Multiplex panel for detecting viral, bacterial, and parasitic nucleic acids

Abstract

Described herein are compositions, methods, and kits for detecting diarrhea causing pathogens from patient, food, or environmental samples. One embodiment described herein is primer pairs and probes for multiplex polymerase chain reaction (PCR) based assays for the detection of gastrointestinal pathogens, such as Adenovirus, Astrovirus, Rotavirus, Norovirus, Sapovirus, Campylobacter species, Clostridium difficile, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC), Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Plesiomonas shigelloides, Salmonella species, Yersinia enterocolitica, Vibrio species, Cryptosporidium species, Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. Other embodiments include methods and kits for detecting gastrointestinal pathogens.

Description

[0001] MULTIPLEX PANEL FOR DETECTING VIRAL, BACTERIAL, AND PARASITIC NUCLEIC ACIDS CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.63 / 593,282, filed on October 26, 2023, which is incorporated by reference herein in its entirety. REFERENCE TO SEQUENCE LISTING This application was filed with a Sequence Listing in ST.26 XML format accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “215686-0092-WO01_sequence_listing_xml_22-OCT-2024.xml,” was created on October 22, 2024, contains 885 sequences, has a file size of 784 kilobytes (802,816 bytes), and is incorporated by reference in its entirety into the specification. BACKGROUND Bacterial gastrointestinal (GI) pathogens such as Adenovirus, Astrovirus, Rotavirus, Norovirus, Sapovirus, Campylobacter species, Clostridium difficile, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin- producing E. coli (STEC), Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Plesiomonas shigelloides, Salmonella species, Yersinia enterocolitica, Vibrio species, Cryptosporidium species, Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis or Giardia lamblia are the leading causes of acute gastroenteritis, hemorrhagic colitis, and fatal typhoid fever. The presence of GI pathogens is correlated to plethora of highly impactful diseases and an increase in antibiotic resistance. Accordingly, detection of the etiological agents of acute bacterial diarrhea is important for the management of the patient and for public health interventions, while key clinical decisions are driven by bacterial gastrointestinal identification. Salmonella infection can cause a variable clinical disease starting from a mild, subclinical infection, or lead to severe systemic infection, typhoid fever. Salmonella sp. invades the host through the colonic epithelial cells, especially M cells using a type III secretion system. They are also able to survive within phagosomes of macrophages and evade the host immune system by several ways. Campylobacter jejuni and Campylobacter coli are among the large Campylobacter family predominant human stool pathogens causing watery diarrhea, fever, and typically hard abdominal pain. Campylobacter upsaliensis is the most important Campylobacter species after C. jejuni and C. coli. Shigella and EIEC are genetically closely related. Both of these organisms invade the colonic epithelium mediated by the genes located in virulence plasmid pINV coding e.g., Ipa proteins and their transcription regulator invE. Accordingly, there is a need to detect pathogens in a single assay that would be sensitive, specific for the targets and not cross-reactive. The need is solved by the presently disclosed method that is directed to provide the detection of presence or absence of one or more of Adenovirus, Astrovirus, Rotavirus, Norovirus, Sapovirus, Campylobacter species, Clostridium difficile, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC), Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Plesiomonas shigelloides, Salmonella species, Yersinia enterocolitica, Vibrio species, Cryptosporidium species, Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a multiplex qPCR assay. SUMMARY One embodiment described herein is a method for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample, the method comprising the steps of: creating a reaction mixture containing the sample and a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome; and subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin- producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in the sample. In one aspect, the Primer Pair Sets comprise the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73– 74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118– 119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175– 176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343– 344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469– 470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the generating of the at least one amplicon comprises performing PCR. In another aspect, the at least one amplicon is one selected from: an amplicon specific for Adenovirus produced using at least one primer pair selected from SEQ ID NO: 1–2 or 4–5, and a sequence selected from SEQ ID NO: 3 or 6 an amplicon specific for Astrovirus produced using at least one primer pair selected from SEQ ID NO: 7–8, 10–11, or 13– 14, and a sequence selected from SEQ ID NO: 9, 12, or 15 an amplicon specific for Norovirus GI produced using at least one primer pair selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64– 65, 67–68, 70–71, or 73–74, and a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 an amplicon specific for Norovirus GII produced using at least one primer pair selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101, and a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 an amplicon specific for Rotavirus A produced using at least one primer pair selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121– 122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140, and a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 an amplicon specific for Rotavirus B produced using at least one primer pair selected from SEQ ID NO: 142– 143, 145–146, or 148–149, and a sequence selected from SEQ ID NO: 144, 147, or 150 an amplicon specific for Rotavirus C produced using at least one primer pair selected from SEQ ID NO: 151–152 or 154–155, and a sequence selected from SEQ ID NO: 153 or 156 an amplicon specific for Sapovirus 1 produced using at least one primer pair selected from SEQ ID NO: 157– 158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179, and a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 an amplicon specific for Sapovirus 2 produced using at least one primer pair selected from SEQ ID NO: 181–182, 184– 185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224, and a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis produced using at least one primer pair selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257, and a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 an amplicon specific for Clostridium difficile (toxin A / B) produced using at least one primer pair selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286– 287, 289–290, 292–293, 295–296, 298–299, or 301–302, and a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 an amplicon specific for Plesiomonas shigelloides produced using at least one primer pair selected from SEQ ID NO: 304–305, 307–308, or 310–311, and a sequence selected from SEQ ID NO: 306, 309, or 312 an amplicon specific for Salmonella sp. produced using at least one primer pair selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326, and a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349– 350, 352–353, 355–356, 358–359, or 361–362, and a sequence selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus produced using at least one primer pair selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392, and a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 an amplicon specific for Enteroaggregative E. coli (EAEC) produced using at least one primer pair selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406– 407, 409–410, or 412–413, and a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 an amplicon specific for , Enteropathogenic E. coli (EPEC) produced using at least one primer pair selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458, and a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 an amplicon specific for Enterotoxigenic E. coli (ETEC) produced using at least one primer pair selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485, and a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m produced using at least one primer pair selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500, and a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) produced using at least one primer pair selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536, and a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 an amplicon specific for E. coli O157 produced using at least one primer pair selected from SEQ ID NO: 538–539 or 541–542, and a sequence selected from SEQ ID NO: 540 or 543 an amplicon specific for Listeria monocytogenes produced using at least one primer pair selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557, and a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 an amplicon specific for Cryptosporidium sp. produced using at least one primer pair selected from SEQ ID NO: 559–560, 562–563, or 565–566, and a sequence selected from SEQ ID NO: 561, 564, 567 an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581, and a sequence selected from SEQ ID NO: 570, 573, 576, 579, 582 an amplicon specific for Entamoeba histolytica produced using at least one primer pair selected from SEQ ID NO: 583–584, 586–587, or 589–590, and a sequence selected from SEQ ID NO: 585, 588, 591; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia produced using at least one primer pair selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607– 608, 610–611, or 613–614, and a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the at least one amplicon is one selected from: an amplicon specific for Adenovirus having a sequence selected from SEQ ID NO: 681 or 682 an amplicon specific for Astrovirus having a sequence selected from SEQ ID NO: 683, 684, or 685 an amplicon specific for Norovirus GI having a sequence selected from SEQ ID NO: 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705 an amplicon specific for Norovirus GII having a sequence selected from SEQ ID NO: 706, 707, 708, 709, 710, 711, 712, 713, or 714 an amplicon specific for Rotavirus A having a sequence selected from SEQ ID NO: 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, or 727 an amplicon specific for Rotavirus B having a sequence selected from SEQ ID NO: 728, 729, or 730 an amplicon specific for Rotavirus C having a sequence selected from SEQ ID NO: 731 or 732 an amplicon specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 733, 734, 735, 736, 737, 738, 739, or 740 an amplicon specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, or 755 an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, or 766 an amplicon specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, or 781 an amplicon specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 782, 783, or 784 an amplicon specific for Salmonella sp. having a sequence selected from SEQ ID NO: 785, 786, 787, 788, or 789 an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, or 801 an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 802, 803, 804, 805, 806, 807, 808, 809, 810, or 811 an amplicon specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 812, 813, 814, 815, 816, 817, or 818 an amplicon specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, or 833 an amplicon specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 834, 835, 836, 837, 838, 839, 840, 841, or 842 an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 843, 844, 845, 846, or 847 an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, or 859 an amplicon specific for E. coli O157 having a sequence selected from SEQ ID NO: 860 or 861 an amplicon specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 862, 863, 864, 865, or 866 an amplicon specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 867, 868, or 869 an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 870, 871, 872, 873, or 874 an amplicon specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 875, 876, or 877; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 878, 879, 880, 881, 882, 883, 884, or 885. In another aspect, the reaction mixture further comprises probes specific for the at least one amplicon. In another aspect, the reaction mixture further comprises probes pecific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649– 650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect, the probe comprises a fluorescent reporter. In another aspect, the probe comprises a quencher. In another aspect, the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect, the probe is labeled at or near the 3′-end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a composition for simultaneously determining the presence or absence of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia, comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin- producing E. coli (STEC) stx1 / stx2m genome at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome. In one aspect, the Primer Pair Sets comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28– 29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172– 173, 175–176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220– 221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343– 344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469– 470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the composition further comprises a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, Primer Pair Set F, Primer Pair Set G, Primer Pair Set H, Primer Pair Set I, Primer Pair Set J, Primer Pair Set K, Primer Pair Set L, Primer Pair Set M, Primer Pair Set N, Primer Pair Set O, Primer Pair Set P, Primer Pair Set Q, Primer Pair Set R, Primer Pair Set S, Primer Pair Set T, Primer Pair Set U, Primer Pair Set V, Primer Pair Set X, Primer Pair Set Y, or Primer Pair Set Z. In another aspect, the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the composition further comprises a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). In another aspect, the composition further comprises a sample. In another aspect, the composition further comprises at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample. In another aspect the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643– 644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect the probe contains a fluorescent reporter. In another aspect the probe contains a quencher. In another aspect the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a kit for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, or Giardia intestinalis, or Giardia lamblia in a sample, comprising the any of the compositions described herein. In one aspect, the kit further comprising any of the control compositions described herein. In another aspect, the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22– 23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106– 107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163– 164, 166–167, 169–170, 172–173, 175–176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211– 212, 214–215, 217–218, 220–221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241– 242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334– 335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367– 368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409– 410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451– 452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect, the kit further comprises a control plasmid comprising one or more target sequences selected from Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. In another aspect, the control plasmid comprises one or more of nucleic acid sequences of SEQ ID NO: 655–680. DESCRIPTION OF THE DRAWINGS FIG. 1A–B show work flows for Open Array (FIG. 1A) and TaqMan (FIG. 1B) multiplex assays as described herein. FIG.2 shows an exemplary sample extraction workflow using the MagMAX™ Microbiome Ultra Nucleic Acid Isolation Kit with Bead Plate (Thermo Fisher Scientific). DETAILED DESCRIPTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, immunology, microbiology, genetics, cell and tissue culture, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein. As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. As used herein, the terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified. As used herein, the term “or” can be conjunctive or disjunctive. As used herein, the term “and / or” refers to both the conjuctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely. As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol “~” means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1–2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments. As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process. As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of” or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifest. The polynucleotides described herein may include variants that have substitutions, deletions, and / or additions that can involve one or more nucleotides. Some embodiments described herein include nucleic acid molecules comprising polynucleotides having nucleotide sequences about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, and more preferably at least about 95–99% or 100% identical to (a) nucleotide sequences of SEQ ID NO: 1–615 and capable of being used as primers or probes as described herein; or (b) nucleotide sequences capable of hybridizing to the complement of any of the nucleotide sequences of SEQ ID NO: 1–615 and capable of being used as primers or probes as described herein. As used herein, a nucleotide having a nucleotide sequence at least 90–99% “identical” to a reference nucleotide sequence indicates that the nucleotide sequence is identical to the reference sequence except that the nucleotide sequence can include up to about 10-to-1 point mutations, additions, or deletions per each 100 nucleotides of the reference nucleotide sequence. In other words, to obtain a nucleotide having a nucleotide sequence at least 90–99% identical to a reference nucleotide sequence, up to 10% of the nucleotides in the reference sequence can be deleted, added, or substituted with another nucleotide, or a number of nucleotides up to 10% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5′- or 3′-terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. These may include standard nucleotides, modified nucleotides, fluorescent dyes, linkers, or other modifications. As described above, two or more polynucleotide sequences can be compared by determining their percent identity. The percent identity of two sequence is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. Alignment for nucleic acid sequences can be performed using by the global alignment method of Needleman and Wunsch, J. Mol. Biol.48 (3): 443-453 (1970) or the local homology algorithm of Smith and Waterman, Adv. Appl. Math.2: 482-489 (1981). Described herein are primers, primer sets, and probes designed for target sequences and compatible for use in a multiplex qPCR determining the presence of multiple diarrhea-causing pathogens. Multiplex PCR presents a challenge for quantitation of the pathogen DNA: the different amplicons compete for the same PCR reaction components (such as e.g., DNA polymerase and MgCl2) and this can compromise the quantitative comparison between samples. It is known in the art that there is bias in the amplification efficiencies between different template amounts or lengths so that e.g., short amplicons are favored in the expense of longer ones. At the same time, undesired cross-reactions of multiplex set oligo combinations must be avoided. Finding suitable primer and probe sequences for the detection of a diverse group of pathogenic microbes is far from trivial especially when designing multiplex set ups. Described herein are primer sets and probes for detecting the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. The selected primers and probes of the assay do not cross-react with other closely-related pathogens. The disclosed detection method and assay may contain internal process control, such as Bacillus atrophaeus (BA) or a universal RNA Spike In / Reverse Transcription Control (Xeno). In addition, the assay may have a real time PCR positive control. The probes that target genomic regions of different pathogens utilize three distinct fluorophores, while a fourth fluorophore is designated for the process control detection. Therefore, a multiplex qPCR assay is described herein, wherein the detection takes place in a single-well reaction, to meet the speed and high-throughput needs for rapid clinical gastrointestinal pathogen testing. When an exemplary “embodiment” or a particular “assay” is described herein, it will be understood that the features of that embodiment may be applicable to a composition (e.g., the particular physical components of an assay such as primers and / or probes), a kit (e.g., primers and / or probes and additional buffers, reagents, etc.), or a method (e.g., a process for detecting target nucleic acids) as appropriate. For simplicity, embodiments are presented by describing “assays,” but it will be understood that the associated methods for the assays, and the compositions for carrying out the assays (primers, probes, and primer sets), are also intended to be part of this disclosure. One embodiment described herein are primer pair sets, comprising one or more forward primers, reverse primers, and probes for detecting the presence or absence of one or more gastrointestinal pathogens. Various primer pair sets for detecting specific gastrointestinal pathogens are shown in Table 1. Table 1. Primer Pair Sets for Detecting Gastrointestinal Pathogens Primer Pair Set Organsim A Adenovirus F40 / 41 B Astrovirus C Norovirus GI D Norovirus GII E Rotavirus A F Rotavirus B G Rotavirus C H Sapovirus 1 of 2 I Sapovirus 2 of 2 JCampylobacter pool (Campylobacter coli, Campylobacter jejuni,Campylobacter upsaliensis)Clostridium difficile (toxin A / B) Plesiomonas shigelloides M Salmonella sp. N Yersinia enterocolitica O Vibrio pool (Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus) P Enteroaggregative E. coli (EAEC) Q Enteropathogenic E. coli (EPEC) R Enterotoxigenic E. coli (ETEC) S Shiga-like toxin-producing E. coli (STEC) stx1 / stx2 T Shigella / Enteroinvasive E. coli (EIEC) U E. coli O157 V Listeria monocytogenes W Cryptosporidium sp. X Cyclospora cayetanensis Y Entamoeba histolytica Z Giardia intestinalis or Giardia lamblia In one embodiment, Primer Pair Set A comprises one or more the primer pairs shown in Table 2, in a combination with a corresponding probe sequence: Table 2. Adenovirus Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID A NO NO NO1GCGCTAACGTAACCTACTTAGGCGGAGGAA TTGGTATGGGCCTTT TGTATTTGT 1 TGTCAATAAC2CC32ACAAATACAAGGTTAGTTATTGACATTCCT GGAAAGGCCCATACC CGTTAGCGC 4 CCGCCTAAGT5AA6In another embodiment, Primer Pair Set B comprises one or more the primer pairs shown in Table 3, in a combination with a corresponding probe sequence: Table 3. Astrovirus Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID B NO NO NO 1GACTCACAGAAGAGCGCTAGCCATCACACT AACTCCAT 7 TCTTTGGT8 CCCCTCCAAATGCG 92GACTCACAGAAGAGCGCTAGCCATCACACT AACTCCAT 10 TCTTTGGT11 CTCCCCTCCAAATGC 123CTCACGGACTGCAAACGGCCATTATTACTG GCA 13 ACCTCAACA14 CCCCTCCAAATGCG 15In another embodiment, Primer Pair Set C comprises one or more the primer pairs shown in Table 4, in a combination with a corresponding probe sequence: Table 4. Norovirus GI Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID C NO NO NO GCCATGTTCCGCTGGTCCTTAGACGCCATC 13CCAGCTCGGCAAGAGGGAAGCAGCAATTGC GTA 52 ACCAA53 TCTGCGCCGATAATG 5414CCAGCTCGGCAAGAG55GGAAGCAGCAATTGC 56TATCGGCGCAGACCA 57 one or more in Table 6, in a combination with a corresponding probe sequence: Table 6. Rotavirus A Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID E NO NO NO1GGAAATGAGTTCCAATAAATTTAGTAGAGT CAAAATCAAAATTCC ACTGGAGGAA 103 TGTTCCAAGTAATC104AATTTCT1052TAGGTACTACGCTTT1 GAGACTCTCTTGCCA CTGGCAGTCTCAACA TAAATCTTGATGCT 06 TTTCATCCAT107TAAT108TTTAAGAGAATAAAT ATTTTGTAAGTTCCA 3 TTCGATAATTCATCA109CCGGTGCGCTGTCTTATAC 110111GAT ATTTTC4GCAACAGTTGGACTT1GGTGACATTCGCCAA CACTGATTCACAAAC ACGTTACG 12 TAAAGTTTCA113TGC1145GAGTTTTAAACGCAT115CTTCAACTTCACCAC ATCACGCATCAATTT 117 In another embodiment, Primer Pair Set F comprises one or more the primer pairs shown in Table 7, in a combination with a corresponding probe sequence: Table 7. Rotavirus B Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID F NO NO NO 1TCTCAATGCCTCTAAATTATTACGTCTGA 142TGATCTGTTATGGCA TCTTGAGCAT143ACGGTGGCCTACATG GAAA1442GCAGATGTCGTATGT145CTTTTGATCATGACG CAGCTTAAATAATGT CTTGTACGTT146 3CGCTATCGGTGATCGGCGAATTTCGGATCA TCGTATCTCCCAAAT ACATTCTTTA 148 TCAGCAAA149ATG150In another embodiment, Primer Pair Set G comprises one or more the primer pairs shown in Table 8, in a combination with a corresponding probe sequence: Table 8. Rotavirus C Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID G NO NO NO1GAGAAACAAATACTGGTTGGGATCAATTCT CCTTGAGCATCAGTT CAAAATATCCAGCTA 151 GCAATATTTCTTGT152AATT1532GAGAAACAAATACTG154GTTGGGATCAATTCT 155CTTGAGCATCAGTTA 156 in Table 9, in a combination with a corresponding probe sequence: Table 9. Sapovirus 1 Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID H NO NO NO 1ACCCGTACACAAAACGACTGTGACTCTAAT ATCTTGCT 157 GTCCATTGCT158 ACCCGGCAAACATT 159GCTCTCGCCACCTACCCCTCCATTTCAAAC CCCAGTGAAGAGACC in Table 10, in a combination with a corresponding probe sequence: Table 10. Sapovirus 2 Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID I NO NO NO 1GGGTTGTGCGAATGTGCTGCAGCAATTGTT CTGGCAGCGACTGTT CATGAGTTA 181 GTGATG182G183 8ACAAAGGTAGGGTGTCGTGGGTTCTCTGGA TTGCACATCAAACTA TCACTTCAAA 202 ATGACA203CCC2049GCCTTTCCGTCCGACGAACGCCCTCCAGAG ACCTTGGTTACAATC CAT 205 TGT206CC20710GCCTTTCCGTCCGAC208GAACGCCCTCCAGAG 209CCTTGGTTACAATCC 210 1GTTATGCCGCTACTA2 ACAATAATAGCCGAA CCAACCATCTAGAAA GTATGGCTTT 26 CTTACACTGCTT227GTC2282GCTAAAGGTCCAATCCTCACTCACATATTC CAGGAGTTGCCATTT CAAGCTGAT 229 AGGCAATGATGA230CA2313GATTGTGTGTCCTGTAGGACAAGCATAAAG CCACCCCATCGCCTC GGATTGTTTT 232 GCAGTATCC233T2344GAAAGTGCAGCAAGTCCGCACCGATTAAAT ATAGCTTGAGGAATG CTTGGTTTA 235 AAGCAAAAGT236ATAATAT2375CAAAACGCTATAATC238GCTGCATTTTCAGGG 2 TTCATTAGAGTGATA TTACGCAAATTCC AAACCATTTT39AGTTTTTG240ACACTTGCTAAAGAATTATAAATTATGAGA CAAAAAAAAGGCATCAGCAAGCTCATTTTCCCATGTGATG 241AGT242 243TATCAT7CTTGCGGTCATGATGAGCACCACCCAAACC TGCTTGCTGCAAAGT GACATAC 244 CTCTTCA245ATT2468GCCGATCAAGCTAAAACTGCGAGTTTAGCA CCAAGCTGATCCTGA GGTCCAAT 247 GGAGTTG248AATG2499CCAGAGAGAAAGCGT2 CCTTTTTAGTTGGGA CATTAACACTATCAT AAAGATGGA 50 AGCGTTTAGG251TTTCCC25210TCCGGATTTAGTGCGTTCAAAGGTTTCCTC ACAAATGGGTATGGA TGTGAAAA 253 CCACTCATTT254TATTAA25511GATTGTGTGTCCTGTGGATTGTTTT 256AGGACAAGCATAAAG GCAGTATCC257ACCCCATCGCCTCTA AT258In another embodiment, Primer Pair Set K comprises one or more the primer pairs shown in Table 12, in a combination with a corresponding probe sequence: Table 12. Clostridium difficile (toxin A / B) Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID K NO NO NO 1GCTGCAGCATCTGACGAGTGAATACCTGGA ATACTCCGCCAA ATAGTAAGA 259 AGCATATCAACA260AAT T2612GGCTGAAGCTAATGC262TTTTAACATCTGGGA 263CCTAGTTCCATCATA 264 In another embodiment, Primer Pair Set L comprises one or more the primer pairs shown in Table 13, in a combination with a corresponding probe sequence: Table 13. Plesiomonas shigelloides Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID L NO NO NO 1ATGACCGCAAAGGGACCACCGCTTGCGCAA TCAGAGGAAAAATCT TGTGT 304 TA305CG3062TCGAGCGGCTCAAAC30ACCCAATCATCCCTG ACTGAAACGCCAATA GT 7 AGACTGA308CC3093CCGCCGTGAAGGCAAGCTACCGGCTCACCC AG 310 AGAT311 CACACCCAAGAATAC 312 In another embodiment, Primer Pair Set M comprises one or more the primer pairs shown in Table 14, in a combination with a corresponding probe sequence: Table 14. Salmonella sp. Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID M NO NO NO 1GCCGATGCCGGTGAA3 CGCCAGGCTATCGCC ACGAATTGCCCGAAC ATTATC 13 AATA314GTG3152CTCACCAGGAGATTAAGCTCAGACCAAAAG CACCGACGGCGAGAC CAACATGG 316 TGACCATC317CGACTTT3183GAATGGTGTTTTGCTCATGGATCTCAACGC ACTGGTACAGATGAA GGGT 319 320TGAC4GCGAACTGGTACAGA322CCAGACTCGCTCAGC 32CCTTAGGCGTTGAGA TGAATGACA CATT3TCC3245GCCGATGCCGGTGAAGCCAGGCTATCGCCA ATTATC 325 ATAAC326 ACGTTCGGGCAATTC 327In another embodiment, Primer Pair Set N comprises one or more the primer pairs shown in Table 15, in a combination with a corresponding probe sequence: Table 15. Yersinia enterocolitica Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID N NO NO NO 1CGGCATCGGTGATCAGTGAGCGTAATGGTA TCGCGCCGACTGACC TCATG 328 AGGTTGTTG329A3302GCTACCGCTTAGGAAGTCATCCCATGCTTG CATCAGGTCCTATCA CAGACTTT 331 ATACTTTTCG332CTCC3333GCTTAGGAACAGACT3 GTCATCCCATGCTTG CTCCAGCATCAGGTC TTGGAGTGAT 34 ATACTTTTCG335CT3364GCTTCAAACGCAAGT337CCATATTGAGTAAGT TTCGATGAGGACTTT CCATTTATTG GGGCTGATGA338CC3395GGATAAGGAAATCCT340CCAGAACCCTGCCAG 34CCTCAAATGGCGTTC CAAACGCATT ATTATGTTTA1TTT3426TGTACGCTGCGAGTG343CGAGTTCATAACGGT 34AAGCCATGTAAAAGA AAAATAGTAT ACTTCAGGTT4AAAT3457CTATTGGTTATGCAC346CGAGTTCATAACGGT 347CCTTTAGGGTCATTA AAAGCCATGT ACTTCAGGTT TCC3488CTATTGGTTATGCACCAAACGAACCTATTA TCGAGTTCATAA AAAGCCATGT 349 CTCCCCAGTT350CGG TACTTC3519CCTGAAGTACCGTTA352CCCTGATGGGTATAA 35ACCTATTACTCCCCA GCAAACGA3 CCCAGTAATCCATAA 10 355 AGGCTAACATAT356 11TGATTCACCAGCAGCGGCATCATGAAAGGC TGTCGGTTTCTCCTT AATAC 358 GG359CCAGG36012CCACAACACTCACCTGCCGACTGACCAAAT ATGCCGGTACACTGG CTGATACG 361 CATGATGA362TAC363In another embodiment, Primer Pair Set O comprises one or more the primer pairs shown in Table 16, in a combination with a corresponding probe sequence: Table 16. Vibrio Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID 0 NO NO NO 1GCCGCGGAATTTTATCGCTTTCTAACTTGA TATCCCGATA 364 TGATCGCAAT365 CACTGCCGAAGAATC 3662AATGCCGGCTAAAGG367CACCCAGTTGCTCTT 368TCGTGCCAACGGTTT 369 1AGCGATACATTAAGACCAATTCGGACAACT ATGCCCTGATGATAA CGCCTAAAGG 394 ACAAGCATCT395TATAC3962 GTATTGGAAATGTGC TGCAGAAGAA TTCT3TGGTGACTACTTTGA TGGACATTGT4014 ACGACACCCCTGATA AACAA404ATTTAAG5 CCAATTCGGACAACT ACAAGCATCT407TGC6GGGCAGTATATAAACGCATTTTTGCTTCAT CAGACAGCAATTTTT AACAATCAGTGGTT 409 AAGCCGATAGA410ATTTATC4117GTTCTCCAGAAGGTCCCTCAGGCATTTCAC CAGTACCGTCAATTC TTGTATGTGT 412 GCTTTT413C414 In another embodiment, Primer Pair Set Q comprises one or more the primer pairs shown in Table 18, in a combination with a corresponding probe sequence: Table 18. Enteropathogenic E. coli (EPEC) Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID Q NO NO NO 1CCCAAAGCGACCATCTGAACAAAATTTTCT CTGTAGCTGAAGATA AAATCC 415 GGTGTTAACGAGTT416AAGTTC4172TCGGCACCTGTTGTT418GCCTTGTCATCGGTC 419CCAGCGACACCACCT 420 in Table 19, in a combination with a corresponding probe sequence: Table 19. Enterotoxigenic E. coli (ETEC) Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID R NO NO NO 1GCAGGCAAAAGAGAATGTCCTTCATCCTTT CTTCGACCTGAAATG ATGGTTATCA 460 CAATGGCTTT461TT462 5TTCCCACCGGATCAC472CAACCTTGTGGTGCA CTTGGAGAGAAGAAC CAA TGATGA473CCT4746CGCAACATTTCAGGTGTCCTTCATCCTTTC CCGGGCAGTCAACAT CGAAGTC 475 AATGGCTTTT476A4777TCAGGATGCTAAACCCGGTACAAGCAGGAT TCACAGCAGTAATTG AGTAGAGTCT 478 TACAACACAA479C4808GCCAGAAAGCTGAATGCACAGGCAGGATTA TTCACAGCAGTAAA CAGTTGAC 481 CAA482A 483 CAAAG TGT9TCAACTGAATCACTTCCAGCACAGGCAGGA TTACTGCTGTGAACT GACT 484485 TTACAA TTGIn another embodiment, Pair Set S comprises one the primer pairs shown in Table 20, in a combination with a corresponding probe sequence: Table 20. Shiga-like toxin-producing E. coli (STEC) stx1 / stx2 Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID R NO NO NO 1CAAGACTCTGTTCGTCGATGCATGATGATG GTAGGAAGAA 487 ACAATTCAGT488 ATGCCACGCTTCCC 4892CAAAGTGCTCAGTTG490TCAGTCATTATTAAA CCGGAGCCTGATTCA ACAGGAATG CTGCACTTCAGCAA491C4923GCTTTACGTTTTCGGCCTTCCCCAGTTCAA CCCACTGAGATCATC CAAATACAGA 493 TGTAAGATCA494C495AAAGTGCTCAGTTGACAGCAAATCCGGAGC CTGTCACAATCAAAT CAGGAATGA 496 CTGAT497CC4985CTCTGCAATAGGTAC4 ACTTCTCGACTGCAA ACAAATTATCCCCTG TCCA 99 AGACGTATG500WGCCACTATC501In another embodiment, Primer Pair Set T comprises one or more the primer pairs shown in Table 21, in a combination with a corresponding probe sequence: Table 21. Shigella / Enteroinvasive E. coli (EIEC) and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID T NO NO NO 1CATGCTGTCACGGCACCACGGATTTACTTC CAGAATACACTCCAT TCAG 502 TCCATGAGT503CGCCC5042 CGGAATCCGGAGGTA TTGC506GTCTCTGCA3 508 ATGGAGAAAG C4 GCTGCCGATTATTGT ATGGAGAAAG512TG5 tgaatgatcagttct tcagctgcat515ttcg6ccgaagcagctttag517agcccttcactagct aacagagcatgagaa gatattgtga gatgact518taa5197TCAGCTGAAATTTAT52CCTCTGTTGGGAACG AAGGAGACCTCAGTT GCACACGAA 0 CAAAAG521TTC5228CAGCTGAAATTTATGGTTGTGGAAGATGAG TTTTGCGTTCCCAAC CACACGAAGA 523 ATCGACAGAA524AGAG5259CCTTTTCCGCGTTCCCGGAATCCGGAGGTA CGCCTTTCCGATACC TTGA 526 TTGC527GTCTCTGCA52810TGAAGAGCATGCCAA529GTGCAGAGACGGTAT TCCGCGTTCCTTGAC CACCTTT CGGAAA530CG53111CGTTCCTTGACCGCCAGCGACCTGTTCACG TACCGTCTCTGCACG TTTC 532 GAATC533CAAT53412CATGCTGTCACGGCACCACGGATTTACTTC ACGGACAACAGAATA TCAG 535 TCCATGAGT536CA537In another embodiment, Primer Pair Set U comprises one or more the primer pairs shown in Table 22, in a combination with a corresponding probe sequence: Table 22. E. coli O157 Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID U NO NO NO 1CCCAACTTCAACCCA53GTCGTGTTTACTGGG ACGAGCACGGATAAA ATCACTTTG 8 ATATCTTGTGA539A540CACGTTGATTAATGCACCAGTCATGGCCAG CAGTGCGCCAGATTT In another embodiment, Primer Pair Set V comprises one or more the primer pairs shown in Table 23, in a combination with a corresponding probe sequence: Table 23. Listeria monocytogenes Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID V NO NO NO 1CAAACTGAAGCAAAGATTGGCGTCTTAGGA CACCACCAGCATCTC GATGCATCT 544 CTTGCA545C5462GGGAAATCTGTCTCA547GGTTACCGTCGATGA 548CTTTTGCGGAGCCAC GGTGATGTAG TTTGAACTTC CG549 In another embodiment, Primer Pair Set W comprises one or more the primer pairs shown in Table 24, in a combination with a corresponding probe sequence: Table 24. Cryptosporidium sp. Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID W NO NO NO 1TCAGATACCGTCGTAAAGGAGTAAGGAACA AACTATGCCAACTAG GTCTTAACCA 559 ACCTC560AGATTG5612GGGTTGTATTTATTA562AGGCCAATACCCTAC TGACATATCATTCAA GATAAAGAACCA CGTCT563GTTTCTGAC5643AGCATTTGCCAAGGAAAGGAGTAAGGAACA CTCTAGTTGGCATAG TGTTTTCATT 565 ACCTCCAAT566TTTATGG567In another embodiment, Primer Pair Set X comprises one or more the primer pairs shown in Table 25, in a combination with a corresponding probe sequence: Table 25. Cyclospora cayetanensis Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID X NO NO NO 1GCGAGACTGGAAGCTCGTCGTGAGAGAGAA CCCATCCCAACCCTC TTTAACG 568 AAGCGATT569G5702GCGAGACTGGAAGATCGTCGTGAGAGAGAA CTCATCCCATCCCTC TTTAACG 571 AAGCGATT572G5733ATTTGTGTGGTGGCTCACCGTATCTCTTTC CTGCTGCTCGCTATC CTTTCTTTG 574 GGACGAA575C5764GTGCAGTCACATGAGGCACTTGCACACACA ACGCGAAACAACCCT GCATATATCA 577 CAGA578CG5795GTGCAGTCACATGAGGCACTTGCACACACA CACGCGAAACAACCC GCATATATCA 580 CAGA581T582In another embodiment, Primer Pair Set Y comprises one or more the primer pairs shown in Table 26, in a combination with a corresponding probe sequence: Table 26. Entamoeba histolytica Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID Y NO NO NO GCTGTATTCCCATCCCTCTCTTTGATTGAG CCATACCAGCCATAA In another embodiment, Primer Pair Set Z comprises one or more the primer pairs shown in Table 27, in a combination with a corresponding probe sequence: Table 27. Giardia Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID Z NO NO NO 1AAGAAGTCCGCCGAC592TTGAGTGTGTCGCCC 593CATGGTGTCGATCTC AACA ATCTC C5942ACCTCGACAGGCTCAGCGGATGTCCTCGAA CCTGGCGCTTCCTCG TCCA 595 CGA596AC5973ACCAGATCGCCATCCCGAGGTCGTTCAGGC CTCAGGAAGGAGGCC ACAAC 598 TCTTG599CT6004GACACCATGGCTGCAATGGATGGCGATCTG TTGCGGAGATGGGCG AACTTC 601 GTTCTG602ACAC6035ACCTCGACAGGCTCACTCGCGGATGTCCTC TCCA 604 GAA605 AAGCGCCAGGCCTC 6066CCCTCAAGAGCCTGA60TGAGCTGGTCATACA ATCGCCACGGAGAAC ACGA 7 TCTTCTTCCT608G609 7610611C 8GTC 613 ACTG614TCA615In some embodiments, the method or assay includes one or more control primers and probes. In one aspect, the control is Primer Pair Set CTRL that comprises one or more the primer pairs shown in Table 28, in a combination with a corresponding probe sequence for the detection of control sample: Table 28. Bacillus subtilis atrophaeus Primers and Probes (5′→3′) Primer SEQ SEQ SEQ Pair Set Forward Primer ID Reverse Primer ID Probe ID CTRL NO NO NO 1AGGAAATCAGGGAGA616GTCCGTGAATCGCGT 61TTCAACCGTCACCTC CGTACGAT TGAAAA7TCCGTCCTGA618 12CCCGTTTGTAGTAGTACTGCTGCCGAGATG GGATAACTGT 649 AAGTTC650 CCCCGCCGAAGATG 65113CCCGTTTGTAGTAGT652ACTGCTGCCGAGATG 653TTTTAATATCCCCGC CGAAGAT or more control plasmids that contains target sequences for one or more of the target organisms. In one aspect, the control plasmid comprises one or more the sequences shown in Table 29. This plasmid can be used with the primers and probes of Tables 2–27 as positive control. Table 29. Superplasmid control sequences (5′→3′) SEQ No. Organism Sequence ID NO GCCCATACCAAAGAGCTTGAACATAACACCTATGTTAGGCTTTATGT 1 Adenovirus F TATTGACATTCCTCCGCCTAAGTGTGACATTACTTCACGTTACTTAG 655 GCATACAGG 2AstrovirusGACTCACAGAAGAGCAACTCCATCGCATTTGGAGGGGAGGACCAAAGAAGTGTGATGGCTAGC 656GCCATGTTCCGCTGGATGCGCTTCCATGATCTGAGCATGTGGACAGG 3 Norovirus GI GGATCGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAG 657 GA 4Norovirus GIIGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGA 6585 Rotavirus AGCAACAGTTGGACTTACGTTACGTATTGAATCTGCAGTTTGTGAATCAGTGCTTGCGGATGCAAATGAAACTTTATTGGCGAATGTCACC 659TCTCAATGCCTCTAAATTATTACGTCTGATGAATAGCAATCTAAAGA CTTCAATTGAACAATTTTCACTAATTTTTAATTGTTTTTCAGCTACT 6 Rotavirus B TTCCATGTAGGCCACCGTATAGATAATGCTCAAGATGCCATAACAGA 660 TCA GAGAAACAAATACTGCAAAATATCCAGCTATTCTACATCCCGTAGAT 7 Rotavirus C AATGAGCTTAATCAATACTTCCTTGAGCATCAGTTAATTCAACCATT 661 AACTACAAGAAATATTGCAGAATTGATCCCAAC GCTCTCGCCACCTACGAATCTTGGTTCATAGGCGGTACAGGCCTGGT 8 Sapovirus 1 GCAAGGCAGCCCCAGTGAAGAGACCACCAAATTAGTGTTTGAAATGG 662 AGGG 9Sapovirus 2GGGTTGTGCGAATGTCATGAGTTACTGGCAGCGACTGTTGAAAGTTTGTGCTGGCATCACAACAATTGCTGCAGC 66310CampylobacterGCTAAAGGTCCAATCCAAGCTGATCCTGAAATGGCAACTCCTGCTAA jejuni ACTCGCAGTAGAAAAAATTTCATCATTGCCTGAATATGTGAGTGAG664CACCAGATGGATTTAAAT 11ClosterioidesACTTTGCACATCAAAATACTTTGGATGAG difficileAATTTTGAGGGAGAATCAATAAACTATACTGGTTGGTTAGATTTAGA 665 TGAAAAGAGATATTATTTTACAGATGAATATATTGCAGCAACTGGT 12PlesiomonasATGACCGCAAAGGGATGTGTTCAGAGGAAAAATCTCGTATTGCGCAA shigelloides GCGGTGG66613 Salmonella sp.GCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCCTGGCG 66714 YersiniaCGGCATCGGTGATCATCATGATTTGGTCAGTCGGCGCGACTTGTACC enterocolitica GCCCCAACAACCTTACCATTACGCTCAC66815 Vibrio poolGCCGCGGAATTTTATTATCCCGATAACTATGTCGATTCTTCGGCAGTGTATTGGCCAAATGATATTGCGATCATCAAGTTAGAAAGCG 66916Escherichia coliAGCGATACATTAAGACGCCTAAAGGATGCCCTGATGATAATATACGG EAEC AATATCAAAAGTAGATGCTTGTAGTTGTCCGAATTGG670TCGGCACCTGTTGTTGCTGCAGGTGGTGTCGCTGGTCATACGAAT 17Escherichia coliAA EPECAATGACTAAAATGTCCCCGGACGCGACTAAAAGCAACACGACCGATG 671 ACAAGGC 18Escherichia coliGCAGGCAAAAGAGAAATGGTTATCATTACATTTAAGAGCGGCGCAAC ETECATTTCAGGTCGAAGTCCCGGGCAGTCAACATATAGACTCCCAAAAAA 672 AAGCCATTGAAAGGATGAAGGACA 19Escherichia coliCAAGACTCTGTTCGTGTAGGAAGAATTTCTTTTGGAAGCATTAATGC STECAATTCTGGGAAGCGTGGCATTAATACTGAATTGTCATCATCATGCAT 673 CG 20 ShigellaCATGCTGTCACGGCATCAGCCAGGGGGCGATGGAGTGTATTCTGTTG Escherichia coli TCCGTCACTCATGGAGAAGTAAATCCGTGG67421 E. coli O157CCCAACTTCAACCCAATCACTTTGGATATTTTTATAAACTATTTTATCCGTGCTCGTATCACAAGATATCCCAGTAAACACGAC 22 ListeriaCAAACTGAAGCAAAGGATGCATCTGCATTCAATAAAGAAAATTTAAT monocytogenesTTCATCCATGGCACCACCAGCATCTCCGCCTGCAAGTCCTAAGACGC CAAT 23CryptosporidiumTCAGATACCGTCGTAGTCTTAACCATAAACTATGCCAACTAGAGATT sp. GGAGGTTGTTCCTTACTCCTT67724 CyclosporaGCGAGACTGGAAGCTTTTAACGTTGTATACACCCATCCCAACCCTCG cayetanensis AATCGCTTTTCTCTCTCACGACG67825 EntamoebaGCTGTATTCCCATCCATTGTTGGTAGACCAAGACACGTTTCAGTTAT histolyticaGGCTGGTATGGGTCAAAAAGATGCTTATGTTGGAGATGAAGCTCAAT 679 CAAAGAGAG AAGAAGTCCGCCGACAACATGTACCTAACGATCAAGGAGGAGATCGA 26 Giardia CACCATGGCTGCAAACTTCCGCAAGTCCCTTGCGGAGATGGGCGACA 680 CACTCAA In one embodiment, the method and / or assay comprises a panel comprising one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Rotavirus, Norovirus, Sapovirus, Campylobacter species, Clostridium difficile, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC), Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Plesiomonas shigelloides, Salmonella species, Yersinia enterocolitica, Vibrio species, Cryptosporidium species, Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. In one aspect, the method has one or more primer pairs and one or more probes for the detection of a control sample of Bacillus atrophaeus. In another aspect, the method has one or more primer pairs and one or more probes for the detection of a universal RNA Spike In / Reverse Transcription (Xeno) Control. One embodiment described herein is a multiplex panel for the simultaneous detection of the presence or absence of one or more of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. In one aspect, the multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each organsim as shown in Table 28. All primer pairs (forward primers and reverse primers), and the requisite probes are consecutively numbered in multiples of three, e.g., 1, 2, 3; ... ; 652, 653, 654, as forward primer; reverse primer; and probe, respectively. As an exemplary aspect, for detecting Adenovirus, a primer pair and probe set could include: a forward primer such as SEQ ID NO: 1, a reverse primer such as SEQ ID NO:2, and a probe such as SEQ ID NO: 3. Optionally, the multiplex panel comprises controls, comprising at least one forward primer, at leat one reverse primer, and a probe for the control organsim Bacillus atrophaeus, as shown in Table 28 (SEQ ID NO: 616–617; 619–620; 622–623; 625–626; 628– 629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; or 652–653) or the Universal RNA Spike In / Reverse Transcription Control (Xeno). An additional positive control is a multisequence plasmid comprising the sequences shown in Table 29. This plasmid can be used with the primers and probes of Tables 2–27 as an amplication positive control. One embodiment described herein is a multiplex panel for the simultaneous detection of the presence or absence of one or more of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter upsaliensis, Campylobacter coli, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Cryptosporidium sp., Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. In one aspect, the multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each organsim as shown in Table 30. Optionally, the multiplex panel comprises controls, comprising at least one forward primer, at leat one reverse primer, and a probe for the control organsim Bacillus atrophaeus, as shown in Table 28 (SEQ ID NO: 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; or 652–653). Table 30. Multiplex Panel I Open Array – Primers and Probes (26 Organisms)OrganismForward PrimerReverse Primer Probe SEQ ID NOSEQ ID NO SEQ ID NO Adenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 10, 13 8, 11, 14 9, 12, 15 16, 19, 22, 25, 28, 17, 20, 23, 26, 29, 18, 21, 24, 27, 30, Norovirus GI 31, 34, 37, 40, 43, 32, 35, 38, 41, 44, 33, 36, 39, 42, 45, 46, 49, 52, 55, 58, 47, 50, 53, 56, 59, 48, 51, 54, 57, 60, 61, 64, 67, 70, 73 62, 65, 68, 71, 74 63, 66, 69, 72, 75Norovirus GII76, 79, 82, 85, 88,77, 80, 83, 86, 89, 78, 81, 84, 87, 90, 91, 94, 97, 10092, 95, 98, 101 93, 96, 99, 102 103, 106, 109, 112, 104, 107, 110, 113, 105, 108, 111, 114, Rotavirus A 115, 118, 121, 124, 116, 119, 122, 125, 117, 120, 123, 126, 127, 130, 133, 136, 128, 131, 134, 137, 129, 132, 135, 138, 139 140 141 Rotavirus B 142, 145, 148 143, 146, 149 144, 147, 150 Rotavirus C 151, 154 152, 155 153, 156Sapovirus 1 157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169, 172, 175, 178170, 173, 176, 179 171, 174, 177, 180 181, 184, 187, 190, 182, 185, 188, 191, 183, 186, 189, 192, Sapovirus 2 193, 196, 199, 202, 194, 197, 200, 203, 195, 198, 201, 204, 205, 208, 211, 214, 206, 209, 212, 215, 207, 210, 213, 216, 217, 220, 223 218, 221, 224 219, 222, 225 226, 229, 232, 235, 227, 230, 233, 236, 228, 231, 234, 237, Campylobacter pool 238, 241, 244, 247, 239, 242, 245, 248, 240, 243, 246, 249, 250, 253, 256 251, 254, 257 252, 255, 258 259, 262, 265, 268, 260, 263, 266, 269, 261, 264, 267, 270, Clostridium difficile (toxin A / B) 271, 274, 277, 280, 272, 275, 278, 281, 273, 276, 279, 282, 283, 286, 289, 292, 284, 287, 290, 293, 285, 288, 291, 294, 295, 298, 301 296, 299, 302 297, 300, 303 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 328, 331, 334, 337, 329, 332, 335, 338, 330, 333, 336, 339, Yersinia enterocolitica 340, 343, 346, 349, 341, 344, 347, 350, 342, 345, 348, 351, 352, 355, 358, 361 353, 356, 359, 362 354, 357, 360, 363 364, 367, 370, 373, 365, 368, 371, 374, 366, 369, 372, 375, Vibrio pool 376, 379, 382, 385, 377, 380, 383, 386, 378, 381, 384, 387, 388, 391 389, 392 390, 393Enteroaggregative E. coli (EAEC)394, 397, 400, 403,395, 398, 401, 404, 396, 399, 402, 405, 406, 409, 412407, 410, 413 408, 411, 414 415, 418, 421, 424, 416, 419, 422, 425, 417, 420, 423, 426, Enteropathogenic E. coli (EPEC) 427, 430, 433, 436, 428, 431, 434, 437, 429, 432, 435, 438, 439, 442, 445, 448, 440, 443, 446, 449, 441, 444, 447, 450, 451, 454, 457 452, 455, 458 453, 456, 459 460, 463, 466, 469, 461, 464, 467, 470, 462, 465, 468, 471, Enterotoxigenic E. coli (ETEC) 472, 475, 478, 481, 473, 476, 479, 482, 474, 477, 480, 483, 484 485 486 Shiga-like toxin-producing E. coli 487, 490, 493, 496, 488, 491, 494, 497, 489, 492, 495, 498, (STEC) stx1 / stx2 499 500 501 Shigella / Enteroinvasive E. coli 502, 505, 508, 511, 503, 506, 509, 512, 504, 507, 510, 513, (EIEC) 514, 517, 520, 523, 515, 518, 521, 524, 516, 519, 522, 525, 526, 529, 532, 535 527, 530, 533, 536 528, 531, 534, 537 E. coli O157 538, 541 539, 542 540, 543Listeria monocytogenes544, 547, 550, 553,545, 548, 551, 554, 546, 549, 552, 555, 556557 558 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Cyclospora cayetanensis568, 571, 574, 577,569, 572, 575, 578, 570, 573, 576, 579, 580581 582 Entamoeba histolytica 583, 586, 589 584, 587, 590 585, 588, 591 Giardia592, 595, 598, 601,593, 596, 599, 602, 594, 597, 600, 603, 604, 607, 610, 613605, 608, 611, 614 606, 609, 612, 615 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 Another embodiment described herein is a multiplex panel for the simultaneous detection of the presence or absence of one or more of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter upsaliensis, Campylobacter coli, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Cryptosporidium sp., Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. In one aspect, the multiplex panel comprises at least one forward primer, at least one reverse primer, and at least one probe for each organsim as shown in Table 31. Optionally, the multiplex panel comprises controls, comprising at least one forward primer, at leat one reverse primer, and a probe for the control organsim Bacillus atrophaeus, as shown in Table 28 (SEQ ID NO: 616–617; 619–620; 622–623; 625–626; 628–629; 631–632; 634–635; 637–638; 640–641; 643–644; 646–647; 649–650; or 652–653). Table 31. Multiplex Panel II TaqMan Array – Primers and Probes OrganismForward PrimerReverse Primer Probe SEQ ID NOSEQ ID NO SEQ ID NO Adenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 10, 13 8, 11, 14 9, 12, 15 16, 19, 22, 25, 28, 17, 20, 23, 26, 29, 18, 21, 24, 27, 30, Norovirus GI 31, 34, 37, 40, 43, 32, 35, 38, 41, 44, 33, 36, 39, 42, 45, 46, 49, 52, 55, 58, 47, 50, 53, 56, 59, 48, 51, 54, 57, 60, 61, 64, 67, 70, 73 62, 65, 68, 71, 74 63, 66, 69, 72, 75 Norovirus GII76, 79, 82, 85, 88,77, 80, 83, 86, 89, 78, 81, 84, 87, 90, 91, 94, 97, 10092, 95, 98, 101 93, 96, 99, 102 103, 106, 109, 112, 104, 107, 110, 113, 105, 108, 111, 114, Rotavirus A 115, 118, 121, 124, 116, 119, 122, 125, 117, 120, 123, 126, 127, 130, 133, 136, 128, 131, 134, 137, 129, 132, 135, 138, 139 140 141Sapovirus 1157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169, 172, 175, 178170, 173, 176, 179 171, 174, 177, 180 181, 184, 187, 190, 182, 185, 188, 191, 183, 186, 189, 192, Sapovirus 2 193, 196, 199, 202, 194, 197, 200, 203, 195, 198, 201, 204, 205, 208, 211, 214, 206, 209, 212, 215, 207, 210, 213, 216, 217, 220, 223 218, 221, 224 219, 222, 225 226, 229, 232, 235, 227, 230, 233, 236, 228, 231, 234, 237, Campylobacter pool 238, 241, 244, 247, 239, 242, 245, 248, 240, 243, 246, 249, 250, 253, 256 251, 254, 257 252, 255, 258 259, 262, 265, 268, 260, 263, 266, 269, 261, 264, 267, 270, Clostridium difficile (toxin A / B) 271, 274, 277, 280, 272, 275, 278, 281, 273, 276, 279, 282, 283, 286, 289, 292, 284, 287, 290, 293, 285, 288, 291, 294, 295, 298, 301 296, 299, 302 297, 300, 303 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312 Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 328, 331, 334, 337, 329, 332, 335, 338, 330, 333, 336, 339, Yersinia enterocolitica 340, 343, 346, 349, 341, 344, 347, 350, 342, 345, 348, 351, 352, 355, 358, 361 353, 356, 359, 362 354, 357, 360, 363 364, 367, 370, 373, 365, 368, 371, 374, 366, 369, 372, 375, Vibrio pool 376, 379, 382, 385, 377, 380, 383, 386, 378, 381, 384, 387, 388, 391 389, 392 390, 393 Enteroaggregative E. coli (EAEC)394, 397, 400, 403,395, 398, 401, 404, 396, 399, 402, 405, 406, 409, 412407, 410, 413 408, 411, 414 415, 418, 421, 424, 416, 419, 422, 425, 417, 420, 423, 426, Enteropathogenic E. coli (EPEC) 427, 430, 433, 436, 428, 431, 434, 437, 429, 432, 435, 438, 439, 442, 445, 448, 440, 443, 446, 449, 441, 444, 447, 450, 451, 454, 457 452, 455, 458 453, 456, 459 460, 463, 466, 469, 461, 464, 467, 470, 462, 465, 468, 471, Enterotoxigenic E. coli (ETEC) 472, 475, 478, 481, 473, 476, 479, 482, 474, 477, 480, 483, 484 485 486 Shiga-like toxin-producing E. coli 487, 490, 493, 496, 488, 491, 494, 497, 489, 492, 495, 498, (STEC) stx1 / stx2 499 500 501 Shigella / Enteroinvasive E. coli 502, 505, 508, 511, 503, 506, 509, 512, 504, 507, 510, 513, (EIEC) 514, 517, 520, 523, 515, 518, 521, 524, 516, 519, 522, 525, 526, 529, 532, 535 527, 530, 533, 536 528, 531, 534, 537 E. coli O157 538, 541 539, 542 540, 543 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Entamoeba histolytica 583, 586, 589 584, 587, 590 585, 588, 591 Giardia592, 595, 598, 601,593, 596, 599, 602, 594, 597, 600, 603, 604, 607, 610, 613605, 608, 611, 614 606, 609, 612, 615 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 In one embodiment, the primers pairs and probes can be used to produce an amplicon. In one embodiment, the amplicons are shown in Table 32. Table 32. Amplicons Organism Amplicon Sequences (5′→3′) SEQ IDAdenovirusGCCCATACCAAAGAGCTTGAACATAACACCTATGTTAGGCTTTATGTTATTGACATTCCTCCGCCTAAGTGTGACATTACTTCACGTTACTTAGGCATACAGG 681AdenovirusGCCCATACCAAAGAGCTTGAACATAACACCTATGTTAGGCTTTATGTTATTGACATTCCTCCGCCTAAGTGTGACATTACTTCACGTTACTTAGGCATACAGG 682AstrovirusGACTCACAGAAGAGCAACTCCATCGCATTTGGAGGGGAGGACCAAAGAAGTGTGATGGCTAGC 683AstrovirusGACTCACAGAAGAGCAACTCCATCGCATTTGGAGGGGAGGACCAAAGAAGTGTGATGGCTAGC 684CTCACGGACTGCAAAGCAGCTTCGTGACTCTGGCTTTCCAGCCAGACTCACAGAA Astrovirus GAGCAACTCCATCGCATTTGGAGGGGAGGACCAAAGAAGTGTGATGGCTAGCAAG 685 TCCAATAAGCAGGTAACTGTTGAGGTCAGTAATAATGGCCGNorovirus GIGCCATGTTCCGCTGGATGCGATTCCATGACTTGAGTATGTGGACAGGAGATCGCAATCTCTTGCCCGATTATGTAAATGATGATGGCGTCTAAGGA 686Norovirus GIGCCATGTTCCGCTGGATGCGATTCCATGATCTAAGTTTGTGGACAGGAGACCGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGA 687Norovirus GIGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACGGGAGATCGCAATCTCCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGA 688Norovirus GICGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACATGGATGGCACCAGTGGTGCCGGC 689Norovirus GIGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACATGGATGGCAC 690Norovirus GIGGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCAATCTCCTGCCCGAATTCGTAAAT 691Norovirus GIATGTGGACAGGAGATCGCAATCTACTGCCTGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCCTCAAACATGGATGGCACCAG 692Norovirus GIGCCATGTTCCGCTGGATGCGCTTCCATGATCTGAGCATGTGGACAGGGGATCGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGA 693Norovirus GIGGATGGCAGGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGA 694Norovirus GIGGATGGCAGGCCATGTTCCGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGA 695Norovirus GIGGTTGGCAGGCCATGTTCCGCTGGATGCGCTTCCATGATCTGAGTTTGTGGACAGGAGACCGC 696Norovirus GIGGTTGGCAGGCCATGTTCCGCTGGATGCGCTTCCATGATCTGAGTTTGTGGACAGGAGACCGC 697Norovirus GICCAGCTCGGCAAGAGGTAGGCTTGGTCTGCGCCGATAATGGCCCAAGCCATAATTGGTGCAATTGCTGCTTCC 698Norovirus GICCAGCTCGGCAAGAGGTAGGCTTGGTCTGCGCCGATAATGGCCCAAGCCATAATTGGTGCAATTGCTGCTTCC 699Norovirus GIGCGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACATGGATGGCACCAG 700Norovirus GICGATCTCCTGCCCGATTATGTAAATGATGATGGCGTCTAAGGACGCCCCAACAAACATGGATGGCACCAG 701Norovirus GITCTAAGGACGCCCCAACAAACATGGATGGCACCAGTGGTGCCGGCCAGCTGG702Norovirus GICCTAAGTCAGCATGGGCAGATGATGAGCGTGAAGTGGACTACAATGAGAGGATCAACTTTGAGGCG 703Norovirus GIATGTAAATGATGATGGCGTCTAAGGACGCCCCCTCAAACATGGATGGCACTAGTGGTGCCGGTCAGCTGGTTCCAGAGGTTAATGCAGC 704Norovirus GIGGCTGGGCCAACAACAGCCGTAGCCACTGCTGGGCAAGTTAATATGATTGATCCCTGGATTGTTAATAATTTTGTCCAGTCACCTCAAGGT 705Norovirus GIIGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAATGACGCCGCTCC 706Norovirus GIICTTGGTTCCCTTATCAATGCTGGGGCTGGGGCCATCAACCAAAAAGTTGAGTTTGAAAATAACAGAAAATTGCAACAAGCATCCTTCCAATTTAG 707Norovirus GIIGCAATCTTGCTCCCGAAGGTGTGAATGAAGATGGCGTCGAATGACGCTACTCCATCTGATGATGGTGCAGCCG 708Norovirus GIIGGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGA709Norovirus GIIGGAGGGCGATCGCAATCTTGCTCCCGAGGGTGTGAATGAAGATGGCGTCGAATGACGCT 710Norovirus GIIGGAGGGCGATCGCAATCTTGCTCCCGAGGGTGTGAATGAAGATGGCGTCGAATGACGCT 711Norovirus GIITGGTTCCCTTATCAATGCTGGGGCTGGGGCCATCAACCAAAAAGTTGAGTTTGAAAATAACAGAAAATTGCAACAAGCATCCTTCCAATTTAG 712Norovirus GIICTTGCTCCCGAAGGTGTGAATGAAGATGGCGTCGAATGACGCTACTCCATCTGATGATGGTGCAGCCG 713Norovirus GIIGGAGGGCGATCGCAATCTGGCTCCCAGTTTTGTGAATGAAGATGGCGTCGAATGACGCCGCTCC 714Rotavirus AGGAAATGAGTTCCAAACTGGAGGAATTGGTAATCTACCAATTAGAAATTGGAATTTTGATTTTGGATTACTTGGAACAACTCTACTAAATTTA 715TAGGTACTACGCTTTTAAATCTTGATGCTAATTATGTTGAGACTGCCAGAACTAC Rotavirus A GATTGAGTATTTTATCGATTTCATTGATAATGTATGTATGGATGAAATGGCAAGA 716 GAGTCTCRotavirus ATTTAAGAGAATAAATTTCGATAATTCATCAGAATACATAGAAAATTGGAACTTACAAAATAGAAGACAGCGCACCGG 717Rotavirus AGCAACAGTTGGACTTACGTTACGTATTGAATCTGCAGTTTGTGAATCAGTGCTTGCGGATGCAAATGAAACTTTATTGGCGAATGTCACC 718Rotavirus AGAGTTTTAAACGCATGCTTCAGTGTAAAAAGAATACCTGGAAAATCATCATCTATTATTAAATGCACAAAATTGATGCGTGATAAATTGGAACGTGGTGAAGTTGAAG 719GGAATCGACCAAAAGATGAGAGTACTTAATGCTTGTTTTAGTGTAAAAAGAATAC Rotavirus A CAGGAAAATCATCATCAATAATTAAATGCACTAGACTTATGAAGGATAAAATAGA 720 ACGTGGAGAAGTTGAAGTTGATRotavirus ATATTTCCATACTCAGCGTCATTTACTTTAAATAGATCTCAACCAATGCATGACAATTTAATGGGAACCATGTGGCTTAATGCTGGA 721Rotavirus ACACCAGCTGTTAATGCACTGTTTCCACAAGCACAACCTTTTCAGCACCATGCAACAGTTG 722Rotavirus AAGTGGCTGGATTTGACTACTCATGCGCCATAAATGCACCAGCGAACATACAGCAATTTGAACATATCGTCCAGCT 723Rotavirus ATGCAACAGTTGGACTTACATTACGTATTGAATCTGCGGTTTGTGAATCAGTGCTTGCGGACG 724Rotavirus AGGATCAGAAATTCAAGTGGCTGGATTTGACTACTCATGCGCCATAAATGCACCAGCGAACATACAGCAATTTGAACATATCGTCCAGCT 725Rotavirus ACTGCAGTTTGTGAATCAGTGCTTGCGGATGCAAATGAAACTTTATTGGCGAATGTCACCGCGGTACGTCAAGAGTATGCTATACCAGTTGGCCCAGT 726Rotavirus AGCAACAGTTGGACTTACGTTACGTATTGAATCTGCAGTTTGTGAATCAGTGCTTGCGGATGCAAATGAAACTTTATTGGCGAATGTCACC 727TCTCAATGCCTCTAAATTATTACGTCTGATGAATAGCAATCTAAAGACTTCAATT Rotavirus B GAACAATTTTCACTAATTTTTAATTGTTTTTCAGCTACTTTCCATGTAGGCCACC 728 GTATAGATAATGCTCAAGATGCCATAACAGATCA GCAGATGTCGTATGTACACACAATCAGAAAAACTTTTCACATTATTTAAGCTGTT Rotavirus B AACTCAAACTGTATCTGTTTCAGTTACTCCAGAAGAAATTAAGAAGTACTCTAAC 729 ACGCCTCAATTTAAAAAACGTACAAGCGTCATGATCAAAAG CGCTATCGGTGATCGACATTCTTTACATGATTTTCGTAATACATATGCATATTTG Rotavirus B GGAGATACGATCAACCCCATATTCAGGTCCAATTTAGTTACCAACAAATTTGCTG 730 ATGATCCGAAATTCGC GAGAAACAAATACTGCAAAATATCCAGCTATTCTACATCCCGTAGATAATGAGCT Rotavirus C TAATCAATACTTCCTTGAGCATCAGTTAATTCAACCATTAACTACAAGAAATATT 731 GCAGAATTGATCCCAAC GAGAAACAAATACTGCAAAATATCCAGCTATTCTACATCCCGTAGATAATGAGCT Rotavirus C TAATCAATACTTCCTTGAGCATCAGTTAATTCAACCATTAACTACAAGAAATATT 732 GCAGAATTGATCCCAAC Sapovirus 1 of ACCCGTACACAAAACATCTTGCTCAAATGTTTGCCGGGTGGGGGGGAGCAATGGA 2CATTAGAGTCACAGTC733 Sapovirus 1 of GCTCTCGCCACCTACGAATCTTGGTTCATAGGCGGTACAGGCCTGGTGCAAGGCA 2GCCCCAGTGAAGAGACCACCAAATTAGTGTTTGAAATGGAGGG734Sapovirus 1 of2GCCACTGGTGCAATCCAATCCAATGTCCCTGAGGCAATACGCAACTGCTTTGCAG735Sapovirus 1 of2CATCCCATCTTTCAGGCATGTGGGCAGGGTGGGGAGGTAGCTTTGAGGCCCG736Sapovirus 1 of TCACTAGTGTTGTCAACTCTCTCAACCACATGACATATTTTGCTGCTGCTGTCCT 2C737Sapovirus 1 of CCGTACACAAAACATCTTGCTCAAATGTTTGCCGGGTGGGGGGGAGCAATGGACA 2TTAGAGTCACAGTCTCAGGCTCGGGTCTATTTGCAGGCAAGCTTGTC738Sapovirus 1 of GCAATGGCAATGAACATGGAACTTTCCACTCGCGGCCCAGCCCTGCGTGTTCAAT 2CGGCAATTGACGCTGG739Sapovirus 1 of GTGACGCAATGGCAATGAACATGGAACTTTCCACTCGCGGCCCAGCCCTGCGTGT 2TCAATCGGCAATTGACGCTGGGTTTGACC740Sapovirus 2 of GGGTTGTGCGAATGTCATGAGTTACTGGCAGCGACTGTTGAAAGTTTGTGCTGGC 2ATCACAACAATTGCTGCAGC741Sapovirus 2 of GCATAATCAACAGTGCACCATACCCACTAAATTGTGACCGGGCCGAAAACAAAGG 2TAAAGTTTTCTCATCTGAGTACGTAATTTGCACCAG742Sapovirus 2 of ACATCTGTCCTCCCGGAGAACCCTCGGGCCGGCGCCTTCTACCGTCGTGTGATCA 2CGGTGGACGTTTCATCACCCTCAATAGATGACTGGAAGAAGAGGAACCC743AGCTGGTCAAAACAACGTTCACCGCCCAAGGCCCAACAGACCTTGGGTGGGCGGC Sapovirus 2 of GGTGCTGGCAGGGGCTGCAATGATTCTACTAAAAATGTCTGGGTGCCCAGGCGTG 2 744 CTCGGTATGTGGACAAAAGTGCTCAAAATCTGCGG GCCCAAGGCCCAACAGACCTTGGGTGGGCGGCGGTGCTGGCAGGGGCTGCAATGA Sapovirus 2 of TTCTACTAAAAATGTCTGGGTGCCCAGGCGTGCTCGGTATGTGGACAAAAGTGCT 2 745 CAAAATCTGCGG GCCCAAGGCCCAACAGACCTTGGGTGGGCGGCGGTGCTGGCAGGGGCTGCAATGA Sapovirus 2 of TTCTACTAAAAATGTCTGGGTGCCCAGGCGTGCTCGGTATGTGGACAAAAGTGCT 2 746 CAAAATCTGCGG Sapovirus 2 of ACAAAGGTAGGGTGTTCACTTCAAATTATGTTATTTGCACATCAAACTACCCCAC 2GTCTGTCATTCCAGAGAACCCACG747Sapovirus 2 of ACAAAGGTAGGGTGTTCACTTCAAATTATGTTATTTGCACATCAAACTACCCCAC 2GTCTGTCATTCCAGAGAACCCACG748Sapovirus 2 of GCCTTTCCGTCCGACCATACCTTGGTTACAATCCCGAAGGGGACACTCTGGAGGG 2CGTTC749Sapovirus 2 of GCCTTTCCGTCCGACCATACCTTGGTTACAATCCCGAAGGGGACACTCTGGAGGG 2CGTTC750Sapovirus 2 of ACACCGCCCCCTATCCACTCAATTGTGACCGAGTGGAGAACAAAGGCAAAGTGTT 2TACATCTGAATACATCATATGTACCAGCAATTACCCAACCTC751Sapovirus 2 of ACACCGCCCCCTATCCACTCAATTGTGACCGAGTGGAGAACAAAGGCAAAGTGTT 2TACATCTGAATACATCATATGTACCAGCAATTACCCAACCTC752Sapovirus 2 of TGGCTGGGCTGCTATTGGGGCTGGTGTGATTCTGATACTCCTTAAAATATCGGGT 2TGTGCGAATGTC753Sapovirus 2 of2CCAGGGCCGGTTCGTGGAGACCATGATTGGCATAATCAACAGTGCACCATACCCA754Sapovirus 2 of ACATCTGTCCTCCCGGAGAACCCTCGGGCCGGCGCCTTCTACCGTCGTGTGATCA 2CGGTGGACGTTTCATCA755Campylobacte GTTATGCCGCTACTAGTATGGCTTTTTATGGTATATTTTGGACTTTCTAGATGGT r poolTGGGTATAAATTTAAGCAGTGTAAGTTCGGCTATTATTGT756Campylobacte GCTAAAGGTCCAATCCAAGCTGATCCTGAAATGGCAACTCCTGCTAAACTCGCAG r poolTAGAAAAAATTTCATCATTGCCTGAATATGTGAGTGAG757Campylobacte GATTGTGTGTCCTGTGGATTGTTTTTATATTAGAGGCGATGGGGTGGTTTTGCAC r poolGATAAAGAAATTTGTATAGGGTGTGGATACTGCCTTTATGCTTGTCCT758Campylobacte GAAAGTGCAGCAAGTCTTGGTTTAAATAAAGCTCAAAGTTATTTTTATATTATCA r pool TTCCTCAAGCTATGCGTCGTTTAACACCTATGAGTATGAATTTATTAACACGCAT 759 GATTAAAAGTACAACTTTTGCTTATTTAATCGGTGCGG Campylobacte CAAAACGCTATAATCTTACGCAAATTCCTGTAGAAATTTTAGGTAAGGAACCAAA r pool AAGCAAAGATTTGCAAAAACTTATCACTCTAATGAAAGATAAAAATTTAAAAGTC 760 ATTTTTGTTCAAAATGGTTTCCCTGAAAATGCAGC Campylobacte ACACTTGCTAAAGAATGTGATGCAAAAATTTACAAAATAGATCATTTATCTTATG r poolATTGGGAAAATGAGCTTTTAAAAACTGCTGATGCCTTTTCTCATAATTTATAA761Campylobacte AGCACCACCCAAACCCTCTTCAGCAGGTTGAAAATAAAGATTTAGAGTGCCATTA r pool AAATTCTGACTTGCTAAATACTTTGCAGCAAGCAATAAAGAAGTAGTATGTCCAT 762 CATGACCGCAAG Campylobacte GCCGATCAAGCTAAAGGTCCAATCCAAGCTGATCCTGAAATGGCAACTCCTGCTA r poolAACTCGCAGT763Campylobacte CCAGAGAGAAAGCGTAAAGATGGACATTATTATGTGATTGATTTTACTTTAGATG r pool AGCTTAAAAGCTTAAAAATGAGTGAGGGTTTTAAAGGGGAAAATGATAGTGTTAA 764 TGCTTATCCTAAACGCTTCCCAACTAAAAAGG Campylobacte TCCGGATTTAGTGCGTGTGAAAAAGGAGTTATTGCCACAAATGGGTATGGATATT r poolAAACTTGTTGGGCTTATAGGTTTAAATGAGTGGGAGGAAACCTTTGAA765Campylobacte GATTGTGTGTCCTGTGGATTGTTTTTATATTAGAGGCGATGGGGTGGTTTTGCAC r poolGATAAAGAAATTTGTATAGGGTGTGGATACTGCCTTTATGCTTGTCCT766Clostridium GCTGCAGCATCTGACATAGTAAGATTATTAGCCCTAAAAAATTTTGGCGGAGTAT difficileATTTAGATGTTGATATGCTTCCAGGTATTCACTC767Clostridium GGCTGAAGCTAATGCAGATAATGGTAGATTTATGATGGAACTAGGAAAGTATTTA difficileAGAGTTGGTTTCTTCCCAGATGTTAAAA768CACCAGATGGATTTAAATACTTTGCACATCAAAATACTTTGGATGAGAATTTTGA Clostridium GGGAGAATCAATAAACTATACTGGTTGGTTAGATTTAGATGAAAAGAGATATTAT difficile 769 TTTACAGATGAATATATTGCAGCAACTGGT CTCTTGAATACATAAAACAATGGGCTGATATTAATGCAGAATATAATATTAAACT Clostridium GTGGTATGATAGTGAAGCATTCTTAGTAAATACACTAAAAAAGGCTATAGTTGAA difficile 770 TCTTCTACCACTGAAGCATTACAGCTACTAGAGGAAGAGATTC GCAGTTACCGGATGGCAAACTATTGATAGTAAAAAATATTACTTTAATACTAACA Clostridium CTGCTGAAGCAGCTACTGGATGGCAAACTATTGATGGTAAAAAATATTACTTTAA difficile 771 TACTAACACTGCT Clostridium TTGATAATAACTCAAAAGCAGTTACCGGATGGCAAACTATTGATAGTAAAAAATA difficileTTACTTTAATACTAACACTGCTGAAGCAGCTACTGGATGGCAAACTATTGATGGT772Clostridium GGCTGAAGCTAATGCAGATAATGGTAGATTTATGATGGAACTAGGAAAGTATTTA difficileAGAGTTGGTTTCTTCCCAGATGTTAAAA773CAGATGCAGCCAAAGTTGTTGAATTAGTATCAACTGCATTAGATGAAACTATAGA Clostridium CTTACTTCCTACATTATCTGAAGGATTACCTATAATTGCAACTATTATAGATGGT difficile 774 GTAAGTTTAGGTGCAGC GGCGTGTTTTTTGGCAATATATCCTCACCAGCTTGTTCTGAAGACCATGAGGAGG Clostridium TCATTTCTAACCAAACATCAGTTATAGATTCTCAAAAAACAGAAATAGAAACTTT difficile 775 AAATAGCAAATTGTCTGATGCTGAACCAT CCAGCTTGTTCTGAAGACCATGAGGAGGTCATTTCTAACCAAACATCAGTTATAG Clostridium ATTCTCAAAAAACAGAAATAGAAACTTTAAATAGCAAATTGTCTGATGCTGAACC difficile 776 ATGGTTCAAAATGAAAGACGACGAAAAGAAAGC CCAGCTTGTTCTGAAGACCATGAGGAGGTCATTTCTAACCAAACATCAGTTATAG Clostridium ATTCTCAAAAAACAGAAATAGAAACTTTAAATAGCAAATTGTCTGATGCTGAACC difficile 777 ATGGTTCAAAATGAAAGACGACGAAAAGAAAGC ACGAATTTAGTAATGAAGGAAAAGGAAGCTCTAAGAAAATAATTAAATTCTTTAA Clostridium GAGCACAAAGGGTATTGCTCTACTGGCATTTATTTTAGGCGTGTTTTTTGGCAAT difficile 778 ATATCCTCACCAGCTT Clostridium GCGATACCTCCCCGATACCGCCGTATCCTTAAAAAAGGGCGACTTTAATACACTA difficileCCCGCAATCCATTCTATAATAGGGAACAGCGGCTTTTGCGC779CATCTGCAAATTGAAGACCTGTTGAATAAGTAGTTCCATCAACTAAACCAAACTT Clostridium TTTAGTTTTCATAGCATCTTTTATAGTAAGTTTCACAGCAGTTTCAGTTGAATCT difficile 780 GTAAAAGCTGTATCAAATACATCTGACATAGACATAACTGCAGCAC Clostridium GGCGCTGTGCATTAGCACTTTAAGCAACGGAATTTATTCGTTGGCGCTGTGCATT difficileAGCACTTTAAGCAACGGAATTTATTCGTTGGCGCTGT781 Plesiomonas shigelloidesATGACCGCAAAGGGATGTGTTCAGAGGAAAAATCTCGTATTGCGCAAGCGGTGG782Plesiomonas TCGAGCGGCTCAAACGTCGCTTGATCATCGGCTGTGCGGTGGGTATTGGCGTTTC shigelloidesAGTGTCAGTCTCAGGGATGATTGGGT783Plesiomonas shigelloidesCCGCCGTGAAGGCAAAGTGCACACCCAAGAATACCATCTGGGTGAGCCGGTAGC784GCCGATGCCGGTGAAATTATCGCCACGTTCGGGCAATTCGTTATTGGCGATAGCC enterocoliticaAACCTTACCATTACGCTCAC790GCTACCGCTTAGGAACAGACTTTGGAGTGATAGGACCTGATGCTGGAGGTCAAAA Yersinia AGTCCAAAACAAAGCCCATCAATTTATTAATGCCGAAAAGTATCAAGCATGGGAT enterocolitica 791 GAC Yersinia GCTTAGGAACAGACTTTGGAGTGATAGGACCTGATGCTGGAGGTCAAAAAGTCCA enterocoliticaAAACAAAGCCCATCAATTTATTAATGCCGAAAAGTATCAAGCATGGGATGAC792Yersinia GCTTCAAACGCAAGTCCATTTATTGTTATTCGATGAGGACTTTCCTGAGCCGCTC enterocoliticaATCAGCCCACTTACTCAATATGG793GGATAAGGAAATCCTCAAACGCATTAATGAGTTAGTAAAAAATATTCAAAGAACG Yersinia CCATTTGAGGGAAAGGGTAAACCGGAACCCCTTAAACATAATCTGGCAGGGTTCT enterocolitica 794 GG TGTACGCTGCGAGTGAAAATAGTATTTCTATTGGTTATGCACAAAGCCATGTAAA Yersinia AGAAAATGGGTATACATTGGATAATGACCCTAAAGGTTTTAACCTGAAGTACCGT enterocolitica 795 TATGAACTCG Yersinia CTATTGGTTATGCACAAAGCCATGTAAAAGAAAATGGGTATACATTGGATAATGA enterocoliticaCCCTAAAGGTTTTAACCTGAAGTACCGTTATGAACTCG796CTATTGGTTATGCACAAAGCCATGTAAAAGAAAATGGGTATACATTGGATAATGA Yersinia CCCTAAAGGTTTTAACCTGAAGTACCGTTATGAACTCGATGATAACTGGGGAGTA enterocolitica 797 ATAGGTTCGTTTG Yersinia CCTGAAGTACCGTTATGAACTCGATGATAACTGGGGAGTAATAGGTTCGTTTGCT enterocoliticaTATACCCATCAGGG798ATGATAACTGGGGAGTAATAGGTTCGTTTGCTTATACCCATCAGGGATACGATTT Yersinia CTTCTATGGCAGTAATAAGTTTGGTCACGGTGATCTTGATTACTATTCAGTAACA enterocolitica 799 ATGGGGCCATCTTTCCGCATTAACGAATATGTTAGCCTTTATGGATTACTGGG GGCATCATGAAAGGCGGCGAGAGTGCAGGGTGGCACAACTGGACAATCGGTGATG Yersinia CGCCGTTTGCCGGAGGGTTCTCGGCGATGATTGGTGTGGCGATGATTGTCGGTTT enterocolitica 800 CTCCTTCCAGGGAACTGAGCTGATTGGTATTGCTGCTGGTGAATCA Yersinia CCACAACACTCACCTCTGATACGCGGGTACGTACCAGTGTACCGGCATCGGTGAT enterocoliticaCATCATGATTTGGTCAGTCGGC801Vibrio poolGCCGCGGAATTTTATTATCCCGATAACTATGTCGATTCTTCGGCAGTGTATTGGCCAAATGATATTGCGATCATCAAGTTAGAAAGCG 802Vibrio poolAATGCCGGCTAAAGGTGACTTTGTTAAGGACGGTATTTCTCCTGAATTTGCAAACCGTTGGCACGACTGGCAGCAAGCTGTTATTGCAGTGAGTAAAGAGCAACTGGGTG 803CAGTGATGGTTTCAACTTCCTCAAACAGATGAAAGCGTTTGAATTTGAAAGAGAG Vibrio pool ATTCAAGTTGTCGCTTTTGCGGCCGATGAAACCTATCTAAGCAATGTGGATTCAC 804 AATCGTTACAAGGCGTG Vibrio poolGTCAATGGTACCAATGCGAATGTCGCAAACTACCCTTCGTTTGCCAGCTTGGCGATTTATATCTCTCCTTATCAATACAGCTCAGGAACCTACTGTGGTGCG 805Vibrio poolTCGATGCGTTAAACACGAAGCGATAATCTTGGGCAATCGCATCGGTTGACCACTCACGGAAATAGGCATCTAACGTCGTATAACTGGCTCCAAACTGACGAT 806Vibrio poolGGACGGTATTTCTCCTGAATTTGCAAACCGTTGGCACGACTGGCAGCAAGCTGTTATTGCAGTGAGTAAAGAGCAACTGGGTG 807Vibrio poolCATTCGCTCTCGATTCCATTTCGAGAATGGCGACATGAAGCCATTCTCGACTTCGACACCGACCTTAAAGTCGCGAAAGAACTCG 808Vibrio poolCACCAGAGGTTGCGATCGTGGTGGATACTAAGCTCTATCATCACGAAGAGTTGCTTTATACACCAGGGCTACCAGAGC 809GTTTGGCGTGAGCAAGGTTTTGAGGTGGATGACTCAAGCCTGACTCAAGCGATTT Vibrio pool CTACTCTGCGTAAGATGTTGAAGGATTCAACCAAATCTCCAGAGTTTGTTAAAAC 810 CGTTCCAAAACGAGGCTATCAACTCATTTGTACTGTTGAACGCCTAAGCCCGCTTVibrio poolCCACACCGCATGTCTCAACGCATTGTCGAAGAAGTCGAGAAAGTGGAAGGCGAAATCAGC 811Enteroaggreg AGCGATACATTAAGACGCCTAAAGGATGCCCTGATGATAATATACGGAATATCAA ative E. coliAAGTAGATGCTTGTAGTTGTCC812(EAEC)GAATTGGEnteroaggreg GCTAGTCTGGGTATCAGTTTTCCTTTGATGGGATTATTTAGTTCTTCAGAAAATC ative E. coli AAAAAGAAAAGATTATTTCTATATCTCGAACCAGAAATGAATTATTGAAAGAAAA (EAEC) TATAAAACTAGATCTGTTGGAAAAAGAGATTCGCCAGAAAATTGATAAATTAGAG AAAAATCTTGCGATGATGAAAAATGAACTAGCTCTGAAAAAAAGGAAAATTGAGT 813 ATATAAATTATCGCGTAAAGAATGGACAAGACGACGTTATCACTTATTTGTCTAG TGTAGAGAATTTACATGAAACAGAAAATGAATTTCAGAAAATTGGATATGAGATT GAATATTATAGTTTATATCATTATTTTCTTCTGCAGCACATTTCCAATAC Enteroaggreg GTTCTCCAGAAGGTCTTGTATGTGTTTAGTAACCCTAAGCTTCAAATTAATTAAA ative E. coli TCAAAAACAGTACCGTCAATTCCTGAAAAAGCGTGAAATGCCTGAGGACAATGTC 814 (EAEC) CATCAAAGTAGTCACCA Enteroaggreg ACGACACCCCTGATAAACAACCTTAAATGATGAGTATGCACTACCTGATTTAGTT ative E. coli GATTCCCTACGTAAAATTTCTATTTTAACTTCTTTTTCACCTCTCTTAAAAAAGT (EAEC) TCTCCAGAAGGTCTTGTATGTGTTTAGTAACCCTAAGCTTCAAATTAATTAAATC 815 AAAAACAGTACCGTCAATTCCTGAAAAAGCGTGAAATGCCTGAGGACAAT Enteroaggreg GCAATCAGATTAAGCAGCGATACATTAAGACGCCTAAAGGATGCCCTGATGATAA ative E. coliTATACGGAATA816(EAEC)TCAAAAGTAGATGCTTGTAGTTGTCCGAATTGGEnteroaggreg GGGCAGTATATAAACAACAATCAGTGGTTCTCATCTATTACAGACAGCAATTTTT ative E. coliATTTATCATTATCCTATAATCTTCTATCGGCTTATGAAGCAAAAATGC817(EAEC) Enteroaggreg GTTCTCCAGAAGGTCTTGTATGTGTTTAGTAACCCTAAGCTTCAAATTAATTAAA ative E. coliTCAAAAACAGTACCGTCAATTCCTGAAAAAGCGTGAAAT818(EAEC)GCCTGAGGEnteropathoge CCCAAAGCGACCATCAAATCCCCCTGTCAGATAAGTTCCTGAAAAGGAAAAAACG nic E. coli ATCTCCTGTAGCTGAAGATAAAGTTCAAAACTCGTTAACACCAGAAAATTTTGTT 819 (EPEC) CA Enteropathoge TCGGCACCTGTTGTTGCTGCAGGTGGTGTCGCTGGTCATACGAATAAAATGACTA nic E. coliAAATGTCCCCGGAC820(EPEC)GCGACTAAAAGCAACACGACCGATGACAAGGCEnteropathoge CATCCGTTGTGGCACTATTTGCCCCAAGAGTTGCAGTTCCTGAAACAATATTAAA nic E. coli TGAAACAGGGACATTAGCCTGAGTTACCCCATTCTTTTTCACCGTCGCGGTATAA 821 (EPEC) GTAATCGCCTCGGTGC Enteropathoge CAGCAGATCATTTTGCCACTCAAAAAACTTCCCTTTGAATACAGTGCACTACCAC nic E. coli )TTTTAGGT822(EPECTCGGCAEnteropathoge GGTCTAAAACTTCTACAGAAGCAAGCTGATTTACTAAAAATAATCATGGAGGATA nic E. coli CCTCTGTTACAGAAAATACCTTTAAAAACATAGAGATGGCTATAGCAGATATAAA 823 (EPEC) AAGGGAGTACTATTCGCATACAGTTG Enteropathoge CATTGATCAGGATTTTTCTGGTGATAATACCCGTTTAGGTATTGGTGGCGAATAC nic E. coliTGGCGAGACTATTTCAAAAGTAGCGTTAACG824(EPEC)GCTATTTCCGCATGAGEnteropathoge ACTGCGACTAAAACGTTGACTAAGGCAACGGAAAGCGTTGCTGATGCTGTTGAAG nic E. coliATGCATCCA825(EPEC)GCGEnteropathoge GGCTCTTTTGCAGCAATTAACAGTGCTACGAAAGGCGCGAGTGATATTGCTCAAA nic E. coliAAACCGCCTCTACATCTTCTAA826(EPEC)GGEnteropathoge GCTCTAAATTATGCGGCACAACAGGCCGCGAGCCTTGGTAGCCAGCTCCAGTCGC nic E. coliGCTCACTGAACGGCGATTACGCG827(EPEC) Enteropathoge CATTAGCCTGAGTTACCCCATTCTTTTTCACCGTCGCGGTATAAGTAATCGCCTC nic E. coliGGTGCCATCCGCTTTAGCCGAAGTC828(EPEC)TTATCAGCEnteropathoge GCGGTTTTAGCAGACACGACTACCTGCCCTGGCGTACTCGACTTCAACGTTACAG nic E. coli EC)TTGCCTTA829(EPCCGTTAGEnteropathoge GGGCTGCAAATAAATATAGCCATTATAGTTCTATGAACTCAATAACTGCTTGGAT nic E. coli TAAACAGACATCTAGTGAGCAGCGTTCTGGAGTATCAAGCACTTATAACCTAATA 830 (EPEC) ACACAAAACCCTCTTCCTGGG Enteropathoge CCCTTTGAATACAGTGCACTACCACTTTTAGGTTCGGCACCTCTTGTTGCTGCAG nic E. coliGTGGTGTTGCTGGTC831(EPEC)ACACGAATAAACTEnteropathoge AACATTATGGAACGGCAGAGGTTAATCTGCAGAGTGGTAATAACTTTGACGGTAG nic E. coli TTCACTGGACTTCTTATTACCGTTCTATGATTCCGAAAAAATGCTGGCATTTGGT 832 (EPEC) CAGGT Enteropathoge CCGTTTAGGTATTGGTGGCGAATACTGGCGAGACTATTTCAAAAGTAGTGTTAAC nic E. coliGGCTATTTCCGCATG833(EPEC)AGCGGCTGGCATGAEnterotoxigeni GCAGGCAAAAGAGAAATGGTTATCATTACATTTAAGAGCGGCGCAACATTTCAGG c E. coli TCGAAGTCCCGGGCAGTCAACATATAGACTCCCAAAAAAAAGCCATTGAAAGGAT 834 (ETEC) GAAGGACA Enterotoxigeni GGTCCTGAAAGCATGAATAGTAGCAATTACTGCTGTGAATTGTGTTGTAATCCTG c E. coli ETEC)CT835(TGTACCGGGEnterotoxigeni GCCAGAAAGCTGAATCAGTTGACTCTTCAAAAGAGAAAATTACATTAGACACTAA c E. coli AAAGTGTAATGTTGTAAAAAACAACAGTGGAAAAAAATCAGAAAATATGAATAAC 836 (ETEC) ACATTTTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGCTGG Enterotoxigeni TCAACTGAATCACTTGACTCTTCAAAAGAGAAAATTACATTAGAGACTAAAAAGT c E. coli GTGATGTTGTAAAAAACAACAGTGAAAAAAAATCAGAAAATATGAACAACACATT 837 (ETEC) TTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGCTGG Enterotoxigeni CAACCTTGTGGTGCATGATGAATCCAGGGTTCTTCTCTCCAAGCTTGGTGATCCG c E. coli83ETEC)GTG8(GGAAEnterotoxigeni CGCAACATTTCAGGTCGAAGTCCCGGGCAGTCAACATATAGACTCCCAAAAAAAA c E. coliGCCATTGAAAGGATGAAG839(ETEC)GACEnterotoxigeni TCAGGATGCTAAACCAGTAGAGTCTTCAAAAGAAAAAATCACACTAGAATCAAAA c E. coli AAATGTAACATTGCAAAAAAAAGTAATAAAAGTGGTCCTGAAAGCATGAATAGTA 840 (ETEC) GCAATTACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCG Enterotoxigeni GCCAGAAAGCTGAATCAGTTGACTCTTCAAAAGAGAAAATTACATTAGACACTAA c E. coli AAAGTGTAATGTTGTAAAAAACAACAGTGGAAAAAAATCAGAAAATATGAATAAC 841 (ETEC) ACATTTTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGC Enterotoxigeni TCAACTGAATCACTTGACTCTTCAAAAGAGAAAATTACATTAGAGACTAAAAAGT c E. coli GTGATGTTGTAAAAAACAACAGTGAAAAAAAATCAGAAAATATGAACAACACATT 842 (ETEC) TTACTGCTGTGAACTTTGTTGTAATCCTGCCTGTGCTGG Shiga-like toxin- CAAGACTCTGTTCGTGTAGGAAGAATTTCTTTTGGAAGCATTAATGCAATTCTGG producing E. )GAAGCGTGGCATTAATAC843coli (STECTGAATTGTCATCATCATGCATCGstx1 / stx2 Shiga-like toxin- CAAAGTGCTCAGTTGACAGGAATGACTGTCACAATCAAATCCAGTACCTGTGAAT producing E.CAGGCTCCGGATTTGCTGAAGTGCAGTTTAA844coli (STEC)TAATGACTGAstx1 / stx2 Shiga-like toxin- GCTTTACGTTTTCGGCAAATACAGAGGGGATTTCGTACAACACTGGATGATCTCA producing E. GTGGGCGTTCTTATGTAATGACTGCTGAAGATGTTGATCTTACATTGAACTGGGG 845 coli (STEC) AAGG stx1 / stx2 Shiga-like toxin- AAAGTGCTCAGTTGACAGGAATGACTGTCACAATCAAATCCAGTACCTGTGAATC producing E.AGGCT846coli (STEC)CCGGATTTGCTGstx1 / stx2 Shiga-like toxin- CTCTGCAATAGGTACTCCATTACAGACTATTTCATCAGGAGGTACGTCTTTACTG producing E.ATGATTGATA847coli (STEC)GTGGCACAGGGGATAATTTGTstx1 / stx2 Shigella / CATGCTGTCACGGCATCAGCCAGGGGGCGATGGAGTGTATTCTGTTGTCCGTCAC EnteroinvasiveTCATG848E. coli (EIEC)GAGAAGTAAATCCGTGGShigella / CCTTTTCCGCGTTCCTTGACCGCCTTTCCGATACCGTCTCTGCACGCAATACCTC Enteroinvasive (EIEC)CGGATTC849E. coliCGShigella / CCGAAAGAGCAAAACCGTAAGTTTCTGTTCAAATGCTCCCGCTGGTCCGGTATGG EnteroinvasiveAATATCTT850E. coli (EIEC)TCTCCATACAATAATCGGCAGCShigella / CCGAAAGAGCAAAACCGTAAGTTTCTGTTCAAATGCTCCCGCTGGTCCGGTATGG EnteroinvasiveAATATCTTTCT851E. coli (EIEC)CCATACAATAATCGGCAGCShigella / AGCTAAGGACAGCATTCCAATTGATCAATTAGTATGGACCAAACTAAGTTATATT Enteroinvasive TTCGGCGATTACCATCCATACGATACATCTTTCGATGCAGCTGAAGAACTGATCA 852 E. coli (EIEC) TTCA Shigella / CCGAAGCAGCTTTAGGATATTGTGATTTATTTTTGACTGAAAAACCTTTGAAAGT Enteroinvasive TCTAGTGAGTCAAGAACATTTGGGATTAAGAGAATTATTCTCATGCTCTGTTGAG 853 E. coli (EIEC) TCATCAGCTAGTGAAGGGCT Shigella / TCAGCTGAAATTTATGCACACGAAGAAAACTGAGGTCTCCTTTCTTTTGCGTTCC EnteroinvasiveCAACAGAG854E. coli (EIEC)GShigella / CAGCTGAAATTTATGCACACGAAGAAAACTGAGGTCTCCTTTCTTTTGCGTTCCC EnteroinvasiveAACAGAGGATTGTCAATTATTCTGTCGATCTC855E. coli (EIEC)ATCTTCCACAACShigella / CCTTTTCCGCGTTCCTTGACCGCCTTTCCGATACCGTCTCTGCACGCAATACCTC EnteroinvasiveCGGAT856E. coli (EIEC)TCCG Shigella / TGAAGAGCATGCCAACACCTTTTCCGCGTTCCTTGACCGCCTTTCCGATACCGTC Enteroinvasive857E. coli (EIEC)TCTGCACShigella / CGTTCCTTGACCGCCTTTCCGATACCGTCTCTGCACGCAATACCTCCGGATTCCG Enteroinvasive858E. coli (EIEC)TGAACAGGTCGCTShigella / CATGCTGTCACGGCATCAGCCAGGGGGCGATGGAGTGTATTCTGTTGTCCGTCAC EnteroinvasiveTCA859E. coli (EIEC)TGGAGAAGTAAATCCGTGGE. coli O157CCCAACTTCAACCCAATCACTTTGGATATTTTTATAAACTATTTTATCCGTGCTCGTATCACAAGATATCCCAGTAAACACGAC 860E. coli O157CACGTTGATTAATGCGGTTGCTTCCAGTGCGCCAGATTTAACTTTTTTTTCATCATATACATAGTAACTGGCCATGACTGGT 861Listeria CAAACTGAAGCAAAGGATGCATCTGCATTCAATAAAGAAAATTTAATTTCATCCA monocytogeneTGGCACCACCAGCATCTCCGCCTGCAAGTCCTAAGACGCCAAT862GGGAAATCTGTCTCAGGTGATGTAGAACTGACAAATATCATCAAAAATTCTTCCT TCAAAGCCGTAATTTACGGTGGCTCCGCAAAAGATGAAGTTCAAATCATCGACGG 863 TAACC GCATCTCCGCCTGCAAGTCCTAAGACGCCAATCGAAAAGAAACACGCGGATGAAA TCG864TGCAAGTCCTAAGACGCCAATCGAAAAGAAACACGCGGATGAAATCGATAAGTAT ATACAAGGATTGGATTACAATAAAAACAATGTATTAGTATACCACGGAGATGCAG 865 TGA AAGTCCTAAGACGCCAATCGAAAAGAAACACGCGGATGAAATCGATAAGTATATA CAAGGATTGGATTACAATAAAAACAATGTATTAGTATACCACGGAGATGCAGTGA866TCAGATACCGTCGTAGTCTTAACCATAAACTATGCCAACTAGAGATTGGAGGTTG TTCCTTACTCCTT867 AGGCCAATACCCTACCGTCTAAAGCTGATAGGTCAGAAACTTGAATGATATGTCA CATTTAATGTGATCCGTAAAGTTATTATGAGTCACCAATTATATTGGTTCTTTAT m sp. 868 CTAATAAATACAACCC AGCATTTGCCAAGGATGTTTTCATTAATCAAGAACGAAAGTTAGGGGATCGAAGA Cryptosporidiu CGATCAGATACCGTCGTAGTCTTAACCATAAACTATGCCAACTAGAGATTGGAGG m sp. 869 TTGTTCCTTACTCCTT Cyclospora GCGAGACTGGAAGCTTTTAACGTTGTATACACCCATCCCAACCCTCGAATCGCTT cayetanensisTTCTCTCTCACGACG870Cyclospora GCGAGACTGGAAGATTTTAACGTTGTACATACTCATCCCATCCCTCGAATCGCTT cayetanensisTTCTCTCTCACGACG871Cyclospora ATTTGTGTGGTGGCTCTTTCTTTGCTGCTGCTCGCTATCCTTTCGTCCGAAAGAG cayetanensisATACGGTG872Cyclospora GTGCAGTCACATGAGGCATATATCATGAGAGCGAGGGTTGTTTCGCGTGGCTGTC cayetanensisTGTGTGTGTGCAAGTGC873Cyclospora GTGCAGTCACATGAGGCATATATCATGAGAGCGAGGGTTGTTTCGCGTGGCTGTC cayetanensisTGTGTGTGTGCAAGTGC874Entamoeba GCTGTATTCCCATCCATTGTTGGTAGACCAAGACACGTTTCAGTTATGGCTGGTA histolyticaTGGGTCAAAAAGATGCTTATGTTGGAGATGAAGCTCAATCAAAGAGAG875CTTTCAGGAGGAACATCAATGTATCCAGGTATTAACACCAGACTTGAAAAGGAAA Entamoeba TGATTCAATTAGCACCACCAACAATGAAGATTAAGGTTATTGCACCACCAGAAAG histolytica 876 A ATTGTCGTGGCATCCTAACTCACTTAGAATGTCATTTCTCAATTCATTGAATGAA Entamoeba TTGGCCATTTTGTACTAATACAAACTGGATCGTCTCAAGTATTATCTTTATCATT histolytica CACAAAGCTATCCTTGTATTTTACTAACCAAAGAAACTATTACTGTTATAATGAG 877 CCGTCCGC GiardiaAAGAAGTCCGCCGACAACATGTACCTAACGATCAAGGAGGAGATCGACACCATGGCTGCAAACTTCCGCAAGTCCCTTGCGGAGATGGGCGACACACTCAA 878GiardiaACCTCGACAGGCTCATCCAGACGGAGTCGAGGAAGCGCCAGGCCTCGTTCGAGGACATCCGC 879ACCAGATCGCCATCCACAA GiardiaCGACGCCATCGCAGCCCTCAGGAAGGAGGCCCTCAAGAGCCTGAACGACCTCG 880GACA GiardiaCCATGGCTGCAAACTTCCGCAAGTCCCTTGCGGAGATGGGCGACACACTCAACAACGTTGAGACAAATCTCCAGAACCAGATCGCCATCCAT 881 GiardiaACCTCGACAGGCTCATCCAGACGGAGTCGAGGAAGCGCCAGGCCTCGTTCGAGGACATCCGCGAG 882 GiardiaCCCTCAAGAGCCTGAACGACCTCGAGACAGGCATCGCCACGGAGAACGCCGAGAGGAAGAAGATGTATGACCAGCTCA GiardiaGCGACACACTCAACAACGTTGAGACAAACCTCCAGAACCAGATCGCCATCCACAACGATGCCATCGCGGCCCTCAGAAAGGAGGCCCTCAAGA GiardiaGCGCTGCTATCCTCAACTGTTTTGACGTGTTTGCCGCAATGGCTGTTGACAGGTGTACGGCGGAA In another embodiment, the method and / or assay comprises one or more primer and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 33. Multiplex Panne I – Open Array – Primers and Probes (26 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NOAdenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 10 8, 11 9, 12 Norovirus GI16, 19, 22, 49, 64,17, 20, 23, 50, 65, 18, 21, 24, 51, 66, 7071 72 Norovirus GII76, 79, 82, 85, 94,77, 80, 83, 86, 95, 78, 81, 84, 87, 96, 100101 102 Rotavirus A103, 106, 109, 112,104, 107, 110, 113, 105, 108, 111, 114, 130, 139131, 140 132, 141 Rotavirus B 142, 145, 148 143, 146, 149 144, 147, 150 Rotavirus C 151, 154 152, 155 153, 156 Sapovirus 1157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169, 178170, 179 171, 180 Sapovirus 2181, 184, 187, 202,182, 185, 188, 203, 183, 186, 189, 204, 211, 217212, 218 213, 219 Campylobacter pool226, 229, 232, 241,227, 230, 233, 242, 228, 231, 234, 243, 244, 256245, 257 246, 258Clostridium difficile (toxin A / B)259, 262, 265, 271,260, 263, 266, 272, 261, 264, 267, 273, 286, 301287, 302 288, 303 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312 Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 Yersinia enterocolitica328, 331, 337, 340,329, 332, 338, 341, 330, 333, 339, 342, 358, 361359, 362 360, 363 Vibrio pool364, 367, 370, 373,365, 368, 371, 374, 366, 369, 372, 375, 385, 388, 391386, 389, 392 387, 390, 393 Enteroaggregative E. coli (EAEC)394, 397, 400, 406,395, 398, 401, 407, 396, 399, 402, 408, 409, 412410, 413 411, 414 Enteropathogenic E. coli (EPEC)415, 418, 421, 424,416, 419, 422, 425, 417, 420, 423, 426, 430, 454431, 455 432, 456 Enterotoxigenic E. coli (ETEC)460, 463, 466, 469,461, 464, 467, 470, 462, 465, 468, 471, 475, 481476, 482 477, 483 Shiga-like toxin-producing E. coli 487, 490, 493, 496, 488, 491, 494, 497, 489, 492, 495, 498, (STEC) stx1 / stx2 499 500 501 Shigella / Enteroinvasive E. coli 502, 511, 517, 520, 503, 512, 518, 521, 504, 513, 519, 522, (EIEC) 526, 532 527, 533 528, 534 E. coli O157 538, 541 539, 542 540, 543 Listeria monocytogenes544, 547, 550, 553,545, 548, 551, 554, 546, 549, 552, 555, 556557 558 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Cyclospora cayetanensis568, 571, 574, 577,569, 572, 575, 578, 570, 573, 576, 579, 580581 582 607, 610608, 611 609, 612 616, 619, 622, 625, 617, 620, 623, 626, Optional control: Bacillus 628, 631, 634, 637, 629, 632, 635, 638, 624, 627, 630, 648, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 651, 657 652 653 In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 34. Multiplex Panel II – TaqMan Array Card – Primers and Probes (22 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NO Adenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 10 8, 11 9, 12 Norovirus GI16, 19, 22, 49, 64,17, 20, 23, 50, 65, 18, 21, 24, 51, 66, 7071 72 Norovirus GII76, 79, 82, 85, 94,77, 80, 83, 86, 95, 78, 81, 84, 87, 96, 100101 102 Rotavirus A103, 106, 109, 112,104, 107, 110, 113, 105, 108, 111, 114, 130, 139131, 140 132, 141 Sapovirus 1157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169, 178170, 179 171, 180 Sapovirus 2181, 184, 187, 202,182, 185, 188, 203, 183, 186, 189, 204, 211, 217212, 218 213, 219 Campylobacter pool226, 229, 232, 241,227, 230, 233, 242, 228, 231, 234, 243, 244, 256245, 257 246, 258 Clostridium difficile (toxin A / B)259, 262, 265, 271,260, 263, 266, 272, 261, 264, 267, 273, 286, 301287, 302 288, 303 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312 Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 Yersinia enterocolitica328, 331, 337, 340,329, 332, 338, 341, 330, 333, 339, 342, 358, 361359, 362 360, 363 Vibrio pool364, 367, 370, 373,365, 368, 371, 374, 366, 369, 372, 375, 385, 388, 391386, 389, 392 387, 390, 393 Enteroaggregative E. coli (EAEC)394, 397, 400, 406,395, 398, 401, 407, 396, 399, 402, 408, 409, 412410, 413 411, 414 Enteropathogenic E. coli (EPEC)415, 418, 421, 424,416, 419, 422, 425, 417, 420, 423, 426, 430, 454431, 455 432, 456 Enterotoxigenic E. coli (ETEC)460, 463, 466, 469,461, 464, 467, 470, 462, 465, 468, 471, 475, 481476, 482 477, 483 Shiga-like toxin-producing E. coli 487, 490, 493, 496, 488, 491, 494, 497, 489, 492, 495, 498, (STEC) stx1 / stx2 499 500 501 Shigella / Enteroinvasive E. coli 502, 511, 517, 520, 503, 512, 518, 521, 504, 513, 519, 522, (EIEC) 526, 532 527, 533 528, 534 E. coli O157 538, 541 539, 542 540, 543 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Entamoeba histolytica 583, 586, 589 584, 587, 590 585, 588, 591 Giardia592, 595, 598, 601,593, 596, 599, 602, 594, 597, 600, 603, 607, 610608, 611 609, 612 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 35. Multiplex Panne I – Open Array – Primers and Probes (26 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NOAdenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 13 8, 14 9, 15 Norovirus GI22, 37, 40, 43, 49,23, 38, 41, 44, 50, 24, 39, 42, 45, 51, 7374 75 Norovirus GII79, 85, 91, 94, 97,80, 86, 92, 95, 98, 81, 87, 93, 96, 99, 100101 102 Rotavirus A109, 112, 121, 124,110, 113, 122, 125, 111, 114, 123, 126, 127, 136128, 137 129, 138 Rotavirus B 145, 148 146, 149 147, 150 Rotavirus C 151, 154 152, 155 153, 156 Sapovirus 1163, 166, 169, 172,164, 167, 170, 173, 165, 168, 171, 174, 175, 178176, 179 177, 180 Sapovirus 2181, 184, 205, 214,182, 185, 206, 215, 183, 186, 207, 216, 217, 223218, 224 219, 225 Campylobacter pool229, 232, 244, 250,230, 233, 245, 251, 231, 234, 246, 252, 253, 256254, 257 255, 258 Clostridium difficile (toxin A / B)259, 265, 277, 283,260, 266, 278, 284, 261, 267, 279, 285, 295296 297 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312 Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 Yersinia enterocolitica328, 334, 337, 343,329, 335, 338, 344, 330, 336, 339, 345, 349, 361350, 362 351, 363 Vibrio pool367, 370, 376, 382,368, 371, 377, 383, 369, 372, 378, 384, 385, 388386, 389 387, 390 E. coli O157 538, 541 539, 542 540, 543 Listeria monocytogenes544, 547, 550, 553,545, 548, 551, 554, 546, 549, 552, 555, 556557 558 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Cyclospora cayetanensis568, 571, 574, 577,569, 572, 575, 578, 570, 573, 576, 579, 580581 582 Entamoeba histolytica 583, 586, 589 584, 587, 590 585, 588, 591 Giardia592, 598, 601, 604,593, 599, 602, 605, 594, 600, 603, 606, 607, 610608, 611 609, 612 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus subtilis 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 36. Multiplex Panel II – TaqMan Array Card – Primers and Probes (22 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NOAdenovirus F40 / 41 1, 4 2, 5 3, 6 Astrovirus 7, 13 8, 14 9, 15 Norovirus GI22, 37, 40, 43, 49,23, 38, 41, 44, 50, 24, 39, 42, 45, 51, 7374 75 Norovirus GII79, 85, 91, 94, 97,80, 86, 92, 95, 98, 81, 87, 93, 96, 99, 100101 102 Rotavirus A109, 112, 121, 124,110, 113, 122, 125, 111, 114, 123, 126, 127, 136128, 137 129, 138 Sapovirus 1163, 166, 169, 172,164, 167, 170, 173, 165, 168, 171, 174, 175, 178176, 179 177, 180 Sapovirus 2181, 184, 205, 214,182, 185, 206, 215, 183, 186, 207, 216, 217, 223218, 224 219, 225 Campylobacter pool229, 232, 244, 250,230, 233, 245, 251, 231, 234, 246, 252, 253, 256254, 257 255, 258 Clostridium difficile (toxin A / B)259, 265, 277, 283,260, 266, 278, 284, 261, 267, 279, 285, 295296 297 Plesiomonas shigelloides 304, 307, 310 305, 308, 311 306, 309, 312 Salmonella sp.313, 316, 319, 322,314, 317, 320, 323, 315, 318, 321, 324, 325326 327 Yersinia enterocolitica328, 334, 337, 343,329, 335, 338, 344, 330, 336, 339, 345, 349, 361350, 362 351, 363 Vibrio pool367, 370, 376, 382,368, 371, 377, 383, 369, 372, 378, 384, 385, 388386, 389 387, 390 Enteroaggregative E. coli (EAEC)394, 400, 403, 406,395, 401, 404, 407, 396, 402, 405, 408, 409, 412410, 413 411, 414 Enteropathogenic E. coli (EPEC)415, 421, 424, 442,416, 422, 425, 443, 417, 423, 426, 444, 454, 457455, 458 456, 459Enterotoxigenic E. coli (ETEC)460, 466, 469, 472,461, 467, 470, 473, 462, 468, 471, 474, 478, 481479, 482 480, 483 Shiga-like toxin-producing E. coli (STEC) stx1 / stx2490, 493, 496, 499 491, 494, 497, 500 492, 495, 498, 501Shigella / Enteroinvasive E. coli 502, 514, 517, 520, 503, 515, 518, 521, 504, 516, 519, 522, (EIEC) 529, 532 E. coli O157 538, 541 Cryptosporidium sp. 559, 562, 565 560, 563, 566 561, 564, 567 Entamoeba histolytica 583, 586, 589 584, 587, 590 585, 588, 591 Giardia592, 598, 601, 604,593, 599, 602, 605, 594, 600, 603, 606, 607, 610608, 611 609, 612 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus subtilis 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 37. Multiplex Panne I – Open Array – Primers and Probes (26 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NOAdenovirus F40 / 41 1 2 3 Astrovirus 7 8 9 Norovirus GI 16, 19, 22 17, 20, 23 18, 21, 24 Norovirus GII 76, 79, 82, 85 77, 80, 83, 86 78, 81, 84, 87 Rotavirus A 103, 106, 109, 112 104, 107, 110, 113 105, 108, 111, 114 Rotavirus B 142, 145, 148 143, 146, 149 144, 147, 150 Rotavirus C 151 152 153 Sapovirus 1157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169170 171 Sapovirus 2 181, 184, 187 182, 185, 188 183, 186, 189 Campylobacter pool 226, 229, 232 227, 230, 233 228, 231, 234 Clostridium difficile (toxin A / B) 259, 262, 265 260, 263, 266 261, 264, 267 Plesiomonas shigelloides 304 305 306 Salmonella sp. 313 314 315 Yersinia enterocolitica 328 329 330 Vibrio pool 364, 367, 370 365, 368, 371 366, 369, 372 Enteroaggregative E. coli (EAEC)394, 397, 400, 415,395, 398, 401, 416, 396, 399, 402, 417, 418, 421, 424419, 422, 425 420, 423, 426 Enteropathogenic E. coli (EPEC) 415, 418, 421, 424 416, 419, 422, 425 417, 420, 423, 426 Enterotoxigenic E. coli (ETEC) 460, 463, 466, 469 461, 464, 467, 470 462, 465, 468, 471 Shiga-like toxin-producing E. coli (STEC) stx1 / stx2487, 490 488, 491 489, 492E.504540 546 sp. 561 Cyclospora cayetanensis 568, 571, 574 569, 572, 575 570, 573, 576 Entamoeba histolytica 583 584 585 Giardia 592, 595, 598 593, 596, 599 594, 597, 600 616, 619, 622, 625, 617, 620, 623, 626, 618, 621, 624, 627, Optional control: Bacillus subtilis 628, 631, 634, 637, 629, 632, 635, 638, 630, 633, 636, 639, atrophaeus 640, 643, 646, 649, 641, 644, 647, 650, 642, 645, 648, 651, 652 653 654 In another embodiment, the method and / or assay comprises one or more primer pairs and one or more probes for the simultaneous detection of the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter jejuni, Campylobacter coli, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample. Table 38. Multiplex Panel II – TaqMan Array Card – Primers and Probes (22 Targets) OrganismForward PrimerReverse Primer SEQ ID NO SEQ ID NOProbe SEQ ID NOAdenovirus F40 / 41 1 2 3 Astrovirus 7 8 9 Norovirus GI 16, 19, 22 17, 20, 23 18, 21, 24 Norovirus GII 76, 79, 82, 85 77, 80, 83, 86 78, 81, 84, 87 Rotavirus A 103, 106, 109, 112 104, 107, 110, 113 105, 108, 111, 114 Sapovirus 1157, 160, 163, 166,158, 161, 164, 167, 159, 162, 165, 168, 169170 171 Sapovirus 2 181, 184, 187 182, 185, 188 183, 186, 189 Campylobacter pool 226, 229, 232 227, 230, 233 228, 231, 234 Clostridium difficile (toxin A / B) 259, 262, 265 260, 263, 266 261, 264, 267 Plesiomonas shigelloides 304 305 306 Salmonella sp. 313 314 315 Yersinia enterocolitica 328 329 330 Vibrio pool 364, 367, 370 365, 368, 371 366, 369, 372 Enteroaggregative E. coli (EAEC)394, 397, 400, 415,395, 398, 401, 416, 396, 399, 402, 417, 418, 421, 424419, 422, 425 420, 423, 426 Enteropathogenic E. coli (EPEC) 415, 418, 421, 424 416, 419, 422, 425 417, 420, 423, 426 Enterotoxigenic E. coli (ETEC) 460, 463, 466, 469 461, 464, 467, 470 462, 465, 468, 471 Shiga-like toxin-producing E. coli (STEC) stx1 / stx2487, 490 488, 491 489, 492 Described herein are compositions, kits, and method for the detection (i.e., the presence or absence) of gastrointestinal pathogens including one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a specimen or a sample. DNA or RNA is extracted from one or more specimen / sample, reverse transcribed if required, multiplied using real-time amplification (or RT-PCR if required), and detected using specific primers and a fluorescent reporter dye probe for one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. As will be appreciated by those in the art, the specimen / sample may comprise any number of things, including, but not limited to, include stool samples, rectal swabs, or tissue samples (for example, taken during a biopsy) obtained from human patients; research samples; purified samples, such as purified genomic DNA, RNA, proteins, etc.; and raw samples (bacteria, virus, genomic DNA, etc.). As will be appreciated by those in the art, any experimental manipulation can have been performed on the sample before analysis. In some embodiments, the specimen / sample type for diagnosis of diarrhea-causing pathogens is a stool sample or a rectal swab. If required, nucleic acid from the sample / specimen is isolated using known techniques. For example, the sample / specimen may be treated to lyse the cells, using known lysis buffers, sonication, electroporation, etc., with purification occurring as needed, as will be appreciated by those in the art. In addition, the reactions outlined herein may be accomplished in a variety of ways, as will be appreciated by those in the art. Components of the reaction may be added simultaneously, or sequentially, in any order, with preferred embodiments outlined below. In addition, the reaction may include a variety of other reagents that may be included in the assays. These include reagents like salts, buffers, neutral proteins, e.g., albumin, detergents, etc., which may be used to facilitate optimal hybridization and detection, and / or reduce non-specific or background interactions. Reagents that otherwise improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial agents, etc., may be used, depending on the sample / specimen preparation methods and purity of the target diarrhea-causing pathogens. In some embodiments, total nucleic acid extraction from a stool sample or a rectal swab is performed. The specimen / sample may be collected and transported in the Remel™ Cary-Blair Transport Medium by Thermo Fisher Scientific according to appropriate laboratory procedures. Remel™ Cary-Blair Transport Medium is a semisolid medium recommended for use in the collection, transportation, and preservation of sample / specimens, especially stool samples and rectal swabs. Nucleic acids may be isolated and purified from the specimen / sample using a nucleic acid isolation, such as, e.g., the MagMAX™ Microbiome Ultra Nucleic Acid Isolation Kit with Bead Plate (Thermo Fisher Scientific). Nucleic acid extraction may be performed via an automated process using, e.g., the Kingfisher™ Flex Purification System. For RNA viruses, the RNA is reverse transcribed into cDNA. The cDNA and genomic DNA (from DNA viruses) are then subjected for amplification using the currently disclosed composition, method, or kit. Process Control, Control Organism, or Control Sample In addition, the disclosed kit and method of detection may further include a process control (“process control” is herein referred to, interchangeably, as “control organism” or “control sample”). This is an exogenous control that has the added advantage of being a bacterial lysis control in addition to being a nucleic acid extraction and recovery control. Controls are treated and tested in parallel with target pathogen and are used to generate a predetermined expected result. When the expected result is reported, one or more aspects of the diagnostic test are confirmed to be working as intended, enabling the user of to verify the diagnostic test as valid. The process control may be Bacillus atrophaeus, which is a gram- positive, endospore forming bacterium. Preferably, the process control can function as a positive control for lysis, purification and amplification within the cartridges described herein. One exemplified process control is lyophilized Bacillus atrophaeus, such as, e.g., the TaqMan™ Universal Extraction Control Organism by Thermo Fisher Scientific. The process control may be supplied lyophilized in a quantity of 1 × 109copies / vial, and reconstituted in 200 µL of 1× PBS, pH 7.4 to a final concentration 5 × 106copies / µL During nucleic acid isolation, 10 µL of the process control is processed as a stand-alone sample in a background of universal transport media. The process control can be added to a negative extraction control. The process control may be added to one or more samples / specimens at the start of the extraction process. The process control is carried through the remainder of the workflow with the samples / specimens. It is recommended that at least one stand-alone control sample is run per extraction plate. Another exemplified process control is a bacterial spore, such as a spore of a Bacillus species. Suitable spores can be comprised of any species of Bacillus, including, e.g., Bacillus globigii, Bacillus atrophaeus, Bacillus subtilis, or Bacillus stearothermophilus. In one embodiment, the process control may be a Bacillus atrophaeus bacterial spore. In one embodiment, vicinal oxygen chelate (VOC) genes (accession number cll463) of Bacillus atrophaeus are detected as a process control. Another exemplified process control is the TaqMan® Universal RNA Spike In / Reverse Transcription (Xeno) Control is an exogenous process control for nucleic acid isolation, reverse transcription, and preamplification. The control can also be used as an internal positive control for real-time PCR. The control is used with the proprietary TaqMan® assay for Xeno™ sequences. Positive Control In addition, the disclosed method of detection may further include a positive control to determine the validity of the assay. The positive control is a mixture of plasmids of the target pathogens. For instance, an exemplified positive control is a mixture of plasmids containing sequences for one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. Reaction Mixture The terms “reaction mixture,” “amplification mixture,” or “PCR mixture” as used herein refer to a mixture of components necessary to amplify at least one amplicon from nucleic acid templates. The mixture may comprise nucleotides (dNTPs, such as A, C, G, and T), a thermostable polymerase, primers, and a plurality of nucleic acid templates. The mixture may further comprise a buffer. As used herein, “buffer” refers a solution that can include mutliple components such buffers that maintain a specific pH (e.g., Tris ^HCl), mono and divalent salts (e.g., NaCl, KCl, (NH4)2SO4, MgCl2, MgSO4), cofactors, detergents (e.g., Polysorbate 20 (Tween™ 20), t-octylphenoxy polyethoxyethanol (Triton™ X-100), octylphenoxy polyethoxyethanol (Nonidet™ P-40)), and other additives (e.g., glycerol, polyethylene glycol, betaine, formamide, dimethyl sulfoxide, dithiothreitol, tetramethylammonium chloride, bovine serum albumin, gelatin, inter alia), The working concentration range of each component is known in the art and can be optimized as needed. An exemplary PCR reaction mixture comprises: 0.1– 50 ng of target DNA; 0.1–1 μM of each primer and probe; 1–2 units of Taq DNA polymerase; 0.2 mM of each dNTP; 20 mM Tris ^HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, and water to the requisite volume. Typically, the PCR mixture is dispensed into a PCR microtube or plate, the mixture is mixted by vortexing, and either capped, sealed, or overlayed with mineral oil or silicone oil to prevent evaporation. Amplification “Amplification” as used herein refers to the use of any amplification procedures to increase the concentration of a particular nucleic acid sequence within a mixture of nucleic acid sequences. In one embodiment and as describe more fully herein, a sequence from a sample is amplified to produce a secondary target (e.g., an amplicon) that is detected, as outlined herein. Amplification involves the amplification (replication) of the sequence to be detected, such that the number of copies of the sequence is increased. Suitable amplification techniques include, but are not limited to, the polymerase chain reaction (PCR), strand displacement amplification (SDA), transcription mediated amplification (TMA) and nucleic acid sequence-based amplification (NASBA). In one embodiment, the amplification technique is PCR. The polymerase chain reaction (PCR) is well known and involves the use of primer extension combined with thermal cycling to amplify a target sequence. As used herein, “PCR”, unless specifically defined, refers to either single-plex or multiplex PCR assays, and can be real time or quantitative PCR (wherein detection occurs during amplification), end-point PCR (when detection occurs at the end amplification), or reverse transcription PCR, including but not limited to, “real-time PCR” or “quantitative PCR” or “qPCR”, “digital PCR” or “dPCR”, “reverse transcriptase PCR” or “RT-PCR”, “multiplex PCR”, “nested PCR”, “hot start PCR”, “long-range PCR”, “assembly PCR”, “asymmetric PCR”, “in situ PCR,” “single-cell PCR,” or “fast-cycling PCR,” among others. An exemplary PCR amplification typically consists of 25–35 cycles of: a denaturing step a 94 °C for 30–45 seconds; an annealing step at 55 °C for 20–60 seconds; and an extension step at 72 °C for 30–90 seconds. The amplification may be preceeded by an initial denaturation step at 94 °C for 2–3 minutes. The amplification may be followed by a final extension step at 72 °C for 10 min, and then cooled to 4 °C and maintained at this temperature until the samples are removed from the thermocycler. Example embodiments of amplification are not limited to PCR. For instance, signal amplification, single base extension (SBE) or minisequencing, oligonucleotide ligation amplification (OLA) and / or rolling-circle amplification can be used for amplification. In an embodiment, amplification can include OLA followed by RCA. A skilled person would be well aware of the real-time PCR systems that can be used for a multiplex detection using several dyes, or nucleic acid amplification assays as described herein. Exemplary systems include a real-time quantitative PCR (qPCR) instrument, including for example a QuantStudio™ Real-Time PCR system, such as the QuantStudio™5 Real-Time PCR System (QS5), QuantStudio™ 7 Real-Time PCR System (QS7), QuantStudio™ 12K Flex System (QS12K), QuantStudio™ DX Real-Time PCR System (QS Dx or QS5 Dx), or a 7500 Real-Time PCR system, such as the 7500 Fast Dx system, all from Applied Biosystems™ – a Thermo Fisher Scientific brand. Amplicon The terms “amplified product” or “amplicon” refer to a fragment of DNA amplified by a polymerase using a pair of primers in an amplification method such as PCR. Probe “Probe” as used herein, is a non-extendable oligonucleotide attached to a fluorescent reporter dye and a quencher moiety. Primer “Primer” as used herein can refer to more than one primer and refers to an oligonucleotide, whether occurring naturally or produced synthetically, which is capable of acting as an initiation- point for primer extension synthesis when placed under conditions that produce a primer extension product which is complementary to a nucleic acid strand, e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase, at a suitable temperature for a sufficient amount of time and in the presence of a buffering agent. Such conditions can include, for example, the presence of at least four different deoxyribonucleoside triphosphates (such as A, C, G, and T) and a polymerization-inducing agent such as DNA polymerase or reverse transcriptase, in a suitable buffer, and at a suitable temperature. In some embodiments, the primer may be single-stranded for maximum efficiency in amplification. The primers herein are selected to be substantially complementary to the different strands of each specific sequence to be amplified. This means that the primers must be sufficiently complementary to hybridize with their respective strands. A non-complementary nucleotide fragment may be attached to the 5′-end of the primer, with the remainder of the primer sequence being complementary, or partially complementary, to the target region of the target nucleic acid. Commonly, the primers are complementary, except when non-complementary nucleotides may be present at a predetermined sequence location, such as a primer terminus as described. The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5′-end of one sequence is paired with the 3′-end of the other, is in “antiparallel association.” Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Dyes, Detectable Labels, or Fluorescent Labels The primers and / or probes described herein may further comprise a dye, fluorescent label, or other detectable label. It should be appreciated that when using multiple fluorescent or detectable labels, particularly in a multiplex format, each fluorescent or detectable label preferably differs in its spectral properties from the other detectable labels used therewith such that the labels may be distinguished from each other, or such that together the fluorescent or detectable labels emit a signal that is not emitted by either fluorescent or detectable label alone. Exemplary fluorescent or detectable labels include, for instance, a fluorescent dye or fluorophore (e.g., a chemical group that can be excited by light to emit fluorescence or phosphorescence), “acceptor dyes” capable of quenching a fluorescent signal from a fluorescent donor dye, and the like, as described above. Suitable fluorescent or detectable labels may include, for example, fluoresceins (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein (5-FAM); 5-hydroxy tryptamine (5- HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); Mustang Purple, VIC, ABY, JUN; FITC; 6-carboxy- 4′,5′-dichloro-2′,7′-dimethoxy-fluorescein (JOE)); 6-carboxy-1,4-dichloro-2′,7′-dichloro-fluorescein (TET); 6-carboxy-1,4-dichloro-2′,4′,5′,7′-tetra-chlorofluorescein (HEX); Alexa Fluor fluorophores (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492 / 515, 493 / 503, 500 / 510, 505 / 515, 530 / 550, 542 / 563, 558 / 568, 564 / 570, 576 / 589, 581 / 591, 630 / 650-X, 650 / 665-X, 665 / 676, FL, FL ATP, FI-Ceramide, R6G SE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), Cascade Blue, Cascade Yellow; Cy™ dyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP Fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent protein (e.g., GFP, EGFP), blue fluorescent protein (e.g., BFP, EBFP, EBFP2, Azurite, mKalamal), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet), yellow fluorescent protein (e.g., YFP, Citrine, Venus, YPet), FRET donor / acceptor pairs (e.g., fluorescein / fluorescein, fluorescein / tetramethylrhodamine, IAEDANS / fluorescein, EDANS / dabcyl, BODIPY FL / BODIPY FL, Fluorescein / QSY7 and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND-22, LysoTracker Blue-White DPX, LysoTracker Yellow HCK-123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND-167, LysoSensor Green DND-189, LysoSensor Green DND-153, LysoSensor Yellow / Blue DND-160, LysoSensor Yellow / Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); rhodamines (e.g., 110, 123, B, B 200, BB, BG, B extra, 5- carboxytetramethylrhodamine (5-TAMRA), 5 GLD, 6-Carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidin, Phalloidine, Red, Rhod-2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulphorhodamine B can C, Sulphorhodamine G Extra, TAMRA (6-carboxytetramethyl-rhodamine), Tetramethylrhodamine (TRITC), Texas Red, Texas Red-X, among others as would be known to those of skill in the art. Exemplary fluorescent labels include but are not limited to FAM, VIC, ABY, JUN, AF647, or 6FAM. In one exemplary multiplex dye scheme, the fluorescent labels include FAM, VIC, ABY, JUN, or AF647; or 6FAM, VIC, ABY, JUN, or FAM. In another exemplary multiplex dye scheme, the fluorescent labels include FAM, HEX (JOE / VIC), Texas Red, and Cy5 dyes. In one embodiment the probes are labled with FAM. Other detectable labels may be used in addition to or as an alternative to labelled probes. For example, primers can be labeled and used to both generate amplicons and to detect the presence (or concentration) of amplicons generated in the reaction, and such may be used in addition to or as an alternative to labeled probes described herein. As a further example, primers may be labeled and utilized as described in Nazarenko et al., Nucleic Acids Res. 30(9): e37 (2002), Hayashi et al., Nucleic Acids Res.17(9): 3605 (1989), and / or Neilan et al., Nucleic Acids Res.25(14): 2938-2939 (1997). Those of skill in the art are capable of utilizing the PCR processes (and associated probe and primer design techniques) described in Zhu et al., Biotechniques (4): 317-325 (2020). In some embodiments, the primers and / or probes may further comprise a quencher. Suitable quenchers include but are not limited to QSY (e.g., QSY7 and QSY21), BHQ (Black Hole Quencher) and DFQ (Dark Fluorescent Quencher). In an exemplary embodiment, the quencher is QSY7. Detector probes may also include two probes, wherein, for example, a fluorophore is associated with one probe and a quencher is associated with a complementary probe such that hybridization of the two probes on a target quenches the fluorescent signal or hybridization on the target alters the signal signature via a change in fluorescence. Detector probes may also include sulfonate derivatives of fluorescein dyes with SO3 instead of the carboxylate group, phosphoramidite forms of fluorescein, phosphoramidite forms of Cy5. Any of these systems and detectable labels, as well as many others, may be used to detect amplified target nucleic acids. In some embodiments, intercalating labels can be used such as ethidium bromide, SYBR Green I, SYBR GreenER, and PicoGreen (all products of Applied Biosystems – a brand of Thermo Fisher Scientific), thereby allowing visualization in real- time, or end point, of an amplification product in the absence of a detector probe. In some embodiments, real-time visualization may include both an intercalating detector probe and a sequence-based detector probe. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in the amplification reaction and is at least partially unquenched when hybridized to a complementary sequence in the amplification reaction. In some embodiments, probes may further comprise various modifications such as a minor groove binder (MGB) to further provide desirable thermodynamic characteristics. In some embodiments, the amplicon is labeled by incorporation of, or hybridization to labeled primer. In some embodiments, the amplicon is labeled by hybridization to a labeled probe. In some embodiments, the amplicon is labeled by binding of a DNA-binding dye. In some embodiments, the dye may be a single-strand DNA binding dye. In other embodiments, the dye may be a double-stranded DNA binding dye. In other embodiments, the amplicon is labeled via polymerization or incorporation of labeled nucleotides in a template-dependent (or template- independent) polymerization reaction. This can be part of the amplifying step or alternatively the labeled nucleotide can be added after amplifying is completed. The labeled amplicon (or labeled derivative thereof) can be detected using any suitable method such as, for example, electrophoresis, hybridization-based detection (e.g., microarray, molecular beacons, and the like), chromatography, NMR, and the like. In one exemplary embodiment, the labeled amplicon is detected using qPCR. In some embodiments, a plurality of different amplicons is formed, and optionally labeled, within a single reaction volume via a single amplification reaction. For example, a multiplex reaction (e.g., 4- plex) carried out in a single tube or reaction vessel (e.g., “single-tube” or” I-tube” or “single-vessel” reaction) can produce a plurality of amplicons that are labeled. In some embodiments, the plurality of amplicons can be differentially labeled. In some embodiments, each of the plurality of amplicons produced during amplification is labeled with a different label. Assay Mixture The terms “assay mixture” or “assay mix” or “assay composition,” as used herein, include mixture containing the primer-probe pairs described above that are used in PCR. Another aspect provided herein is a method of detecting or quantifying a target nucleic acid molecule in a sample by polymerase chain reaction (PCR), such as by quantitative real-time polymerase chain reaction (qPCR). In one embodiment, the method includes: (i) contacting a sample comprising one or more target nucleic acid molecules with (a) at least one probe, such as those described herein, being sequence specific for the target nucleic acid molecule, where the at least one probe undergoes a detectable change in fluorescence upon amplification of the one or more target nucleic acid molecules; and with (b) at least one oligonucleotide primer pair; (ii) incubating the mixture of step (i) with a DNA polymerase under conditions sufficient to amplify one or more target nucleic acid molecules; and (iii) detecting the presence or absence or quantifying the amount of the amplified target nucleic acid molecules by measuring fluorescence of the probe. In some embodiments, the DNA polymerase comprises 5′-exonuclease activity. In some other embodiments, the DNA polymerase is a Thermus aquaticus (Taq) DNA polymerase. In some embodiments, the probe is a hydrolysis probe, such as a TaqMan™ probe. Another aspect provided herein is a kit for PCR, such as quantitative real-time polymerase chain reaction (qPCR) and reverse transcription polymerase chain reaction (RT-PCR). In an exemplary embodiment, the kit includes the assay mixture, the process control, and the positive control each described above, as well as a multiplex master mix. In an embodiment, the multiplex master mix is a RT-qPCR mix that provides for sensitive, reproducible detection of a plurality of different target pathogens in a single multiplex reaction. In an embodiment, the multiplex master mix may include an enzyme (for instance, DNA polymerase), a thermostable enzyme, enzyme cofactors, deoxynucleotide triphosphates (dNTPs) including dUTP, an enzyme inhibitor (for instance, RNase inhibitor), a dye and / or a buffer agent. In an exemplary embodiment, the multiplex master mix can be, for instance, TaqPath™ 1-step Multiplex Master Mix by Applied Biosystems – a brand of Thermo Fisher Scientific. In an embodiment, the master mix may be concentrated. For instance, the master mix may be provided at a 4× concentration. In some embodiments, the master mix is prepared such that it requires less than a 3× dilution prior to use in PCR, e.g., 2× dilution, 1.5× dilution, 1.2× dilution, etc. In some embodiments, the kit also includes instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In another embodiment, the kit for PCR comprises the described dye and / or quencher moiety, instructions for conjugating or labeling the dye and / or quencher moiety to a biomolecule, such as an oligonucleotide, instructions for conducting the PCR, and one or more of the following: a buffering agent, deoxynucleotide triphosphates (dNTPs), an organic solvent, an enzyme, enzyme cofactors, and an enzyme inhibitor. In some embodiments, the systems, compositions, methods, and devices used for nucleic acid amplification comprise a “point-of-service” (POS) system. In some embodiments, samples may be collected and / or analyzed at a “point-of-care” (POC) location. In some embodiments, analysis at a POC location typically does not require specialized equipment and has rapid and easy-to-read visual results. In some embodiments, analysis can be performed in the field, in a home setting, and / or by a lay person not having specialized skills. In certain embodiments, for example, the analysis of a small-volume clinical sample may be completed using a POS system in a short period of time (e.g., within hours or minutes). Optionally, a POS system is utilized at a location that is capable of providing a service (e.g., testing, monitoring, treatment, diagnosis, guidance, sample collection, verification of identity (ID verification), and other services) at or near the site or location of the subject. A service may be a medical service, or it may be a non-medical service. In some situations, a POS system provides a service at a predetermined location, such as a subject’s home, school, or work, or at a grocery store, a drug store, a community center, a clinic, a doctor’s office, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POS system can include one or more point of service devices, such as a portable virus / pathogen detector. In some embodiments, a POS system is a point of care system. In some embodiments, the POS system is suitable for use by non-specialized workers or personnel, such as nurses, police officers, civilian volunteers, or the patient. In certain embodiments, a POC system is utilized at a location at which medical-related care (e.g., treatment, testing, monitoring, diagnosis, counseling, etc.) is provided. A POC may be, e.g., at a subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, an outdoor triage tent, a makeshift hospital, a border check point, etc. A POC system is a system which may aid in, or may be used in, providing such medical-related care, and may be located at or near the site or location of the subject or the subject’s health care provider (e.g., subject’s home, work, or school, or at a grocery store, a community center, a drug store, a doctor’s office, a clinic, a hospital, etc.). In embodiments, a POS system is configured to accept a clinical sample obtained from a subject at the associated POS location. In embodiments, a POS system is further configured to analyze the clinical sample at the POS location. In embodiments, the clinical sample is a small volume clinical sample. In embodiments, the clinical sample is analyzed in a short period of time. In embodiments, the short period of time is determined with respect to the time at which sample analysis began. In embodiments, the short period of time is determined with respect to the time at which the sample was inserted into a device for the analysis of the sample. In embodiments, the short period of time is determined with respect to the time at which the sample was obtained from the subject. In some embodiments, a POS system or a POC system can include the amplification- based methods, compositions and kits disclosed herein, including any of the described assays and / or assay panels. Such assays are contemplated for use with both thermal cycling amplification workflows and protocols, such as in PCR, as well as isothermal amplification workflows and protocols, such as in LAMP. In some embodiments, a POS or a POC system comprises self-collection of a biological sample, such as a stool sample or rectal swab. In some embodiments, the self-collection may comprise the use of a self-collection kit and / or device, such as a swab or a tube (e.g., a stool collection tube or similar sample collection device). In some embodiments, the self-collection kit comprises instructions for use, including collection instructions, sample preparation or storage instructions, and / or shipping instructions. For example, the self-collection kit and / or device may be used by an individual, such as lay person, not having specialized skills or medical expertise. In some embodiments, self-collection may be performed by the patient themselves or by any other individual in proximity to the patient, such as but not limited to a parent, a care giver, a teacher, a friend, or other family member. Notably, in some embodiments, the nucleic acid amplification protocol can be configured for rapid processing (e.g., in less than about 45 minutes) and high throughput, allowing for a minimally invasive method to quickly screen large numbers of individuals in a scalable way. This can be particularly useful to perform asymptomatic testing (e.g., high frequency / widespread testing at schools, workplaces, conventions, sporting events, large social gatherings, etc.) or for epidemiological purposes. The disclosed embodiments can also beneficially provide a lower cost sample collection system and method that enables self-collection (reducing health care professional staffing needs) using a low-cost collection device. This eliminates the requirements for swabs, buffers, virus transmission media (or other specialized transport medium), and the like. The disclosed embodiments also allow for a reduction in Personal Protective Equipment (PPE) requirements and costs. There is also a beneficial reduced dependence on supply-constrained items, and the compatibility of these methods and kit components with existing equipment improves the flexibility and simplicity of their implementation to the masses. Overall, such embodiments allow for a less expensive assay that can be accomplished more quickly from sample collection through result generation. One embodiment described herein is a method for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample, the method comprising the steps of: creating a reaction mixture containing the sample and a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome; and subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin- producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in the sample. In one aspect, the Primer Pair Sets comprise the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73– 74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118– 119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175– 176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343– 344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469– 470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the generating of the at least one amplicon comprises performing PCR. In another aspect, the at least one amplicon is one selected from: an amplicon specific for Adenovirus produced using at least one primer pair selected from SEQ ID NO: 1–2 or 4–5, and a sequence selected from SEQ ID NO: 3 or 6 an amplicon specific for Astrovirus produced using at least one primer pair selected from SEQ ID NO: 7–8, 10–11, or 13– 14, and a sequence selected from SEQ ID NO: 9, 12, or 15 an amplicon specific for Norovirus GI produced using at least one primer pair selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64– 65, 67–68, 70–71, or 73–74, and a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 an amplicon specific for Norovirus GII produced using at least one primer pair selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101, and a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 an amplicon specific for Rotavirus A produced using at least one primer pair selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121– 122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140, and a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 an amplicon specific for Rotavirus B produced using at least one primer pair selected from SEQ ID NO: 142– 143, 145–146, or 148–149, and a sequence selected from SEQ ID NO: 144, 147, or 150 an amplicon specific for Rotavirus C produced using at least one primer pair selected from SEQ ID NO: 151–152 or 154–155, and a sequence selected from SEQ ID NO: 153 or 156 an amplicon specific for Sapovirus 1 produced using at least one primer pair selected from SEQ ID NO: 157– 158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179, and a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 an amplicon specific for Sapovirus 2 produced using at least one primer pair selected from SEQ ID NO: 181–182, 184– 185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224, and a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis produced using at least one primer pair selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257, and a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 an amplicon specific for Clostridium difficile (toxin A / B) produced using at least one primer pair selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286– 287, 289–290, 292–293, 295–296, 298–299, or 301–302, and a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 an amplicon specific for Plesiomonas shigelloides produced using at least one primer pair selected from SEQ ID NO: 304–305, 307–308, or 310–311, and a sequence selected from SEQ ID NO: 306, 309, or 312 an amplicon specific for Salmonella sp. produced using at least one primer pair selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326, and a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349– 350, 352–353, 355–356, 358–359, or 361–362, and a sequence selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus produced using at least one primer pair selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392, and a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 an amplicon specific for Enteroaggregative E. coli (EAEC) produced using at least one primer pair selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406– 407, 409–410, or 412–413, and a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 an amplicon specific for , Enteropathogenic E. coli (EPEC) produced using at least one primer pair selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458, and a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 an amplicon specific for Enterotoxigenic E. coli (ETEC) produced using at least one primer pair selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485, and a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m produced using at least one primer pair selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500, and a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) produced using at least one primer pair selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536, and a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 an amplicon specific for E. coli O157 produced using at least one primer pair selected from SEQ ID NO: 538–539 or 541–542, and a sequence selected from SEQ ID NO: 540 or 543 an amplicon specific for Listeria monocytogenes produced using at least one primer pair selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557, and a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 an amplicon specific for Cryptosporidium sp. produced using at least one primer pair selected from SEQ ID NO: 559–560, 562–563, or 565–566, and a sequence selected from SEQ ID NO: 561, 564, 567 an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581, and a sequence selected from SEQ ID NO: 570, 573, 576, 579, 582 an amplicon specific for Entamoeba histolytica produced using at least one primer pair selected from SEQ ID NO: 583–584, 586–587, or 589–590, and a sequence selected from SEQ ID NO: 585, 588, 591; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia produced using at least one primer pair selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607– 608, 610–611, or 613–614, and a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the at least one amplicon is one selected from: an amplicon specific for Adenovirus having a sequence selected from SEQ ID NO: 681 or 682 an amplicon specific for Astrovirus having a sequence selected from SEQ ID NO: 683, 684, or 685 an amplicon specific for Norovirus GI having a sequence selected from SEQ ID NO: 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705 an amplicon specific for Norovirus GII having a sequence selected from SEQ ID NO: 706, 707, 708, 709, 710, 711, 712, 713, or 714 an amplicon specific for Rotavirus A having a sequence selected from SEQ ID NO: 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, or 727 an amplicon specific for Rotavirus B having a sequence selected from SEQ ID NO: 728, 729, or 730 an amplicon specific for Rotavirus C having a sequence selected from SEQ ID NO: 731 or 732 an amplicon specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 733, 734, 735, 736, 737, 738, 739, or 740 an amplicon specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, or 755 an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, or 766 an amplicon specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, or 781 an amplicon specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 782, 783, or 784 an amplicon specific for Salmonella sp. having a sequence selected from SEQ ID NO: 785, 786, 787, 788, or 789 an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, or 801 an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 802, 803, 804, 805, 806, 807, 808, 809, 810, or 811 an amplicon specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 812, 813, 814, 815, 816, 817, or 818 an amplicon specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, or 833 an amplicon specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 834, 835, 836, 837, 838, 839, 840, 841, or 842 an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 843, 844, 845, 846, or 847 an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, or 859 an amplicon specific for E. coli O157 having a sequence selected from SEQ ID NO: 860 or 861 an amplicon specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 862, 863, 864, 865, or 866 an amplicon specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 867, 868, or 869 an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 870, 871, 872, 873, or 874 an amplicon specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 875, 876, or 877; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 878, 879, 880, 881, 882, 883, 884, or 885. In another aspect, the reaction mixture further comprises probes specific for the at least one amplicon. In another aspect, the reaction mixture further comprises probes pecific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649– 650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect, the probe comprises a fluorescent reporter. In another aspect, the probe comprises a quencher. In another aspect, the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect, the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a composition for simultaneously determining the presence or absence of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia, comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin- producing E. coli (STEC) stx1 / stx2m genome at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome. In one aspect, the Primer Pair Sets comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28– 29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172– 173, 175–176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220– 221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343– 344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469– 470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the composition further comprises a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, Primer Pair Set F, Primer Pair Set G, Primer Pair Set H, Primer Pair Set I, Primer Pair Set J, Primer Pair Set K, Primer Pair Set L, Primer Pair Set M, Primer Pair Set N, Primer Pair Set O, Primer Pair Set P, Primer Pair Set Q, Primer Pair Set R, Primer Pair Set S, Primer Pair Set T, Primer Pair Set U, Primer Pair Set V, Primer Pair Set X, Primer Pair Set Y, or Primer Pair Set Z. In another aspect, the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the composition further comprises a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). In another aspect, the composition further comprises a sample. In another aspect, the composition further comprises at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample. In another aspect the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643– 644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect the probe contains a fluorescent reporter. In another aspect the probe contains a quencher. In another aspect the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. In another aspect the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Another embodiment described herein is a kit for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, or Giardia intestinalis, or Giardia lamblia in a sample, comprising the any of the compositions described herein. In one aspect, the kit further comprising any of the control compositions described herein. In another aspect, the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5 Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14 Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22– 23, 25–26, 28–29, 31–32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74 Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101 Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106– 107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140 Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149 Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155 Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163– 164, 166–167, 169–170, 172–173, 175–176, or 178–179 Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211– 212, 214–215, 217–218, 220–221, or 223–224 Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241– 242, 244–245, 247–248, 250–251, 253–254, or 256–257 Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302 Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310–311 Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326 Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334– 335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362 Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367– 368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392 Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409– 410, or 412–413 Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451– 452, 454–455, or 457–458 Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485 Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500 Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536 Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542 Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557 Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562– 563, or 565–566 Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581 Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. In another aspect, the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6 a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15 a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75 a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102 a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141 a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150 a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156 a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180 a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225 a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258 a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303 a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312 a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327 a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363 a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393 a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414 a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459 a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486 a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501 a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537 a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543 a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558 a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567 a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582 a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. In another aspect, the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. In another aspect, the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. In another aspect, the kit further comprises a control plasmid comprising one or more target sequences selected from Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. In another aspect, the control plasmid comprises one or more of nucleic acid sequences of SEQ ID NO: 655–680. It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof. Various embodiments and aspects of the inventions described herein are summarized by the following clauses: Clause 1. A method for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome; at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome; at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome; at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome; at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes; at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome; at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome; at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome; at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome; at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome; at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome; at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome; at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome; at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome; at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome; at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome; at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in the sample. Clause 2. The method of clause 1, wherein the Primer Pair Sets comprise the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149; Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224; Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302; Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413; Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485; Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542; Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. Clause 3. The method of clause 1 or 2, wherein the generating of the at least one amplicon comprises performing PCR. Clause 4. The method of any one of clauses 1–3, wherein the at least one amplicon is one selected from: an amplicon specific for Adenovirus produced using at least one primer pair selected from SEQ ID NO: 1–2 or 4–5, and a sequence selected from SEQ ID NO: 3 or 6; an amplicon specific for Astrovirus produced using at least one primer pair selected from SEQ ID NO: 7–8, 10–11, or 13–14, and a sequence selected from SEQ ID NO: 9, 12, or 15; an amplicon specific for Norovirus GI produced using at least one primer pair selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40– 41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74, and a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; an amplicon specific for Norovirus GII produced using at least one primer pair selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101, and a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; an amplicon specific for Rotavirus A produced using at least one primer pair selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140, and a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; an amplicon specific for Rotavirus B produced using at least one primer pair selected from SEQ ID NO: 142–143, 145–146, or 148–149, and a sequence selected from SEQ ID NO: 144, 147, or 150; an amplicon specific for Rotavirus C produced using at least one primer pair selected from SEQ ID NO: 151–152 or 154–155, and a sequence selected from SEQ ID NO: 153 or 156; an amplicon specific for Sapovirus 1 produced using at least one primer pair selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179, and a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; an amplicon specific for Sapovirus 2 produced using at least one primer pair selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224, and a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis produced using at least one primer pair selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257, and a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; an amplicon specific for Clostridium difficile (toxin A / B) produced using at least one primer pair selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302, and a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; an amplicon specific for Plesiomonas shigelloides produced using at least one primer pair selected from SEQ ID NO: 304–305, 307–308, or 310–311, and a sequence selected from SEQ ID NO: 306, 309, or 312; an amplicon specific for Salmonella sp. produced using at least one primer pair selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326, and a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331– 332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355– 356, 358–359, or 361–362, and a sequence selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus produced using at least one primer pair selected from SEQ ID NO: 364–365, 367– 368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392, and a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; an amplicon specific for Enteroaggregative E. coli (EAEC) produced using at least one primer pair selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413, and a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; an amplicon specific for , Enteropathogenic E. coli (EPEC) produced using at least one primer pair selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458, and a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; an amplicon specific for Enterotoxigenic E. coli (ETEC) produced using at least one primer pair selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485, and a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m produced using at least one primer pair selected from SEQ ID NO: 487–488, 490–491, 493– 494, 496–497, or 499–500, and a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) produced using at least one primer pair selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536, and a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; an amplicon specific for E. coli O157 produced using at least one primer pair selected from SEQ ID NO: 538–539 or 541–542, and a sequence selected from SEQ ID NO: 540 or 543; an amplicon specific for Listeria monocytogenes produced using at least one primer pair selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557, and a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; an amplicon specific for Cryptosporidium sp. produced using at least one primer pair selected from SEQ ID NO: 559–560, 562–563, or 565–566, and a sequence selected from SEQ ID NO: 561, 564, 567; an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581, and a sequence selected from SEQ ID NO: 570, 573, 576, 579, 582; an amplicon specific for Entamoeba histolytica produced using at least one primer pair selected from SEQ ID NO: 583–584, 586–587, or 589–590, and a sequence selected from SEQ ID NO: 585, 588, 591; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia produced using at least one primer pair selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614, and a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. Clause 5. The method of any one of clauses 1–5, wherein the at least one amplicon is one selected from: an amplicon specific for Adenovirus having a sequence selected from SEQ ID NO: 681 or 682; an amplicon specific for Astrovirus having a sequence selected from SEQ ID NO: 683, 684, or 685; an amplicon specific for Norovirus GI having a sequence selected from SEQ ID NO: 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705; an amplicon specific for Norovirus GII having a sequence selected from SEQ ID NO: 706, 707, 708, 709, 710, 711, 712, 713, or 714; an amplicon specific for Rotavirus A having a sequence selected from SEQ ID NO: 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, or 727; an amplicon specific for Rotavirus B having a sequence selected from SEQ ID NO: 728, 729, or 730; an amplicon specific for Rotavirus C having a sequence selected from SEQ ID NO: 731 or 732; an amplicon specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 733, 734, 735, 736, 737, 738, 739, or 740; an amplicon specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, or 755; an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, or 766; an amplicon specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, or 781; an amplicon specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 782, 783, or 784; an amplicon specific for Salmonella sp. having a sequence selected from SEQ ID NO: 785, 786, 787, 788, or 789; an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, or 801; an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 802, 803, 804, 805, 806, 807, 808, 809, 810, or 811; an amplicon specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 812, 813, 814, 815, 816, 817, or 818; an amplicon specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, or 833; an amplicon specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 834, 835, 836, 837, 838, 839, 840, 841, or 842; an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 843, 844, 845, 846, or 847; an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, or 859; an amplicon specific for E. coli O157 having a sequence selected from SEQ ID NO: 860 or 861; an amplicon specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 862, 863, 864, 865, or 866; an amplicon specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 867, 868, or 869; an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 870, 871, 872, 873, or 874; an amplicon specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 875, 876, or 877; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 878, 879, 880, 881, 882, 883, 884, or 885. Clause 6. The method any one of clauses 1–5, wherein the reaction mixture further comprises probes specific for the at least one amplicon. Clause 7. The method of any one of clauses 1–6, wherein the reaction mixture further comprises probes pecific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582; a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. Clause 8. The method of any one of clauses 1–7, wherein the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. Clause 9. The method of clause 8, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. Clause 10. The method of any one of clauses 1–9, wherein the probe comprises a fluorescent reporter. Clause 11. The method of clause 10, wherein the probe comprises a quencher. Clause 12. The method of clause 10 or 11, wherein the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. Clause 13. The method of any one of clauses 10–12, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Clause 14. A composition for simultaneously determining the presence or absence of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia, comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome; at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome; at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome; at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome; at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes; at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome; at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome; at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome; at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome; at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome; at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome; at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome; at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome; at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome; at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome; at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome; at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome. Clause 15. The composition of clause 14, wherein the Primer Pair Sets comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149; Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224; Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302; Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413; Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485; Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542; Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. Clause 16. The composition of clause 14 or 15, further comprising a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, Primer Pair Set F, Primer Pair Set G, Primer Pair Set H, Primer Pair Set I, Primer Pair Set J, Primer Pair Set K, Primer Pair Set L, Primer Pair Set M, Primer Pair Set N, Primer Pair Set O, Primer Pair Set P, Primer Pair Set Q, Primer Pair Set R, Primer Pair Set S, Primer Pair Set T, Primer Pair Set U, Primer Pair Set V, Primer Pair Set X, Primer Pair Set Y, or Primer Pair Set Z. Clause 17. The composition of any one of clauses 14–16, wherein the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582; a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. Clause 18. The composition of any one of clauses 14–17, further comprising a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs). Clause 19. The composition of any one of clauses 14–18, further comprising a sample. Clause 20. The composition of any one of clauses 14–19, further comprising at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample. Clause 21. The composition of clause 21, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631– 632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. Clause 22. The composition of any one of clauses 14–21, wherein the probe contains a fluorescent reporter. Clause 23. The composition of clause 22, wherein the probe contains a quencher. Clause 24. The composition of any one of clauses 22 or 23, wherein the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM. Clause 25. The composition of any one of clauses 22–24, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ. Clause 26. A kit for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, or Giardia intestinalis, or Giardia lamblia in a sample, comprising the compositions of any one of clauses 14–18. Clause 27. The kit of clause 29, further comprising the compositions of any one of clauses 19–25. Clause 28. The kit of clause 26 or 27, wherein the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149; Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224; Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302; Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413; Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485; Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542; Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614. Clause 29. The kit of clause 28, wherein the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582; a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615. Clause 30. The kit of clause 28, wherein the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample. Clause 31. The kit of clause 30, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654. Clause 32. The kit of clause 28, wherein the kit further comprises a control plasmid comprising one or more target sequences selected from Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia. Clause 33. The control plasmid of clause 32, wherein the plasmid comprises one or more of nucleic acid sequences of SEQ ID NO: 655–680.

[0002] EXAMPLES Example 1 The multiplex panels were assayed for accuracy on Open Array and TaqMan platforms using multiple clinical matrixes. The samples tested were: Pooled fecal swabs from 8 raw stool samples (prev. screened negative) (Fecal) Raw stool, stored at −20 °C (FRS) Pooled rectal swabs from 14 rectal swab samples (prev. screened negative) Pooled stool in ParaPak samples prepared from 8 raw stool samples (StoolPP) (prev. screened negative) Pooled stool in Cary-Blair Pool 1–3 (prev. screened negative) (StoolCB) Raw stool, stored at 4 °C (TRS) Live organism / genomic material were pooled and spiked into respective matrix at 100,000 organism / 40,000 copies / extraction reaction. Three pools were prepared covering 22 panel targets, except for Sapovirus, Rota B and Rota C due to unavailability of live organism / genomic material / clean synthetic material. Selection criteria: Live organism > Genomic material > Pure synthetic material Panels consisted of primer pairs and probes for panels of Open Array (Table 30) and TaqMan (Table 31). Results are shown in Table 39 (Open Array) and Table 40 (TaqMan).

[0003] Table 39. Open Array Accuracy Validation Data Fecal FRS (−20 °C) Rectal Target Name TP FP TN FN Accuracy TP FP TN FN Accuracy TP FP TN FN Accuracy Adenovirus F 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Astrovirus 28 2 60 0 97.8% 28 0 62 0 100.0% 28 2 60 0 97.8% Norovirus GI 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Norovirus GII 28 0 62 0 100.0% 28 1 61 0 98.9% 28 2 60 0 97.8% Rotavirus A 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Rotavirus B 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Rotavirus C 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Sapovirus 1 / 2 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Sapovirus 2 / 2 0 2 88 0 97.8% 0 0 90 0 100.0% 0 2 88 0 97.8% CampylobacterPool84 2 4 0 97.8% 84 2 4 0 97.8% 84 4 2 0 95.6%C. difficile toxinA / B28 2 60 0 97.8% 28 1 61 0 98.9% 28 2 60 0 97.8%P. shigelloides 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Salmonella 28 0 62 0 100.0% 28 1 61 0 98.9% 28 0 62 0 100.0% Y. enterocolitica 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Vibrio Pool 84 2 4 0 97.8% 84 0 6 0 100.0% 84 2 4 0 97.8% E. coli EAEC 28 2 60 0 97.8% 28 0 62 0 100.0% 28 2 60 0 97.8% E. coli EPEC 84 2 4 0 97.8% 84 0 6 0 100.0% 84 1 5 0 98.9% E. coli ETEC 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% E. coli STEC 56 2 32 0 97.8% 56 0 34 0 100.0% 56 2 32 0 97.8% Shigella / EIEC 56 2 32 0 97.8% 56 0 34 0 100.0% 56 2 32 0 97.8% E. coli O157 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% L.monocytogenes28 2 60 0 97.8% 28 0 62 0 100.0% 28 2 60 0 97.8%Cryptosporidium 56 0 34 0 100.0% 56 0 34 0 100.0% 56 0 34 0 100.0% C. cayetanensis 28 0 62 0 100.0% 28 3 59 0 96.7% 28 2 60 0 97.8% E. histolytica 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% G. lamblia 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0%

[0004] B. atrophaeusControl90 0 0 0 100.0% 90 0 0 0 100.0% 90 0 0 0 100.0%XENO Control 90 0 0 0 100.0% 90 0 0 0 100.0% 90 0 0 0 100.0% StoolCB StoolPP TRS (4 °C) Target Name TP FP TN FN Accuracy TP FP TN FN Accuracy TP FP TN FN Accuracy Adenovirus F 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Astrovirus 28 0 62 0 100.0% 28 0 62 0 100.0% 28 2 60 0 97.8% Norovirus GI 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Norovirus GII 28 0 62 0 100.0% 28 0 62 0 100.0% 28 3 59 0 96.7% Rotavirus A 28 1 61 0 98.9% 28 0 62 0 100.0% 28 0 62 0 100.0% Rotavirus B 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Rotavirus C 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Sapovirus 1 / 2 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Sapovirus 2 / 2 0 0 90 0 100.0% 0 0 90 0 100.0% 0 0 90 0 100.0% Campylobacter Pool84 0 6 0 100.0% 84 2 4 0 97.8% 84 2 4 0 97.8%C. difficile toxinA / B28 0 62 0 100.0% 28 0 62 0 100.0% 28 2 60 0 97.8%P. shigelloides 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Salmonella 28 2 60 0 97.8% 28 0 62 0 100.0% 28 0 62 0 100.0% Y. enterocolitica 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% Vibrio Pool 84 0 6 0 100.0% 84 0 6 0 100.0% 84 2 4 0 97.8% E. coli EAEC 28 0 62 0 100.0% 28 0 62 0 100.0% 28 4 58 0 95.6% E. coli EPEC 84 0 6 0 100.0% 84 0 6 0 100.0% 84 2 4 0 97.8% E. coli ETEC 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% E. coli STEC 56 0 34 0 100.0% 56 0 34 0 100.0% 56 2 32 0 97.8% Shigella / EIEC 56 0 34 0 100.0% 56 0 34 0 100.0% 56 2 32 0 97.8% E. coli O157 28 0 62 0 100.0% 28 0 62 0 100.0% 28 1 61 0 98.9% L.monocytogenes28 0 62 0 100.0% 28 0 62 0 100.0% 28 2 60 0 97.8%Cryptosporidium 56 0 34 0 100.0% 56 0 34 0 100.0% 56 0 34 0 100.0% C. cayetanensis 28 2 60 0 97.8% 28 1 61 0 98.9% 28 1 61 0 98.9%

[0005] E. histolytica 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% G. lamblia 28 0 62 0 100.0% 28 0 62 0 100.0% 28 0 62 0 100.0% B. atrophaeusControl90 0 0 0 100.0% 90 0 0 0 100.0% 90 0 0 0 100.0%XENO Control 90 0 0 0 100.0% 90 0 0 0 100.0% 90 0 0 0 100.0% Table 40. TaqMan Accuracy Validation Data Fecal FRS (−20 °C) Rectal Target Name TP FP TN FN Accuracy TP FP TN FN Accuracy TP FP TN FN Accuracy Adenovirus F 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Astrovirus 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Norovirus GI 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Norovirus GII 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Rotavirus A 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Sapovirus 1 / 2 0 0 84 0 100.0% 0 0 84 0 100.0% 0 0 84 0 100.0% Sapovirus 2 / 2 0 2 82 0 97.6% 0 2 82 0 97.6% 0 2 82 0 97.6% CampylobacterPool84 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0%C. difficile toxinA / B28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0%P. shigelloides 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Salmonella 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Y. enterocolitica 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Vibrio Pool 84 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0% E. coli ETEC 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% E. coli EAEC 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% E. coli EPEC 84 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0% E. coli STEC 56 0 28 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% Shigella / EIEC 56 0 28 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% E. coli O157 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Cryptosporidium 56 0 28 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% E. histolytica 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% G. lamblia 28 0 56 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0%

[0006] B. atrophaeusControl84 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0%XENO Control 84 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0% StoolCB StoolPP TRS (4 °C) Target Name TP FP TN FN Accuracy TP FP TN FN Accuracy TP FP TN FN Accuracy Adenovirus F 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Astrovirus 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Norovirus GI 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Norovirus GII 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Rotavirus A 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Sapovirus 1 / 2 0 0 168 0 100.0% 0 0 84 0 100.0% 0 0 84 0 100.0% Sapovirus 2 / 2 0 0 168 0 100.0% 0 0 84 0 100.0% 0 0 84 0 100.0% CampylobacterPool168 84 0 0 0 100.0% 84 0 0 0 100.0%C. difficile toxinA / B56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0%P. shigelloides 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Salmonella 56 4 108 0 97.6% 28 0 56 0 100.0% 28 0 56 0 100.0% Y. enterocolitica 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Vibrio Pool 168 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0% E. coli ETEC 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% E. coli EAEC 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% E. coli EPEC 168 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0% E. coli STEC 112 0 56 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% Shigella / EIEC 112 0 56 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% E. coli O157 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% Cryptosporidium 112 0 56 0 100.0% 56 0 28 0 100.0% 56 0 28 0 100.0% E. histolytica 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% G. lamblia 56 0 112 0 100.0% 28 0 56 0 100.0% 28 0 56 0 100.0% B. atrophaeusControl168 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0%XENO Control 168 0 0 0 100.0% 84 0 0 0 100.0% 84 0 0 0 100.0%

[0007] Example 3 Exemplary Test Sample Preparation A sample is obtained from a subject. The sample is typically a stool sample or rectal swab. For fresh fecal samples, approximately 100 mg of sample is used to isolate genomic DNA. Fecal samples can be frozen in a storage solution at a fecal sample to solution ratio of 1:2. Frozen samples are thawed on ice and approximately 100 mg of the fecal sample are used to isolate nucleic acids. The frozen or fresh fecal samples are lysed, and genomic DNA is isolated from the lysis. For rectal swabs, the stick of the swab is removed and the swab containing the fecal matter is placed in lysis genomic extraction conditions. To each fecal sample or rectal swab, the B. Atrophaeus control is added before lysis during nucleic acid nucleic acid extraction. Control Sample Preparation The TaqMan™ Universal Extraction Control Organism (B. atrophaeus) (BA process control) is used to verify the efficacy of the sample preparation and the absence of inhibitors in the real-time PCR reaction. A 1× solution of the control is added to each sample and negative control before extraction. The BA process control is sample contains a lyophilized pellet at 1 × 109copies / vial. A 25× stock solution of the BA process control is prepared by adding 200 µL of 1× phosphate buffered saline (1× PBS: 137 mM NaCl, 2.7 mM KCl: 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) to the vial containing the lyophilized pellet and vortexing until the pellet is resuspended. A working 1× stock solution is prepared by combining 24 µL of a 25× stock solution with 576 µL 1× PBS, pH 7.4 to achieve a total volume of 600 µL. The prepared BA process control is added to the genomic DNA extraction reaction, to each sample and to the negative extraction control immediately before lysis during nucleic acid extraction. Real-time PCR Reaction Preparation Genomic DNA samples are thawed or placed on ice. All reagents are gently vortexed, briefly centrifuged to collect the liquid at the bottom of the container and kept on ice until use. The amplification control is prepared by combining 495.0 µL of 1× TE buffer (1× TE: 10 mM Tris ^HCl, 1 mM EDTA ^Na2, pH 8.0) into a microcentrifuge tube, and adding 5.0 µL of the amplification control. The sample is mixed well and briefly centrifuged. A 5.0 µL aliquot of the diluted sample is combined with 170 µL of 1× TE buffer, mixed, and centrifuged briefly. For each 96-well plate, the following components are combined in sufficient amounts for the number of samples plus the amplification control and negative control. Table 41. PCR Multiplex Master Mix and Primer / Probes ComponentVolume per sample orVolume for n samples plus control2 controls Multiplex Master Mix 6.25 µL 6.25 × (1.2 × n) µL Panel 1.25 µL 1.25 × (1.2 × n) µL Total Volume 7.50 µL — The Multiplex Master Mix contains components for the PCR reaction (buffer, MgCl2, dNTPs, and DNA polymerase, inter alia) and the Multiplex Primer / Probe Panel contains the primer paris and probes specific for the target organisms and controls. The reaction plate is set up by dispensing 7.5 µL of the reaction mix prepared as shown in Table 28 to each well of a MicroAmp™ Optical 96-Well Reaction Plate, 0.2 mL. 17.5 µL of either the extracted materials (target DNA), the diluted amplification control, or nuclease- free water is added to the designated wells. The plate is sealed thoroughly with MicroAmp™ Optical Adhesive Film, ensuring that pressure is applied across the entire plate and that there is a tight seal across every individual well. The plate is vortexed the plate at the highest setting speed for 30–60 seconds as follows: 5–10 seconds in the center of the plate, 5–10 seconds in each plate corner, and 5–10 seconds, again in the center. The reaction plate is centrifuged for 1–2 minutes at ≥ 650 × g to remove bubbles and to collect the liquid at the bottom. The real-time PCR reaction plate is maintained at 2–8 °C and protected from light until it is loaded into the real-time PCR instrument. The real-time PCR reaction is run within an hour after preparation of the plate. The real-time PCR reaction is performed, and the results are analyzed using the software accompanying the instrument. Example 4 Real-Time TaqMan™ PCR with Open Array The pre-amplified nucleic acid samples are diluted 1:10. An OpenArray™ plate is allowed to equilibrate to room temperature. Before preparing the samples, the TaqMan™ OpenArray™ Real-time PCR Master Mix is mixed but not inverted. The master mix and isolated nucleic acids are added to the wells of the OpenArray™ Plate in a 1:1 ratio of master mix-to-pre-amplified nucleic acid. In separate wells, the TaqMan™ Gastrointestinal Tract Microbiota Amplification Control is used in place of the diluted pre-amplified nucleic acid sample. The resulting mixtures are further mixed with pipetting. After mixing, the plate is sealed with aluminum foil and centrifuged at 1,200 RPM (301 × g) for 1 minute. The OpenArray™ plate is transferred to an OpenArray™ AccuFill™ Instrument where a fraction of the samples are loaded onto a separate OpenArray™ plate. The new OpenArray™ plate is transferred to a QuantStudio™ 12K Flex OpenArray™ Plate Press where the plate is encased with a lid. OpenArray™ Immersion Fluid is slowly injected into the port of the encasement to minimize formation of air bubbles. After injection of the immersion fluid, the port is sealed. The encased OpenArray™ plate is transferred to a QuantStudio™ 12K Flex Instrument where the real-time PCR reaction is performed, imaged, and analyzed. Example 5 Real-Time TaqMan™ PCR with TaqMan Array Card The pre-amplified nucleic acid samples are diluted 1:10. A TaqMan™ Array Card is allowed to equilibrate to room temperature. The TaqMan™ Fast Advanced Master Mix containing no UNG is mixed before preparing the PCR samples. A master mix containing a 2:3:5 ratio of diluted pre-amplified nucleic acid, nuclease-free water, and of TaqMan™ Fast Advanced Master Mix is prepared such that 100 µL of sample is added to each port of the TaqMan™ Array Card. Optionally, positive amplification control samples can be added to the TaqMan™ Array Card by preparing a sample containing 10 µL of TaqMan™ Gastrointestinal Tract Microbiota Amplification Control, 40 µL of nuclease free water, and 50 µL of TaqMan™ Fast Advanced Master Mix for each designated control port. After the samples are added to TaqMan™ Array Card, the card is centrifuged twice at 1,200 RPM (301 × g) for 1 minute. The TaqMan™ Array Card is sealed and loaded into a real-time PCR instrument. Inside the instrument, the samples are activated by heating the sample to 95 °C for 10 minutes. Following activation, amplification is performed by holding the temperature at 95 °C for 3 seconds to allow for separation of the templates into single strands followed by reducing the temperature to 60 °C and holding the temperature for 30 second to allow for annealing and elongation. The cycling between the two temperatures is repeated 40 times. The results of the real-time TaqMan™ PCR reaction are analyzed using the software accompanying the instrument. Example 6 A proprietary panel of 62 TaqMan®-based assays was created that allows for the detection of 26 GI microorganisms including 13 bacterial, 9 viral and 4 parasitic targets. Each assay was designed for a species-specific gene target or phenotype associated marker. For the sensitivity study, a super-plasmid containing template for each pathogen target was serially diluted from 1 × 107down to 10 copies / mL and tested against the panel with and without preamplification. For the concordance studies, 319 repository stool samples covering 19 pathogens were processed using the MagMAX™ Microbiome Ultra Nucleic Acid Isolation Kit (Thermo Fisher Scientific) with bead beating. The resulting total nucleic acids were then screened on the GI panel via the OpenArray™ platform for presence of the pre-determined pathogen. Results are shown in Table 4 Table 42. Target List for the Multiplex Panel with Standard Curve Slopes, R-Squared and PCR Efficiency Values 102to 107cp / μL 1 to 105cp / μL no no Target NameTargetNucleicMagellPA PA no +PA +PA PA Slo Eff. +PA Type Acidan IDSlop Eff. R2 pe R2 e (%) (%) AdenovirusVirus DNA Vi07922199_s1 −3.0.99 −3.3 0.99 F40 / 414 96.895999 Astrovirus Virus (+)ss RNA Vi07922200_s1−3.31.00 100. 0.99 897.6 0−3.39 9 Norovirus GI Virus (+)ss RNA Vi07922261_po−3.2103. 0.99 −3.2 105. 0.99 4 6 8 1 1 9 Norovirus GII Virus (+)ss RNA Vi07922262_po−3.30.99 −3.3 100. 0.99 598.89 1 4 9 Rotavirus A Virus ds RNA Vi07922263_po−3.31.00 −3.3 100. 0.99 499.20 1 5 9 Rotavirus B Virus ds RNA Vi07922264_po −3.4 96.80.99−3.3 0.99 8598.99 Rotavirus C Virus ds RNA Vi07922215_s1−3.40.99 −3.3 100. 0.99 196.49 1 4 9 Sapovirus 1 Virus (+)ss RNA Vi07922286_po−3.20.99 −3.3 100. 0.99 71028 1 6 9 Sapovirus 2 Virus (+)ss RNA Vi07922266_po−3.3100. 0.99 −3.3 100. 0.99 1 5 9 1 6 9 Campylobacte r pool (coli, BacteriDNA Ba0−3.4 0.99 −3.3 0.99 jejuni,a7922280_po794.1921009 upsaliensis) Clostridium difficile (toxin BacteriDNA Ba0−3.2 101. 0.99 −3.2 101. 0.99 A / B)a7922268_po8 6 8 8 8 8 Enteroaggreg ative E. coliDNA Ba07922271_po−3.2 104. 0.99−3.3100. 0.99 (EAEC)a2 288 9 Enteropathoge nic E. coli BacteriDNA Ba07−3.3 100. 0.99 −3.2 104. 0.99 (EPEC)a922272_po1 5 9 3 2 9 Enterotoxigeni c E. coli BacteriDNA Ba−3.2 101. 0.99 −3.2 102. 0.99 (ETEC)a07922273_po8 6 8 5 9 9 Shiga-like toxin- BacteriDNA Ba079222−3.4 0.99 −3.2 102. 0.99 producing E.a74_po196.49 7 2 9 coli (STEC) stx1 / stx2 Shigella / Bacteri −3.2 102. 0.99 −3.2 1 CaDNA Ba003. 0.99 EIE7922250_s17 2 9 5 2 9 E. coli O157BacteriDNA Ba07−3.3 1.00 −3.2 103. 0.99 a922251_s1 83 9 9 Listeria monocytogene Bacteri saDNA Ba07922252_s1 98.5−3.2 103. 1.00 0 5 1 0 Plesiomonas BacteriDNA Ba07922230-s−3.3 −3.2 101. 0.99 shigelloidesa1399.7 8 7 9 SalmonellaBacteri−3.3 1.00 −3.3 100. 0.99 aDNA Ba07922231_s1 997.20 1 3 9 Yesinia BacteriDNA Ba07922269_p−3.3 0.99 105. 1.00 enterocoliticaao499.59−3.22 0 Vibrio pool (cholerae, BacteriDNA B−3.3 0.99 −3.2 103. 1.00 parahaemolytiaa07922270_po698.39 5 1 0 cus, vulnificus) Cryptosporidiu Parasit DNA Pr07922253_s1−3.397.4 −3.3 1.00 me 9021000 Cyclospora ParasitDNA Pr07922275_po −3.100. 0.99 cayetanensise39 7 Entamoeba ParasitDNA Pr079222−3.4 1.00 histolyticae57_s1694.50 5 3 9 Giardia Parasit 0.99 −3.1 106. 0 bliaeDNA Pr0792 .99 lam2276_po 1017 8 3 7 Xeno Control RNA Pa00010014_s1−3.40.99 −3.3 0.99 794.39399.7BacillusControl DNA Ba065965−3.3 0.99 −3.2 102. atrophaeus76_s1698.39 7 4 Example 7 More than 300 repository stool samples covering 16 pathogens were tested to evaluate accuracy and performance of the multiplex panel (pathogens with less than 4 samples are excluded). All samples had been previously tested by external clinical laboratories with an FDA- approved Gastrointestinal (GI) panel. Sample types include raw stool, stool in Cary Blair media, rectal swabs, and fecal swabs. Samples were retrospectively tested with the whole Thermo Fish...

Claims

CLAIMS What is claimed:

1. A method for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in a sample, the method comprising the steps of: (a) creating a reaction mixture containing the sample and a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise one or more of: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome; at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome; at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome; at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome;at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes; at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome; at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome; at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome; at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome; at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome; at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome; at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome; at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome; at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome; at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome; at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome; at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; orat least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome; and (b) subjecting the reaction mixture to reaction conditions suitable to amplify targeted nucleic acids, thereby generating at least one amplicon when the targeted nucleic acids are present in the sample; wherein the presence or absence of at least one amplicon in the sample indicates the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia in the sample.

2. The method of claim 1, wherein the Primer Pair Sets comprise the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149;Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224; Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302; Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413;Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485; Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542; Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614.

3. The method of claim 1 or 2, wherein the generating of the at least one amplicon comprises performing PCR.

4. The method of any one of claims 1–3, wherein the at least one amplicon is one selected from: an amplicon specific for Adenovirus produced using at least one primer pair selected from SEQ ID NO: 1–2 or 4–5, and a sequence selected from SEQ ID NO: 3 or 6; an amplicon specific for Astrovirus produced using at least one primer pair selected from SEQ ID NO: 7–8, 10–11, or 13–14, and a sequence selected from SEQ ID NO: 9, 12, or 15; an amplicon specific for Norovirus GI produced using at least one primer pair selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31–32, 34–35, 37–38, 40– 41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74, and a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; an amplicon specific for Norovirus GII produced using at least one primer pair selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91–92, 94–95, 97–98, or 100–101, and a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; an amplicon specific for Rotavirus A produced using at least one primer pair selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140, and a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; an amplicon specific for Rotavirus B produced using at least one primer pair selected from SEQ ID NO: 142–143, 145–146, or 148–149, and a sequence selected from SEQ ID NO: 144, 147, or 150; an amplicon specific for Rotavirus C produced using at least one primer pair selected from SEQ ID NO: 151–152 or 154–155, and a sequence selected from SEQ ID NO: 153 or 156; an amplicon specific for Sapovirus 1 produced using at least one primer pair selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179, and a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; an amplicon specific for Sapovirus 2 produced using at least one primer pair selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224,and a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis produced using at least one primer pair selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257, and a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; an amplicon specific for Clostridium difficile (toxin A / B) produced using at least one primer pair selected from SEQ ID NO: 259–260, 262–263, 265–266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289–290, 292–293, 295–296, 298–299, or 301–302, and a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; an amplicon specific for Plesiomonas shigelloides produced using at least one primer pair selected from SEQ ID NO: 304–305, 307–308, or 310–311, and a sequence selected from SEQ ID NO: 306, 309, or 312; an amplicon specific for Salmonella sp. produced using at least one primer pair selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326, and a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331– 332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355– 356, 358–359, or 361–362, and a sequence selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus produced using at least one primer pair selected from SEQ ID NO: 364–365, 367– 368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392, and a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; an amplicon specific for Enteroaggregative E. coli (EAEC) produced using at least one primer pair selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413, and a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; an amplicon specific for , Enteropathogenic E. coli (EPEC) produced using at least one primer pair selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449,451–452, 454–455, or 457–458, and a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; an amplicon specific for Enterotoxigenic E. coli (ETEC) produced using at least one primer pair selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485, and a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m produced using at least one primer pair selected from SEQ ID NO: 487–488, 490–491, 493– 494, 496–497, or 499–500, and a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) produced using at least one primer pair selected from SEQ ID NO: 502–503, 505–506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529–530, 532–533, or 535–536, and a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; an amplicon specific for E. coli O157 produced using at least one primer pair selected from SEQ ID NO: 538–539 or 541–542, and a sequence selected from SEQ ID NO: 540 or 543; an amplicon specific for Listeria monocytogenes produced using at least one primer pair selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557, and a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; an amplicon specific for Cryptosporidium sp. produced using at least one primer pair selected from SEQ ID NO: 559–560, 562–563, or 565–566, and a sequence selected from SEQ ID NO: 561, 564, 567; an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581, and a sequence selected from SEQ ID NO: 570, 573, 576, 579, 582; an amplicon specific for Entamoeba histolytica produced using at least one primer pair selected from SEQ ID NO: 583–584, 586–587, or 589–590, and a sequence selected from SEQ ID NO: 585, 588, 591; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia produced using at least one primer pair selected from SEQ ID NO: 592–593, 595–596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614, and a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615.

5. The method of any one of claims 1–5, wherein the at least one amplicon is one selected from: an amplicon specific for Adenovirus having a sequence selected from SEQ ID NO: 681 or 682; an amplicon specific for Astrovirus having a sequence selected from SEQ ID NO: 683, 684, or 685; an amplicon specific for Norovirus GI having a sequence selected from SEQ ID NO: 686, 687, 688, 689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705; an amplicon specific for Norovirus GII having a sequence selected from SEQ ID NO: 706, 707, 708, 709, 710, 711, 712, 713, or 714; an amplicon specific for Rotavirus A having a sequence selected from SEQ ID NO: 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, or 727; an amplicon specific for Rotavirus B having a sequence selected from SEQ ID NO: 728, 729, or 730; an amplicon specific for Rotavirus C having a sequence selected from SEQ ID NO: 731 or 732; an amplicon specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 733, 734, 735, 736, 737, 738, 739, or 740; an amplicon specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, or 755; an amplicon specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, or 766; an amplicon specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, or 781; an amplicon specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 782, 783, or 784; an amplicon specific for Salmonella sp. having a sequence selected from SEQ ID NO: 785, 786, 787, 788, or 789; an amplicon specific for Yersinia enterocolitica selected from SEQ ID NO: 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, or 801;an amplicon specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 802, 803, 804, 805, 806, 807, 808, 809, 810, or 811; an amplicon specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 812, 813, 814, 815, 816, 817, or 818; an amplicon specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, or 833; an amplicon specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 834, 835, 836, 837, 838, 839, 840, 841, or 842; an amplicon specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 843, 844, 845, 846, or 847; an amplicon specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, or 859; an amplicon specific for E. coli O157 having a sequence selected from SEQ ID NO: 860 or 861; an amplicon specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 862, 863, 864, 865, or 866; an amplicon specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 867, 868, or 869; an amplicon specific for Cyclospora cayetanensis selected from SEQ ID NO: 870, 871, 872, 873, or 874; an amplicon specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 875, 876, or 877; and / or an amplicon specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 878, 879, 880, 881, 882, 883, 884, or 885.

6. The method any one of claims 1–5, wherein the reaction mixture further comprises probes specific for the at least one amplicon.

7. The method of any one of claims 1–6, wherein the reaction mixture further comprises probes pecific for the at least one amplicon and suitable for use with a Primer Pair Set, the probes comprising:a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414;a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582; a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615.

8. The method of any one of claims 1–7, wherein the reaction mixture further contains a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample.

9. The method of claim 8, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654.

10. The method of any one of claims 1–9, wherein the probe comprises a fluorescent reporter.

11. The method of claim 10, wherein the probe comprises a quencher.

12. The method of claim 10 or 11, wherein the probe is labeled at or near the 5′-end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM.

13. The method of any one of claims 10–12, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.

14. A composition for simultaneously determining the presence or absence of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia, comprising a plurality of Primer Pair Sets, wherein the Primer Pair Sets comprise: at least one primer pair selected from Primer Pair Set A that specifically amplifies a portion of Adenovirus genome; at least one primer pair selected from Primer Pair Set B that specifically amplifies a portion of Astrovirus genome; at least one primer pair selected from Primer Pair Set C that specifically amplifies a portion of Norovirus GI genome; at least one primer pair selected from Primer Pair Set D that specifically amplifies a portion of Norovirus GII genome; at least one primer pair selected from Primer Pair Set E that specifically amplifies a portion of Rotavirus A genome; at least one primer pair selected from Primer Pair Set F that specifically amplifies a portion of Rotavirus B genome; and at least one primer pair selected from Primer Pair Set G that specifically amplifies a portion of Rotavirus C genome; at least one primer pair selected from Primer Pair Set H that specifically amplifies a portion of Sapovirus 1 genome;at least one primer pair selected from Primer Pair Set I that specifically amplifies a portion of Sapovirus 2 genome; at least one primer pair selected from Primer Pair Set J that specifically amplifies a portion of Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis genomes; at least one primer pair selected from Primer Pair Set K that specifically amplifies a portion of Clostridium difficile (toxin A / B) genome; at least one primer pair selected from Primer Pair Set L that specifically amplifies a portion of Plesiomonas shigelloides genome; at least one primer pair selected from Primer Pair Set M that specifically amplifies a portion of Salmonella sp. genome; at least one primer pair selected from Primer Pair Set N that specifically amplifies a portion of Yersinia enterocolitica genome; at least one primer pair selected from Primer Pair Set O that specifically amplifies a portion of Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus genome; at least one primer pair selected from Primer Pair Set P that specifically amplifies a portion of Enteroaggregative E. coli (EAEC) genome; at least one primer pair selected from Primer Pair Set Q that specifically amplifies a portion of Enteropathogenic E. coli (EPEC) genome; at least one primer pair selected from Primer Pair Set R that specifically amplifies a portion of Enterotoxigenic E. coli (ETEC) genome; at least one primer pair selected from Primer Pair Set S that specifically amplifies a portion of Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m genome; at least one primer pair selected from Primer Pair Set T that specifically amplifies a portion of Shigella / Enteroinvasive E. coli (EIEC)genome; and at least one primer pair selected from Primer Pair Set U that specifically amplifies a portion of E. coli O157 genome; at least one primer pair selected from Primer Pair Set V that specifically amplifies a portion of Listeria monocytogenes genome; at least one primer pair selected from Primer Pair Set W that specifically amplifies a portion of Cryptosporidium sp. genome; at least one primer pair selected from Primer Pair Set X that specifically amplifies a portion of Cyclospora cayetanensis genome;at least one primer pair selected from Primer Pair Set Y that specifically amplifies a portion of Entamoeba histolytica genome; or at least one primer pair selected from Primer Pair Set Z that specifically amplifies a portion of Giardia intestinalis genome.

15. The composition of claim 14, wherein the Primer Pair Sets comprises the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5; Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149; Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224;Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302; Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413; Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485;Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542; Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614.

16. The composition of claim 14 or 15, further comprising a probe specific for amplicons produced using the at least one primer pair selected from one or more of Primer Pair Set A, Primer Pair Set B, Primer Pair Set C, Primer Pair Set D, Primer Pair Set E, Primer Pair Set F, Primer Pair Set G, Primer Pair Set H, Primer Pair Set I, Primer Pair Set J, Primer Pair Set K, Primer Pair Set L, Primer Pair Set M, Primer Pair Set N, Primer Pair Set O, Primer Pair Set P, Primer Pair Set Q, Primer Pair Set R, Primer Pair Set S, Primer Pair Set T, Primer Pair Set U, Primer Pair Set V, Primer Pair Set X, Primer Pair Set Y, or Primer Pair Set Z.

17. The composition of any one of claims 14–16, wherein the probe suitable for use with a specific forward and reverse primer pair are selected from: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225; a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393;a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582; a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615.

18. The composition of any one of claims 14–17, further comprising a polymerase, a buffer, and deoxynucleotide triphosphates (dNTPs).

19. The composition of any one of claims 14–18, further comprising a sample.

20. The composition of any one of claims 14–19, further comprising at least one control forward and reverse primer and, optionally, a control probe, that specifically amplifies a target nucleic acid of a control sample.

21. The composition of claim 21, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637–638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654.

22. The composition of any one of claims 14–21, wherein the probe contains a fluorescent reporter.

23. The composition of claim 22, wherein the probe contains a quencher.

24. The composition of any one of claims 22 or 23, wherein the probe is labeled at or near the 5′ end with a dye selected from FAM, VIC, ABY, JUN, AF647, or 6FAM.

25. The composition of any one of claims 22–24, wherein the probe is labeled at or near the 3′ end with a quencher selected from MGB, QSY7, QSY21, MGBNFQ, BHQ, or DFQ.

26. A kit for simultaneously determining the presence or absence of one or more of Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, or Giardia intestinalis, or Giardia lamblia in a sample, comprising the compositions of any one of claims 14–18.

27. The kit of claim 29, further comprising the compositions of any one of claims 19–25.

28. The kit of claim 26 or 27, wherein the kit comprises Primer Pair Sets comprising the following sequences: Primer Pair Set A comprises at least one forward and reverse primer pair specific for Adenovirus selected from SEQ ID NO: 1–2 or 4–5;Primer Pair Set B comprises at least one forward and reverse primer pair specific for Astrovirus selected from SEQ ID NO: 7–8, 10–11, or 13–14; Primer Pair Set C comprises at least one forward and reverse primer pair specific for Norovirus GI selected from SEQ ID NO: 16–17, 19–20, 22–23, 25–26, 28–29, 31– 32, 34–35, 37–38, 40–41, 43–44, 46–47, 49–50, 52–53, 55–56, 58–59, 61–62, 64–65, 67–68, 70–71, or 73–74; Primer Pair Set D comprises at least one forward and reverse primer pair specific for Norovirus GII selected from SEQ ID NO: 76–77, 79–80, 82–83, 85–86, 88–89, 91– 92, 94–95, 97–98, or 100–101; Primer Pair Set E comprises at least one forward and reverse primer pair specific for Rotavirus A selected from SEQ ID NO: 103–104, 106–107, 109–110, 112–113, 115–116, 118–119, 121–122, 124–125, 127–128, 130–131, 133–134, 136–137, or 139–140; Primer Pair Set F comprises at least one forward and reverse primer pair specific for Rotavirus B selected from SEQ ID NO: 142–143, 145–146, or 148–149; Primer Pair Set G comprises at least one forward and reverse primer pair specific for Rotavirus C selected from SEQ ID NO: 151–152 or 154–155; Primer Pair Set H comprises at least one forward and reverse primer pair specific for Sapovirus 1 selected from SEQ ID NO: 157–158, 160–161, 163–164, 166–167, 169–170, 172–173, 175–176, or 178–179; Primer Pair Set I comprises at least one forward and reverse primer pair specific for Sapovirus 2 selected from SEQ ID NO: 181–182, 184–185, 187–188, 190–191, 193–194, 196–197, 199–200, 202–203, 205–206, 208–209, 211–212, 214–215, 217–218, 220–221, or 223–224; Primer Pair Set J comprises at least one forward and reverse primer pair specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis, selected from SEQ ID NO: 226–227, 229–230, 232–233, 235–236, 238–239, 241–242, 244–245, 247–248, 250–251, 253–254, or 256–257; Primer Pair Set K comprises at least one forward and reverse primer pair specific for Clostridium difficile (toxin A / B) selected from SEQ ID NO: 259–260, 262–263, 265– 266, 268–269, 271–272, 274–275, 277–278, 280–281, 283–284, 286–287, 289– 290, 292–293, 295–296, 298–299, or 301–302;Primer Pair Set L comprises at least one forward and reverse primer pair specific for Plesiomonas shigelloides selected from SEQ ID NO: 304–305, 307–308, or 310– 311; Primer Pair Set M comprises at least one forward and reverse primer pair specific for Salmonella sp. selected from SEQ ID NO: 313–314, 316–317, 319–320, 322–323, or 325–326; Primer Pair Set N comprises at least one forward and reverse primer pair specific for Yersinia enterocolitica selected from SEQ ID NO: 328–329, 331–332, 334–335, 337–338, 340–341, 343–344, 346–347, 349–350, 352–353, 355–356, 358–359, or 361–362; Primer Pair Set O comprises at least one forward and reverse primer pair specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus selected from SEQ ID NO: 364–365, 367–368, 370–371, 373–374, 376–377, 379–380, 382–383, 385–386, 388–389, or 391–392; Primer Pair Set P comprises at least one forward and reverse primer pair specific for Enteroaggregative E. coli (EAEC) selected from SEQ ID NO: 394–395, 397–398, 400–401, 403–404, 406–407, 409–410, or 412–413; Primer Pair Set Q comprises at least one forward and reverse primer pair specific for Enteropathogenic E. coli (EPEC) selected from SEQ ID NO: 415–416, 418–419, 421–422, 424–425, 427–428, 430–431, 433–434, 436–437, 439–440, 442–443, 445–446, 448–449, 451–452, 454–455, or 457–458; Primer Pair Set R comprises at least one forward and reverse primer pair specific for Enterotoxigenic E. coli (ETEC) selected from SEQ ID NO: 460–461, 463–464, 466–467, 469–470, 472–473, 475–476, 478–479, 481–482, or 484–485; Primer Pair Set S comprises at least one forward and reverse primer pair specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m selected from SEQ ID NO: 487–488, 490–491, 493–494, 496–497, or 499–500; Primer Pair Set T comprises at least one forward and reverse primer pair specific for Shigella / Enteroinvasive E. coli (EIEC) selected from SEQ ID NO: 502–503, 505– 506, 508–509, 511–512, 514–515, 517–518, 520–521, 523–524, 526–527, 529– 530, 532–533, or 535–536; Primer Pair Set U comprises at least one forward and reverse primer pair specific for E. coli O157 selected from SEQ ID NO: 538–539 or 541–542;Primer Pair Set V comprises at least one forward and reverse primer pair specific for Listeria monocytogenes selected from SEQ ID NO: 544–545, 547–548, 550–551, 553–554, or 556–557; Primer Pair Set W comprises at least one forward and reverse primer pair specific for Cryptosporidium sp. selected from SEQ ID NO: 559–560, 562–563, or 565–566; Primer Pair Set X comprises at least one forward and reverse primer pair specific for Cyclospora cayetanensis selected from SEQ ID NO: 568–569, 571–572, 574–575, 577–578, or 580–581; Primer Pair Set Y comprises at least one forward and reverse primer pair specific for Entamoeba histolytica selected from SEQ ID NO: 583–584, 586–587, or 589–590; and / or Primer Pair Set Z comprises at least one forward and reverse primer pair specific for Giardia intestinalis, or Giardia lamblia selected from SEQ ID NO: 592–593, 595– 596, 598–599, 601–602, 604–605, 607–608, 610–611, or 613–614.

29. The kit of claim 28, wherein the kit further comprises probes suitable for use with specific forward and reverse primer pairs, the probes comprising one or more of: a probe specific for Adenovirus having a sequence selected from SEQ ID NO: 3 or 6; a probe specific for Astrovirus having a sequence selected from SEQ ID NO: : 9, 12, or 15; a probe specific for Norovirus GI having a sequence selected from SEQ ID NO: 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, or 75; a probe specific for Norovirus GII having a sequence selected from SEQ ID NO: 78, 81, 84, 87, 90, 93, 96, 99, or 102; a probe specific for Rotavirus A having a sequence selected from SEQ ID NO: 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, or 141; a probe specific for Rotavirus B having a sequence selected from SEQ ID NO: 144, 147, or 150; a probe specific for Rotavirus C having a sequence selected from SEQ ID NO: 153 or 156; a probe specific for Sapovirus 1 having a sequence selected from SEQ ID NO: 159, 162, 165, 168, 171, 174, 177, or 180; a probe specific for Sapovirus 2 having a sequence selected from SEQ ID NO: 183, 186, 189, 192, 195, 198, 201, 204, 207, 210, 213, 216, 219, 222, or 225;a probe specific for Campylobacter coli, Campylobacter jejuni, or Campylobacter upsaliensis having a sequence selected from SEQ ID NO: 228, 231, 234, 237, 240, 243, 246, 249, 252, 255, or 258; a probe specific for Clostridium difficile (toxin A / B) having a sequence selected from SEQ ID NO: 261, 264, 267, 270, 273, 276, 279, 282, 285, 288, 291, 294, 297, 300, or 303; a probe specific for Plesiomonas shigelloides having a sequence selected from SEQ ID NO: 306, 309, or 312; a probe specific for Salmonella sp. having a sequence selected from SEQ ID NO: 315, 318, 321, 324, or 327; a probe specific for Yersinia enterocolitica selected from SEQ ID NO: 330, 333, 336, 339, 342, 345, 348, 351, 354, 357, 360, or 363; a probe specific for Vibrio cholerae, Vibrio parahaemolyticus, or Vibrio vulnificus having a sequence selected from SEQ ID NO: 366, 369, 372, 375, 378, 381, 384, 387, 390, or 393; a probe specific for Enteroaggregative E. coli (EAEC) having a sequence selected from SEQ ID NO: 396, 399, 402, 405, 408, 411, or 414; a probe specific for Enteropathogenic E. coli (EPEC) having a sequence selected from SEQ ID NO: 417, 420, 423, 426, 429, 432, 435, 438, 441, 444, 447, 450, 453, 456, 459; a probe specific for Enterotoxigenic E. coli (ETEC) having a sequence selected from SEQ ID NO: 462, 465, 468, 471, 474, 477, 480, 483, or 486; a probe specific for Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m having a sequence selected from SEQ ID NO: 489, 492, 495, 498, or 501; a probe specific for Shigella / Enteroinvasive E. coli (EIEC) having a sequence selected from SEQ ID NO: 504, 507, 510, 513, 516, 519, 522, 525, 528, 531, 534, 537; a probe specific for E. coli O157 having a sequence selected from SEQ ID NO: 540 or 543; a probe specific for Listeria monocytogenes having a sequence selected from SEQ ID NO: 546, 549, 552, 555, or 558; a probe specific for Cryptosporidium sp. having a sequence selected from SEQ ID NO: 561, 564, 567; a probe specific for Cyclospora cayetanensis selected from SEQ ID NO: 570, 573, 576, 579, 582;a probe specific for Entamoeba histolytica having a sequence selected from SEQ ID NO: 585, 588, 591; and / or a probe specific for Giardia intestinalis, or Giardia lamblia having a sequence selected from SEQ ID NO: 594, 597, 600, 603, 606, 609, 612, 615.

30. The kit of claim 28, wherein the kit further comprises a control sample, control forward and reverse primers and, optionally, a control probe, that specifically amplifies a target nucleic acid of the control sample.

31. The kit of claim 30, wherein the control forward and reverse primer pairs are selected from SEQ ID NO: 616–617, 619–620, 622–623, 625–626, 628–629, 631–632, 634–635, 637– 638, 640–641, 643–644, 646–647, 649–650, or 652–653; and the control probe comprises a probe sequence selected from SEQ ID NO: 618, 621, 624, 627, 630, 633, 636, 639, 642, 645, 648, 651, or 654.

32. The kit of claim 28, wherein the kit further comprises a control plasmid comprising one or more target sequences selected from Adenovirus, Astrovirus, Norovirus GI, Norovirus GII, Rotavirus A, Rotavirus B, Rotavirus C, Sapovirus 1, Sapovirus 2, Campylobacter coli, Campylobacter jejuni, Campylobacter upsaliensis, Clostridium difficile (toxin A / B), Plesiomonas shigelloides, Salmonella sp., Yersinia enterocolitica, Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Enteroaggregative E. coli (EAEC), Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Shiga-like toxin-producing E. coli (STEC) stx1 / stx2m, Shigella / Enteroinvasive E. coli (EIEC), E. coli O157, Listeria monocytogenes, Cryptosporidium sp., Cyclospora cayetanensis, Entamoeba histolytica, Giardia intestinalis, or Giardia lamblia.

33. The control plasmid of claim 32, wherein the plasmid comprises one or more of nucleic acid sequences of SEQ ID NO: 655–680.

Images