QTL for regulating corn stalk rot resistance, SNP molecular marker closely linked therewith, and use thereof

Abstract

The present invention relates to the technical field of molecular markers, in particular to a QTL for regulating the corn stalk rot resistance, an SNP molecular marker closely linked therewith, and the use thereof. The QTL for regulating the corn stalk rot resistance provided herein can be used for improving the corn stalk rot resistance and performing breeding of stalk rot-resistant corns. The provided SNP molecular marker closely linked with the corn stalk rot-resistant QTL can be used for identifying the stalk rot resistance of corns and has high accuracy, and can also be used for assisted breeding and germplasm resource improvement for the corn stalk rot resistance, thus achieving an important significance in improving the breeding efficiency and breeding level in stalk rot-resistant corns.

Description

QTLs regulating maize stalk rot resistance, their tightly linked SNP molecular markers, and their applications

[0001] Cross-references

[0002] This application claims priority to Chinese Patent Application No. 2023114501118, filed on November 2, 2023, entitled “QTL for regulating corn stalk rot resistance, its tightly linked SNP molecular markers and their applications,” all disclosures of which are incorporated herein by reference in their entirety. Technical Field

[0003] The present invention relates to the technical field of molecular markers, and in particular to QTLs for regulating corn stalk rot resistance, tightly linked SNP molecular markers thereof, and applications thereof. Background Art

[0004] Maize (Zea mays L.) is a major food and feed crop, as well as an important industrial raw material and energy plant. It plays a crucial role in the national economy and agricultural production. Maize stalk rot is a global soil-borne disease that severely harms maize production. It primarily causes premature plant aging, stalk lodging, and insufficient grain filling, resulting in yield losses and hindering mechanized maize harvesting. Fusarium graminearum and Pythium inflatum are the dominant pathogens causing maize stalk rot.

[0005] Corn resistance to stalk rot is a complex quantitative trait controlled by multiple quantitative trait loci (QTLs). Because stalk rot is significantly affected by pathogens, the environment, and genotype, and because it is difficult to identify sources of high or multi-resistance, corn stalk rot incidence has become increasingly severe year by year. Currently, most identified stalk rot resistance loci have low efficacy, and relatively few stalk rot resistance genes have been cloned. Therefore, further research is needed to identify QTLs and genes for stalk rot resistance in corn, as well as to develop molecular markers tightly linked to QTLs. This will provide strong support for molecular breeding for stalk rot resistance, aggregating multiple resistance genes, and ultimately improving corn stalk rot resistance.

[0006] Summary of the Invention

[0007] The present invention provides a QTL for regulating corn stalk rot resistance, a tightly linked SNP molecular marker thereof and applications thereof.

[0008] The present invention utilizes a population of recombinant inbred lines of maize to identify resistance to stalk rot in multiple environments, and combines high-density genetic mapping with fine mapping to locate a stable QTL controlling maize stalk rot resistance on maize chromosome 2, bin 2.02. Based on this, the present invention provides a maize genomic region and its corresponding DNA fragment that can improve maize stalk rot resistance. In addition, the present invention also provides nucleotide sequence polymorphisms and SNP molecular markers that are tightly linked to the above-mentioned QTL sites. Utilizing the SNP molecular markers provided by the present invention, stalk rot resistance sites can be efficiently and quickly introduced into other susceptible materials to produce maize stalk rot-resistant germplasm, and the genotype of the maize material to be tested can also be accurately identified with high throughput to screen for stalk rot-resistant materials.

[0009] Specifically, the present invention provides the following technical solutions:

[0010] The present invention provides a QTL for regulating corn stalk rot resistance. The QTL is a DNA fragment located on corn chromosome 2. With reference to the B73AGP_V3 genome, the DNA fragment comprises a nucleotide sequence at positions 12360575-14116693 on corn chromosome 2.

[0011] In some embodiments of the present invention, the QTL regulating corn stalk rot resistance is located between molecular markers Ks1 and Ks3, with a physical distance of 1.75 Mb; wherein the polymorphic site of molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0012] The present invention provides the use of the QTL for regulating corn stalk rot resistance described above in improving corn stalk rot resistance or in breeding stalk rot-resistant corn.

[0013] In the present invention, the stem rot is preferably Fusarium graminearum stem rot.

[0014] The present invention provides a method for breeding stalk rot-resistant corn, which comprises the step of allowing the corn chromosome to contain the QTL regulating corn stalk rot resistance.

[0015] Preferably, the method comprises the step of crossing corn comprising the QTL with corn not comprising the QTL.

[0016] In some embodiments of the invention, the method comprises the following steps:

[0017] 1) crossing a corn plant comprising the QTL with a corn plant not comprising the QTL to obtain an F1 population;

[0018] 2) performing one or more rounds of self-pollination on the F1 population, and / or hybridizing plants from the F1 population to obtain a next generation population;

[0019] 3) Selecting maize plants containing the QTL using molecular markers tightly linked to the QTL.

[0020] The present invention provides SNP molecular markers associated with corn stalk rot resistance, wherein the SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; with reference to the B73AGP_V3 genome, the polymorphic site of molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0021] It will be understood by those skilled in the art that, based on the polymorphic sites of the above-mentioned SNP molecular markers and their upstream and downstream genomic sequences, sequence fragments of different lengths can be developed as molecular markers for the amplification and detection of polymorphic sites. Therefore, the present invention has no special restrictions on the length of the sequence fragments of SNP molecular markers. All SNP molecular markers containing the above-mentioned polymorphic sites and the upstream and / or downstream genomic sequences of the polymorphic sites are within the scope of protection of the present invention.

[0022] The present invention provides SNP molecular markers associated with corn stalk rot resistance, wherein the SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; wherein the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 of the sequence shown in SEQ ID NO.1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 of the sequence shown in SEQ ID NO.2.

[0023] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 60 of the sequence shown in SEQ ID NO. 13;

[0024] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 60 of the sequence shown in SEQ ID NO.14.

[0025] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 70 of the sequence shown in SEQ ID NO.15;

[0026] The molecular marker Ks3 is a nucleotide sequence containing the polymorphism A / C at position 70 of the sequence shown in SEQ ID NO.16.

[0027] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 80 of the sequence shown in SEQ ID NO. 17;

[0028] The molecular marker Ks3 is a nucleotide sequence containing the polymorphism A / C at position 80 of the sequence shown in SEQ ID NO.18.

[0029] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 90 of the sequence shown in SEQ ID NO.19;

[0030] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 90 of the sequence shown in SEQ ID NO. 20.

[0031] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 100 of the sequence shown in SEQ ID NO. 21;

[0032] The molecular marker Ks3 is a nucleotide sequence containing the polymorphism A / C at position 100 of the sequence shown in SEQ ID NO.22.

[0033] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 150 of the sequence shown in SEQ ID NO. 23;

[0034] The molecular marker Ks3 is a nucleotide sequence containing the polymorphism A / C at position 150 of the sequence shown in SEQ ID NO.24.

[0035] Furthermore, the molecular marker Ks1 is a nucleotide sequence containing the polymorphism A / G at position 200 of the sequence shown in SEQ ID NO. 25;

[0036] The molecular marker Ks3 is a nucleotide sequence containing a polymorphism of A / C at position 200 of the sequence shown in SEQ ID NO. 26.

[0037] The above SNP molecular markers are closely linked to the maize stalk rot resistance QTL locus.

[0038] Specifically, the molecular marker Ks1 is obtained by PCR amplification using a primer set with sequences as shown in SEQ ID NO. 3-5 and corn genomic DNA as a template;

[0039] The molecular marker Ks3 is obtained by PCR amplification using a primer set with sequences as shown in SEQ ID NOs. 6-8 and corn genomic DNA as a template.

[0040] SEQ ID NO.3: CAGCTTATAGACAGGGGTTTGGG;

[0041] SEQ ID NO.4: CAGCTTATAGACAGGGGTTTGGA;

[0042] SEQ ID NO.5: GGCACCACAACCATTATTTTAGTTTCC;

[0043] SEQ ID NO.6:AGTTGGTCATCAGCTTGTCAAAAA;

[0044] SEQ ID NO.7:AGTTGGTCATCAGCTTGTCAAAAC;

[0045] SEQ ID NO. 8: GGTAAAGACTAGTTTCGCAAGCCG.

[0046] In some embodiments of the present invention, the SNP molecular marker associated with corn stalk rot resistance is Ks1 or Ks3.

[0047] In some embodiments of the present invention, the SNP molecular marker associated with corn stalk rot resistance is a combination of Ks1 and Ks3.

[0048] The present invention was verified by a large sample of corn materials and found that the molecular markers Ks1 and Ks3 alone can be used to identify corn stalk rot resistance, and the combined use of molecular markers Ks1 and Ks3 can significantly improve the accuracy of corn stalk rot resistance identification.

[0049] In the molecular marker Ks1 described above, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot;

[0050] In the molecular marker Ks3 described above, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0051] The present invention provides a primer set for amplifying the SNP molecular marker associated with corn stalk rot resistance.

[0052] According to the genomic location of the polymorphic site of the SNP molecular marker provided above and its upstream and downstream sequences, those skilled in the art can develop various types of primer sets for amplifying the SNP molecular marker.

[0053] The primer set may include any primers that can be used to detect the genotype of a SNP molecular marker.

[0054] Preferably, the primer set includes primers having sequences shown as SEQ ID NOs. 3-5, and / or primers having sequences shown as SEQ ID NOs. 6-8.

[0055] Among them, the primers with sequences shown as SEQ ID NO.3-4 are forward primers, and the primer with sequence shown as SEQ ID NO.5 is a reverse universal primer; the primers with sequences shown as SEQ ID NO.6-7 are forward primers, and the primer with sequence shown as SEQ ID NO.8 is a reverse universal primer.

[0056] KASP (competitive allele-specific PCR) technology eliminates the need for typing based on DNA fragment size and relies on traditional, cumbersome, low-throughput, and expensive methods like gel electrophoresis. This makes it more suitable for the rapidly developing high-throughput molecular detection platforms. Therefore, the present invention has developed a low-cost KASP primer set for detecting corn stalk rot resistance, suitable for high-throughput molecular detection platforms.

[0057] Among them, the KASP primer set used to amplify the Ks1 includes a first forward primer, a second forward primer and a reverse universal primer, wherein the sequence of the first forward primer is a specific fluorescent tag sequence and a sequence shown in SEQ ID NO.3 connected in sequence, and the sequence of the second forward primer is a specific fluorescent tag sequence and a sequence shown in SEQ ID NO.4 connected in sequence; the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO.5.

[0058] Among them, the KASP primer set used to amplify the Ks3 includes a third forward primer, a fourth forward primer and a reverse universal primer, wherein the sequence of the third forward primer is a specific fluorescent tag sequence and a sequence shown in SEQ ID NO.6 connected in sequence, and the sequence of the fourth forward primer is a specific fluorescent tag sequence and a sequence shown in SEQ ID NO.7 connected in sequence; the nucleotide sequence of the reverse universal primer is shown in SEQ ID NO.8.

[0059] The fluorescent labels of the first forward primer and the second forward primer are different, and the fluorescent labels of the third forward primer and the fourth forward primer are different. There is no special limitation on the fluorescent labels, and commonly used fluorescent labels can be selected.

[0060] In some embodiments of the present invention, the KASP primer set for amplifying the Ks1 includes primers with sequences as shown in SEQ ID NOs. 9-10 and 5, wherein the primers with sequences as shown in SEQ ID NOs. 9-10 are forward primers, and the primer with sequence as shown in SEQ ID NO. 5 is a reverse universal primer;

[0061] In some embodiments of the present invention, the KASP primer set for amplifying the Ks3 includes primers with sequences as shown in SEQ ID NOs. 11-12 and 8, wherein the primers with sequences as shown in SEQ ID NOs. 11-12 are forward primers, and the primer with sequence as shown in SEQ ID NO. 8 is a reverse universal primer.

[0062] The present invention also includes a kit containing the above primer set.

[0063] To facilitate detection, the kit may also contain other reagents for PCR amplification, including but not limited to DNA polymerase, PCR reaction buffer, probe, dNTP, Mg 2+ , water, etc.

[0064] The above reagents can be packaged individually or provided as a premixed solution after mixing.

[0065] The present invention provides any of the following uses of the QTL regulating corn stalk rot resistance or the SNP molecular marker associated with corn stalk rot resistance, or the primer set or the kit described above:

[0066] (1) Application in identifying or assisting in identifying resistance to corn stalk rot;

[0067] (2) Application in the preparation of products for identifying or assisting in identifying corn stalk rot resistance;

[0068] (3) Application in early prediction of corn stalk rot resistance;

[0069] (4) Application in screening corn for resistance to stalk rot;

[0070] (5) Application of molecular marker-assisted breeding for corn stalk rot resistance;

[0071] (6) Application in the preparation of products for molecular marker-assisted breeding of corn stalk rot resistance;

[0072] (7) Application in improving corn germplasm resources resistant to stalk rot;

[0073] Among them, the SNP molecular markers related to corn stalk rot resistance include Ks1 and / or Ks3, the polymorphic site of Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0074] In the Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0075] In some embodiments of the present invention, the Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1, and the Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.2.

[0076] The present invention provides a method for identifying corn stalk rot resistance, the method comprising:

[0077] Using the genomic DNA of the maize to be identified as a template, PCR amplification of SNP molecular markers associated with maize stalk rot resistance was performed;

[0078] Analyzing the genotype of the SNP molecular marker associated with corn stalk rot resistance in the PCR amplification product, and determining the stalk rot resistance of the corn to be identified based on the genotype;

[0079] Among them, the SNP molecular markers related to corn stalk rot resistance include Ks1 and / or Ks3, the polymorphic site of Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

[0080] In some embodiments of the present invention, the Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1, and the Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.2.

[0081] Specifically, in the Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

[0082] In some embodiments of the present invention, PCR amplification of SNP molecular markers associated with corn stalk rot resistance is performed using a primer set with sequences shown in SEQ ID NOs. 3-5 and / or a primer set with sequences shown in SEQ ID NOs. 6-7.

[0083] In some embodiments of the present invention, PCR amplification of SNP molecular markers associated with corn stalk rot resistance is performed using a primer set with sequences such as SEQ ID NOs. 9-10, 5 and / or a primer set with sequences such as SEQ ID NOs. 11-12, 8.

[0084] The present invention provides a method for obtaining a corn plant having increased resistance to stalk rot, the method comprising the steps of:

[0085] (1) Providing a first corn plant comprising any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or

[0086] The invention further comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO. 2, an A at the 60th base of the sequence shown in SEQ ID NO. 14, an A at the 70th base of the sequence shown in SEQ ID NO. 16, an A at the 80th base of the sequence shown in SEQ ID NO. 18, an A at the 90th base of the sequence shown in SEQ ID NO. 20, an A at the 100th base of the sequence shown in SEQ ID NO. 22, an A at the 150th base of the sequence shown in SEQ ID NO. 24, or an A at the 200th base of the sequence shown in SEQ ID NO. 26;

[0087] wherein said first corn plant is resistant to stalk rot;

[0088] (2) hybridizing the first corn plant with a second corn plant to obtain a progeny plant; the second corn plant does not contain or contains the chromosome interval described in step (1);

[0089] (3) Selecting progeny plants containing the chromosome interval of step (1) from the progeny plants by isolating nucleic acid from the progeny plants and detecting it in the nucleic acid, thereby obtaining corn plants with increased resistance to stalk rot.

[0090] The present invention provides a method for producing a corn plant having stalk rot resistance, the method comprising the steps of:

[0091] (1) Isolating nucleic acids from corn plants;

[0092] (2) detecting the SNP molecular marker in the nucleic acid;

[0093] (3) selecting corn plants having stalk rot resistance based on the presence of the SNP molecular marker detected in step (2);

[0094] The selection refers to selecting the corn plant when the genotype of the polymorphic site of the SNP molecular marker Ks1 in the isolated nucleic acid is AA; and / or

[0095] When the genotype of the polymorphic site of the SNP molecular marker Ks3 in the isolated nucleic acid is AA, the corn plant is selected.

[0096] The present invention provides a method for conferring stalk rot resistance to corn, the method comprising: 1) providing a nucleic acid molecule from a corn chromosome having stalk rot resistance, and 2) inserting the nucleic acid molecule into a chromosome of a recipient corn, thereby producing a corn plant having increased stalk rot resistance compared to the recipient corn; the nucleic acid molecule comprises a nucleotide sequence at positions 12360575-14116693 of corn chromosome 2 or any part thereof, and the nucleic acid molecule is capable of conferring stalk rot resistance to corn.

[0097] The present invention provides a corn plant obtained by the above method.

[0098] The present invention provides a corn plant obtained by hybridizing a first corn plant with a second corn plant, wherein the first corn plant comprises any of the following chromosome intervals in its genome:

[0099] a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or

[0100] The invention further comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO. 2, an A at the 60th base of the sequence shown in SEQ ID NO. 14, an A at the 70th base of the sequence shown in SEQ ID NO. 16, an A at the 80th base of the sequence shown in SEQ ID NO. 18, an A at the 90th base of the sequence shown in SEQ ID NO. 20, an A at the 100th base of the sequence shown in SEQ ID NO. 22, an A at the 150th base of the sequence shown in SEQ ID NO. 24, or an A at the 200th base of the sequence shown in SEQ ID NO. 26;

[0101] The first corn plant is resistant to stalk rot;

[0102] The second corn plant contains none or any of the chromosome intervals described above.

[0103] Preferably, the chromosome region of the above-mentioned corn plant contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.1, and / or contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.2.

[0104] The beneficial effects of the present invention include at least: the LOD value of the QTL for regulating corn stalk rot resistance provided by the present invention is between 3.67-8.79, and the explained phenotypic variation is 5.40%-15.60%, which can be used to improve corn stalk rot resistance and breed stalk rot-resistant corn.

[0105] The SNP molecular markers tightly linked to the maize stalk rot resistance QTL provided by the present invention can be used to identify maize stalk rot resistance with high accuracy and can also be used for assisted breeding and germplasm resource improvement for maize stalk rot resistance. The SNP molecular markers of the present invention can be used to identify and assist in screening maize stalk rot resistance at the seedling stage. In maize breeding, the use of the SNP molecular markers of the present invention can improve the selection efficiency of maize breeding and accelerate the breeding process, which is of great significance for improving the efficiency and level of maize stalk rot resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0107] Figure 1 shows the symptoms of Fusarium graminearum stem rot of the parental inbred lines in Example 1 of the present invention; wherein, A is the field phenotype of stem rot of the parental inbred lines (HR: disease-resistant, S: susceptible); B is the observation of the occurrence of stem rot by splitting the stems of the parental inbred lines; C is the stem rot disease grading standard (HR: disease-resistant, HS: susceptible); D is the disease grading of the parental inbred lines under four environments; *** indicates significance at the 0.001 level.

[0108] FIG2 is a frequency distribution diagram of the disease classification of Fusarium graminearum stem rot under the conditions of single environment and multi-environment joint analysis in Example 1 of the present invention.

[0109] Figure 3 shows the QTL mapping for Fusarium graminearum stem rot disease classification under single and multi-environment combined analysis conditions in Example 1 of the present invention. In the QTL mapping results, the lines represent the QTL mapping results for Fusarium graminearum stem rot-related traits on maize chromosome 2 under different environments; the X-axis represents the genetic map position in cM; and the Y-axis represents the LOD value. In the QTL additive effect analysis, the lines represent the additive effect values ​​of different QTLs; the X-axis represents the genetic map position in cM; the Y-axis represents the additive effect value, with positive and negative values ​​indicating the direction of the effect.

[0110] Figure 4 shows the effect verification and fine mapping of the QTL for Fusarium graminearum stem rot resistance in Example 1 of the present invention; wherein, A represents the effect verification of the QTL; B represents the fine mapping of the QTL. The QTL effect verification and fine mapping were performed using the recombinant progeny verification method, and the t-test was used to analyze whether there was a difference in the DSI between the progeny homozygous for the disease-resistant allele and the progeny homozygous for the disease-susceptible allele of each recombinant plant. If there was a significant difference in the DSI between the two genotype groups (P < 0.05), it was inferred that the parental recombinant individual carried the disease-resistant gene, represented by R; conversely, if there was no significant difference between the two genotype groups (P > 0.05), it was inferred that the parental recombinant individual did not carry the disease-resistant gene, represented by S. Black rectangles represent homozygous disease-resistant allele segments; gray rectangles represent heterozygous allele segments. Molecular markers are the markers used in the analysis results. The bar graph shows the DSI distribution of plants with different genotypes. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. DETAILED DESCRIPTION

[0111] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0112] Example 1 Mapping of maize stalk rot resistance QTL and development of its tightly linked molecular markers

[0113] 1. Materials and Methods

[0114] 1.1 Test materials

[0115] Corn materials for testing:

[0116] 215 F clones derived from the disease-resistant inbred line KA105, the disease-susceptible inbred line Huangzaosi (HZ4), and their combinations 7:8 Recombinant inbred line (RIL) population.

[0117] The detailed information of the RIL families is shown in Table 1 .

[0118] Table 1 RIL families (215 samples)

[0119] KA105 is an inbred line independently bred by the maize genetics and breeding team of Northwest Agriculture and Forestry University (Wang Boxin, Wang Yahui, Chen Pengfei, et al. Analysis of combining ability of maize inbred lines derived from Shaanxi A and Shaanxi B groups under different density conditions [J]. Acta Agronomica Sinica, 2017, 43(9):1328-1336.). HZ4 is a backbone maize inbred line bred in China, jointly bred by the Beijing Academy of Agricultural and Forestry Sciences and the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences (Zhao Jiuran, Li Chunhui, Zhang Ruyang, et al. Exploration of the origin of the backbone maize inbred line Huang Zao Si [J]. Journal of Plant Genetic Resources, 2021, 22(1):6.). Seeds of the parental inbred lines of the test materials were provided by the maize breeding team of the College of Agriculture, Northwest Agriculture and Forestry University.

[0120] Pathogen: The Fusarium graminearum strain was provided by Associate Researcher Long Shusheng from the College of Plant Protection, Northwest Agriculture and Forestry University. This pathogen is the dominant pathogen of stalk rot in northern China (Wang Xiaoming, Jin Qiming, Li Xiao, et al. Field Manual of Corn Pests and Diseases [M]. China Agricultural Science and Technology Press, 2010.).

[0121] 1.2 Test methods

[0122] 1.2.1 Field design

[0123] Populations of 215 RILs derived from the parental lines KA105 and HZ4, and their combinations, were inoculated and tested in Yangling and Sanyuan in 2020-2021. The site and year were uniformly defined as an environment, abbreviated as "year + site initials," e.g., 2020YL. Field trials employed an incompletely randomized block design with two replicates per environment. Plants were planted in single-row plots with a row length of 4 m and a row spacing of 0.6 m, at a density of 5,500 plants per mu. Field management practices were the same as those for local field corn production.

[0124] 1.2.2 Pathogen culture

[0125] Propagation culture of Fusarium graminearum: The pathogen strain isolated from a single spore is inoculated onto PDA (Potato Dextrose Agar) culture medium and cultured in the dark in a constant temperature incubator at 25°C for 5-7 days. When the mycelium covers the surface of the culture medium, it is cut into equal parts and inoculated onto sterilized corn kernel culture medium to carry out the propagation of Fusarium graminearum inoculum.

[0126] Preparation of PDA solid culture medium: Select fresh potatoes, wash and peel them, cut them into small pieces of approximately 1cm×1cm, weigh 200g, put them into a pot, add appropriate amount of pure water and boil for 30 minutes, filter through 8 layers of gauze, and collect the filtrate into a 1L beaker; add 20g of glucose and stir to dissolve, weigh 15g of agar powder, heat and dissolve, then pour it into the filtrate, stir evenly and adjust the volume to 1L, sterilize at 121℃ and high temperature and high pressure for 20min, divide into culture dishes on a clean bench, cool and solidify for use, or store in a 4℃ refrigerator for later use.

[0127] To prepare the inoculum for Fusarium graminearum: Select healthy, plump corn kernels and soak them in water for 20-22 hours, then boil them in boiling water for 100 minutes. Lay the cooked corn kernels flat and air-dry. Portion the kernels into heat-resistant inoculum bags in 500g increments and autoclave at 121°C for 50 minutes. After cooling, inoculate the inoculum with Fusarium graminearum grown on PDA culture medium and seal the bags with breathable film. Incubate in the dark at 25°C for 15-20 days until mycelium covers the entire surface of the corn kernels. Rub the bags every two days to ensure full contact between the corn kernels and the inoculum. Dry the inoculum in the shade for 3-4 days, then pack it into sacks and store in a cold storage until ready for use.

[0128] 1.2.3 Field inoculation

[0129] During the tasseling stage, corn is inoculated in the field using the buried root wounding method. Before inoculation, mix the prepared seed inoculation material thoroughly. During inoculation, dig a hole 5-10 cm from the plant's base, cut off some of the fibrous roots to create a wound, place 75-85 infected corn kernels in the hole, and cover with soil, compacting it firmly. After inoculation, irrigate the field to keep the soil moist to promote pathogen growth and infection.

[0130] 1.2.4 Characteristic Investigation

[0131] 50-55 days after inoculation, corn stalk rot in the field was identified using the stem splitting method. Plants were cut at the cob attachment point and split longitudinally along the stem. The pathogen infection at the root and stem base, as well as the degree of pith necrosis, were observed. The disease rating scale (DRS) was used to identify stalk rot phenotypes, which are divided into five grades:

[0132] Level 1: Highly resistant, normal plants, no obvious symptoms;

[0133] Level 3: disease-resistant, the plant's stem surface is normal, with brown lesions appearing at the stem tip;

[0134] Level 5: Moderate resistance, the base of the plant stem becomes soft and faded, with obvious water stains; the pith tissue between the first and second internodes at the base of the stem shrinks and decomposes, and browning symptoms appear;

[0135] Level 7: Susceptible. The lower stem nodes of the plant gradually turn from green to brown. The stem becomes soft and severely dehydrated. The internal stem pith tissue decomposes into filaments and shrinks severely. White or rose-red hyphae appear on the stem nodes. The root system becomes soft, dry, and sparse but does not fall over. The fruit clusters begin to droop.

[0136] Level 9: Highly susceptible, the plant stem is hollow and constricted, with only necrotic vascular tissue remaining inside the stem, the nodes and internodes turn black and have rose-red marks; the root system is sparse, rotten and hollow, the plant is bent or lodged; the bracts of the female ear are dry and loose, and the female ear droops.

[0137] Ten plants of consistent growth were selected from each family, and their stem rot disease grade was recorded. The average value was used as the phenotypic value for each family. The number of days from sowing to 50% of the plants shedding pollen was also investigated and recorded for each family.

[0138] 1.2.5 Phenotypic data analysis

[0139] To assess the significance of genotype and environment variances, as well as the interaction between the two, the "PROC MIXED" procedure in SAS (V9.2) was used to calculate variance components. The mixed linear model was: y = μ + gi + ej + ε, where μ represents the overall phenotypic mean, gi is the genotype effect of the 'i'th family, ej is the effect of the 'j'th environment, and ε is the random residual term. Genotype was used as a fixed effect, flowering date as a covariate, and environment, replication within environment, and genotype-environment interaction as random effects. The results of the variance analysis were used to calculate the broad-sense heritability (H) of stem rot resistance. 2 ): in, is the genetic variance, represents the genotype-environment interaction variance, is the error term, n is the number of environments, and r is the number of replicates. To eliminate the effects of environmental variation on phenotypes, a mixed linear model was used in SAS (V9.2) to estimate the best linear unbiased prediction (BLUP) for each family (all families included in the mapping population). BLUP values ​​were used as data for multi-environment joint analysis to plot phenotypic distribution histograms and multi-environment joint QTL mapping.

[0140] 1.2.6 Linkage map construction

[0141] At the 5- to 6-leaf stage, young leaves from five plants of uniform growth were selected from each family (all families included in the mapping population) and mixed. Genomic DNA was extracted using the conventional CTAB method. Genotypic data were generated by Liaoning East Asia Crop Seed Quality Inspection and Testing Co., Ltd., and genotyping analysis was performed using the Maize6H-60K chip independently developed by the Maize Research Center of the Beijing Academy of Agricultural and Forestry Sciences. Linkage maps were constructed using QTL ICImapping 4.2 software. Markers were filtered using the "*.snp" function to remove markers with identical parents (P1 = P2), parental deletions or heterozygosity, and no polymorphism in the progeny. Redundant markers were removed using the "*.bin" function (with thresholds set to a deletion rate greater than 15% and a partial segregation P value less than 0.001) to obtain bin markers. A linkage map was constructed using the ".map" function, and genetic distances were estimated using the Kosambi function. A total of 40,812 polymorphic SNP markers were screened, and redundant markers were removed and merged into 8,257 bin markers.

[0142] 1.2.7 QTL Positioning

[0143] Based on a constructed high-density linkage map, combined with disease-graded phenotypic values ​​from recombinant inbred line populations analyzed in single and multiple environments, QTLs for Fusarium graminearum stem rot resistance were detected. Initial mapping and genetic effect analysis were performed using the composite interval mapping (CIM) method using Windows QTL Cartographer V2.5 software. The LOD threshold was set at 1000 permutations, with a significance level P value less than 0.05. Finally, the LOD = 3 threshold was used, and the confidence interval of the target QTL was determined by dropping two LOD values ​​on either side of the LOD peak. QTLs identified simultaneously in multiple environments or those explaining greater than 10% of phenotypic variation in a single environment were selected for effect verification and fine-tuning.

[0144] In the mapping of QTLs for maize stalk rot resistance, the phenotypic identification of RIL families in the mapping population was based on the following principles: 10 plants with consistent growth from each family were selected under a single environment, the incidence of stalk rot was observed and recorded one by one, and the average value of the 10 plants was used as the family phenotypic value; the best linear unbiased prediction (BLUP) of the phenotypic value of the RIL population under multiple environments was calculated using the phenotypic means of each family under a single environment.

[0145] 1.2.8 Molecular marker development and QTL effect verification

[0146] Polymorphic SNPs located within the target QTL region were selected for development of KASP markers for effect verification. KASP marker primer design parameters were as follows: primer length 20-27 bp, GC content between 40% and 60%, and annealing temperature between 59°C and 65°C (optimum temperature 63°C). A fluorescent linker sequence was added to the 5' end of the designed forward primer: the FAM linker sequence was 5'-gaaggtgaccaagttcatgct-3', and the HEX linker sequence was 5'-gaaggtcggagtcaacggatt-3'. Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0147] The PCR reaction system is as follows: the total system is 4 μL, including 2 μL HiGeno 2×Probe Mix, 1 μL DNA template (20–50 ng / μL), 0.944 μL ddH2O and 0.056 μL primer mixture (the preferred primer mixture ratio is: 12 μL each of forward primer Primer X and Primer Y (100 μM), 30 μL reverse primer Primer R (100 μM), 46 μL ddH2O).

[0148] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min, first amplification reaction, denaturation at 94°C for 20 s, annealing at 61°C for 60 s, for 10 cycles, and second amplification reaction, denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 38 cycles.

[0149] PCR products were scanned and fluorescence data were read using a FLUOstar Omega microplate reader (BMG Labtech, Offenburg, Germany). Genotyping data were read and clustered using the SNP typing software KclusterCaller (V 3.4.1.36; LGC Hoddesdon, UK). The genotype of the FAM allele was X:X, the genotype of the HEX allele was Y:Y, and the heterozygous genotype was X:Y.

[0150] 1.2.9 QTL effect verification and fine mapping

[0151] The QTL effect was verified and finely mapped using the recombinant progeny verification method. Based on the initial QTL mapping results, the remaining heterozygous lines with fixed background genotypes in the target segment were screened in the RIL population, and KASP markers were developed to screen for individuals that exchanged in the target segment. The key recombinant individuals were verified by the genotype and stem rot phenotype of the offspring for effect verification and fine mapping. 60-180 plants of each recombinant individual were planted for genotype and stem rot disease grading, and the disease severity index (DSI) of each genotype was calculated. The one-tailed t-test was used to analyze the differences in resistance to Fusarium graminearum stem rot among different genotypes. If the differences among different genotypes were significant (P < 0.05), it meant that the major effect QTL was located in the heterozygous region, and vice versa.

[0152] The calculation formula of DSI is as follows: DSI (%) = Σ (disease grade × number of plants with corresponding grade) × 100 / (maximum disease grade × total number of plants with identified stem rot phenotype).

[0153] 2. Results and Analysis

[0154] 2.1 Phenotypic variation in resistance to Fusarium graminearum stem rot in maize

[0155] Resistance to Fusarium graminearum stem rot in RIL populations and parental materials was assessed under different environments (Figure 1). Statistical analysis revealed highly significant differences in disease grading between parental materials within each population (Table 2). Within the RIL population, disease grading exhibited wide, continuous variation across different environments, indicating that stem rot resistance is a quantitative trait controlled by multiple genes. The range of disease grading varied from 1.00 to 9.00, with a mean of 4.21 to 4.50 and a coefficient of variation of 40.92% to 51.49%. After eliminating environmental influences by calculating the BLUP value, the coefficient of variation for disease grading in the RIL population decreased to 33.52%. Disease grading within a single environment exhibited a skewed normal distribution (Figure 2), and BLUP values ​​for combined analysis of multiple environments showed a normal distribution.

[0156] The results of the joint analysis of variance (Table 3) showed that within the RIL population, there were highly significant differences between genotypes, between environments, and in the genotype-by-environment interaction. The estimated genetic variance was greater than the estimated variance for both the environment and the genotype-by-environment interaction, indicating that genetic factors were the primary source of variation, with significant environmental influences. The heritability of stem rot resistance was 81.01%.

[0157] Table 2

[0158] Table 3 Variance and heritability analysis of stem rot phenotypic indicators in multiple environments

[0159] 2.2 Linkage map construction

[0160] A linkage map was constructed using 215 RIL families and 8,257 binned markers. The map had a total length of 6,541 cM, with an average genetic distance of 0.79 cM between adjacent markers. Chromosome 1 was the longest, at 926.78 cM, and contained the most markers, 1,191; chromosome 10 was the shortest, at 385.39 cM, and contained the fewest markers, 393.

[0161] 2.3 QTL mapping for resistance to Fusarium graminearum stem rot in maize

[0162] Using the phenotypic data of disease classification in single environment and multi-environment joint analysis, WinQTLCart V 2.5 Composite interval mapping was used to locate a QTL for resistance to Fusarium graminearum stem rot in maize. A QTL was detected on chromosome 2, bin 2.02 (Figure 3), with a physical location between 10,606,703 bp and 14,892,011 bp, and a confidence interval of approximately 4.29 Mb (referenced to the B73 AGP_V3 genome). This QTL was co-localized in both 2020YL and 2021YL lines, explaining 5.40%-15.60% of the phenotypic variation. The resistance allele originated from KA105, and the locus showed environmental specificity (Table 4).

[0163] Table 4 QTL analysis of disease grade of Fusarium graminearum stem rot under single and combined environments

[0164] 2.4 Verification and fine mapping of QTL effects for resistance to Fusarium graminearum stem rot

[0165] Among 215 F7RIL families, one heterozygous genotype in the target QTL candidate interval was screened, with the remaining heterozygous line material, KHRIL-187, having a relatively fixed background genotype. Seeds of segregating population progeny were obtained by self-pollination. Developed molecular markers (Table 5) were used to screen for individuals that underwent exchange in the target segment. Key recombinant individuals were precisely located using progeny testing. For each recombinant individual, 100-200 plants were planted to identify the genotype and stem rot resistance phenotype. Verification of the effect of the target QTL showed that the homozygous allele from the resistant parent significantly improved field resistance to stem rot (P < 0.001) (Figure 4A). Among them, the mean DSI of the homozygous disease-resistant KA105 / KA105 genotype was 31.48%, while the mean DSI of the homozygous susceptible HZ4 / HZ4 genotype was 55.42%. A t-test within the population showed a highly significant difference in DSI between the homozygous disease-resistant and susceptible genotypes (P < 0.001). In summary, the remaining heterozygous line, KHRIL-187, was used to detect the effect of the resistance QTL, and the results were significantly different, indicating that the genetic effect of this locus on resistance to Fusarium graminearum stem rot is real. The QTL locus carrying the homozygous disease-resistant allele can reduce the DSI by approximately 23.94%, significantly improving the plant's field resistance to Fusarium graminearum stem rot.

[0166] Three molecular markers were encrypted within the candidate interval for the target QTL. Molecular marker primers were designed using the maize B73 reference genome version V3 sequence as a reference. The molecular markers, Ks1 and Ks3, were located at either end of the candidate interval. Ks1 is located at position 12360575 on maize chromosome 2, with a mutation of either A or G; Ks3 is located at position 14116693 on maize chromosome 2, with a mutation of either A or C. Using the newly developed markers, the progeny of the segregating population were divided into two recombinant types, and the target QTL was finely mapped using progeny testing. The results showed that the DSI of plants carrying the homozygous KA105 genotype and the homozygous HZ4 genotype in both types I and II were highly significantly different (P < 0.001) (Figure 4B), indicating that the target QTL was carried in the heterozygous segments of both recombinant types. Among them, in type II, the molecular marker Ks2 is a heterozygous genotype, and the molecular markers Ks1 and Ks3 are homozygous susceptible genotypes. It is speculated that the QTL candidate interval is located between the molecular markers Ks1 and Ks3, with a physical distance of about 1.75Mb (B73AGP_V3).

[0167] The detailed information of the molecular markers closely linked to the maize stalk rot resistance QTL developed above is as follows (the locations of the molecular markers are all referenced to the B73AGP_V3 genome):

[0168] (1) Molecular marker Ks1: The polymorphic site is located at nucleotide 12360575 on maize chromosome 2, and the polymorphism is A / G;

[0169] (2) Molecular marker Ks3: The polymorphic site is located at nucleotide 14116693 on maize chromosome 2, and the polymorphism is A / C.

[0170] Among them, the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 200 as shown in SEQ ID NO.1, and the molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 200 as shown in SEQ ID NO.2.

[0171] Optionally, the nucleotide sequence of the molecular marker Ks1 is as shown in SEQ ID NO.1, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.1, and the polymorphism is A / G; the nucleotide sequence of the molecular marker Ks3 is as shown in SEQ ID NO.2, the polymorphic site is located at the 50th position of the sequence shown in SEQ ID NO.2, and the polymorphism is A / C.

[0172] SEQ ID NO.1:

[0173] GAAATTTACTGGTTAGCGCCAGACATGCAGCTTATAGACAGGGGTTTTGGRCACCATGTTTATTTTTTTACTATAAATACACAGTGGGAAACTAAAATAAT, where R stands for A / G.

[0174] SEQ ID NO.2:

[0175] AAGTATGTGATAAGAGCTGCGGCAGGAGTTGGTCATCAGCTTGTCAAAAMCCCTCTTTCCAATTGATTGACAGTGCCACCAGGACGGCTTGCGAAACTA, where M represents A / C.

[0176] The information of the KASP primer set developed based on the above SNP molecular markers is shown in Table 5.

[0177] Table 5 Primers for KASP markers used for QTL effect verification Note: Lowercase letters gaaggtgaccaagttcatgct are the specific fluorescent tag sequence FAM; lowercase letters gaaggtcggagtcaacggatt are the specific fluorescent tag sequence HEX.

[0178] Example 2 Application of Maize Fusarium graminearum Stem Rot Resistance QTL and Its Tightly Linked Molecular Markers

[0179] The substance for detecting the polymorphism or genotype of a SNP molecular marker site closely linked to a QTL for resistance to Fusarium graminearum stalk rot in maize has at least the following applications:

[0180] (1) Identify or assist in identifying corn resistant to stalk rot;

[0181] (2) preparing products for identifying or assisting in identifying corn resistant to stalk rot;

[0182] (3) Corn assisted breeding or preparation of products for corn assisted breeding.

[0183] The method for identifying or assisting in identifying maize stalk rot resistance using molecular markers tightly linked to maize stalk rot resistance QTLs is as follows:

[0184] If the genotype of the molecular marker Ks1 in the tested corn is AA, the genotype of the target QTL locus is a disease-resistant gene; if the genotype of the molecular marker Ks1 in the tested corn is GG, the genotype of the target QTL locus is a disease-susceptible gene;

[0185] If the genotype of the molecular marker Ks3 in the tested maize is AA, the genotype of the target QTL locus is a disease-resistant gene; if the genotype of the molecular marker Ks3 in the tested maize is CC, the genotype of the target QTL locus is a disease-susceptible gene;

[0186] In summary, corn with the genotype of molecular marker Ks1 being AA and the genotype of molecular marker Ks3 being AA was selected as the stalk rot-resistant parent for breeding.

[0187] The SNP molecular markers developed in Example 1 were used to screen for maize stalk rot-resistant materials. The test materials were 214 recombinant inbred families in the RIL population except the target QTL fine-mapping family KHRIL-187. 55 recombinant inbred lines were screened out with homozygous genotypes at the Ks1 and Ks3 molecular markers. The phenotypic identification of stalk rot was carried out and it was found that when the genotypes of the molecular markers Ks1 and Ks3 were both homozygous disease-resistant alleles AA, 16 of the 20 recombinant inbred lines showed high resistance to stalk rot, with disease grade between 1.81 and 2.81, and the accuracy rate of stalk rot resistance identification was 80%; when only the molecular marker Ks1 was homozygous disease-resistant When the allele type was AA, 12 out of 24 recombinant inbred lines showed resistance to stem rot, including 9 families with high resistance to stem rot, with disease grades between 1 and 3, and the accuracy rate of stem rot resistance identification was 50%; when only the molecular marker Ks3 was the homozygous disease-resistant allele type AA, 5 out of 20 recombinant inbred lines showed high resistance to stem rot, with disease grade 1, and the accuracy rate of stem rot resistance identification was 25%; when the genotypes of the molecular markers Ks1 and Ks3 were both homozygous susceptible allele types GG and CC, 18 out of 23 recombinant inbred lines showed high susceptibility to stem rot, with disease grades of 6.83-8.51, and the accuracy rate of stem rot susceptibility identification was 78%. To expand the sample size, phenotypic values ​​from individual plants of 12 families were selected for screening maize stalk rot-resistant materials: KHRIL-102, KHRIL-149, KHRIL-154, KHRIL-199, KHRIL-168, KHRIL-148, KHRIL-68, KHRIL-205, KHRIL-204, KHRIL-176, KHRIL-099, and KHRIL-123. The identification results are shown in Table 6. Disease grading for individual families is expressed using BLUP values ​​from a multi-environment joint analysis, while disease grading for individual plants within a family is expressed using phenotypic values ​​from individual plants in the 2021SY environment. Statistical results for phenotypic identification accuracy are shown in Table 7.

[0188] Table 6 Alleles and phenotypes of molecular markers Ks1 and Ks3

[0189] Note: Ks1: AA (resistance allele), GG (susceptibility allele); Ks3: AA (resistance allele), CC (susceptibility allele).

[0190] Table 7 Identification accuracy of molecular markers Ks1 and Ks3 for stem rot resistance

[0191] Note: In estimating the accuracy of stalk rot resistance identification, recombinant inbred lines showing high resistance and resistance are considered resistant. Ks1: AA (resistance allele), GG (susceptibility allele); Ks3: AA (resistance allele), CC (susceptibility allele).

[0192] These results show that both SNP markers Ks1 and Ks3, which are tightly linked to the QTL, can be used to identify stalk rot resistance in maize. When Ks1 is used alone, the accuracy is approximately 50%; when Ks3 is used alone, the accuracy is approximately 25%; and when both markers are used together, the accuracy is 80%. These results indicate that the SNP markers Ks1 and Ks3 have a high accuracy for identifying stalk rot resistance in maize and are effective in assisting selection for stalk rot resistance phenotypes in maize.

[0193] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention. Industrial Applicability

[0194] The present invention provides a QTL for regulating corn stalk rot resistance, a tightly linked SNP molecular marker thereof, and applications thereof. The QTL for regulating corn stalk rot resistance provided by the present invention can be used to improve corn stalk rot resistance and breed stalk rot-resistant corn. The SNP molecular marker tightly linked to the corn stalk rot resistance QTL provided by the present invention can be used to identify corn stalk rot resistance with high accuracy, and can also be used for auxiliary breeding and germplasm resource improvement for corn stalk rot resistance, which is of great significance for improving the efficiency and breeding level of corn stalk rot resistance breeding, and has good economic value and application prospects.

Claims

1. A QTL regulating corn stalk rot resistance, characterized in that: The QTL is a DNA fragment located on chromosome 2 of maize. Referring to the B73 AGP_V3 genome, the DNA fragment contains the nucleotide sequence at positions 12360575-14116693 of chromosome 2 of maize.

2. Use of the QTL for regulating corn stalk rot resistance according to claim 1 in improving corn stalk rot resistance or in breeding stalk rot-resistant corn.

3. A method for breeding corn resistant to stalk rot, characterized in that: The method comprises the steps of making the maize chromosome contain the QTL regulating maize stalk rot resistance according to claim 1; Preferably, the method comprises the step of crossing corn comprising the QTL with corn not comprising the QTL.

4. A SNP molecular marker associated with corn stalk rot resistance, characterized in that: The SNP molecular markers include molecular marker Ks1 and / or molecular marker Ks3; Wherein, the molecular marker Ks1 contains a nucleotide sequence with a polymorphism of A / G at position 50 as shown in SEQ ID NO.1; The molecular marker Ks3 contains a nucleotide sequence with a polymorphism of A / C at position 50 as shown in SEQ ID NO.

2.

5. The SNP molecular marker associated with corn stalk rot resistance according to claim 4, characterized in that: The molecular marker Ks1 is obtained by PCR amplification using a primer set as shown in SEQ ID NO.3-5 and corn genomic DNA as a template; The molecular marker Ks3 is obtained by PCR amplification using a primer set with sequences as shown in SEQ ID NO.6-8 and corn genomic DNA as a template.

6. The SNP molecular marker associated with corn stalk rot resistance according to claim 4 or 5, characterized in that: In the molecular marker Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; In the molecular marker Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

7. A primer set, characterized in that: The primer set is used to amplify the SNP molecular marker associated with corn stalk rot resistance according to any one of claims 4 to 6; Preferably, the primer set includes primers having sequences shown as SEQ ID NOs. 3-5, and / or primers having sequences shown as SEQ ID NOs. 6-8.

8. A kit, characterized in that The kit comprises the primer set according to claim 7.

9. Any one of the following uses of the QTL regulating corn stalk rot resistance or the SNP molecular marker associated with corn stalk rot resistance according to claim 1, the primer set according to claim 7, or the kit according to claim 8: (1) Application in identifying or assisting in identifying resistance to corn stalk rot; (2) Application in the preparation of products for identifying or assisting in identifying resistance to corn stalk rot; (3) Application in early prediction of corn stalk rot resistance; (4) Application in screening corn resistant to stalk rot; (5) Application of molecular marker-assisted breeding for maize resistance to stalk rot; (6) Application in the preparation of products for molecular marker-assisted breeding of corn stalk rot resistance; (7) Application in improving maize germplasm resources resistant to stalk rot; in, The SNP molecular markers associated with corn stalk rot resistance include molecular marker Ks1 and / or molecular marker Ks3. The polymorphic site of the molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C.

10. A method for identifying corn stalk rot resistance, characterized in that: The method comprises: Using the genomic DNA of the maize to be identified as a template, PCR amplification of SNP molecular markers associated with maize stalk rot resistance was performed; Analyzing the genotype of the SNP molecular marker associated with corn stalk rot resistance in the PCR amplification product, and judging the stalk rot resistance of the corn to be identified according to the genotype; The SNP molecular marker associated with corn stalk rot resistance includes molecular marker Ks1 and / or molecular marker Ks3, the polymorphic site of the molecular marker Ks1 is located at position 12360575 of corn chromosome 2, and the polymorphism is A / G; the polymorphic site of the molecular marker Ks3 is located at position 14116693 of corn chromosome 2, and the polymorphism is A / C; Preferably, in the molecular marker Ks1, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is GG, corresponding to susceptibility to corn stalk rot; in the molecular marker Ks3, the genotype of the polymorphic site is AA, corresponding to resistance to corn stalk rot, and the genotype of the polymorphic site is CC, corresponding to susceptibility to corn stalk rot.

11. A method for obtaining a corn plant having increased resistance to stalk rot, characterized in that The method comprises the following steps: (1) A first corn plant is provided, which comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26; wherein said first corn plant is resistant to stalk rot; (2) hybridizing the first corn plant with the second corn plant to obtain a progeny plant; the second corn plant does not contain or contains the chromosome interval described in step (1); (3) Selecting progeny plants containing the chromosome interval of step (1) from the progeny plants by isolating nucleic acid from the progeny plants and detecting it in the nucleic acid, thereby obtaining corn plants with increased resistance to stalk rot.

12. A method for producing corn plants resistant to stalk rot, characterized in that The method comprises the following steps: (1) Isolating nucleic acids from corn plants; (2) detecting the SNP molecular marker according to any one of claims 4 to 6 in the nucleic acid; (3) selecting corn plants having stalk rot resistance based on the presence of the SNP molecular marker detected in step (2); The selection means selecting the corn plant when the genotype of the site with the polymorphism in the SNP molecular marker Ks1 in the isolated nucleic acid is AA; and / or, When the genotype of the site where the SNP molecular marker Ks3 in the isolated nucleic acid has the polymorphism is AA, the corn plant is selected.

13. A method for imparting resistance to corn stalk rot, characterized in that: The method comprises: 1) providing a nucleic acid molecule from a chromosome of corn having stalk rot resistance, and 2) inserting the nucleic acid molecule into a chromosome of a recipient corn, thereby producing a corn plant having increased stalk rot resistance compared to the recipient corn; The nucleic acid molecule comprises the nucleotide sequence at positions 12360575-14116693 of corn chromosome 2 or any part thereof, and the nucleic acid molecule can confer resistance to corn stalk rot.

14. A corn plant obtained by the method of any one of claims 3, 11, 12, and 13.

15. A corn plant, characterized in that The plant is obtained by hybridizing a first corn plant and a second corn plant, wherein the first corn plant comprises any of the following chromosome intervals in its genome: A nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.1, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.13, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.15, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.17, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.19, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.21, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.23, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.25, and / or The present invention comprises any of the following chromosomal intervals in its genome: a nucleotide sequence corresponding to the 50th base of the sequence shown in SEQ ID NO.2, or a nucleotide sequence corresponding to the 60th base of the sequence shown in SEQ ID NO.14, or a nucleotide sequence corresponding to the 70th base of the sequence shown in SEQ ID NO.16, or a nucleotide sequence corresponding to the 80th base of the sequence shown in SEQ ID NO.18, or a nucleotide sequence corresponding to the 90th base of the sequence shown in SEQ ID NO.20, or a nucleotide sequence corresponding to the 100th base of the sequence shown in SEQ ID NO.22, or a nucleotide sequence corresponding to the 150th base of the sequence shown in SEQ ID NO.24, or a nucleotide sequence corresponding to the 200th base of the sequence shown in SEQ ID NO.26; The first corn plant is resistant to stalk rot; The second corn plant contains none or any of the chromosome intervals described above.

16. The corn plant of claim 15, wherein: The chromosome interval contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.1, and / or contains a nucleic acid sequence that is at least 85%, at least 90% or at least 95% identical to the sequence shown in SEQ ID NO.2.

Images