Use of soybean MYC2-like transcription factor gene gmmyc3 and KASP marker thereof
By overexpressing the GmMYC3 gene in soybeans and developing KASP markers, the problem of insufficient resistance to soybeans to Sakura and Sakura is solved, and a significant improvement in soybean insect resistance is achieved.
Patent Information
- Application Number
- PCT/CN2024/118139
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-22
- Filing Date
- 2024-09-11
- Publication Date
- 2025-05-30
AI Technical Summary
Soybeans are insufficiently resistant to the fall armyworm and fall armyworm, resulting in economic losses for farmers. The existing technology has not yet effectively solved this problem.
By overexpressing the soy MYC2-like transcription factor gene GmMYC3 in soy plants and developing KASP markers associated with GmMYC3 are used for molecular assisted selection of highly insect-resistant soy varieties.
The resistance of soybeans to Sarcotid and Sarcotid is significantly improved, and the soybean defense response is enhanced by increasing the accumulation of trypsin inhibitors.
Smart Images

Figure CN2024118139_30052025_PF_FP_ABST
Abstract
Description
Application of soybean MYC2-like transcription factor gene GmMYC3 and its KASP marker
[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on November 22, 2023, with application number 202311563452.6 and invention name “Application of soybean MYC2-like transcription factor gene GmMYC3 and its KASP marker”, the entire contents of which are incorporated by reference into this application. Technical Field
[0002] The present application relates to the application of soybean MYC2-like transcription factor gene GmMYC3 and its KASP marker, and belongs to the field of genetic engineering. Background Art
[0003] Soybean is an important food and cash crop worldwide and a major source of protein and oil for humans. The Spodoptera litura (Spodoptera litura) is a major defoliating pest in southern China and the Jianghuai region, causing severe economic losses to farmers. The Fall Armyworm (Spodoptera frugiperda) has recently emerged as one of the most destructive defoliating pests in maize production in Asia and Africa. It can complete its life cycle in soybeans and may become a potential pest of soybeans in future corn-soybean intercropping. Therefore, developing insect-resistant soybean varieties has become an urgent need in soybean breeding and a key task in developing sustainable agriculture.
[0004] MYC2-like transcription factors are core transcription factors in the plant jasmonic acid signaling pathway and are widely involved in regulating various physiological processes, including plant growth and development, stress responses, and defense reactions. In terms of growth and development, Arabidopsis AtMYC2 / 3 / 4 not only act as inhibitors of flowering and stomatal development but also regulate seed size, quality, and storage protein accumulation. Tomato LeMYC2 is a negative regulator of blue-light-mediated photomorphogenesis, promoting the growth of adult tomatoes. In terms of stress response, Arabidopsis AtMYC2 impairs salt stress tolerance in seedlings by mediating the repression of the antioxidant enzyme AtCAT2. PtrMYC2 in trifoliate orange promotes cold tolerance by regulating the betaine aldehyde dehydrogenase PtrBADH-1, thereby increasing betaine biosynthesis. Regarding biotic stress, Arabidopsis AtMYC2 / 3 / 4 / 5 have redundant functions in regulating glucosinolate biosynthesis, and the quadruple mutant atmyc2 / 3 / 4 / 5 is extremely susceptible to the beet armyworm. Maize ZmMYC2a / b play a crucial role in defense responses against armyworms and fall armyworms by mediating the biosynthesis of benzoxazinoids and volatile terpenes. In soybean, only GmMYC1 has been reported to regulate insect resistance in tobacco. However, the natural function and regulatory mechanism of this family in soybean have not been fully understood.
[0005] Summary of the Invention
[0006] The present application provides the use of the soybean MYC2-like transcription factor gene GmMYC3 in genetically engineering soybean resistance to leaf-feeding pests. The coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 in the resistant parent soybean KF No.1 is shown in SEQ ID NO.1; the coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 in the susceptible parent soybean NN 1138-2 is shown in SEQ ID NO.2.
[0007] The present application provides a method for improving soybean resistance to leaf-feeding pests, wherein the method comprises: overexpressing the soybean MYC2-like transcription factor gene GmMYC3 in soybean plants.
[0008] The present application provides an expression vector for overexpressing the soybean MYC2-like transcription factor gene GmMYC3, wherein the plasmid of the expression vector is a pBA002 vector.
[0009] The present application provides the use of an expression vector for overexpressing the soybean MYC2-like transcription factor gene GmMYC3 in improving soybean resistance to leaf-feeding pests.
[0010] The present application provides a KASP marker associated with soybean resistance to leaf-feeding pests. The KASP marker is located in the GmMYC3 promoter region at position 4451695bp on chromosome 7 in the soybean genome Glycine max Wm82.a2.v1, and a T / C base mutation exists at this site.
[0011] The present application provides a primer combination for detecting a KASP marker associated with resistance to soybean foliar pests. The sequence of the primer combination is as follows: upstream primer F1 is shown in SEQ ID NO.6, upstream primer F2 is shown in SEQ ID NO.7, and downstream primer R is shown in SEQ ID NO.8.
[0012] The present application provides a kit for detecting soybean resistance to leaf-feeding pests, comprising the above primer combination.
[0013] The present application provides an application of a KASP marker targeting the gene GmMYC3 in insect-resistant soybean breeding. The KASP marker primer sequences are: upstream primer F1 as shown in SEQ ID NO.6, upstream primer F2 as shown in SEQ ID NO.7, and downstream primer R as shown in SEQ ID NO.8.
[0014] The present application provides a soybean breeding method with high resistance to leaf-feeding pests, the method comprising: detecting the genotype of the above-mentioned KASP marker site, and screening soybean varieties with a CC type at the 4451695bp site on chromosome 7. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1. Agarose gel electrophoresis of PCR-cloned GmMYC3. 1: Target fragment size of 1401 bp in the resistant soybean KF No. 1; 2: Target fragment size of 1395 bp in the susceptible soybean NN 1138-2; M: Marker DL2000 Plus.
[0016] Figure 2 Tissue expression pattern of GmMYC3 in the resistant parent soybean KF No. 1 (n=3). Error bars represent ±SE.
[0017] Figure 3. GmMYC3 rapidly responds to Spodoptera litura stress. Changes in GmMYC3 expression in the resistant soybean KF No. 1 and susceptible soybean NN 1138-2 at 0.5, 4, and 8 h after simulated insect induction (W+OS) (n = 3). Two-tailed t-test: **, P < 0.01; ns, not significant. Error bars represent ±SE.
[0018] Fig. 4 Subcellular localization of the GmMYC3-GFP fusion protein in Arabidopsis protoplasts. The 35S:GFP vector was used as a control.
[0019] Figure 5. Transcriptional activity assays of the full-length, N-terminal, and C-terminal GmMYC3 proteins in yeast. The pGBKT7(BD) vector was used as a control. -Trp, nutrient-deficient medium lacking tryptophan; -Trp / -His / -Ade, nutrient-deficient medium lacking tryptophan, histidine, and adenine.
[0020] Figure 6 PCR and qRT-PCR detection of GmMYC3 transgenic soybean. (A) Overexpression of 35S:GmMYC3 KF No.1 PCR detection of soybean. The target fragment size in the resistant parent soybean KF No. 1 is 1135 bp. M: Marker DL2000 Plus; P1: positive plasmid pBA002-GmMYC3 KF No.1 ; CK: wild type WT; 1-6: different 35S:GmMYC3 KF No.1 Transgenic plants. (B) Overexpression of 35S:GmMYC3 NN 1138-2 PCR detection of soybean. The target fragment size in the susceptible parent soybean NN 1138-2 is 1129 bp. M: Marker DL2000 Plus; P2: positive plasmid pBA002-CmMYC3 NN 1138-2; CK: wild type WT; 1-6: different 35S:GmMYC3 NN 1138-2 Transgenic plants. (C) Relative expression levels of GmMYC3 in wild-type WT and GmMYC3-overexpressing soybeans (n = 3). Two-tailed t-test: **, P < 0.01; ***, P < 0.001. Error bars represent ±SE. (D) Sequences of wild-type WT and two types of GmMYC3 homozygous mutants, KO1 and KO2.
[0021] Figure 7 GmMYC3 positively regulates soybean resistance to Spodoptera litura. (A) Wild type WT, overexpression of 35S:GmMYC3 KF No.1 、35S:CmMYC3 NN 1138-2 The size of larvae of the knockout and knockout soybean lines after feeding with Spodoptera litura for 2 days. (B) The average larval weight of the larvae after feeding with Spodoptera litura for 2 days. OE4 and OE28 represent two lines overexpressing 35S:GmMYC3. KF No.1 strains, OE17, OE25, OE27, OE37, and OE38 represent five strains overexpressing 35S:CmMYC3 NN 1138-2 Lines, KO1 and KO2 represent two knockout mutants. The n values for WT, OE4, OE28, OE17, OE25, OE27, OE37, OE38, KO1, and KO2 soybeans are 33, 30, 33, 30, 33, 27, 33, 29, 20, and 15, respectively. Two-tailed t-test: *, P < 0.05; ***, P < 0.001. Error bars represent ±SE.
[0022] Figure 8 GmMYC3 overexpression soybean is resistant to Spodoptera frugiperda. (A) Wild type WT and overexpression 35S:GmMYC3 KF No.1 Larval size of S. frugiperda larvae fed with OE28 soybeans for 4 days. (B) Average larval weight of S. frugiperda larvae after 2 and 4 days of feeding (n = 50). Two-tailed t-test: ***, P < 0.001; ns, not significant. Error bars represent ±SE.
[0023] Figure 9 Quantitative analysis of trypsin inhibitor content in transgenic soybean leaves (n=3). Two-tailed t-test: *, P<0.05; ns, not significant. Error bars represent ±SE.
[0024] Figure 10 Development of the GmMYC3 KASP marker. (A) Genotyping of 50 soybean accessions using the KASP marker. Circles near the Y-axis and triangles near the X-axis represent soybean accessions carrying the T allele and C allele, respectively. Squares near the origin represent no-template DNA blank controls (NTCs). (B) Number of soybean accessions carrying the T and C alleles. (C) Evaluation of the weight of Spodoptera litura larvae fed to 50 soybean accessions for 7 days to validate the KASP marker. Error bars represent ±SE. DETAILED DESCRIPTION
[0025] The purpose of this application is to disclose the insect-resistant genetic engineering application of the soybean MYC2-like transcription factor gene GmMYC3 and provide a method for using its KASP marker in molecular-assisted selection of highly insect-resistant soybean varieties.
[0026] The coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 described in the present application in the resistant parent soybean KFNo.1 is shown as SEQ ID NO.1; the coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 in the susceptible parent soybean NN 1138-2 is shown as SEQ ID NO.2.
[0027] GmMYC3 is highly expressed in soybean leaves, flowers, and pods, rapidly responding to feeding by the major soybean pest, Spodoptera litura. The upregulation in the resistant soybean line, KF No.1, is significantly greater than in the susceptible line, NN 1138-2. This gene encodes a nuclear-localized protein and exhibits transcriptional activation activity in yeast. GmMYC3 cloned from KF No.1 and NN 1138-2, respectively, was introduced into soybean as a target gene, significantly enhancing the accumulation of trypsin inhibitor and resistance to Spodoptera litura. Conversely, knocking out this gene in soybean reduced insect resistance. Overexpression of GmMYC3 also conferred resistance to the generalist maize and soybean pest, Spodoptera frugiperda. Furthermore, a genetic variant in the promoter region of this gene exists between the resistant and susceptible soybean lines, and this variant is tightly linked to insect resistance in soybean. A KASP marker has been developed for this variant, which can be used in marker-assisted selection breeding.
[0028] The soybean MYC2-like transcription factor gene GmMYC3, represented by SEQ ID NO. 1 and SEQ ID NO. 2, is used in genetically engineering soybean resistance to Spodoptera litura and Spodoptera frugiperda. Overexpression of this gene significantly enhances soybean resistance to Spodoptera litura and Spodoptera frugiperda. Knockout of this gene weakens soybean resistance to these two pests.
[0029] The method described in this application for increasing soybean resistance to foliar pests comprises overexpressing the soybean MYC2-like transcription factor gene GmMYC3 in soybean plants. The overexpression method comprises transferring an overexpression vector into the soybean plant, wherein the overexpression vector targets the soybean MYC2-like transcription factor gene GmMYC3. The overexpression vector is transferred by Agrobacterium cotyledonary node transformation. The foliar pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.
[0030] The expression vector for overexpressing the soybean MYC2-like transcription factor gene GmMYC3 described herein is constructed from the pBA002 vector. The expression vector for overexpressing the soybean MYC2-like transcription factor gene GmMYC3 is used to improve soybean resistance to foliar insect pests selected from one or both of Spodoptera litura and Spodoptera frugiperda.
[0031] SEQ ID NO. 3 shows the nucleotide sequence of the GmMYC3 promoter genetic variant located on the soybean genome, Glycine max Wm82.a2.v1. Based on this variant, a KASP marker was developed. By detecting the CC or TT genotype of the deoxyribonucleotide at position 4451695 on chromosome 7 of the soybean genome, the insect resistance of the soybean was determined. Soybeans with the CC genotype showed higher insect resistance than those with the TT genotype.
[0032] The present application provides a KASP marker associated with soybean resistance to leaf-feeding insect pests. The KASP marker is located in the GmMYC3 promoter region at position 4451695 bp on chromosome 7 in the soybean genome Glycine max Wm82.a2.v1, and a T / C base mutation exists at this site.
[0033] This application provides a primer combination for detecting a KASP marker associated with soybean resistance to foliar insect pests. The sequences of the primer combination are as follows: upstream primer F1 is shown in SEQ ID NO. 6, upstream primer F2 is shown in SEQ ID NO. 7, and downstream primer R is shown in SEQ ID NO. 8. This application also provides a kit for detecting soybean resistance to foliar insect pests, comprising the primer combination.
[0034] The present application provides the application of the KASP marker of the gene GmMYC3 in soybean insect-resistant breeding. The GmMYC3 promoter region located at position 4451695bp on chromosome 7 in the soybean genome Glycine max Wm82.a2.v1 undergoes a C to T substitution between resistant and susceptible soybeans. This genetic variation is closely linked to soybean insect resistance. The insect resistance of the tested soybeans with the CC genotype is higher than that of the tested soybeans with the TT genotype.
[0035] The present application provides a soybean breeding method for high resistance to leaf-feeding insect pests, the method comprising: detecting the genotype of a KASP marker locus associated with resistance to soybean leaf-feeding insect pests, and screening soybean varieties with a CC-type at the 4451695bp locus on chromosome 7. The genotype detection comprises: extracting genomic DNA from the soybean to be tested; performing real-time fluorescence PCR amplification on the genomic DNA of the soybean to be tested using a primer combination for detecting a KASP marker associated with resistance to soybean leaf-feeding insect pests; and genotyping the soybean material based on the fluorescence signal, with those displaying FAM fluorescence being the CC-type. The reaction system for the real-time fluorescence PCR amplification comprises: 2.5 μL DNA template, 2.5 μL V4.02×Kasparmix, and 0.07 μL primer combination; the real-time fluorescence PCR amplification procedure comprises: activation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61-55°C for 1 minute, for 10 cycles; denaturation at 94°C for 20 seconds, annealing at 55°C for 1 minute, for 26 cycles. Beneficial effects
[0036] GmMYC3 encodes a key transcription factor in the plant jasmonic acid signaling pathway. Expression pattern analysis revealed that GmMYC3 is primarily expressed in soybean leaves, flowers, and pods. Following Spodoptera litura induction, its expression is rapidly upregulated in leaves, with the upregulation rate in the resistant soybean line, KF No.1, being much greater than in the susceptible line, NN 1138-2. Subcellular localization and yeast transcriptional activity analysis revealed that GmMYC3 is a transcriptionally active nuclear-localized transcription factor. Insect-free feeding experiments confirmed that this gene not only positively regulates soybean resistance to the major pest, Spodoptera litura, but also to the polyphagous corn and soybean pest, Spodoptera frugiperda. Furthermore, overexpression of GmMYC3 increased the accumulation of the defense-related substance trypsin inhibitor. Therefore, GmMYC3 could serve as a target for regulating soybean resistance to Spodoptera litura and Spodoptera frugiperda, potentially enabling insect resistance modification in soybean. The KASP marker was developed based on the genetic variation of the GmMYC3 promoter region in the two parental soybeans. This molecular marker can effectively distinguish resistant and susceptible soybean varieties and is of great value in soybean insect-resistant breeding.
[0037] The present application will be further described below with reference to the accompanying drawings and embodiments.
[0038] Unless otherwise specified, the methods used in the following examples are all conventional methods.
[0039] Example 1 Cloning, expression pattern, protein sublocalization and transcriptional activation activity analysis of soybean MYC2-like transcription factor GmMYC3 gene
[0040] 1) Cloning of the soybean GmMYC3 gene
[0041] The resistant parent soybean KF No.1 and the susceptible parent soybean NN 1138-2 of the soybean recombinant inbred line population were used as the sample. The leaves were taken and ground with a mortar. The leaves were added to a 1.5 mL EP tube containing lysis solution. After sufficient shaking, the total RNA was extracted using an RNA extraction kit (Shanghai Pudi). The quality of the total RNA was identified by formaldehyde denaturing gel electrophoresis, and the RNA content was determined by spectrophotometry. The obtained total RNA was used as a template and the reverse transcription kit (TaKaRa Primer Script TM Reverse transcription was performed according to the instructions of the RT reagent kit (Japan) to obtain the first-strand cDNA, which was then amplified by PCR. The PCR program was as follows: pre-denaturation at 95°C for 3 minutes, denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 72°C for 90 seconds, for a total of 35 cycles, followed by a final incubation at 72°C for 5 minutes, followed by a constant temperature at 12°C, to obtain the cDNAs of KF No. 1 and NN 1138-2.
[0042] Specific primers were designed using the coding sequence of GmMYC3 (Glyma.07G051500) in the soybean database Phytozome v13 as a template. The gene was amplified from the cDNA of soybean parents KF No.1 and NN 1138-2 by PCR reaction. The PCR products were ligated with T vector to construct T-GmMYC3. KF No.1 and T-GmMYC3 NN 1138-2 The recombinant vector was sequenced to obtain the complete CDS sequence of the soybean GmMYC3 gene. The target fragment size was 1401 bp in KF No. 1 and 1395 bp in NN 1138-2 (Figure 1). The GmMYC3 gene coding sequences in KF No. 1 and NN 1138-2 are shown in SEQ ID NOs. 1 and 2, respectively, and the corresponding amino acid sequences are shown in SEQ ID NOs. 4 and 5. The specific primer sequences required for the PCR reaction are F: atggaggatttaatcatatctcc (SEQ ID NO. 9) and R: tcactgatccaacctcatcag (SEQ ID NO. 10).
[0043] 2) Tissue expression analysis of GmMYC3
[0044] The resistant soybean line, KF No. 1, was used for tissue expression analysis of GmMYC3. Leaves, stems, and roots were sampled at the V3 stage, flowers at peak flowering, and pods and seeds 15 days after anthesis. Total RNA was extracted from all samples using the same procedure as in 1) and reverse transcribed into cDNA. Real-time RT-PCR was then used to determine the expression level of the GmMYC3 gene in different soybean tissues. The primer sequences for GmMYC3 RT-PCR were F: tggtctcgaggtcgatgtgaa (SEQ ID NO. 11) and R: gacatgctagcgtgatgaacc (SEQ ID NO. 12). The soybean Tubulin gene was used as an internal reference with primer sequences F: ggagttcacagaggcagag (SEQ ID NO. 13) and R: cacttacgcatcacatagca (SEQ ID NO. 14).
[0045] GmMYC3 was highly expressed in leaves, flowers, and pods, whereas its expression levels were low in seeds, roots, and stems ( Figure 2 ).
[0046] 3) Expression analysis of GmMYC3 under Spodoptera litura stress
[0047] Two soybean parents, KF No. 1 and NN 1138-2, from the V3 stage were treated for Spodoptera litura induction. Induction with Spodoptera litura was simulated by wounding leaves and immediately applying oral secretions (OS) from S. litura larvae to the wounded surface (W+OS). Total RNA was extracted from leaves of treated plants and from untreated control plants at the same time points 0.5, 4, and 8 hours after W+OS treatment. Total RNA extraction was performed as in step 1. Total RNA from leaves of the induced and control groups was used as a template for reverse transcription into cDNA, and real-time RT-PCR was performed. The primer sequences for GmMYC3 fluorescence quantitative analysis and the internal reference gene Tubulin were the same as in step 2.
[0048] GmMYC3 can quickly respond to feeding induction by Spodoptera litura, and the up-regulation fold in the resistant parent soybean KF No.1 is much greater than that in the susceptible parent soybean NN 1138-2 (Figure 3).
[0049] 4) Subcellular localization of soybean GmMYC3 protein
[0050] Design specific primers and perform PCR reaction from T-GmMYC3 KF No.1The GmMYC3 coding sequence, excluding the stop codon, was amplified from the vector and fused to the N-terminus of green fluorescent protein (GFP) in the pAN580 vector. This vector, which harbors the 35S promoter, strongly induces expression of the target gene, GmMYC3, in the recipient. The fusion construct, 35S:GmMYC3-GFP, and an empty vector control, 35S:GFP, were transformed into Arabidopsis protoplasts for transient expression, and the GFP signal was observed using a laser confocal microscope. The primer sequences used to construct the vector were F:atggaggatttaatcatatctcc (SEQ ID NO. 9) and R:ctgatccaacctcatc aga (SEQ ID NO. 27).
[0051] The GFP signal showed that GmMYC3 was localized in the cell nucleus, while the fluorescent signal of the empty control was distributed throughout the cell ( Figure 4 ), indicating that GmMYC3 is a nuclear-localized transcription factor.
[0052] 5) Analysis of soybean GmMYC3 transcriptional activation activity
[0053] The transcriptional activity of GmMYC3 was analyzed using Matchmarker GAL4 Two-Hybrid System 3 (Clontech, USA). Specific primers were designed and PCR reaction was performed to obtain the transcriptional activity of GmMYC3 from T-GmMYC3. KF No.1 The full-length coding sequence, N-terminal sequence, and C-terminal sequence of GmMYC3 were amplified from the vector and fused to the GAL4 DNA BD in the pGBKT7(BD) vector. The primer sequences for constructing the vector were: F-full-length: atggaggatttaatcatatctcc (SEQ ID NO. 9) and R-full-length: tcactgatccaacctcatcag (SEQ ID NO. 10), F-N-terminal: atggaggatttaatcatatctcc (SEQ ID NO. 9) and R-terminal: cggagtctcgcgtccgagaat (SEQ ID NO. 15), F-terminal: ataacccctccagatccggtt (SEQ ID NO. 16), and R-terminal: tcactgatccaacctcatcag (SEQ ID NO. 10). The construct and the empty vector control BD were transformed into the yeast strain Y2HGold for plate selection. The plates were respectively lacking tryptophan (-Trp) and lacking tryptophan, histidine and adenine (-Trp / -His / -Ade).
[0054] Compared with BD used as a negative control, GmMYC3 showed transcriptional activation activity in yeast, and its transcriptional activation domain was located at the N-terminus ( FIG. 5 ).
[0055] Example 2 Genetic Engineering Application of Soybean MYC2-like Transcription Factor Gene GmMYC3
[0056] 1) Construction of plant expression vector for soybean GmMYC3 gene
[0057] When constructing gene overexpression vector, specific primers were designed and PCR reaction was performed to express T-GmMYC3 KF No.1 and T-GmMYC3 NN 1138-2 The coding sequence of GmMYC3 containing the complete ORF was amplified from the vector and inserted into the pBA002 vector under the drive of the 35S promoter to obtain the recombinant vector pBA002-GmMYC3. K F No.1 and pBA002-CmMYC3 NN 1138-2 The specific primer sequences required for the PCR reaction were the same as those in step 1 of Example 1. For CRISPR / Cas9 gene editing, specific primers for three target sites in GmMYC3 were designed using CRISPR-P software. These three targets were integrated into three sgDNA expression cassettes and ultimately ligated into the pGmUbi-Cas9-4XsgR vector (Zhang et al., Plant Biotechnology Journal, 2019, 217:1-12). Three pairs of target site primers are respectively F1:ggctctcatgaacttctttg (SEQ ID NO.17) and R1:caaagaagttcatgagagcc (SEQ ID NO.18), F2:accaaagaggaagacgaaga (SEQ ID NO.19) and R2:tcttcgtcttcctctttggt (SEQ ID NO.20), F3:acatgaacttctttgtgggaa (SEQ ID NO.21) and R3:ttcccacaaagaagttcatgt (SEQ ID NO.22).All constructs for soybean transformation are introduced into Agrobacterium tumefaciens strain EHA105.
[0058] 2) GmMYC3 overexpression and creation of gene-edited soybeans
[0059] The soybean cultivar GP03-8-23 was transformed using the cotyledonary node transformation method. The axils of soybean leaves, which had grown for 5-6 days, were wounded. The GmMYC3 overexpression and gene editing vectors obtained in step 1) were then inoculated into the wounds in the soybean axils and co-cultured at 25°C for 4-5 days. The plants were then washed with sterile ultrapure water and Wish-Liquid, respectively, and placed in SIM medium without glufosinate. The medium was cultured at 26°C for 15 days under light to induce budding. After 15 days, the medium was switched to SIM medium supplemented with 6 mg / L glufosinate. Subculture was then performed in 15-day cycles, with the glufosinate dosage gradually reduced. When the explant buds grew to approximately 6 cm, they were transferred to rooting medium and cultured for approximately 10 days to induce rooting. Once the root system was well established, the plants could be transplanted.
[0060] First, PCR detection was performed on the extracted soybean DNA using specific primers to determine whether it was positively transformed soybean. The overexpression soybean detection primer sequences were F:gctcctacaaatgccatcattgc (SEQ ID NO.23) and R:tcggttttctccctcttttcttc (SEQ ID NO.24). The PCR detection gel images are shown in Figure 6 AB. Real-time RT-PCR results showed that GmMYC3 was expressed in soybeans overexpressing 35S:GmMYC3 compared with the wild type WT. KF No.1 and 35S:CmMYC3 NN 1138-2 The expression levels in the gene editing soybean were significantly increased (Figure 6C). The fluorescence quantitative primer sequences for GmMYC3 and the soybean internal reference gene Tubulin were the same as those in step 2 of Example 1. For gene-edited soybean, specific primers were designed for PCR amplification near the target site, and the gel-recovered products were sequenced and analyzed. The detection primer sequences for gene-edited soybean were F: atcttaatccggaacccacc (SEQ ID NO. 25) and R: acttaacgtgctgtacgaggtt (SEQ ID NO. 26). The PCR sequencing results are shown in Figure 6D.
[0061] 3) GmMYC3 gene positively regulates soybean resistance to Spodoptera litura
[0062] Indoor insect assays were conducted in an air-conditioned room at 26°C and 30% relative humidity with a photoperiod of 12 h light / 12 h dark. Third-instar Spodoptera litura larvae of uniform size were raised in 250 mL tissue culture jars. Wild-type WT, overexpressing 35S:GmMYC3, and larvae of the same size were harvested at the flowering stage. KF No.1 、35S:CmMYC3 NN 1138-2The leaves of the knockout and KO transgenic soybean lines were fed to Spodoptera litura. Each culture jar had 4 larvae, with no less than 15 replicates. Fresh leaves were replaced every two days, and the larvae were weighed on the second day of feeding. The average larval weight per jar was calculated, and the average larval weight of Spodoptera litura was used as the resistance identification index. Compared with the wild type WT, 35S:GmMYC3 KF No.1 and 35S:GmMYC3 NN 1138-2 Overexpression of soybean significantly reduced the larval weight of Spodoptera litura, while knockout of KO transgenic soybean promoted larval growth (Figure 7). This result indicates that GmMYC3 positively regulates soybean resistance to Spodoptera litura and that GmMYC3 KF No.1 and GmMYC3 NN 1138-2 The CDS may have similar resistance functions.
[0063] 4) GmMYC3 overexpression improves soybean resistance to Spodoptera frugiperda
[0064] Except for Spodoptera litura, 35S:GmMYC3 KF No.1 OE28-overexpressing soybeans were also tested for resistance to Spodoptera frugiperda indoors. Considering the cannibalistic behavior of Spodoptera frugiperda, single second-instar larvae were reared individually in 30 mL transparent plastic containers under the same conditions as for Spodoptera litura. Larval weights were measured on days 2 and 4 after feeding, with 50 replicates. Compared to wild-type WT, 35S:GmMYC3 KF No.1 Overexpression of OE28 in soybean significantly reduced the larval weight of Spodoptera frugiperda ( FIG8 ), indicating that GmMYC3 may confer broad-spectrum resistance to leaf-feeding pests.
[0065] 5) GmMYC3 overexpression promotes the synthesis of trypsin inhibitors
[0066] The content of trypsin inhibitor in transgenic soybean leaves was detected by enzyme-linked immunosorbent assay (Nanjing Maibo). KF No.1 and 35S:GmMYC3 NN 11 38-2 The trypsin inhibitor content in overexpressing soybeans was significantly increased, but the trypsin inhibitor content in knockout soybeans was similar to that in WT (Figure 9). This result suggests that GmMYC3 enhances soybean resistance to Spodoptera litura and Spodoptera frugiperda by promoting the synthesis of trypsin inhibitors.
[0067] Example 3 Development and Application of KASP Markers for the Soybean MYC2-like Transcription Factor GmMYC3 Gene
[0068] The resistant and susceptible parent soybeans of the recombinant inbred line population underwent a C-to-T substitution (SEQ ID NO. 3) in the GmMYC3 promoter region located at position 4451695bp on chromosome 7 of the soybean Glycine max Wm82.a2.v1 genome (https: / / phytozome-next.jgi.doe.gov). The genotype of the resistant parent KF No. 1 was CC, and the genotype of the susceptible parent NN 1138-2 was TT. Targeting this genetic variation, three pairs of primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk), including upstream primer F1: gaaggtgaccaagttcatgctGCACGAACCACTATTATCTTTTTAATCTTC (SEQ ID NO. 6), upstream primer F2: gaaggtcggagtcaacggattGCACGAACCACTATTATCTTTTTAATCTTT (SEQ ID NO. 7), and downstream primer R: ACCAGACAGGATCAAAGATACTTT (SEQ ID NO. 8), wherein F1 and F2 contain FAM and HEX fluorescent linker sequences (lowercase letters), respectively.
[0069] Genomic DNA was extracted from 50 soybean accessions (Table 1). PCR amplification was performed using KASP-labeled primers in an ABI9700 real-time fluorescence quantitative PCR instrument using genomic DNA as template. The reaction setup consisted of a 5.07 μL reaction system (2.5 μL template (5-50 ng DNA), 2.5 μL V4.0 2× Kaspar mix [LGC Group], and 0.07 μL primer mix [12 μM each allele-specific primer and 30 μM common primer]). PCR cycles included activation at 94°C for 15 min, denaturation at 94°C for 20 sec, annealing at 61-55°C for 1 min (the temperature was decreased by 0.6°C per cycle, for 10 cycles), and denaturation at 94°C for 20 sec, annealing at 55°C for 1 min, for 26 cycles. After PCR, the instrument determined genotyping for each of the 50 soybean accessions based on the fluorescence signal. As shown in Figure 10, AC, the KASP primers effectively separated the two genotypes. The circles near the Y-axis represent 23 samples carrying the T allele variant and the TT genotype, with an average feed weight of 305.23 g for S. litura larvae. The triangles near the X-axis represent 27 samples carrying the C allele variant and the CC genotype, with an average feed weight of 187 g for S. litura larvae. The squares near the origins of the X and Y axes represent blank controls. Consistent with the results for the resistant and susceptible parent soybeans, the CC genotype exhibited significantly greater insect resistance than the TT genotype.
[0070] Table 1 Names and numbers of soybean materials used for KASP genotyping
[0071] Note: The above 50 soybean materials appear in the published literature (Liu, H., Che, Z., Zeng, X. et al. (2016). Identification of single nucleotide polymorphisms in soybean associated with resistance to common cutworm (Spodoptera litura Fabricius). Euphytica, 209: 49-62).
[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. Application of soybean MYC2-like transcription factor gene GmMYC3 in genetic engineering soybean resistance to leaf-feeding pests, characterized in that: The coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 in the resistant parent soybean KF No.1 is shown in SEQ ID NO.1; the coding region sequence of the soybean MYC2-like transcription factor gene GmMYC3 in the susceptible parent soybean NN 1138-2 is shown in SEQ ID NO.
2.
2. The use according to claim 1, characterized in that: The leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.
3. The use according to claim 1, characterized in that: Overexpression of the GmMYC3 gene improves soybean resistance to Spodoptera litura and Fall Armyworm.
4. The use according to claim 1, characterized in that: Knocking out the GmMYC3 gene weakens soybean insect resistance.
5. A method for improving soybean resistance to leaf-feeding pests, characterized in that: The method is: overexpressing the soybean MYC2-like transcription factor gene GmMYC3 according to claim 1 in soybean plants.
6. The method according to claim 5, characterized in that The leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.
7. The method according to claim 5, characterized in that The overexpression method comprises: transferring an overexpression vector into a soybean plant, wherein the overexpression vector uses the soybean MYC2-like transcription factor gene GmMYC3 as a target gene.
8. The method according to claim 7, characterized in that The overexpression vector is introduced by Agrobacterium cotyledon node transformation.
9. An expression vector for overexpressing the soybean MYC2-like transcription factor gene GmMYC3 described in claim 1, characterized in that: The plasmid of the expression vector is pBA002 vector.
10. Use of an expression vector overexpressing the soybean MYC2-like transcription factor gene GmMYC3 described in claim 1 in improving soybean resistance to leaf-feeding pests.
11. The use according to claim 10, characterized in that: The leaf-feeding pests are selected from one or both of Spodoptera litura and Spodoptera frugiperda.
12. A KASP marker associated with soybean foliar pest resistance, characterized in that: The KASP marker is located in the GmMYC3 promoter region at the 4451695 bp position of chromosome 7 in the soybean genome Glycine max Wm82.a2.v1, and a T / C base mutation exists in the site.
13. A primer combination for detecting the KASP marker as claimed in claim 12, characterized in that: The sequence of the primer combination is as follows: the upstream primer F1 is shown in SEQ ID NO.6, the upstream primer F2 is shown in SEQ ID NO.7, and the downstream primer R is shown in SEQ ID NO.
8.
14. A kit for detecting soybean resistance to leaf-feeding pests, characterized in that: Comprising the primer combination of claim 13.
15. Use of the KASP marker of the gene GmMYC3 according to claim 1 in soybean insect-resistant breeding, wherein the KASP marker primer sequences are: upstream primer F1 is 5'-gaaggtgaccaagttcatgctGCACGAACCACTATTATCTTTTTAATCTTC-3', upstream primer F2 is 5'-gaaggtcggagtcaacggattGCACGAACCACTATTATCTTTTTAATCTTT-3' and downstream primer R is 5'-ACCAGACAGGATCAAAGATACTTT-3'.
16. The use according to claim 15, characterized in that The GmMYC3 promoter region located at position 4451695bp on chromosome 7 in the soybean genome Glycine max Wm82.a2.v1 underwent a C to T substitution between the resistant and susceptible parental soybeans. This genetic variation is closely linked to soybean insect resistance, and the insect resistance of the tested soybeans with the CC genotype is higher than that of the tested soybeans with the TT genotype.
17. A method for breeding soybeans with high resistance to leaf-feeding pests, characterized in that: The method comprises: detecting the genotype of the KASP marker site according to claim 12, and screening soybean varieties with a CC type at the 4451695bp site on chromosome 7.
18. The method according to claim 17, characterized in that The detection of the genotype comprises the following steps: Extract the genomic DNA of the soybean to be tested; use the primer combination described in claim 13 to perform real-time fluorescence PCR amplification on the genomic DNA of the soybean to be tested; perform genotyping on the soybean material according to the fluorescence signal, and the one showing FAM fluorescence is CC type.
19. The method according to claim 18, characterized in that The reaction system of the real-time fluorescent PCR amplification is: 2.5 μL DNA template, 2.5 μL V4.02×Kaspar mix, and 0.07 μL primer combination.
20. The method according to claim 18, characterized in that The program of the real-time fluorescence PCR amplification is: activation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds; annealing at 61-55°C for 1 minute, 10 cycles; denaturation at 94°C for 20 seconds, annealing at 55°C for 1 minute, 26 cycles.
Citation Information
Patent Citations
GhMYC1 (gossypium hirsutum L. myelocytomatosis protein 1) transcription factor from gossypium hirsutum L., coding gene thereof and applications of GhMYC1 transcription factor and coding gene
CN104178498A
Citrus huanglongbing resistance related protein as well as coding gene and application thereof
CN115160421A