Streptococcus salivarius subsp.thermophilus VB331 and use thereof

Abstract

Provided in the present invention are Streptococcus salivarius subsp.thermophilus VB331 and the use thereof. The strain is deposited at the China General Microbiological Culture Collection Center, with the deposit number of CGMCC NO.28407. The Streptococcus salivarius subsp.thermophilus can effectively inhibit the colonization, propagation and growth of various digestive tract pathogenic bacteria, including Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes and Shigella, and especially has a strong inhibitory effect on Clostridium perfringens. The strain is a natural strain, is very safe, and can provide a new source of probiotics for the development of antibacterial, bacteriostatic and other functional products against multiple harmful bacterial infections.

Description

Streptococcus salivarius thermophilic subspecies VB331 and its application Technical Field

[0001] The present invention belongs to the technical field of probiotics and their applications, and specifically relates to a strain of Streptococcus salivarius thermophilic subspecies VB331 and its application in antibacterial and bacteriostatic products, especially against Clostridium perfringens. Background Art

[0002] Bacterial infections pose significant health risks and result in a heavy economic burden. Traditionally, antibiotics are used to treat infections caused by harmful bacteria. However, with the overuse of antibiotics, bacterial resistance has become a growing public health concern, leading to restrictions or bans on their use in an increasing number of countries. Furthermore, antibiotics can kill both beneficial and harmful bacteria, disrupting the body's overall microbial balance and causing serious side effects. To address these limitations, researchers have been exploring alternative methods to control harmful microorganisms.

[0003] The universally accepted definition of probiotics is "live microorganisms that, when administered in adequate amounts, confer a beneficial effect on the host." The human gastrointestinal tract is the primary site where probiotics colonize and exert their effects. Probiotics carry out metabolic activities within the intestinal microenvironment, influencing numerous physiological processes in the body, including the metabolism of food and drug components, cell renewal, and immune responses. Research has shown that probiotics and probiotic preparations play a role in the prevention and treatment of various gastrointestinal diseases, including the treatment of diarrhea, prevention and treatment of Clostridium difficile infection, and reduction of oxidative damage.

[0004] Streptococcus salivarius subsp. thermophilus is a Gram-positive bacterium that belongs to the normal oral flora and is one of the two important strains used in yogurt fermentation. During its evolution, S. salivarius subsp. thermophilus lost all pathogenicity genes and adapted to a specific, narrow ecological niche, such as milk. This is considered a retrograde evolutionary adaptation to the food environment. Currently, S. salivarius subsp. thermophilus has received GRAS (Generally Recognized as Safe) certification in the United States and QPS (Qualified Presumption of Safety) certification in Europe. It is also one of the strains approved for use in food production and processing by the Ministry of Health of my country in Announcement No. 65 of 2010. Previous studies have shown that the health benefits of S. salivarius subsp. thermophilus include the production of antioxidant compounds, a reduced risk of certain types of cancer, anti-inflammatory and anti-mutagenic effects, and stimulation of the intestinal immune system.

[0005] Summary of the Invention

[0006] The present invention provides a Streptococcus salivarius subsp. thermophilus VB331 screened from adult saliva, which was deposited in the General Microbiology Center of the China Culture Collection Administration on September 8, 2023, with a deposit number of CGMCC NO.28407. Using adult saliva as the isolation source, the obtained strain has higher safety. The strain has been proven to have significant antibacterial and antibacterial activity, and can effectively inhibit the colonization, reproduction and growth of a variety of digestive tract pathogens, including Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes, Shigella, and especially has a strong inhibitory effect on Clostridium perfringens.

[0007] The thermophilic Streptococcus salivarius subspecies provided by the present invention is in the form of living cells, for example, the strain is in the form of bacterial culture fluid.

[0008] The thermophilic Streptococcus salivarius subspecies provided by the present invention is in the form of non-viable cells, for example, the strain is in the form of freeze-dried powder.

[0009] The thermophilic Streptococcus salivarius subspecies provided by the present invention can be used to prepare one or more of microbial preparations, medicines, health products, foods, beverages, additives, and feeds for preventing and treating harmful bacterial infections in the digestive tract, and preferably exerts preventive and therapeutic effects by inhibiting the colonization, reproduction, and growth of harmful bacteria in the digestive tract.

[0010] When targeting infections caused by harmful bacteria in the digestive tract, the harmful bacteria are one or more of Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes, Shigella and Clostridium perfringens, preferably Clostridium perfringens.

[0011] The present invention provides a composition comprising the above-mentioned Streptococcus salivarius subspecies thermophilus. The preparation may comprise additional probiotic materials and may further comprise prebiotic materials.

[0012] The composition provided by the present invention further comprises an ingestible carrier, which can be a pharmaceutically acceptable carrier, such as a capsule, tablet or powder; or a food, such as acidified milk, yogurt, frozen yogurt, milk powder, condensed milk, cheese sauce, condiment or beverage.

[0013] The thermophilic Streptococcus salivarius subspecies provided by the present invention can be subjected to anaerobic fermentation in a nutrient medium containing an assimilable carbon source and / or nitrogen source.

[0014] In the preferred technical solution, the assimilable carbon source is selected from starch, maltodextrin, glucose, sucrose, lactose, maltose, industrial molasses, glycerol, soybean oil, sorbitol, mannitol or any combination thereof; preferably glucose.

[0015] In the preferred technical solution, the assimilable nitrogen source is selected from yeast extract, yeast powder, yeast paste, soy lecithin, soybean cake powder, cottonseed cake powder, peanut cake powder, gluten powder, corn steep liquor, soybean meal, peptone, urea, ammonium salt, or any combination thereof; preferably, yeast extract.

[0016] In a preferred technical solution, the fermentation medium further comprises an inorganic salt, which is selected from one or a combination of trisodium citrate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, ammonium sulfate, calcium carbonate, ferrous sulfate, zinc sulfate, copper sulfate, sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, ferric chloride, and manganese sulfate; preferably dipotassium hydrogen phosphate and magnesium sulfate. Beneficial effects:

[0017] Clostridium perfringens is a facultative anaerobic Gram-positive bacterium. It is divided into seven toxin types, A to G, based on the toxins it secretes. It is widely distributed in the external environment and the intestines of most animals. It is also a conditionally pathogenic bacterium that is extremely pathogenic to both humans and animals. Type A Clostridium perfringens causes gas gangrene and food poisoning in humans. There have also been reports of type C Clostridium perfringens causing human food poisoning. Type G Clostridium perfringens causes necrotic enteritis (also known as enterotoxemia) in broiler chickens. The diseases caused by these pathogens are extremely harmful to animal production and human health.

[0018] The thermophilic Streptococcus salivarius subspecies VB331 provided by the present invention has been shown to possess significant antibacterial and antimicrobial activity, effectively inhibiting the colonization, reproduction, and growth of various digestive tract pathogens. This strain's broad-spectrum and highly effective antibacterial properties, particularly its potent inhibitory effect against Clostridium perfringens, make it suitable as a probiotic for the preparation of microbial preparations, pharmaceuticals, health products, foods, beverages, additives, and feeds for the prevention and treatment of harmful gastrointestinal bacterial infections.

[0019] Streptococcus salivarius thermophilic subspecies VB331 is a naturally occurring probiotic with broad-spectrum and highly effective antibacterial properties. It can exert a synergistic effect in the prevention and treatment of digestive tract bacterial infections, especially infections caused by Clostridium perfringens. It can safely and quickly restore gastrointestinal health, reduce the use of antibiotics, and avoid the side effects of antibiotic use.

[0020] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention.

[0021] Collection information:

[0022] Strain name: VB331

[0023] Deposit date: September 8, 2023

[0024] Depository: China General Microbiological Culture Collection Center (CGMCC)

[0025] Deposit number: CGMCC No.28407 BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments with reference to the following drawings, in which:

[0027] FIG1 is a comparison of the inhibition zone sizes of VB331 against different pathogens according to an embodiment of the present invention;

[0028] FIG2 is a neighbor-joining phylogenetic tree of the VB331 population constructed based on the 16S rDNA sequence according to an embodiment of the present invention, wherein ALIF_s K12, GL698454_s C150, and JN682090_s Brum 177 are all Streptococcus, which is translated as Streptococcus. DETAILED DESCRIPTION

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0030] Unless otherwise specified, the materials and reagents used in the following examples are all common commercial products and can be purchased on the market.

[0031] The MAGEN bacterial genomic DNA extraction kit was purchased from Shanghai Maigen Biotechnology Co., Ltd. Phusion high-fidelity DNA polymerase was purchased from Thermo Scientific.

[0032] The present invention will be further described below by way of examples, which are not intended to further limit the present invention. Those skilled in the art will appreciate that any equivalent substitutions or corresponding improvements made to the present invention are still within the scope of protection of the present invention.

[0033] In the culture medium used in the following examples, the percentage (%) used in the material ratio is by mass unless otherwise specified.

[0034] Example 1: Source of strains

[0035] Streptococcus salivarius subsp. thermophilus VB331 is isolated from adult saliva. Fresh saliva is collected from an adult and sterilized PBS buffer is added to a sterile container. After thorough vortexing, the strain is diluted and spread onto MRS solid culture medium plates. After 48 hours of incubation, individual colonies of varying sizes and morphologies are streaked onto a fresh plate. A single colony is then picked and placed on a slant. After incubation on the slant, the morphology of the colonies is examined microscopically. Identification is performed after the absence of contaminants. Using adult saliva as the isolation source results in a strain with enhanced safety, making it more suitable for use in the production of health products.

[0036] Example 2: Bacteria identification

[0037] The experiment was conducted according to the instructions in the Molecular Cloning Manual. After culturing the purified strain in MRS medium for one day, 1 mL of the culture was centrifuged at 10,000 rpm for 1 minute. The supernatant was discarded, and the cells were harvested for DNA extraction using the MAGEN Bacterial Genomic DNA Extraction Kit. Using the extracted DNA as a template, 16S rDNA was amplified by PCR (polymerase chain reaction) using universal primers 27F (5′AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′TACGGYTACCTTGTTAYGACTT 3′). The PCR reaction volume was 50 μL, and the reaction system and protocol were configured according to the Phusion High-Fidelity DNA Polymerase instructions. The annealing temperature was 55°C. The PCR product was sent to Shanghai Bioengineering for sequencing.

[0038] The 16S rDNA sequence measured by the strain was collated and compared with the sequences of related species and genera in the ECBioCloud database by BLAST to determine the taxonomic status of the strain. After comparison, it was found that its homology with Streptococcus thermophilus ATCC 19258 (T) was as high as 99.1%, and its homology with Streptococcus salivarius NCTC 8618 (T) was as high as 98.83%. Therefore, the strain was identified as a Streptococcus salivarius subsp. thermophilus strain. The internal number of this strain is VB331. It was deposited in the General Microbiology Center of the China Culture Collection Administration on September 8, 2022. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC NO.28407.

[0039] A k-mer frequency fingerprinting method was used. K-mers of length 16 were extracted from the 16S rDNA sequence and their occurrence counts were counted to generate a k-mer frequency fingerprint. Sequence similarities were calculated using cosine distance, and a phylogenetic tree was constructed (see Figure 2). VB331 showed very close relationships with Streptococcus thermophilus ATCC19258, Streptococcus salivarius NCTC8618, Streptococcus vestibularis ATCC49124, and ALIF_s-K12. Further association with Streptococcus porcorum 682-03 and several other bacterial species indicated a relatively close relationship between VB331 and these strains.

[0040] Example 3: Construction of a histone-coated cell-free DNA library

[0041] 1. Bacteria activation

[0042] Take the glycerol tube of the original VB331 strain, thaw it at room temperature, draw 0.1 ml of the bacterial suspension and inoculate it onto the MRS solid plate, spread it evenly, put the plate into an anaerobic bag, and culture it in a 37°C incubator for 48 hours to obtain activated single colonies.

[0043] 2. Seed Preparation

[0044] Take a single activated colony and scrape a loopful of it with an inoculating loop. Inoculate the loopful into a 500ml Erlenmeyer flask containing 100ml of MRS liquid medium. Wrap the flask in an anaerobic bag and incubate on a shaker at 37°C and 70 rpm for 48 hours. Ensure the OD value of the seed solution is ≥2.0. Adjust the pH of the MRS liquid medium to 7.0±0.2 before disinfection. Disinfection conditions: 121-123°C for 30 minutes.

[0045] 3. Fermentation Preparation

[0046] Inoculate the cultured seed liquid at a ratio of 3-5% (v / w) into a 500ml Erlenmeyer flask containing 100ml of MRS liquid medium. Wrap the flask in an anaerobic bag and incubate on a shaker at 37°C and 70 rpm for 24-48 hours, maintaining the fermentation broth at an OD value of ≥3.0. Adjust the pH of the MRS liquid medium to 7.0±0.2 before disinfection at 121-123°C for 30 minutes.

[0047] MRS liquid medium: 0.5% yeast extract, 1.0% peptone, 1.0% beef extract, 2.0% glucose, 0.2% dipotassium hydrogen phosphate, 0.2% diammonium hydrogen citrate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate (all percentages are by mass), 0.1% Tween 80 (volume / mass ratio). MRS solid medium: Add 1.5% agar powder to MRS liquid medium.

[0048] Example 4: Antibacterial activity

[0049] The optimized double-layer plate culture method was used to study the multimicrobial inhibition of Streptococcus salivarius subsp. thermophilus VB331, including the following steps:

[0050] Preparation of Streptococcus salivarius thermophilus subspecies VB331 in the lower layer: Thaw a frozen tube of activated single bacteria and inoculate it onto an MRS plate at pH 6.9. Incubate anaerobically at 37°C for 3 days. Inoculation volume: 2 μl / spot.

[0051] Preparation of the upper pathogenic bacteria layer: Sterilized Clostridium perfringens culture medium was cooled to 40-50℃, and Clostridium perfringens was inoculated to make the final concentration of the culture medium about 10 6 Add 7 ml of the culture medium per dish to a plate containing Streptococcus salivarius thermophilus subspecies VB331, wait for solidification, and culture anaerobically at 37°C for 1 day.

[0052] Sterilized LB medium was cooled to 40-50℃, and Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes and Shigella were added to the medium to make the final concentration of about 10 6 Add 7 ml of the culture medium per dish to the plate where Streptococcus salivarius thermophilus subspecies VB331 has grown, wait for it to solidify, and then culture it aerobically at 37°C for 1 day.

[0053] After the upper plate has grown, observe whether there is an inhibition zone around the thermophilic Streptococcus salivarius subspecies VB331 to determine whether it has antibacterial ability.

[0054] Clostridium perfringens culture medium: 1.5% tryptone, 0.3% beef extract, 0.5% sodium chloride, 1% glucose, 0.5% agar, pH 7.0. The experimental results are shown in Table 1:

[0055] Table 1: Inhibition zone test results of Streptococcus salivarius thermophilic subspecies VB331

[0056] Among them: the inhibition zone size of Escherichia coli (E.coli) is 26mm; the inhibition zone size of Staphylococcus aureus is 23mm; the inhibition zone size of Salmonella is 22mm; the inhibition zone size of Enterococcus is 17mm; the inhibition zone size of Listeria monocytogenes is 16mm; the inhibition zone size of Shigella is 14mm; the inhibition zone size of Clostridium perfringens is 40mm, which is the largest among all bacteria.

[0057] It can be clearly seen that VB331 has a significant inhibitory effect on harmful digestive tract bacteria such as Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes, Shigella and Clostridium perfringens, especially the inhibitory effect on Clostridium perfringens is particularly prominent.

[0058] 16S sequencing sequence of VB331:

[0059] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0060] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. A Streptococcus salivarius subsp. thermophilus VB331, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC NO.28407 and a deposit date of September 8, 2023.

2. The Streptococcus salivarius subsp. thermophilus according to claim 1, which is in the form of living cells.

3. The Streptococcus salivarius thermophilus subspecies according to claim 2, wherein the Streptococcus salivarius thermophilus subspecies is in the form of a bacterial culture solution.

4. The Streptococcus salivarius subspecies thermophilus according to claim 1, which is in the form of non-viable cells.

5. The Streptococcus salivarius subsp. thermophilus according to claim 4, wherein the Streptococcus salivarius subsp. thermophilus is in the form of a lyophilized powder.

6. A fermentation liquid, characterized in that: It is fermented by the thermophilic Streptococcus salivarius subspecies described in claim 1.

7. Use of the thermophilic Streptococcus salivarius subspecies according to any one of claims 1 to 5 or the fermentation broth according to claim 6, characterized in that: Used to prepare one or more of microbial preparations, medicines, health products, foods, beverages, additives, and feeds for preventing and treating harmful bacterial infections in the digestive tract.

8. The use according to claim 7, characterized in that The thermophilic subspecies of Streptococcus salivarius or the fermented liquid exerts preventive and therapeutic effects by inhibiting the colonization, reproduction and growth of harmful bacteria in the digestive tract.

9. The use according to claim 8, characterized in that The harmful bacteria in the digestive tract are at least one of Escherichia coli, Staphylococcus aureus, Salmonella, Enterococcus faecalis, Listeria monocytogenes, Shigella and Clostridium perfringens.

10. A composition comprising the Streptococcus salivarius subsp. thermophilus according to any one of claims 1 to 5.

11. A composition as claimed in claim 10 further comprising additional probiotic material.

12. The composition of claim 11 further comprising a prebiotic material.

13. The composition of claim 12, further comprising an ingestible carrier.

14. The composition of claim 13, wherein the ingestible carrier is a pharmaceutically acceptable carrier, such as a capsule, tablet or powder.

15. The composition of claim 13, wherein the ingestible carrier is a food, such as acidified milk, yogurt, frozen yogurt, milk powder, concentrated milk, cheese sauce, condiment or beverage.

16. A fermentation method of Streptococcus salivarius subsp. thermophilus according to any one of claims 1 to 5, characterized in that: The fermentation is carried out anaerobicly in a nutrient medium containing assimilable carbon source and / or nitrogen source.

17. The fermentation method according to claim 16, characterized in that: The assimilable carbon source is selected from starch, maltodextrin, glucose, sucrose, lactose, maltose, industrial molasses, glycerol, soybean oil, sorbitol, mannitol or any combination thereof.

18. The fermentation method according to claim 16, characterized in that: The assimilable nitrogen source is selected from yeast extract, yeast powder, yeast extract, soybean lecithin, soybean cake powder, cottonseed cake powder, peanut cake powder, gluten powder, corn steep liquor, soybean meal, peptone, urea, ammonium salt or any combination thereof.

19. The fermentation method according to claim 16, characterized in that: The fermentation medium also includes an inorganic salt, which is selected from one of trisodium citrate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, ammonium sulfate, calcium carbonate, ferrous sulfate, zinc sulfate, copper sulfate, sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, ferric chloride, manganese sulfate, or any combination thereof.

Images