammatory pathways. Understanding the exact function of PRLΔE1 in these contexts could provide valuable insights into its potential as a therapeutic target for IRDs. While the precise modifications and transcription factors involved in PRLΔE1 expression are currently under investigation, alternative Transcription Start Sites (aTSS) have been identified in 52% of human protein-coding genes(48). Along with alternative splicing, aTSS significantly increase transcriptomic diversity, allowing for dynamic fine-tuning of the cellular transcriptome in response to various physiological and pathological stimuli(49-55). Epigenetic alterations such as DNA methylation and histone acetylation / deacetylation are common to many neurodegenerative diseases, including IRDs, and change the chromosomal accessibility to direct transcription from aTSS(56-58). We speculate that these epigenetic changes in IRDs may also direct the choice of aTSS in the PRL gene, thus inducing and upregulating PRLΔE1 as disease progresses. While we had previously found that PRLΔE1 expression was associated with disease, it remained to be determined if it played an active role in IRD or its expression was a consequence of the disease process. Our PRLΔE1 knockdown studies support a role for this transcript in promoting disease in the retina. This is in contrast with the anti-apoptotic role identified for the full length PRL in retina(10, 13), and the neurogenic and neuroprotective roles in the CNS(59). Given the limitations of our currently used shRNAPRLΔE1with demonstrated off-target effects even in normal retinas, we could not address in the present study the long-term effects that silencing PRLΔE1 expression may have on PR preservation. Efforts to develop a PRLΔE1 targeting shRNA without off target / non-specific deleterious effects are ongoing. It is currently unclear whether PRLΔE1 exerts its effect as RNA or protein. In our earlier publication(23), we showed that very small amounts of PRL protein could be identified in extracts from PDE6β-RCD1 and RPGR-XLPRA2 retinas using mass spectrometry. However, the low protein abundance and resulting poor peptide coverage precluded identification of the complete PRLΔE1 protein sequence. PRLΔE1 mRNA lacks a consensus Kozak sequence(60) at the first in-frame AUG codon, potentially explaining the extremely low levels of PRLΔE1 protein in extracts from mutant retinas. However, the protein structure prediction algorithm I-TASSER(61, 62) estimates that the short protein isoform can form a 4 helix bundle similar to the full length PRL, and we predict that, if expressed, the protein should be able to bind the PRL receptor, albeit with lower affinity(23). As PRLΔE1 protein was present at extremely low levels if present at all, it is also worth considering the potential role of PRLΔE1 mRNA as a regulatory non-coding RNA. Long non-coding RNAs (lncRNA) are abundantly expressed in CNS and neuroretina, have important roles in normal physiology and homeostasis, and are implicated in pathophysiology of neurodegenerative disorders including Alzheimer’s and Parkinson’s diseases, as well as in retinal degenerations(63-67). Transcripts longer than 500 nucleotides (earlier definition included transcripts >200 nt)(68) can be considered lncRNAs and at >850 nt, PRLΔE1 transcripts satisfy this first criterion. The second criterion for a transcript to be designated ncRNA is the exclusion of the defining characteristics of protein coding loci. However, as shown recently for many other lncRNAs(68), the PRLΔE1 transcript exhibits most attributes of mRNAs. As we cannot currently rule out the potential for this transcript to have both protein coding and regulatory functions(68, 69), our ongoing studies are aimed at defining the active PRLΔE1 entity. We acknowledge two limitations in this study: the small number of dogs in which ONL rescue was demonstrated by PRLΔE1 silencing and the lack of elucidation of the biological pathways through which PRLΔE1 may drive rod degeneration and loss. We intentionally limited the number of dogs recruited for this study after we observed off-target effects with the currently used shRNA. Further, PRLΔE1 isoform is not expressed in the rodent retinas (23), making dogs affected with IRDs valuable animal models in which the function of PRLΔE1 can be investigated. Future studies employing more specific knockdown of this isoform will aim to identify the pathways that are activated by PRLΔE1 in mutant retinas, and explore the translational potential of modulating its expression In summary, examination of PRLΔE1 mRNA expression in four different forms of canine IRD with different degeneration paradigms reveals its consistent expression in IRDs, regardless of the causative gene mutation. Moreover, a causative role for PRLΔE1 mRNA in disease progression is supported by our findings that expression is suppressed when disease progression is halted by corrective gene-specific therapy and that PRLΔE1 knockdown in at least two models of IRD has an initial protective effect on the PRs. Together, our findings suggest that PRLΔE1 knockdown / silencing represents an exciting novel “gene agnostic” therapeutic strategy for IRD. Future studies will include assessing the long-term outcome of PRLΔE1 knockdown on preservation of PRs and identification of the specific pathways through which PRLΔE1 modulates PR survival. Example 3: Knockdown of human PRLΔE1 (hPRLΔE1) using DsiRNAs in HEK293 Cells DsiRNAs (Dicer siRNAs) were evaluated for their ability to knock down human PRLΔE1 (hPRLΔE1) in vitro. HEK293 cells were transfected with pCMVTag5a-hPRLΔE1- mCherry to exogenously express hPRLΔE1. Five different siRNAs were introduced to these cells, and knockdown efficiency was assessed 24 hours post-transfection using qPCR analysis. The experiment was conducted independently in four separate trials to confirm the knockdown efficiencies. The results are presented in FIG.12. Asterisks above the bars indicate significant knockdown, with a p-value of < 0.05 when compared to cells expressing hPRLΔE1 without any siRNA treatment. All tested siRNAs demonstrated effective knockdown and show promise for potential in vivo applications. Additionally, the specific siRNA sequences and their targeted regions, are illustrated below. References 1. Ben-Jonathan N, Hugo ER, Brandebourg TD, LaPensee CR. Focus on prolactin as a metabolic hormone. Trends Endocrinol Metab.2006;17(3):110-6. 2. Bernard V, Young J, Binart N. Prolactin - a pleiotropic factor in health and disease. Nat Rev Endocrinol.2019;15(6):356-65. 3. Triebel J, Bertsch T, Bollheimer C, Rios-Barrera D, Pearce CF, Hufner M, et al. Principles of the prolactin / vasoinhibin axis. Am J Physiol Regul Integr Comp Physiol. 2015;309(10):R1193-203. 4. Costanza M, Binart N, Steinman L, Pedotti R. Prolactin: a versatile regulator of inflammation and autoimmune pathology. Autoimmun Rev.2015;14(3):223-30. 5. Triebel J, Bertsch T, Clapp C. Prolactin and vasoinhibin are endogenous players in diabetic retinopathy revisited. Front Endocrinol (Lausanne).2022;13:994898. 6. Torner L. Actions of Prolactin in the Brain: From Physiological Adaptations to Stress and Neurogenesis to Psychopathology. Front Endocrinol (Lausanne).2016;7:25. 7. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin (PRL) and its receptor: actions, signal transduction pathways and phenotypes observed in PRL receptor knockout mice. Endocr Rev.1998;19(3):225-68. 8. O'Steen WK, Kraeer SL. Effects of hypophysectomy, pituitary gland homogenates and transplants, and prolactin on photoreceptor destruction. Invest Ophthalmol Vis Sci. 1977;16(10):940-6. 9. Arnold E, Rivera JC, Thebault S, Moreno-Paramo D, Quiroz-Mercado H, Quintanar- Stephano A, et al. High levels of serum prolactin protect against diabetic retinopathy by increasing ocular vasoinhibins. Diabetes.2010;59(12):3192-7. 10. Arnold E, Thebault S, Baeza-Cruz G, Arredondo Zamarripa D, Adan N, Quintanar- Stephano A, et al. The hormone prolactin is a novel, endogenous trophic factor able to regulate reactive glia and to limit retinal degeneration. J Neurosci.2014;34(5):1868-78. 11. Triebel J, Macotela Y, de la Escalera GM, Clapp C. Prolactin and vasoinhibins: Endogenous players in diabetic retinopathy. IUBMB Life.2011;63(10):806-10. 12. Froland A, Hagen C, Lauritzen E. Diabetic retinopathy and prolactin. Lancet. 1977;1(8001):45. 13. Melendez Garcia R, Arredondo Zamarripa D, Arnold E, Ruiz-Herrera X, Noguez Imm R, Baeza Cruz G, et al. Prolactin protects retinal pigment epithelium by inhibiting sirtuin 2-dependent cell death. EBioMedicine.2016;7:35-49. 14. Thebault S. Potential mechanisms behind the antioxidant actions of prolactin in the retina. Exp Eye Res.2017;160:56-61. 15. Aranda J, Rivera JC, Jeziorski MC, Riesgo-Escovar J, Nava G, Lopez-Barrera F, et al. Prolactins are natural inhibitors of angiogenesis in the retina. Invest Ophthalmol Vis Sci. 2005;46(8):2947-53. 16. Clapp C, Thebault S, Macotela Y, Moreno-Carranza B, Triebel J, Martinez de la Escalera G. Regulation of blood vessels by prolactin and vasoinhibins. Adv Exp Med Biol. 2015;846:83-95. 17. Diaz-Lezama N, Wu Z, Adan-Castro E, Arnold E, Vazquez-Membrillo M, Arredondo-Zamarripa D, et al. Diabetes enhances the efficacy of AAV2 vectors in the retina: therapeutic effect of AAV2 encoding vasoinhibin and soluble VEGF receptor 1. Lab Invest. 2016;96(3):283-95. 18. Robles-Osorio ML, Garcia-Franco R, Nunez-Amaro CD, Mira-Lorenzo X, Ramirez- Neria P, Hernandez W, et al. Basis and Design of a Randomized Clinical Trial to Evaluate the Effect of Levosulpiride on Retinal Alterations in Patients With Diabetic Retinopathy and Diabetic Macular Edema. Front Endocrinol (Lausanne).2018;9:242. 19. Ben-Jonathan N, Mershon JL, Allen DL, Steinmetz RW. Extrapituitary prolactin: distribution, regulation, functions, and clinical aspects. Endocr Rev.1996;17(6):639-69. 20. Marano RJ, Ben-Jonathan N. Minireview: Extrapituitary prolactin: an update on the distribution, regulation, and functions. Mol Endocrinol.2014;28(5):622-33. 21. Rivera JC, Aranda J, Riesgo J, Nava G, Thebault S, Lopez-Barrera F, et al. Expression and cellular localization of prolactin and the prolactin receptor in mammalian retina. Exp Eye Res.2008;86(2):314-21. 22. Garza-Rodriguez ML, Rodriguez-Sanchez IP, Gonzalez-Alvarez R, Luna M, Burciaga-Flores CH, Alcorta-Nunez F, et al. Prolactin Expression in the Baboon (Papio hamadryas) Eye. Animals (Basel).2022;12(17). 23. Sudharsan R, Murgiano L, Tang HY, Olsen TW, Chavali VRM, Aguirre GD, et al. Short prolactin isoforms are expressed in photoreceptors of canine retinas undergoing retinal degeneration. Sci Rep.2021;11(1):460. 24. Beltran WA, Hammond P, Acland GM, Aguirre GD. A frameshift mutation in RPGR exon ORF15 causes photoreceptor degeneration and inner retina remodeling in a model of X- linked retinitis pigmentosa. Invest Ophthalmol Vis Sci.2006;47(4):1669-81. 25. Genini S, Beltran WA, Aguirre GD. Up-regulation of tumor necrosis factor superfamily genes in early phases of photoreceptor degeneration. PLoS One. 2013;8(12):e85408. 26. Ray K, Baldwin VJ, Acland GM, Blanton SH, Aguirre GD. Cosegregation of codon 807 mutation of the canine rod cGMP phosphodiesterase beta gene and rcd1. Invest Ophthalmol Vis Sci.1994;35(13):4291-9. 27. Suber ML, Pittler SJ, Qin N, Wright GC, Holcombe V, Lee RH, et al. Irish setter dogs affected with rod / cone dysplasia contain a nonsense mutation in the rod cGMP phosphodiesterase beta-subunit gene. Proc Natl Acad Sci U S A.1993;90(9):3968-72. 28. Aguirre GD, Rubin LF. Rod-cone dysplasia (progressive retinal atrophy) in Irish setters. J Am Vet Med Assoc.1975;166(2):157-64. 29. Zhang Q, Acland GM, Wu WX, Johnson JL, Pearce-Kelling S, Tulloch B, et al. Different RPGR exon ORF15 mutations in Canids provide insights into photoreceptor cell degeneration. Hum Mol Genet.2002;11(9):993-1003. 30. Zeiss CJ, Acland GM, Aguirre GD. Retinal pathology of canine X-linked progressive retinal atrophy, the locus homologue of RP3. Invest Ophthalmol Vis Sci.1999;40(13):3292- 304. 31. Downs LM, Scott EM, Cideciyan AV, Iwabe S, Dufour V, Gardiner KL, et al. Overlap of abnormal photoreceptor development and progressive degeneration in Leber congenital amaurosis caused by NPHP5 mutation. Hum Mol Genet.2016;25(19):4211-26. 32. Goldstein O, Mezey JG, Schweitzer PA, Boyko AR, Gao C, Bustamante CD, et al. IQCB1 and PDE6B mutations cause similar early onset retinal degenerations in two closely related terrier dog breeds. Invest Ophthalmol Vis Sci.2013;54(10):7005-19. 33. Beltran WA, Cideciyan AV, Lewin AS, Iwabe S, Khanna H, Sumaroka A, et al. Gene therapy rescues photoreceptor blindness in dogs and paves the way for treating human X- linked retinitis pigmentosa. Proc Natl Acad Sci U S A.2012;109(6):2132-7. 34. Sidjanin DJ, Lowe JK, McElwee JL, Milne BS, Phippen TM, Sargan DR, et al. Canine CNGB3 mutations establish cone degeneration as orthologous to the human achromatopsia locus ACHM3. Hum Mol Genet.2002;11(16):1823-33. 35. Yeh CY, Goldstein O, Kukekova AV, Holley D, Knollinger AM, Huson HJ, et al. Genomic deletion of CNGB3 is identical by descent in multiple canine breeds and causes achromatopsia. BMC Genet.2013;14:27. 36. Beltran WA, Acland GM, Aguirre GD. Age-dependent disease expression determines remodeling of the retinal mosaic in carriers of RPGR exon ORF15 mutations. Invest Ophthalmol Vis Sci.2009;50(8):3985-95. 37. Kijas JW, Cideciyan AV, Aleman TS, Pianta MJ, Pearce-Kelling SE, Miller BJ, et al. Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa. Proc Natl Acad Sci U S A. 2002;99(9):6328-33. 38. Cideciyan AV, Jacobson SG, Aleman TS, Gu D, Pearce-Kelling SE, Sumaroka A, et al. In vivo dynamics of retinal injury and repair in the rhodopsin mutant dog model of human retinitis pigmentosa. Proc Natl Acad Sci U S A.2005;102(14):5233-8. 39. Sudharsan R, Simone KM, Anderson NP, Aguirre GD, Beltran WA. Acute and Protracted Cell Death in Light-Induced Retinal Degeneration in the Canine Model of Rhodopsin Autosomal Dominant Retinitis Pigmentosa. Invest Ophthalmol Vis Sci. 2017;58(1):270-81. 40. Marsili S, Genini S, Sudharsan R, Gingrich J, Aguirre GD, Beltran WA. Exclusion of the unfolded protein response in light-induced retinal degeneration in the canine T4R RHO model of autosomal dominant retinitis pigmentosa. PLoS One.2015;10(2):e0115723. 41. Beltran WA, Cideciyan AV, Iwabe S, Swider M, Kosyk MS, McDaid K, et al. Successful arrest of photoreceptor and vision loss expands the therapeutic window of retinal gene therapy to later stages of disease. Proc Natl Acad Sci U S A.2015;112(43):E5844-53. 42. Aguirre GD, Cideciyan AV, Dufour VL, Ripolles-Garcia A, Sudharsan R, Swider M, et al. Gene therapy reforms photoreceptor structure and restores vision in NPHP5-associated Leber congenital amaurosis. Mol Ther.2021;29(8):2456-68. 43. Arango-Gonzalez B, Trifunovic D, Sahaboglu A, Kranz K, Michalakis S, Farinelli P, et al. Identification of a common non-apoptotic cell death mechanism in hereditary retinal degeneration. PLoS One.2014;9(11):e112142. 44. LaVail MM, Nishikawa S, Steinberg RH, Naash MI, Duncan JL, Trautmann N, et al. Phenotypic characterization of P23H and S334ter rhodopsin transgenic rat models of inherited retinal degeneration. Exp Eye Res.2018;167:56-90. 45. Samardzija M, Wariwoda H, Imsand C, Huber P, Heynen SR, Gubler A, et al. Activation of survival pathways in the degenerating retina of rd10 mice. Exp Eye Res. 2012;99:17-26. 46. Sudharsan R, Beiting DP, Aguirre GD, Beltran WA. Involvement of Innate Immune System in Late Stages of Inherited Photoreceptor Degeneration. Sci Rep.2017;7(1):17897. 47. Yoshida N, Ikeda Y, Notomi S, Ishikawa K, Murakami Y, Hisatomi T, et al. Clinical evidence of sustained chronic inflammatory reaction in retinitis pigmentosa. Ophthalmology. 2013;120(1):100-5. 48. Kimura K, Wakamatsu A, Suzuki Y, Ota T, Nishikawa T, Yamashita R, et al. Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes. Genome Res.2006;16(1):55-65. 49. Pal S, Gupta R, Kim H, Wickramasinghe P, Baubet V, Showe LC, et al. Alternative transcription exceeds alternative splicing in generating the transcriptome diversity of cerebellar development. Genome Res.2011;21(8):1260-72. 50. Popova EY, Salzberg AC, Yang C, Zhang SS, Barnstable CJ. Identification and prediction of alternative transcription start sites that generate rod photoreceptor-specific transcripts from ubiquitously expressed genes. PLoS One.2017;12(6):e0179230. 51. Roni V, Carpio R, Wissinger B. Mapping of transcription start sites of human retina expressed genes. BMC Genomics.2007;8:42. 52. Zhang X, Chen MH, Wu X, Kodani A, Fan J, Doan R, et al. Cell-Type-Specific Alternative Splicing Governs Cell Fate in the Developing Cerebral Cortex. Cell. 2016;166(5):1147-62 e15. 53. Makhnovskii PA, Gusev OA, Bokov RO, Gazizova GR, Vepkhvadze TF, Lysenko EA, et al. Alternative transcription start sites contribute to acute-stress-induced transcriptome response in human skeletal muscle. Hum Genomics.2022;16(1):24. 54. Mao P, Shen Y, Mao X, Liu K, Zhong J. The single-cell landscape of alternative transcription start sites of diabetic retina. Exp Eye Res.2023;233:109520. 55. Thorsen K, Schepeler T, Oster B, Rasmussen MH, Vang S, Wang K, et al. Tumor- specific usage of alternative transcription start sites in colorectal cancer identified by genome-wide exon array analysis. BMC Genomics.2011;12:505. 56. Lu H, Liu X, Deng Y, Qing H. DNA methylation, a hand behind neurodegenerative diseases. Front Aging Neurosci.2013;5:85. 57. Miller AL, James RE, Harvey AR, Trifunovic D, Carvalho LS. The role of epigenetic changes in the pathology and treatment of inherited retinal diseases. Front Cell Dev Biol. 2023;11:1224078. 58. Orozco LD, Owen LA, Hofmann J, Stockwell AD, Tao J, Haller S, et al. A systems biology approach uncovers novel disease mechanisms in age-related macular degeneration. Cell Genom.2023;3(6):100302. 59. Costanza M, Pedotti R. Prolactin: Friend or Foe in Central Nervous System Autoimmune Inflammation? Int J Mol Sci.2016;17(12). 60. Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J Mol Biol.1987;196(4):947-50. 61. Roy A, Kucukural A, Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction. Nat Protoc.2010;5(4):725-38. 62. Yang J, Yan R, Roy A, Xu D, Poisson J, Zhang Y. The I-TASSER Suite: protein structure and function prediction. Nat Methods.2015;12(1):7-8. 63. Carrella S, Banfi S, Karali M. Sophisticated Gene Regulation for a Complex Physiological System: The Role of Non-coding RNAs in Photoreceptor Cells. Front Cell Dev Biol.2020;8:629158. 64. Salta E, De Strooper B. Noncoding RNAs in neurodegeneration. Nat Rev Neurosci. 2017;18(10):627-40. 65. Salvatori B, Biscarini S, Morlando M. Non-coding RNAs in Nervous System Development and Disease. Front Cell Dev Biol.2020;8:273. 66. Shi X, Xue Z, Ye K, Yuan J, Zhang Y, Qu J, et al. Roles of non-coding RNAs in eye development and diseases. Wiley Interdiscip Rev RNA.2023;14(5):e1785. 67. Song J, Kim YK. Targeting non-coding RNAs for the treatment of retinal diseases. Mol Ther Nucleic Acids.2021;24:284-93. 68. Mattick JS, Amaral PP, Carninci P, Carpenter S, Chang HY, Chen LL, et al. Long non-coding RNAs: definitions, functions, challenges and recommendations. Nat Rev Mol Cell Biol.2023;24(6):430-47. 69. Li J, Liu C. Coding or Noncoding, the Converging Concepts of RNAs. Front Genet. 2019;10:496. 70. Dufour VL, Yu Y, Pan W, Ying GS, Aguirre GD, Beltran WA. In-vivo longitudinal changes in thickness of the postnatal canine retina. Exp Eye Res.2020;192:107926. All documents cited in this specification are incorporated herein by reference. US Provisional Patent Application No.63 / 592,346, filed October 23, 2023, is incorporated herein by reference. While the invention has been described with reference to particular embodiments, it will be appreciated that modifications can be made without departing from the spirit of the invention. Such modifications are intended to fall within the scope of the appended claims.
Claims
WHAT IS CLAIMED IS:
1. A method of treating retinal degeneration in a subject in need thereof, the method comprising reducing PRLΔE1 expression or activity in an eye of the subject.
2. The method of claim 1, comprising administering a nucleotide sequence that encodes a nucleic acid that targets a portion of PRLΔE1.
3. The method of claim 1 or 2, wherein the nucleic acid is an siRNA, miRNA, shRNA, ASO, or guide RNA.
4. The method of any one of claims 1 to 3, wherein the nucleic acid targets a sequence comprising a 10-20 nucleotide portion of: GGTCCCTCCTGCTGCTGCTGGTGTCAAACCTGCTCCTGTGCCAGAGCGTGGCCCC CTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTG TTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTCTCCTCAGAAATGTT CAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACCAAGGCCAT CAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCCCA ACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGG AATGAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCG GAGGCTATCCTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTA GAGGGCATGGAGCTGATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAG ATCTACCCTGTCTGGTCGGGACTTCCATCCCTGCAGATGGCTGATGAAGAGTCTC GCCTTTCTGCTTATTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAAAATC GACAATTATCTCAAGCTCCTGAAGTGCCGAATCATCCACAACAACAACTGCTAAG CCCACATCCATTTCATCTATTTCTGAGAAGGTCCTTAATGATCCGTTCCATTGCAA GCTTCTTTTAGTTGTATCTCTTTTGAATCCATGCTTGGGTGTAACAGGTCTCCTCTT AAAAAATAAAAACTGACTCCTTAGAGACATCAAAATCTAAAA 5. The method of any one of claims 1 to 4, wherein the nucleic acid is an siRNA, miRNA, shRNA, ASO, or guide RNA that targets a sequence comprising nucleotides 277-302, 292-317, 267-317, 162-187, 622-647, 305-330, 320-345, 295-320, 188-231, 194-219, or 333-358.
6. The method of any one of claims 1 to 3, wherein the nucleic acid targets a sequence comprising a 10-20 nucleotide portion of: ATGTTCAACGAATTTGATAAAAGGTATGCCCAGGGCCGGGGGTTCATTACCAAG GCCATCAACAGCTGTCACACCTCCTCCCTCTCTACCCCTGAAGACAAGGAGCAAG CCCAACAGATCCACCATGAAGACCTTCTGAATCTGATACTGAGGGTGCTGCGCTC CTGGAATGACCCCCTGTATCATCTAGTCACAGAAGTGCGGGGGATGCAAGAAGC CCCAGATGCAATTCTATCCAGAGCCATAGAGATTGAAGAACAAAACAGAAGACT TCTAGAGGGTATGGAGAAGATAGTTGGCCAGGTTCATCCTGGAATCAGAGAAAA TGAGGTCTACTCTGTCTGGTCAGGACTTCCATCCCTGCAGATGGCGGATGAAGAC ACTCGCCTTTTTGCTTTTTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAA GATTGACAATTATCTCAAGCTCCTGAAGTGCCGAATCGTCTACGACAGCAACTGC TAAGCCCACATCCATTCTATCTATTTCTGGGAAGGTTCTTAATGATCCGTCCCATC GCAACCTTCTCTTAGCTTTATAGCTTTTTAATGCATGCTTGGGTGTAATGGGTCTC ATCTTAAAAAATAAAAACTGACTCCTTAGAGATGTCGAAACAGAAAAAAAAATC AAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 7. The method of claim 6, wherein the nucleic acid is an siRNA or shRNA of Table 1 or 2.
8. The method of any one of claims 1 to 7, comprising administering a sequence that encodes a nuclease that targets a portion of PRLΔE1.
9. The method of claim 8, wherein the nuclease is a Cas enzyme.
10. The method of claim 9, wherein the nuclease is a Cas9 or Cas13 enzyme.
11. The method of any one of claims 1 to 10, comprising delivering a vector that encodes the nucleic acid.
12. The method of claim 11, wherein the vector is an AAV vector.
13. The method of any one of claims 1 to 12, further comprising administering a vectorthat comprises a nucleotide sequence that encodes a functional ocular protein.
14. The method according to claim 13, wherein the nucleotide sequences that encode the nucleic acid and the functional ocular protein are comprised in the same vector.
15. The method of claim 13, wherein the nucleotide sequences that encode the nucleic acid and the functional ocular protein are comprised in different vectors.
16. The method of any one of claims 12 to 15, wherein the AAV vector has an AAV2, AAV5, AAV7m8, or AAV8 capsid.
17. The method of any one of claims 1 to 16, wherein the subject has retinitis pigmentosa (autosomal dominant, autosomal recessive, X-linked), Leber's congenital amaurosis, cone or cone-rod dystrophy, Usher syndrome, macular degeneration, Stargardt's disease, age-related macular degeneration, trauma-induced retinal degeneration, or retinal detachment.
18. The method of any one of claims 1 to 16, wherein a composition comprising the nucleotide sequence that encodes the nucleic acid is administered to an eye of the subject.
19. The method of claim 18, wherein the composition is administered via subretinal injection or intravitreal injection.
20. A composition comprising a nucleotide sequence that encodes a nucleic acid that targets a portion of PRLΔE1.
21. The composition of claim 20, wherein the nucleic acid is an siRNA, miRNA, shRNA, ASO, or guide RNA.
22. The composition of any one of claims 20 to 21, wherein the nucleic acid targets a sequence comprising a 10-20 nucleotide portion of: GGTCCCTCCTGCTGCTGCTGGTGTCAAACCTGCTCCTGTGCCAGAGCGTGGCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAGGTGACCCTTCGAGACCTG TTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTCTCCTCAGAAATGTT CAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACCAAGGCCAT CAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCCCA ACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGG AATGAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCG GAGGCTATCCTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTA GAGGGCATGGAGCTGATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAG ATCTACCCTGTCTGGTCGGGACTTCCATCCCTGCAGATGGCTGATGAAGAGTCTC GCCTTTCTGCTTATTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAAAATC GACAATTATCTCAAGCTCCTGAAGTGCCGAATCATCCACAACAACAACTGCTAAG CCCACATCCATTTCATCTATTTCTGAGAAGGTCCTTAATGATCCGTTCCATTGCAA GCTTCTTTTAGTTGTATCTCTTTTGAATCCATGCTTGGGTGTAACAGGTCTCCTCTT AAAAAATAAAAACTGACTCCTTAGAGACATCAAAATCTAAAA 23. The composition of claim 22, wherein the nucleic acid is an siRNA that targets a sequence comprising nucleotides 277-302, 292-317, 267-317, 162-187, 622-647, 305-330, 320-345, 295-320, 188-231, 194-219, or 333-358.
24. The composition of any one of claims 20 to 21, wherein the nucleic acid targets a sequence comprising a 10-20 nucleotide portion of: ATGTTCAACGAATTTGATAAAAGGTATGCCCAGGGCCGGGGGTTCATTACCAAG GCCATCAACAGCTGTCACACCTCCTCCCTCTCTACCCCTGAAGACAAGGAGCAAG CCCAACAGATCCACCATGAAGACCTTCTGAATCTGATACTGAGGGTGCTGCGCTC CTGGAATGACCCCCTGTATCATCTAGTCACAGAAGTGCGGGGGATGCAAGAAGC CCCAGATGCAATTCTATCCAGAGCCATAGAGATTGAAGAACAAAACAGAAGACT TCTAGAGGGTATGGAGAAGATAGTTGGCCAGGTTCATCCTGGAATCAGAGAAAA TGAGGTCTACTCTGTCTGGTCAGGACTTCCATCCCTGCAGATGGCGGATGAAGAC ACTCGCCTTTTTGCTTTTTATAACCTGCTCCACTGCCTACGCAGGGATTCACATAA GATTGACAATTATCTCAAGCTCCTGAAGTGCCGAATCGTCTACGACAGCAACTGC TAAGCCCACATCCATTCTATCTATTTCTGGGAAGGTTCTTAATGATCCGTCCCATC GCAACCTTCTCTTAGCTTTATAGCTTTTTAATGCATGCTTGGGTGTAATGGGTCTC ATCTTAAAAAATAAAAACTGACTCCTTAGAGATGTCGAAACAGAAAAAAAAATC AAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA25. The composition of claim 24, wherein the nucleic acid is an siRNA or shRNA of Table 1 or 2.
26. The composition of any one of claims 20 to 25, wherein the nucleotide sequence encodes a nuclease that targets a portion of PRLΔE1.
27. The composition of claim 26, wherein the nuclease is a Cas enzyme.
28. The composition of claim 27, wherein the nuclease is a Cas9 or Cas13 enzyme.
29. The composition of any one of claims 20 to 28, comprising a vector that encodes the nucleic acid.
30. The composition of claim 29, wherein the vector is an AAV vector.
31. The composition of any one of claims 20 to 30, wherein the vector further comprises a nucleic acid that encodes a functional ocular protein.
32. The composition of any one of claims 30 or 31, wherein the AAV vector has an AAV2, AAV5, AAV7m8, or AAV8 capsid.
33. The composition of any one of claims 20 to 32, further comprising one or more pharmaceutically acceptable carriers, adjuvants, excipients, or diluents.