Pest management

Abstract

The present disclosure relates to genetically modified insects or arachnids whose genome comprises at least one exogenous nucleic acid sequence that encodes a peptide or polypeptide that disrupts ion channel function as well as uses of the insects or arachnids for effecting reduction in the population of mated females.

Description

[0001] PEST MANAGEMENT

[0002] REFERENCE TO PRIORITY APPLICATION

[0003] The present application claims priority from Australian provisional application AU2023903662 filed 14 November 2023, the entire contents of which are incorporated by reference herein.

[0004] REFERENCE TO SEQUENCE LISTING

[0005] The entire content of the electronic submission of the sequence listing is incorporated by reference in its entirety for all purposes.

[0006] All documents cited or referenced herein, and all documents cited or referenced in herein cited documents, together with any manufacturer’s instructions, descriptions, product specifications, and product sheets for any products mentioned herein or in any document incorporated by reference herein, are hereby incorporated herein by reference in their entirety.

[0007] FIELD

[0008] The present disclosure relates to genetically modified insects or arachnids whose genome comprises at least one exogenous nucleic acid sequence that encodes a peptide or polypeptide that disrupts ion channel function as well as uses of the insects or arachnids for effecting reduction in the population of mated females.

[0009] BACKGROUND

[0010] Invasive insect species are a growing threat to agriculture, human health, and ecologies around the world. Rates of arboviral diseases spread by the Aedes aegypti mosquito, including dengue, Zika, chikungunya, and yellow fever, are reaching unprecedented levels due to increased global trade and warming climates. Dengue virus alone causes 390 million human infections each year and is now considered the most common vector-borne viral infection worldwide. The comprehensive annual economic costs of agricultural insect pests are estimated at a minimum of US$70 billion globally for non-native insect species, with current estimates of annual losses for major food crops ranges between 20-30% due to pests and pathogens. There are over 50,000 invasive species in the United States alone, which have resulted in more extinctions of native species than any other cause, as well as resulting in US$120 billion in damages and control measures annually.

[0011] Pesticides are the first line of defense against many invasive species and are instrumental in efforts to control the spread of vector-borne illness and mitigate damages to agriculture and the environment. However, over-reliance on insecticides has resulted in widespread emergence of resistances across many species to a growing number of classes of insecticides. Over-application of insecticides has also resulted in non-target species to decline in number and are responsible for many other environmental and human-health concerns. Modern integrated pest-management is trending towards reducing reliance on chemical insecticides, in favour of other management techniques.

[0012] One alternative that is likely to see wide-spread adoption soon is genetic biocontrol, defined as the release of organisms which have been genetically altered to reduce the spread and harm caused by a target species. Early genetic biocontrol technologies (GBT) such as the sterile insect technique (SIT) released mass numbers of males which had been radiologically sterilized, thereby reducing the reproductive potential of wild females they mated with. More modern GBT such as Release of Insects carrying a Dominant Lethal (RIDL) and gene drives function by propagating alleles throughout a population which reduce the fitness of future generations. These second generation GBT have proven to be more effective at suppressing and eradicating pest populations in a shorter period of time with far fewer males required for release. Though as powerful as modern GBT have proved to be, they are not without their limitations.

[0013] Fundamentally, as these technologies function by either disrupting female reproductive potential or offspring fitness, they require a minimum of a generation to take effect on the target population, and often much longer until substantial mitigation of the harm from a pest outbreak is observed. Current GBT are highly effective at population suppression, but their success is measured in generations and may take months or years. For the purposes of long-term population control this is acceptable, but a more rapid response to seasonal outbreaks of disease vectors is required to reduce the spread of arboviruses and avert the risk of an epidemic.

[0014] The rise in insecticide resistance has increased the need for alternative pest management strategies. Current genetic biocontrol methods are limited in their ability to rapidly respond to seasonal outbreaks, as they function by impacting the fitness or skewing the sex of offspring-suppressing future generations but leaving females to continue to spread disease or damage crops.

[0015] SUMMARY

[0016] The present disclosure is based on an intragenerational genetic biocontrol technology (GBT) approach of regulating insect populations utilising insect culling by uxoricidal semen (InCuBUS). This technology is referred to herein as “Toxic Male Technique (TMT)”. More specifically, the invention is based on expressing at least one recombinant ion channel disrupting peptide or protein, more preferably an ion channel specific venom peptide, within the accessory glands of the male reproductive tract of an insect and, following mating with a female, transmits the venom to the female resulting in a substantial reduction in the lifespan of the female insect.

[0017] In one aspect, there is provided an expression vector comprising at least one exogenous peptide or protein that disrupts ion channel function operatively linked to a promoter and a signal sequence for expression and secretion of the peptide or protein from the reproductive tract of a male insect or arachnid. In one example, the peptide or protein is secreted into the seminal fluid from the accessory glands of the male insect or arachnid.

[0018] In some examples, the peptide or protein that disrupts ion channel function is a venom peptide. In some examples, the peptide or protein that disrupts ion channel function is an insecticidal or pesticidal protein. In some examples, the peptide or protein is an insecticidal protein derived from and antibody. In some examples, the insecticidal peptide or protein triggers an immune response or apoptosis.

[0019] In one example, the peptide or protein disrupts ion channel function in one or more organs of the female insect or arachnid following insemination by the male insect or arachnid.

[0020] In some examples, accessory gland specific expression is conferred by linking an operator and minimal promoter to the peptide or protein encoding gene whose expression is regulated by a transcriptional activator and the accessory gland specific promoter. In some examples, expression is regulated by exposure to a small molecule (e.g. tetracycline).

[0021] In some examples, the vector further comprises a signal sequence which is operatively linked to the peptide or protein that disrupts ion channel function. In some examples, the signal sequence facilitates secretion of the peptide or protein. In some examples, the signal sequence encodes a sequence selected from the group consisting of ovulin (Acp26Aa), Acp29AB, Acp36DE or Acp53Ea. In one example, the signal sequence encodes the ovulin secretion signal. In a further example, the ovulin signal peptide comprises the sequence

[0022] ATGAACCAGATTTTATTATGCTCTCCAATTTTACTGCTGCTTTTTACAGTGGCA (SEQ ID NO:8). However, the skilled person would appreciate that signal sequences from other insect or arachnid seminal fluid proteins could be utilized in the present vectors. Insect seminal fluid proteins are described, for example in Avila F et al., (2011) Annu Rev Entoml. 56:21-40.

[0023] In some examples, the vector may further comprise a gene encoding a phenotype characteristic of the insect or arachnid. In one example the sequence encodes a phenotype selected from eye color, body color, eye morphology, or morphology of extremities, e.g. wings, body setae, or body colour.

[0024] In some examples, the vector further comprises an upstream activating system (UAS) that supports transcription of the ion channel peptide or protein in the accessory glands. In one example, the UAS is present in up to 20 copies. In some examples, the UAS is present in 10 copies, or 5 copies. In one example, the UAS is located upstream of the promoter. In another example, the UAS comprises a binding site for a transcriptional activator. Examples of UAS constructs most used for conditional expression in Drosophila include pUAST and pUASp. Suitable vectors comprising UAS are known in the art, including the pJFRC81 vector (Pfeiffer BD et al., (2012) PNAS Apr 9 10:1073).

[0025] In some examples, the vector comprises a tetracycline repressor system wherein transcription of the ion channel peptide or protein is induced in the absence of tetracycline.

[0026] In some examples, the peptide or protein is a venom peptide selected from p-AGTX-Aa1 d (SEQ ID NO:1), F-CNTX-Pn1 a (SEQ ID NO:2), 6-CNTX-Pn1 a (SEQ ID NO:3), K-HXTX-HV1 C (SEQ ID NO:4), u>HXTX-Hv1a (SEQ ID NO:5), u>HXTX-Hv2a (SEQ ID NO:6) and 6-AITX-Avd2a (SEQ ID NOT). In a particular example, the venom peptide is <5-AITX-Avd2a (SEQ ID NO:7).

[0027] In some examples, the vector comprises two or more peptides arranged in tandem separated by one or more 2A self-cleaving peptides. In some examples, the peptides are connected by a linker sequence which are known the art, e.g. GS linker.

[0028] In some examples, the peptide exhibits a low lethal dose (LD50) in the insect and no measurable LD50 for mammals. Without wishing to be bound by theory, a low insect molecular weight (MW) is thought to increase the likelihood of the peptide (e.g. venom peptide) entering the haemolymph of mated females.

[0029] In some examples, the venom peptide is selected from one or more of an agatoxin, a ctenitoxin, a hexatoxin, or an actitoxin or a combination thereof. In some examples, the venom peptide is derived from a species selected from Agelenopsis, Phoneutria, Hadronyche and Anemonia. However, the skilled person will appreciate that the venom peptide could be obtained from a different species so long as the peptide is selective for an insect ion channel, more particularly an insect ion channel of the target female insect or arachnid.

[0030] In some examples, the peptide or protein is an insecticide. For example, the peptide or protein is generated from an antibody raised against an insect or arachnid ion channel. Thus, in some examples, the peptide or protein is an antibody mimetic or antigen-binding molecule e.g. single domain polypeptide.

[0031] In some examples, the peptide or protein is codon optimized for expression in the insect or arachnid.

[0032] In another example, expression of the peptide or protein that disrupts ion channel function is driven by galactose-responsive transcription factor (GAL4) binding to the upstream activating sequence (UAS). In another example, the GAL4 driver is located on a separate expression system. In one example the GAL4 driver sequence has no biological activity in the insect or arachnid. In one example, the GAL4 sequence is derived from yeast. In one example, the GAL4 sequence is that described in Laughon A et al., (1984) Molecular and Cellular Biology 4(2):260.

[0033] The disclosure also provides a genetically modified male insect or arachnid, comprising: a genome including at least one first nucleic acid sequence encoding at least one exogenous peptide or protein that disrupts ion channel function, the expression of the first exogenous nucleic acid sequence leading to an ion channel peptide or protein in the genetically modified insect or arachnid, wherein the ion channel peptide or protein is secreted into the seminal fluid of the male insect or arachnid.

[0034] In one example, expression of the first exogenous nucleic acid sequence leads to a functional peptide or protein in the accessory glands of the genetically modified insect or arachnid. In one example, the ion channel peptide or protein is only functional in the female insect or arachnid when cleaved by a protease in the female reproductive tract.

[0035] In one example, the at least one exogenous peptide or protein that disrupts ion channel function is a venom peptide described herein.

[0036] In one example, the expression of the at least one exogenous nucleic acid sequence in the insect or arachnid is in the male accessory glands.

[0037] In one example, the genetically modified insect is Drosophila, Aedes, Spodoptera or Anopheles.

[0038] In one example, the genetically modified arachnid is Arachnida (e.g. mite, scorpion, tick or spider).

[0039] In one example, the expression of the first at least one exogenous DNA sequence encoding at least one exogenous peptide or protein that disrupts ion channel function is under the control of one or more of an accessory gland specific GAL4:UAS expression system. In one example the GAL4:UAS expression system comprises an antr-GAL4 or an Act5C-GAL4.

[0040] In some examples, the genome of the genetically modified insect or arachnid comprises at least one second exogenous DNA sequence encoding including at least one fluorescent protein selected from the group consisting of GFP, CFP, YFP, mCherry, dsRed, and variants thereof. In some examples the second exogenous nucleic acid is located downstream from the sequence encoding the venom peptide or polypeptide.

[0041] The disclosure also provides, a method for generating a genetically modified male insect or arachnid, comprising: inserting a first exogenous nucleic acid sequence encoding at least one exogenous peptide or protein that disrupts ion channel function into an expression vector to obtain a vector comprising the first exogenous DNA sequence; introducing the vector comprising the first exogenous DNA sequence into an insect or arachnid to obtain a stable strain of a transgenic precursor insect or arachnid; and crossing the transgenic precursor insect or arachnid with an insect or arachnid respectively comprising an expression system matched with the expression vector to obtain a genetically modified insect or arachnid with a peptide or protein that disrupts ion channel function.

[0042] In one example, expression of the first exogenous nucleic acid sequence leads to a functional peptide or protein in the accessory glands of the genetically modified insect or arachnid. In one example, the ion channel peptide or protein is only functional in the female insect or arachnid when cleaved by a protease in the female reproductive tract.

[0043] In one example, the at least one exogenous peptide or protein that disrupts ion channel function is a venom peptide described herein. In one example, the genetically modified insect is Drosophila, Aedes, Spodoptera or Anopheles.

[0044] In one example, the genetically modified arachnid is arachnida (e.g. mite, scorpion, tick or spider).

[0045] In some examples, the insect or arachnid comprising the expression system matched with the vector is a female.

[0046] In some examples, the expression system is GAL4 / UAS. In some examples, the matched expression system comprises a GAL4 expression system. In some examples, the genetically modified insect is a Drosophila and the insect comprising the expression system matched with the expression vector is a GAL4 Drosophila line. Suitable GAL4 Drosophila lines are known in the art and include Drosophila strains RRID:BDSC_4414 and RRID:BDSC_79324 described herein.

[0047] In some examples, a temperature sensitive GAL4 repressor (e.g Ga / 80ts) can be co-expressed that that GAL4-induced expression is active only during periods when the insects are shifted to 30 °C. In another example, a GeneSwitch system can be used (Nicholson et al., (2008) Genetics 178(1):215) in which tissue-specific GAL4 lines which are inactive under normal conditions are activated by supplementing the food with the steroid hormone mifepristone. In another example, the SplitGAL4 system can be used in which GAL4 is split into two halves which are expressed by two independent enhancers, so that only the very refined set of insects in which there is coincident expression of both halves show GAL4 activity.

[0048] In one example, the peptide or protein disrupts ion channel function in one or more organs of the female insect or arachnid following mating with the male insect or arachnid respectively.

[0049] In another example, the peptide or protein becomes functional only after entering the female reproductive tract. This example is achieved by engineering the peptide or protein to be in a form that is cleavable, for example by a protease. Thus, in one example, the peptide or protein comprises a sequence that can be cleaved by a protease present in the seminal fluid. Such proteases are described, for example in LaFlamme BA et al., (2012) PLoS Genet 8(1):e1002435.

[0050] For most, if not all genetic crosses the female insects are preferably virgins. This is because females, especially flies store sperm and thus the paternity of any offspring becomes uncertain when a male is subsequently introduced to the female. In some examples, the females are kept in groups, e.g. 10 flies per tube to ensure that there are no larvae on the media / food before crossing to the males. In some examples the virgins are sourced from a GAL4 driver stock that can be expanded to supply females for crosses. In some examples, the females are maintained at 25°C.

[0051] In another aspect, there is provided a method of selective control or suppression of female insects or arachnids in a population of insects or arachnids comprising male and female insects or arachnids respectively, the method comprising:

[0052] (i) preparing a genetically modified male insect or arachnid as described herein; (ii) releasing the genetically modified male insect or arachnid into an environment comprising a population of female insects or female arachnids respectively; and

[0053] (Hi) allowing the genetically modified male insects or arachnids to copulate with the female insects or arachnids respectively so that the females are inseminated with the expressed peptide or protein secreted from the male accessory glands.

[0054] In some examples, in step (iii) allowing the genetically modified male insects or arachnids to copulate with the female insects or arachnids respectively so that the females are envenomated with the expressed venom peptide secreted from the male accessory glands.

[0055] In some examples, the method further comprises wherein the median lifespan of the female insects or arachnids is suppressed.

[0056] In some examples, selective suppression includes eliminating the female insects or arachnids. In some examples, the suppression comprises reducing the female insect or arachnid population by at least about 80, at least about 70%, or at least about 60%. In some examples, the suppression comprises a reduction in the median lifespan of the female insects or arachnids by about 50%, about 45%, about 30%, about 35%, about 25% or about 20% compared to non-mated females.

[0057] In some examples, the female insect or arachnid is a virgin.

[0058] The methods described herein also comprise releasing the genetically modified male insects or arachnids into an environment in which female insects or arachnids are present. Such an environment may include a household, a park, a residential area, an urban area, an agricultural area or wilderness area. In some examples, the method is repeated to achieve a desired level of control or suppression of the female insects or arachnids.

[0059] In some examples, the insect is an insect that damages crops. In another example, the insect is an insect that causes disease in a mammal e.g. a human.

[0060] In some examples, the insect is of the order Diptera, Lepidoptera, Coleoptera, Hemiptera, Homoptera, Dermaptera, Orthptera, Arachnida, Neuroptera, or Hymenoptera. In some examples, the insect is a species of one or more of Drosophila, Anopheles, Pectinophora, Anastrepha, Aedes, or Bombyx. In a particular example, the insect is Aedes aegypti.

[0061] A particular advantage of the present disclosure is that the methods described herein do not require sterilization of male insects or arachnids. Furthermore, by selecting a target of the venom protein that is not expressed in the male reproductive tract, this allows the genetically modified male insects or arachnids to maintain viability.

[0062] DESCRIPTION OF THE FIGURES

[0063] Figure 1 shows a diagrammatic representation of the UAS:GAL4 system and venom production in the accessory glands of Drosophila. Figure 2 shows a) a diagrammatic representation of the venom peptide expression construct and b) shows the GAL4 construct driven by the antr promoter.

[0064] Figure 3 shows specific expression of UAS:mCherry reporter in the accessory glands of male D. melanogaster regulated by the antr-GAL4 driver, observed under brightfield microscopy. Fluorescence microscopy was used to confirm tissue and developmental specific expression of the mCherry protein as regulated by various accessory gland GAL4 drivers.

[0065] Figure 4 shows survival probability of wild type female D. melanogaster after initial exposure to wildtype males orTMT males expressing f-CNTX-Pn1a or <5-AITX-Avd2a venom proteins in their accessory glands. Females were exposed to males at an equal sex ratio (a), or with males at a three-fold excess (3:1 male-to-female ratio) (b). Data are presented as Kaplan-Meier survival probability estimates with 95% Greenwood confidence intervals (indicated by the shaded area). The dashed lines indicate median time to 50% survival.

[0066] Figure 5 shows longevity of male D. melanogaster expressing f-CNTX-Pn1a or <5-AITX-Avd2a venom proteins in their accessory glands compared to wild-type and negative control (NbVHH05) strains. Data are presented as Kaplan-Meier survival probability estimates with 95% Greenwood confidence intervals (indicated by shaded areas). The dashed lines indicate time to 50% survival.

[0067] Figure 6 shows agent-based models simulating Ae. aegypti population control programs with SIT, fsRIDL, TMT, or no transgenic male releases, (a) The size of the female population during the release period relative to initial conditions. 50% reduction in the female population is indicated by the dashed line, (b) The cumulative number of biting events which occurred throughout the releases. Data are presented as the mean of 10 simulations + / - the maximum and minimum values respectively observed at a given time point (indicated by the shaded area).

[0068] Figure 7 shows a diagrammatic representation of the tet system.

[0069] KEY TO SEQUENCE LISTING

[0070] SEQ ID NO:1 : amino acid sequence of venom peptide from North American Funnel-web spider.

[0071] SEQ ID NO:2: amino acid sequence of venom peptide from Brazilian armed spider.

[0072] SEQ ID NO:3: amino acid sequence of venom peptide from Brazilian armed spider.

[0073] SEQ ID NO:4: amino acid sequence of venom peptide from Blue mountains funnel web spider.

[0074] SEQ ID NO:5: amino acid sequence of venom peptide from Blue mountains funnel web spider.

[0075] SEQ ID NO:6: amino acid sequence of venom peptide from Blue mountains funnel web spider.

[0076] SEQ ID NO:7: amino acid sequence of venom peptide from Mediterranean snakelocks sea anemone.

[0077] SEQ ID NO:8: nucleic acid sequence of the ovulin secretion signal peptide. SEQ ID NO:9: amino acid sequence of T2A peptide.

[0078] SEQ ID NO:10: amino acid sequence of P2A peptide.

[0079] SEQ ID NO:11 : amino acid sequence of E2A peptide.

[0080] SEQ ID NO:12: amino acid sequence of F2A peptide.

[0081] SEQ ID NO:13: amino acid sequence of the ovulin signal peptide.

[0082] DETAILED DESCRIPTION

[0083] General techniques and definitions

[0084] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0085] Unless otherwise indicated, the recombinant protein, cell culture, and techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd edn, Cold Spring Harbour Laboratory Press (2001), R. Scopes, Protein Purification - Principals and Practice, 3rd edn, Springer (1994), T.A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D.M. Glover and B.D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F.M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J.E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0086] The term “and / or”, e.g., “X and / or Y” shall be understood to mean either “X and Y” or “X or Y” and shall be taken to provide explicit support for both meanings or for either meaning.

[0087] As used herein, the terms “a”, “an” and “the” include both singular and plural aspects, unless the context clearly indicates otherwise.

[0088] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

[0089] Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

[0090] Each example described herein is to be applied mutatis mutandis to each and every other example of the disclosure unless specifically stated otherwise.

[0091] Those skilled in the art will appreciate that the disclosure is susceptible to variations and modifications otherthan those specifically described. It is to be understood that the disclosure includes all such variations and modifications. The disclosure also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.

[0092] The present disclosure is not to be limited in scope by the specific examples described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the disclosure.

[0093] Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.

[0094] The term ‘‘about’’, as used herein when referring to a measurable value such as an amount of weight, time, dose, etc. is meant to encompass variations of ±20% or±10%, more preferably ±5%, even more preferably ±1 %, and still more preferably ±0.1% from the specified amount, as such variations are appropriate to perform the disclosed method.

[0095] The term ‘‘accessory gland’’ is also referred to as male accessory gland (MAG) and is intended to refer to an internal reproductive organ responsible for the synthesis and secretion of seminal fluid components.

[0096] The term ‘‘recombinant’’ as used herein in the context of a polynucleotide means a polynucleotide of genomic, cDNA, semisynthetic and / or synthetic origin which by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term recombinant as used herein in the context of a polypeptide means a polypeptide produced by expression of a recombinant polynucleotide.

[0097] The term ‘‘heterologous’’ as used herein is understood to mean any DNA sequence which does not occur naturally in the insect in question., without genetic modification of the insect, and which is transferred from another organism into the genome of the insect where it is stably incorporated. The term ‘‘exogenous’’ may be used interchangeably with heterologous.

[0098] By ion channel peptide or protein it is meant an amino acid sequence which binds to an ion channel receptor which is a transmembrane receptor which is a key player in neurotransmission. Relevantly, the peptide or protein is a modulator or inhibitor of ion channel function. By “disrupts ion channel function’’ it is intended to refer to modulation, inhibition or blocking of an ion channel opening and thereby affecting the transport of ions such as Na+, K+, Ca2+ or Cl- through the ion channel.

[0099] By “venom peptide’’ it is meant an amino acid sequence of a non-enzymatic polypeptide in the venom which fold into monomeric domains that are smaller than 80-100 residues.

[0100] A “genetically modified insect or arachnid’’ is understood to mean an insect or arachnid, the genetic material of which has been specifically modified by means of genetic methods. Suitable transgenic insects include Drosophila. To obtain such a genetically modified insect or arachnid, vectors containing a specific foreign gene are introduced into a fertilized egg. The progenies obtained are transfected with a certain probability and can be subsequently screened for the foreign gene. The transgenic insect or arachnid can also be obtained by specific crossing. Furthermore, the transgenic insect or arachnid can also be obtained by introduction of a transgene into the insect or arachnid and subsequent crossing with a further insect or arachnid respectively which may be genetically modified. According to the disclosure, the transgenic insect or arachnid can be obtained by all methods known in the prior art for modifying genes in organisms.

[0101] The term “arachnid’’ as used herein is intended to referto a any member of the arthropod group which have four pairs of legs that are jointed and used for walking. Examples of arachnid include mite, scorpion, tick or spider. The term “insect’’ as used herein refers to a small arthropod animal that has six legs and one or two pairs of wings. Examples include bedbugs, house flies, moths, beetles, aphids, mosquitoes, fleas, horseflies, and hornets.

[0102] Venom peptides

[0103] The present disclosure utilizes venom peptides or proteins that specifically bind to an insect ion channel. Ion channels are a diverse class of membrane proteins that play critical roles in cellular physiology, underlying such essential processes as neuronal signaling and muscle contractility (Catterall WA et al., (1995) Annu. Rev. Biochem. 64,493-531). Key ion channel targets of venom peptides include voltage-gated potassium, sodium and calcium channels. Venom proteins are preferably selected from snakes, scorpions, spiders, cone snails, and sea anemones. The peptides are typically less than 100 amino acids and can comprise one or more disulfide bonds. Suitable peptides are available from third party suppliers. Venom peptides suitable for use are described in Table 1 or in for example, WO 2006 / 130161 , EP3472192, Wo 2023 / 067491 , EP2623111 , WO 2023 / 067366, US 2023 / 0287049 and US 2011 / 0065647.

[0104] A list of venom-derived peptide modulators of cation channels can be found in Table 1 of Bajaj S et al., (2019) Frontiers in Pharmacology, volume 10, article 58. Recombinant vectors

[0105] Heterologous nucleic acids encoding venom peptides are preferably present within a vector or plasmid which is expressed in the accessory glands of the male insect. Suitable backbone vectors are known in the art and include, for example pJFRC81 (Addgene), or other vectors from Addgene such as pJC-20xUAS-TALE-VP64-P10 (#104605) or other commercial sources including GenScript, SnapGene or ThermoFisher Scientific. Bactulovirus vectors may also be used. Alternatively, a GAL4 containing cloning vector can be used such as described in Raycroft L et al., (1992) Gene 1 ;118(1 ):143.

[0106] Regulatory sequences including transcriptional promoters, enhancers, initiation signals or secretion signals may also be present. The purpose of introducing the nucleic acid molecules may be to produce a transgenic insect which is able to express and secrete the peptide venom sequence in the seminal fluid of the host. Technology for the production of transgenic insects are known in the art and described in, for example, as described in Transgenic insects: techniques and applications, M. Q. Benedict ISBN: 978-1-78639-543-6 (2014).

[0107] In a preferred example, the expression of the heterologous nucleic acid in the insect is tissue specific, more preferably specific for the accessory glands of the insect.

[0108] In some examples, expression of the heterologous nucleic acid is underthe control of a tissuespecific GAL4 / UAS expression system, especially an accessory gland specific GAL4 / UAS expression system. In another example, the heterologous nucleic acid can be expressed with the aid of the Q system (Potter et al., (2010) Cell vol. 141 (3):536). What is provided by the GAL4 / UAS system is a genetic tool which allows the expression of foreign genes in specifically selected cells or tissues. Two modules are used. Firstly, the GAL4 gene activator of the baker’s yeast (Saccharomyces cerevisiae) is cloned underthe control of specific regulatory elements. GAL4 encodes a yeast specific transcription factor, the expression of which is under the control of a tissue-specific promoter from the insect. The other module contains the nucleic acid sequence encoding the venom peptide under control of the UAS elements (upstream activating sequences), the target sequences of the GAL4 gene regulator. The specific binding of the GAL4 to the so-called UAS ensures the activation of the downstream gene of interest (e.g.. encoding the venom peptide). By crossing GAL4 lines and those lines bearing the gene of interest it is possible to produce such systems.

[0109] The GAL4 / UAS system is advantageously applicable to insects, especially in Drosophila. According to the present disclosure, GAL4 lines which express in tissue-specific manner can be used to obtain a transgenic / genetically modified insect described herein. The GAL4 is, then, only expressed in the specific tissues.

[0110] The vector or plasmid may comprise a single venom peptide or multiple venom peptides expressed from the same or different promoters. The venom peptides may be joined by a linker sequence known in the art, for example a sequence encoding a GS linker. The venom peptides may be expressed together separated by one or more 2A self-cleaving sequence known in the art (as described for example in Liu Z et al., (2017) Scientific Reports 7(1):2193), for example a sequence encoding a T2A peptide having the sequence EGRGSLLTCGDVEENPGP (SEQ ID NO:9). Other suitable peptides include P2A having the sequence ATNFSLLKQAGDVEENPGP (SEQ ID NO: 10); E2A having the sequence QCTNYALLKLAGDVESNPGP (SEQ ID NO:11); and F2A having the sequence VKQTLNFDLLKLAGDVESNPGP (SEQ ID NO:12). The 2A peptide may optionally comprise a GSG (Gly-Ser-Gly) linker at the N-terminus of the peptide. In some examples, the venom peptide is codon optimized for expression in the insect.

[0111] In some examples, a nucleic acid sequence encoding a signal peptide to facilitate secretion of the expressed venom peptide is included. In some examples, the signal sequence is provided upstream of the venom peptide sequence. Suitable signal / secretion sequences will be known in the art. The signal sequence may be derived from a sequence that is native to the host insect or from a sequence exogenous to the insect. The signal sequence may be derived from any male accessory gland protein such as ovulin (Acp26Aa), Acp29AB, Acp36DE orAcp53Ea (Clark AG, et al., (1995) Genetics 139, 189— 201).

[0112] In a further example, the genome of the genetically modified insect comprises at least one second exogenous DNA sequence encoding a fluorescent protein, especially a fluorescent protein selected from GFP, CFP, YFP, mCherry, dsRed or variants thereof. In this example, it is advantageously possible, as a result of the fluorescence of the particular proteins which can be specifically expressed in the particular tissues, to be able to directly observe the spatial and temporal distribution of the protein in the insect. For example, the fluorescent protein can be used as a marker for a protein, for example a venom peptide or for visualizing the tissue in which the venom protein is expressed. Here, the first exogenous or heterologous DNA sequence encoding the venom peptide or protein can be connected to the second exogenous DNA sequence encoding the fluorescent protein. The proteins and hence the biological processes can thus be visualized in vivo, for example by means of fluorescence microscopy or confocal laser scanning microscopy. Suitable fluorescent proteins include inter alia, the following UV proteins such as, for example, Sirius, Sandercyanin, shBFP-N158S / L173l; blue proteins such as, for example, Azurite, EBFP2, mKalamal, mTagBFP2, TagBFP, shBFP; cyan proteins such as, for example, ECFP, Cerulean, mCerulean3, SCFP3A, CyPet, mTurquoise, mTurquoise2, TagCFP, mTFP1 , monomeric Midoriishi Cyan, Aquamarine; green proteins such as, for example, TurboGFP, TagGFP2, mUKG, Superfolder GFP, Emerald, EGFP, monomeric Azami Green, mWasabi, Clover, mNeonGreen, NowGFP, mClover3; yellow proteins such as, for example, TagYFP, EYFP, Topaz, Venus, SYFP2, Citrine, Ypet, lanRFP-AS83, mPapayal , mCyRFPI ; orange proteins such as, for example, monomeric Kusabira Orange, mOrange, mOrange2, ITIKOK, mKO2; red proteins such as, for example, TagRFP, TagRFP-T, mRuby, mRuby2, mRuby3, mTangerine, mApple, mStrawberry, FusionRed, mCherry, mNectarine, mScarlet, mScarlet-l; dark red proteins such as, for example, mKate2, HcRed-Tandem, mPlum, mRaspberry, mNeptune, NirFP, TagRFP657, TagRFP675, mCardinal, mStable, mMaroonl , mGarnet2; near IR proteins such as, for example, iFP1 .4, iRFP713 (iRFP), iRFP670, iRFP682, iRFP702, iRFP720, iFP2.0, mIFP, TDsmURFP, miRFP670; sapphire-type proteins such as, for example, Sapphire, T-Sapphire, mAmetrine; or long Stokes shift proteins such as, for example, mKeima, mBeRFP, LSS-mKate1 , LSS-mKate2, LSSmOrange, CyOFPI , Sandercyanin. Alternatively, the GAL4:UAS system can be replaced with the tetracycline repressor system (Figure 7). In this system, transcriptional activation of the venom peptide is regulated by the presence of tetracycline (Tc) in the feeding media. In the Tet expression system, a tetracycline-controlled trans activator protein (tTA) which is composed of the Tet repressor DNA binding protein (TetR) from the Tc resistance operon of E.coli transposon Tn10 fused to the strong transactivating domain of VP16 from Herpese simplex virus, regulates expression of a target gene that is under transcriptional control of a tetracycline-responsive promoter element (TRE). The TRE is made up of Tet operator (tetO) sequence concatemers fused to a minimal promoter, (commonly the minimal promoter sequence derived from the human cytomegalovirus (hCMV) immediate-early promoter). In the absence of Tc ordoxycycline (Dox), tTA binds to the TRE and activates transcription of the target gene. In the presence of Tc or Dox, tTA cannot bind to the TRE, and expression from the target gene remains inactive.

[0113] The Tet system is particularly useful in mosquitos. When reared on growth media in the presence of tetracycline, the male mosquito containing the venom peptide construct will not express or transfer the venom peptide and will mate with a female mosquito to produce offspring with all of the male and female offspring containing the transgene. Further, even if a homozygous males mates with a wild type female, the offspring will be heterozygous and should still express the transgene. In the absence of tetracycline, the venom peptide is expressed in the male which, following mating with a female, passes the venom to the female resulting in death of the female.

[0114] Producing genetically engineered insects

[0115] The disclosure is directed to the production of genetically engineered insects. The methods are particularly amenable to insect species in which the GAL4:UAS system is operable. For example, various forms of the GAL4:UAS system have been shown to be more active and robust and have successfully been employed in Tribolium casteneum (Schinko JB, et al. (2010) BMC Dev Biol 10: 53.), Aedes aegypti (Kokoza VA, Raikhel AS (2011) Insect Biochem Mol Biol 41 : 637-644), and Anopheles gambiae (Lynd A et al., (2012) PLoS One 7(2): e31552. https: / / doi.org / 10.1371 / journal.pone.0031552).

[0116] Thus, the present disclosure provides a method for generating a genetically modified male insect, the method comprising:

[0117] (i) inserting a first exogenous DNA sequence encoding at least one secretable venom peptide into an expression vector to obtain a vector comprising a first exogenous DNA sequence;

[0118] (ii) introducing the vector obtained in step (i) to an insect to obtain a stable strain of modified precursor insect;

[0119] (iii) crossing the precursor insect with an insect comprising an expression system matched with the expression vector to obtain a genetically modified insect.

[0120] Preferably, the male offspring is isolated soon after eclosion. In the subcloning the first exogenous DNA sequence, e.g. the venom peptide sequence is introduced into another DNA sequence, the expression vector. To this end, the exogenous DNA sequence and the expression vector can be specifically cut with the aid of restriction enzymes in order to obtain so-called complementary “sticky ends’’, which can be subsequently ligated to one another, with the result that the desired expression vector is obtained. In this process, the ligation can be carried out with the aid of DNA ligases. The introduction of the first exogenous DNA sequence into the expression vector can also be effected by other methods, for example the In-Fusion Cloning System (Takara Bio USA Inc.), orthe PhiC31 mediated site-specific integration as used herein. The vector may be a plasmid, cosmid, YAC or modified virus. In a preferred example, the vector is a plasmid.

[0121] In one example, a UAS -suitable vector can be used. This allows the use of the GAL4 / UAS system in the generation of a genetically modified insect. Furthermore, the vector can comprise a gene sequence encoding a certain phenotype (e.g. miniwhite gene). As a result, it is advantageously possible to carry out a later selection oftransgenic precursor insects on the basis of the phenotype. In this case, the distinct phenotype serves as a selection marker. In a preferred example, the green fluorescent protein sequence within the pJFRC81-10XUAS-IVS-Syn21-GFP-p10 vector backbone is replaced with venom peptide sequence. In one example, the venom peptide sequence is codon optimized for expression in the insect.

[0122] Step (ii) of the method described herein for generating the genetically modified precursor insect the method may further comprise microinjection of the plasmid into the insect. In some examples up to 100 fly embryos are injected.

[0123] In the last step of the method for generating a genetically modified insect, the precursor insect is crossed with a further insect. The two insects differ in their genome. Whereas the precursor insect already contains the gene for the venom peptide or protein, the other insect does not comprise said gene. Preferably, the other (further) insect is a tissue-specific line, the expression system of which is matched with that of the precursor insect.

[0124] Successful crossing can be confirmed by fluorescence microscopy or phenotypic analysis of the presence of marker genes associated with the precursor insect and / or expression system.

[0125] In one example, the expression system is GAL4:UAS.

[0126] In one example, the expression vector in which the sequence encoding the venom peptide is subcloned is suitable for use in a GAL4 / UAS expression system. Preferably, the expression vector comprises an UAS. By crossing the precursor insect which comprises the expression vector containing the UAS with a GAL4 line which is moreover tissue-specific, it is possible to control the expression of the venom peptide in a simple and reliable manner.

[0127] In a further example of the method, the transgenic insect is a Drosophila and the insect used in step c) comprising an expression system matched with the expression vector is a GAL4 Drosophila line. Numerous GAL4 Drosophila lines are already known and are suitable for crossing within a UAS system. The GAL4 lines used can be, for example, P(fkh-Gal4), P(GawB)34B or P(GawB)C-765 or the Drosophila lines used in the present examples.

[0128] The present disclosure further provides a genetically modified insect produced by the method described herein.

[0129] The methods described herein can be applied to any type of insect in which the GAL4:UAS system is operable. Such insects can include insect pests which can cause damage by eating crops or animals. The New World screw-worm fly Cochliomyia hominivorax, for example, is a direct pest of cattle, and the spotted wing Drosophila, Drosophila Suzukii is pest of many fruit crops.

[0130] The methods described herein can also be applied to insects that transmit human diseases, for example, mosquitoes which carry malaria; or arboviruses.

[0131] Additional examples of insects include, but are not limited to, Asian citrus psyllid (diaphorini citriii, Australian sheep blowfly (Lucilia cuprina, Asian tiger mosquito (Aedes albopictus); Japanese beetle (Popilla japonica), White fringed beetle (Graphognatus spp.), Citrus blackfly (Aleurocanthus woglumi). Oriental fruit fly (Dacus dorsalis), Olive fruit fly (Dacus oleae), tropical fruit fly (Dacus cucurbitae, Dacus zonatus), Mediterranean fruit fly (Ceratitis capitata), Natal fruit fly (Ceratitis rosa), Cherny fruit fly (Rhagoletis cerasi), Queensland fruit fly (Bactrocera tryoni), Caribbean fruit fly (Anastrepha suspensa), imported fire ants (Solenopis richteri, Solenopis invictai, Gypsy moth (Lyman tria dispar), Codling moth (Cydia pomonella), Brown tail moth (Euproctis chrysorrhoea), yellow fever mosquito (Aedes aegypti), malaria mosquitoes (Anopheles gambiae, Anopheles Stephansi), New world screwworm (Cochliomyia hominivorax), Old World Screwworm (Chrysomya bezziana), Tsetsefly (Glossina spp), Boll weevil (Anthonomous grandis), Damselfly (Enalagma hageni), Dragonfly (Libellula luctuosa), and rice stem borer (Tryporyza incertulas).

[0132] In some examples, the insect either transmits human disease or are agricultural pests. In some examples, the insects are wild insect populations. In some examples, the insects are mosquitoes or flies (for example fruit flies). The mosquitoes can be, for example, Aedes sp. or Anopheles sp. In some embodiments, the mosquito is yellow fever mosquito (Aedes aegypti), malaria mosquito (Anopheles gambiae, Anopheles Stephensi), and Asian tiger mosquito (Aedes albopictus). In some examples, the insect is one that transmits a disease of a mammal. The disease can be any disease, for example, malaria and / or yellow fever. In some examples, the insect is a Spotted wing Drosophila (Drosophila Suzuki).

[0133] The GAL4: UAS system

[0134] The GAL4:UAS system is a method used to study gene expression and function in organisms such as the fruit fly (Drosophila). The system has two parts: the Gal4 gene, encoding the yeast transcription activator protein GAL4, and the UAS (Upstream Activation Sequence), an enhancer to which GAL4 specifically binds to activate gene transcription (Brand AH et al., (1993) Development 118(2):401). Gal4 is a modular protein consisting broadly of a DNA-binding domain and an activation domain. The UAS to which GAL4 binds is CGG-N11-CCG, where N can be any base. Although GAL4 is a yeast protein not normally present in other organisms it has been shown to work as a transcription activator in a variety of organisms such as Drosophila (Janice A et al., (1988) Nature 332(6167):853), and human cells, highlighting that the same mechanisms for gene expression have been conserved over the course of evolution.

[0135] For study in Drosophila, the GAL4 gene is placed under the control of a native gene promoter, or driver gene, while the UAS controls expression of a target gene. GAL4 is then only expressed in cells where the driver gene is usually active. In turn, GAL4 should only activate target gene transcription where a UAS has been introduced. For example, by fusing a gene encoding a visible marker like GFP (Green Fluorescent Protein) the expression pattern of the driver genes can be determined. GAL4 and the UAS are very useful for studying gene expression in Drosophila as they are not normally present and their expression does not interfere with other processes in the cell.

[0136] Figure 1 provides a representation of the method of the present disclosure. The accessory glands of the Drosophila produce seminal fluid proteins. The present methods result in the production of venom peptides within the accessary glands of the male Drosophila (Figure 1a). The production of venom peptides in the accessary glands is achieved using the GAL4:UAS system. The GAL4:UAS system is demonstrated by reference to a reporter fluorescent protein (RFP). The RFP contains an upstream UAS enhancer. GAL4 protein produced from the pAntares-GAL4 expression system binds to the UAS enhancer to drive expression of the RFP which can be detected by fluorescence microscopy (Figure 1 b).

[0137] EXAMPLES

[0138] Example 1 Heterologous expression of insecticidal venom peptides

[0139] Identifying candidate venom proteins

[0140] A list of candidate venom peptides was identified based on certain criteria. Critically, the target of the venom could not be present in the male reproductive tract, which was determined by tissuespecific gene enrichment values given by FlyAtlas 2 (www.flyatlas2.org). Further, the venoms must also only interact with insect ion channels, with no measurable LD50 found for mammals. Candidates were more likely to be chosen if they had lower Dipteran LD50, as well as lower molecular weight, to increase the likelihood of the venoms entering the haemolymph of mated females. To keep the number of venoms to be assessed manageable, the list was limited to the most promising candidate for a given target or venom class given our criteria (Table 1). Table 1 : Candidate venom proteins investigated for accessory gland-specific recombinant expression.

[0141] The sequences of the venom proteins are provided below in Table 2.

[0142] Table 2: Sequences of the mature venom peptides from various species Expression vector design and transformation of Drosophila

[0143] To generate strains which could express these venoms in tissue-specific patterns, plasmids were constructed using the strong pJFRC81-10xUAS-IVS-Syn21-GFP-p10 backbone (#36432 Addgene).

[0144] Synthetic oligonucleotides were designed containing D. melanogaster codon optimised, mature venom peptide sequences. The peptide were p-AGTX-Aa1d (SEQ ID NO:1), F-CNTX-Pn1 a (SEQ ID NO:2), 6-CNTX-Pn1 a (SEQ ID NO:3) K-HXTX-HV1 C (SEQ ID NO:4), UJ-HXTX-HV1 a (SEQ ID NO:5), w- HXTX-Hv2a (SEQ ID NO:6) and <5-AITX-Avd2a (SEQ ID NO:7) and their sequences are provided in Table 2 above. An ovulin (Ov) signal peptide was included upstream of the venom peptide to facilitate secretion into the lumen of the accessory gland cells. The nucleic acid sequence of the ovulin signal peptide is ATGAACCAGATTTTATTATGCTCTCCAATTTTACTGCTGCTTTTTACAGTGGCA (SEQ ID NO:8) and its corresponding amino acid sequence is MNQILLCSPILLLLFTVA (SEQ ID NO:13).

[0145] This construct is shown in Figure 2.

[0146] Plasmid pJFRC81 was digested with Xba\ and Not\ to replace the green fluorescent protein (GFP) coding sequence with the venom constructs by HiFi assembly (NEBuilder® HiFi DNAAssembly, New England Biolabs). The resulting plasmids were used to engineer D. melanogaster by microinjection of embryos according to standard methods using PhiC31 mediated site-specific integration (Bateman JR et al., (2006) Genetics 173(2):769) into the attP40 docking site on chromosome 2.

[0147] Drosophila strains

[0148] The Drosophila strains used were obtained from the Bloomington Drosophila Stock Centre (Indiana University Bloomington). RRID:BDSC_4414 expresses GAL4 ubiquitously under control of the Act5C promoter. It also includes the CyO gene on the homologous balancer chromosome. RRID:BDSC_79324 (Lee et al., (2018) eLife:e35574) comprises GAL4 under control of the antares (antr.) promoter (see Figure 1 b). RRID:BDSC_1947 (Yoffe et al., (1995) Developmental biology: 170(2)) comprises GAL4 under control of the paired (prd.) promoter. The ovulin (ovu) GAL4 strain was produced as described in Chapman T et al., (2003) PNAS 100(17):9923.

[0149] Accessory-gland specific expression of transqenes

[0150] The success of th is approach hinges on the ability to get high levels of accessory gland-specific expression of the venom proteins, while reducing the off-target expression as much as possible. To determine the most suitable expression pattern, four different GAL4 drivers were tested: prd-GAL4; antr-GAL4; ovu-GAL4; and Lectin-46Ca-GAL4. A diagrammatic representation of the antares-GAL4 driver is shown in Figure 2B. These drivers were crossed to an upstream activator sequence (UAS)- mCherry reporter, and the degree of on and off-target expression for each cross was determined by fluorescence microscopy of dissected male progeny. Of the four GAL4 drivers, only antr-GAL4 produced a strong signal in the accessory glands without also driving expression in earlier developmental stages or off-target tissue (Figure 3).

[0151] Functionality of the venom peptides in vivo

[0152] Venom peptides p-AGTX-Aa1d (SEQ ID NO:1), F-CNTX-Pn1a (SEQ ID NO:2), K-HXTX-HV1 C (SEQ ID NO:4), uj-HXTX-Hv1a (SEQ ID NO:5), and 6-AITX-Avd2a (SEQ ID NO:7) were tested in vivo in Drosophila by crossing the flies comprising a homozygous UAS:venom construct with flies comprising an Act5C-GAL4 / CyO driver (RRID:BDSC_4414, Bloomington Drosophila Stock Centre). By crossing the UAS:venom flies with Act5C-GAL4 flies, offspring that inherit both constructs will secrete the venom from every cell in their body (since actin is expressed in high levels in every cell of the flies’ body), therefore if the venom is functional it should kill those offspring.

[0153] It was expected that any progeny from strain functionally expressing venom peptides only present the CyO phenotype (curly wings), as inheritance of the Act5C-GAL4 chromosome would result in lethal ubiquitous expression of the venoms. Conversely, non-functionally expressing venoms would exhibit 50% penetrance of the CyO phenotype.

[0154] From these crosses (N = 3), progeny from 5 / 7 of the UAS-venoms displayed 100% CyO phenotype, including p-AGTX-Aa1d, F-CNTX-Pn1a, K-HXTX-HV1 C, uj-HXTX-Hv1a, and 6-AITX-Avd2a. The UAS-venom strains expressing <5-CNTX-Pn1a exhibited 46±2% CyO phenotype, and UJ-HXTX- Hv2a exhibited 44±10%.

[0155] Example 2 TMT males reduce the lifespan of mated females

[0156] Lifespan assays of mated females were performed to determine whether exposure to TMT males reduces the lifespan of wild type females. TMT males were prepared by crossing UAS-venom strains (p-AGTX-Aa1d, F-CNTX-Pn1a, K-HXTX-HV1 C, uj-HXTX-Hv1a, or 6-AITX-Avd2a) to the antr- GAL4 driver and transheterozygous male offspring were isolated soon after eclosion. As female D. melanogaster are not receptive to mating for 24 - 48 hours post-eclosion, virgin wild type females were isolated for 2 - 3 days to ensure that they had reached sexual maturity. Females were then housed in groups of eight with an equal number of TMT or wild type males and were transferred to fresh media every 3 days. As female D. melanogaster are refractory to mating for at least 5 days after fertilization, to ensure that females had access to mates with fully replenished SFP when they became receptive, as well as to maintain the 1 :1 sex ratio, males were replaced during each transfer. Females mated to wild type males had a median lifespan of 27 days (95% Ci:25-31 days, N=40, Fig 4a). Females mated to F-CNTX-Pn1a TMT males had a median post-exposure (MPE) lifespan of 17 days (95% Cl:12-19 days, N=40, Fig 4a), 37% lower than controls (log-rank test, x2 (1 , N=80) = 20.7, p <0.005). Females mated to <5-AITX-Avd2a TMT males had a MPE lifespan of 15 days (95% Cl: 11 - 18 days, N = 40, Fig. 4a), 44% lower than controls (log-rank test, x2 (1 , N = 80) = 17.7, p < 0.005). Females mated to p- AGTX-Aa1d or K-HXTX-HV1 C TMT males did not have significantly reduced lifespans compared to wild type controls, indicating that the reduction in lifespan observed in the F-CNTX-Pn1a and <5-AITX-Avd2a treatment groups is the result of specific venom expression rather than exposure to transgenic males. Females mated to w-HXTX-Hvla TMT males had a MPE lifespan of 20 days (95% Cl: 17 - 23 days, N = 40), 26% lower than controls (log-rank test, x2 (1 , N = 80) = 9.51 , P < 0.005). However, most GJ- HXTX-Hv1 a TMT males were not surviving the three days until their replacement. Upon further investigation we found that while expression of the primary subunit (cac) of the calcium channel targeted by UJ-HXTX-HV1 a is not enriched in the MAG, the pore-forming subunit (Ca-a1 D) is. As such, expression of UJ-HXTX-HV1 a was not investigated further.

[0157] Genetic biocontrol release programs such as SIT and RIDL utilise overlflooding ratios of modified males to wild individuals. However, female D. melanogaster are known to have reduced fitness at higher rates of male exposure. To determine if an increase in the sex ratio of TMT males results in a greater reduction in median lifespan than would be expected from a simple increase in male exposure, the inventors performed anotherfemale lifespan assay with a 3:1 male-to-female sex ratio. In this assay, control females mated to wild type males had a median (MPE) lifespan of 8 days (95% Cl: 6 - 13 days, N = 40, Fig. 4b), 64% lower than controls (log-rank test, x2 (1 , N = 79) = 28.1 , P < 0.005). The MPE lifespans of females mated 3:1 to wild type males was not significantly reduced compared to females mated 1 :1 to wild type males (log-rank test, x2 (1 , N = 79) = 0.2, P = 0.6), while females mated to 3:1 F-CNTX-Pn1 a and 6-AITX-Avd2a TMT males had a 35% (log-rank test, x2 (1 , N = 80) = 6.8, P = 0.01) and 47% (log-rank test, x2 (1 , N = 80) = 7.4, P = 0.01) respectively reduced MPE lifespans relative to their equal ratio counterparts. Therefore, the negative effect of exposure to TMT males on the survival of mated females is greater than the negative effect of increased male exposure in general.

[0158] Example 3 TMT male competitiveness

[0159] Single-pair courtship assay

[0160] To determine whether expression of venom proteins in the accessory glands impaired the males’ ability to court females, single-pair courtship assays were performed. A single wild-type virgin female was paired with a virgin male in a mating arena, which were observed for up to two hours to identify males which successfully courted a female. To control for off-target effects of accessory glandspecific expression of heterologous proteins, the competitiveness of negative control males expressing an unrelated low molecular weight protein (NbVHH05, 13 kDa) in the same expression pattern (antr- GAL4 / UAS:NbVHH05) was also measured. The percentage of wild type males which successfully courted a female was 30% (95% Cl: 19 - 44%, N = 50), F-CNTX-Pn1a TMT males was 30% (95% Cl: 19 - 44%, N = 50), 6-AITX-Avd2a TMT males was 22% (95% Cl: 13 - 35%, N = 50), and negative control males was 24% (95% Cl: 14 - 37%, N = 50). No significant difference was observed in the ability of the males in any treatment group to court females (x2 (3, N = 200) = 1 .3, P = 0.73).

[0161] TMT male longevity

[0162] Longevity assays were performed to determine what effect accessory gland-specific venom expression had on the longevity of TMT males relative to wild-type and negative control (NbVHH05) males. Males were isolated soon after eclosion and housed in groups of 8, being transferred onto fresh media ever 3 days. The median lifespan of wild type males was 46 days (95% Cl: 38 - 50 days, N = 40, Fig. 5), negative control males was 43 days (95% Cl: 41 - 46 days, N = 40), F-CNTX-Pn1 a males was 46 days (95% Cl: 38 - 47 days, N = 40), and 6-AITX-Avd2a males was 19 days (95% Cl: 11 - 27 days, N = 40). F-CNTX-Pn1 a TMT males had no significant difference in longevity compared to wild type males (log-rank test, x2 (1 , N = 80) = 2.8, P = 0.09) or negative control males (log-rank test, x2 (1 , N = 80) = 0.8, P = 0.36). However, <5-AITX-Avd2a TMT males had a 59% reduced median lifespan compared to wild type males (log-rank test, x2 (1 , N = 80) = 50.9, P < 0.005).

[0163] Modelling ofAe. aeq / pf; population control

[0164] To evaluate how a TMT release program might compare to currently deployed GBT in its ability to suppress a mosquito population, the inventors developed an agent-based model simulating a hypothetical Ae. aegypti release program of SIT, fsRIDL, and TMT mosquitoes using GAMA 1.9 This model simulates the full life cycle of each mosquito within the population in hourly intervals, with adult females having more complex behavior in response to various internal and external factors such as age, time of day, mate choice etc. Models were instantiated with a seed population that is left for a year of simulation time to reach equilibrium, at which point adult transgenic males are released every three days until the end of the simulation at a release ratio of 12:1 males per wild adult. The frequency of polyandry was set to ~20%, and density-dependent mortality (DDM) of the immature stages was modelled as logistic function (see Methods for further information). The fitness and lifespan of all transgenic males were presumed to be equal to wild males, but the mating competitiveness estimated from Brazil field trials of RIDL mosquitoes (3.1 %) was used. Each technology was likewise ‘idealised’, with all SIT offspring and female fsRIDL pupae being completely non-viable, and wild females that mated with TMT males dying within the hour (which functionally may also be acute incapacitation eventually leading to their death). A negative control (no release) simulation was also performed for comparison.

[0165] The target female populations in SIT and fsRIDL simulations were reduced to 50% of their initial size (PR50) within 56.1 and 36.3 days respectively and reduced by 95% (PR95) within 109.6 and 87.8 days (Fig. 6a). Qualitatively, these results follow a similar trend to the rate of population reduction observed during the suppression phase of the Brazil field trials. The PR50 and PR95 for TMT simulations were 15 and 62.2 days, 58.7% and 29.2% faster than fsRIDL respectively. The model also tracked key epidemiological factors such as cumulative blood feeding events, which on average were 8,183 for SIT simulations, and 5,659 for fsRIDL simulations (Fig. 6b). The average number of blood feeding events in TMT simulations was just 2,804, 67% lower than SIT and 50% lower than fsRIDL simulations. The number of gonotrophic cycles undergone by a female mosquito correlates closely with two important factors, multiple feeding rates and the extrinsic incubation period (EIP) of arboviruses, with the earliest that a female is likely to transmit a virus being her second gonotrophic cycle. The median number of gonotrophic cycles per female was 5 for the negative control (IQR: 3 - 7), SIT (IQR: 3 - 7), and fsRIDL (IQR: 4 - 7) simulations, whereas the median for TMT simulations was just 1 (IQR: 1 - 5).

[0166] REMARKS

[0167] The present disclosure describes a novel example of a genetic biocontrol technology which can reduce the lifespan of mated females, referred to herein as Toxic Male Technique (TMT). The heterologous expression of insect specific venom proteins, f-CNTX-Pn1a from P. nigriventer and <5- AITX-Avd2a from A. sulcata, within the accessory glands of male D. melanogaster resulted in a 37 - 64% reduction in the median lifespan of mated wild-type females. The successful development of intragenerational genetic biocontrol technologies like TMT represents a paradigmatic shift in pest control, as while current mating-based approaches to pest control such as SIT, fsRIDL, and gene drives are highly effective at local eradication of a target species, these techniques function by affecting either the reproductive potential of mated females or the fitness of future generations - neither of which addresses immediate damages associated with outbreaks of disease vectors or agricultural pests. Traditional pest control techniques such as baiting and release of natural predators are effective at decreasing existing population levels, but these methods are rarely species-specific, and can inadvertently lead to the introduction of invasive species.

[0168] Strains of TMT mosquitoes could be used as a first line response to pest outbreaks in place of insecticides, reducing off-target effects on local ecologies. Our modelling suggests that compared to currently deployed genetic biocontrol technologies like fsRIDL, TMT has the potential to reduce Ae. aegypti mosquito populations to half their size 58.7% faster and reduces the rate of potentially disease- transmissible blood feeding during the release period by 50% compared to fsRIDL releases. This effect is due to female Ae. aegypti mating soon after emergence, and it is unlikely that many females within TMT release areas will have the opportunity to incubate the virus and take a subsequent blood meal. Rapid responses to disease outbreaks are crucial in preventing the initial spread, reducing the peak incidence of disease, and lowering the overall transmission rate. Our results suggest that TMTmay be particularly well suited at lowering the basic reproduction number (RO) of arboviral diseases below what is needed to sustain an outbreak.

[0169] Ae. aegypti are less polyandrous than many insect species, though recent research indicates that rates of female-remating have likely been underestimated. Unlike other mating-based GBT such as SIT and fsRIDL where high levels of female-remating can negatively impact their efficacy as females could be re-inseminated by wild males, increased rates of polyandry would by highly advantageous for TMT’s rate of population suppression. Many lepidopteran pests such as the fall armyworm (Spodoptera frugiperda) demonstrate rates of polyandry fourtimes higherthan the highest estimates for Ae. aegypti, making them prime candidates for TMT control.

[0170] Optimisations in the expression patterns of insecticidal proteins, such as changes to regulatory elements and bi-cistronic expression of multiple venoms, would likely result in further decreases in mated female lifespan, as well as the time from mating to female incapacity. Dose-dependent responses to venoms tend to follow a sigmoidal curve, so depending on the dosage that the current iteration of TMT males are able to deliver, it’s possible that even a small increase in venom concentration could result in a significant increase in toxicity. Co-expression of multiple toxins could help to mitigate the emergence of resistance alleles, as well as potentially resulting in synergistic toxicity from affecting multiple ion channel targets. It would also be possible engineer TMT strains with genetic sorting of females from the released population by female-specific intron splicing of venom expression, which would increase the efficiency of large-scale production of male-only cohorts. The inventors investigated the heterologous expression of 7 venom proteins, but many more insect-specific venom proteins have been characterised, and their toxicity is known to vary significantly from species to species, so many more candidates are there to be explored for each use case.

Claims

CLAIMS1. An expression vector comprising at least one exogenous peptide or protein that disrupts ion channel function operatively linked to a promoter and a signal sequence for expression and secretion of the peptide or protein from the reproductive tract of a male insect or arachnid.

2. The vector according to claim 1 , wherein the peptide or protein is secreted into the seminal fluid from the accessory glands of the male insect or arachnid.

3. The vector according to claim 1 or 2, wherein the signal sequence is operatively linked to the peptide or polypeptide that disrupts ion channel function.

4. The vector according to claim 3, wherein the signal sequence encodes the ovulin secretion signal.

5. The vector according to any one of claims 1 to 4, wherein the ion channel peptide or protein that disrupts ion channel function is a venom peptide or an insecticidal or pesticidal protein.

6. The vector according to any one of claims 1 to 5, wherein the peptide or protein disrupts ion channel function in one or more organs of the female insect or arachnid following insemination by the male insect or arachnid respectively.

7. The vector according to any one of claims 1 to 6, further comprising a gene encoding a phenotype characteristic of the insect or arachnid selected from eye colour, body colour, eye morphology, wings, body setae, or body colour.

8. The vector according to any one of claims 1 to 7, which further comprises an upstream activating system (UAS) that supports transcription of the ion channel peptide or protein in the accessory gland cells.

9. The vector according to any one of claims 1 to 7, wherein the vector comprises a tetracycline repressor system wherein transcription of the ion channel peptide or protein is induced in the absence of tetracycline.

10. The vector according to any one of claims 1 to 9, wherein the peptide or protein is a venom peptide selected from one or more of an agatoxin, a ctenitoxin, a hexatoxin, or an actitoxin or a combination thereof.

11. The vector according to claim 10, wherein the venom peptide is selected from p-AGTX-Aa1d (SEQ ID NO:1), f-CNTX-Pn1a (SEQ ID NO:2), 6-CNTX-Pn1a (SEQ ID NO:3), K-HXTX-HV1 C (SEQ ID NO:4), w-HXTX-Hvla (SEQ ID NO:5), uj-HXTX-Hv2a (SEQ ID NO:6) and 6-AITX-Avd2a (SEQ ID NOT).

12. The vector according claim 11 , wherein the venom peptide is <5-AITX-Avd2a (SEQ ID NO:7).

13. The vector according to any one of claims 1 to 12, wherein the vector comprises two or more peptides arranged in tandem separated by one or more 2A self-cleaving peptides.

14. The vector according to any one of claims 1 to 13, wherein the vector comprises two or more peptides connected by a linker sequence.

15. The vector according to any one of claims 1 to 14, wherein the peptide or protein is codon optimized for expression in the insect.

16. The vector according to any one of claims 1 to 8 or 10 to 15, wherein expression of the peptide or protein is driven by GAL4 binding to the UAS.

17. A genetically modified male insect or arachnid, comprising: a genome including at least one first nucleic acid sequence encoding at least one exogenous peptide or protein that disrupts ion channel function, the expression of the first exogenous nucleic acid sequence leading to an ion channel peptide or protein in the genetically modified insect or arachnid, wherein the ion channel peptide or protein is secreted into the seminal fluid of the male insect or arachnid.

18. The insect or arachnid according to claim 17, wherein expression of the first exogenous nucleic acid sequence leads to a functional peptide or protein in the accessory glands of the genetically modified insect or arachnid.

19. The insect or arachnid according to claim 16, wherein the ion channel peptide or protein is only functional in the female insect or arachnid when cleaved by a protease in the female reproductive tract.

20. The insect or arachnid according to any one of claims 17 to 19, wherein the at least one exogenous peptide or protein that disrupts ion channel function is a venom peptide.

21. The insect or arachnid according to any one of claims 17 to 20, wherein expression of the first at least one exogenous DNA sequence encoding at least one exogenous peptide or protein that disrupts ion channel function is under the control of one or more of an accessory gland specific GAL4:UAS expression system.

22. The insect or arachnid according to any one of claims 17 to 21 , wherein the genome of the genetically modified insect or arachnid comprises at least one second exogenous DNA sequence encoding including at least one fluorescent protein selected from the group consisting of GFP, CFP, YFP, mCherry, dsRed, and variants thereof.

23. The insect or arachnid according to claim 22, wherein the genome of the genetically modified insect further encodes GAL4.

24. A method for generating a genetically modified male insect or arachnid, comprising: inserting a first exogenous nucleic acid sequence encoding at least one exogenous peptide or protein that disrupts ion channel function into an expression vector to obtain a vector comprising the first exogenous DNA sequence; introducing the vector comprising the first exogenous DNA sequence into an insect or arachnid to obtain a stable strain of a transgenic precursor insect or arachnid; and crossing the transgenic precursor insect or arachnid with an insect or arachnid respectively comprising an expression system matched with the expression vector to obtain a genetically modified insect or arachnid with a peptide or protein that disrupts ion channel function.

25. The method according to claim 24, wherein expression of the first exogenous nucleic acid sequence leads to a functional peptide or protein in the accessory glands of the genetically modified insect or arachnid.

26. The method according to claim 24, wherein the ion channel peptide or protein is only functional in the female insect or arachnid.

27. The method according to any one of claims 24 to 26, wherein the at least one exogenous peptide or protein that disrupts ion channel function is a venom peptide.

28. The method according to any one of claims 24 to 27, wherein the insect or arachnid comprising the expression system matched with the vector is a female.

29. The method according to any one of claims 24 to 28, wherein the expression system is GAL4 / UAS.

30. A method of selective control or suppression of female insects or arachnids in a population of insects or arachnids comprising male and female insects or arachnids respectively, the method comprising:(i) preparing a genetically modified male insect or arachnid as claimed in any one of claims 24 to 29;(ii) releasing the genetically modified male insect or arachnid into an environment comprising a population of female insects or female arachnids respectively; and(Hi) allowing the genetically modified male insects or arachnids to copulate with the female insects or arachnids respectively so that the females are inseminated with the expressed peptide or protein secreted from the male accessory glands.

31. The method of claim 30, wherein step iii) comprises allowing the genetically modified male insects or arachnids to copulate with the female insects or arachnids so that the females are envenomated with the expressed venom peptide secreted from the male accessory glands.

32. The method according to claim 30 or 31 , wherein suppression includes eliminating the female insects or arachnids.

33. The method according to any one of claims 30 to 32, wherein the female insects or arachnids are virgins.

34. The vector, insect or method according to any preceding claim wherein the insect is an insect that damages crops.

35. The vector, insect or method according to any preceding claim wherein the insect is an insect that causes disease in a mammal.

36. The vector, insect or method according to any preceding claim wherein the insect is of the order Diptera, Lepidoptera, Coleoptera, Hemiptera, Homoptera, Dermaptera, Orthptera, Arachnida, Neuroptera, or Hymenoptera.

37. The vector, insect or method according to any preceding claim wherein the insect is a species of one or more of Drosophila, Anopheles, Pectinophora, Anastrepha, Aedes, or Bombyx.

38. The vector, arachnid or method according to any preceding claim wherein the arachnid is the species Arachnida.

Images