Small-molecule RNA drug, preparation therefor, and use thereof in prevention and / or treatment of cardiomyopathy

DICAR-JP45 was obtained by mutating the 39th base of DICAR-JP from C to U, and the sequence of DICAR-JP was optimized. This small molecule RNA has strong binding to NACα protein, inhibiting the expression of pyroptosis-related proteins, significantly improving the cardioprotection effect and the ability to treat diabetic cardiomyopathy.

WO2025108399A1PCT designated stage expired Publication Date: 2025-05-30SOUTHWEST MEDICAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/133661
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-23
Filing Date
2024-11-22
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

In the prior art, the synthetic DICAR-JP cannot completely inhibit AGEs-induced myocardial injury. How to optimize the DICAR-JP sequence to improve its effect in cardiac protection is an urgent problem.

Method used

By mutating the 39th base of DICAR-JP from C to U, a new small molecule RNA sequence DICAR-JP45 was obtained, which has a high affinity for binding to NACα protein and has strong activity to inhibit the expression of ASC and GSDMD of the pyroptosis-related proteins.

Benefits of technology

DICAR-JP45 has a long half-life in the body, and the drug effect can last more than 24 hours. It has a lower onset concentration and a larger drug safety range, which significantly improves the treatment effect on diabetic cardiomyopathy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024133661_30052025_PF_FP_ABST
    Figure CN2024133661_30052025_PF_FP_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of nucleic acid drugs, and in particular relates to a small-molecule RNA drug, a preparation therefor, and a use thereof in the prevention and / or treatment of cardiomyopathy. The present application provides a novel small-molecule RNA having a nucleotide sequence as shown in SEQ ID NO. 10, the small-molecule RNA having good structural stability, significant efficacy at 24 hours, high affinity for binding to the protein NACα, strong activity in inhibiting the expression of cell pyroptosis-related proteins ASC and GSDMD, and being able to effectively protect myocardial cells and enhance the therapeutic effect on diabetic cardiomyopathy, etc. In addition, it has the advantages of low effective concentration and high biosafety, and has potential for clinical drug development and use as a nucleic acid drug.
Need to check novelty before this filing date? Find Prior Art

Description

A small molecule RNA drug, its preparation and its use in preventing and / or treating cardiomyopathy

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on November 23, 2023, with application number CN202311589842.0 and application name “Preparation of a small molecule RNA drug and its application in the treatment of diabetic cardiomyopathy”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present application relates to the field of nucleic acid drug technology, and in particular to a small molecule RNA drug, its preparation, and its application in the prevention and / or treatment of cardiomyopathy. Background Art

[0003] Diabetic heart disease (DHD) is a common complication in diabetic patients. The incidence of heart failure and mortality in patients with DHD is more than three times that of patients with non-diabetic heart function impairment, and the treatment effect is also weaker than that of patients with non-diabetic heart disease. Typical diabetic heart disease includes diabetic cardiomyopathy (DCM). This disease causes extensive focal necrosis of the myocardium on the basis of metabolic disorders and microvascular lesions, resulting in subclinical cardiac dysfunction and ultimately progressing to heart failure, arrhythmias, and cardiogenic shock. Patients with diabetic cardiomyopathy have a poor prognosis and currently have no effective treatment. Therefore, the search for novel pathogenesis, drug treatment targets, and treatment methods is the main research focus.

[0004] Nucleic acid molecular therapy, as an emerging treatment modality, has garnered widespread attention and research in preclinical and clinical research centers. Nucleic acid drug therapy is a current research hotspot, characterized by well-defined targets, faster and safer design, and rapid clinical development. Small nucleic acid drugs offer inherent advantages in the treatment of chronic diseases: 1) They directly regulate upstream gene expression and are relatively less susceptible to drug resistance; 2) their relatively long-lasting efficacy can significantly reduce dosing frequency, which holds immense clinical value for the treatment of many chronic diseases. A study analyzing a large health insurance company database explored the relationship between medication adherence and cardiovascular disease. The results showed a strong correlation between medication adherence and the incidence of all-cause mortality, myocardial infarction, stroke, or coronary revascularization surgery. Therefore, the advantages of small nucleic acid drugs, such as their long-lasting efficacy and resistance to drug resistance, have led the industry to recognize them as a new research and development direction for the future of cardiovascular disease treatment. However, the main bottlenecks in their application lie in their in vivo stability and targeted delivery. PCSK9 gene siRNA can reduce LDL cholesterol by 47.5% on the 210th day of administration, and this can last for more than 1440 days, with an average LDL-C cholesterol reduction of 44.2% over 4 years. ) has been approved by the China National Medical Products Administration as an adjunct to diet for the treatment of adult patients with primary hypercholesterolemia (heterozygous familial and non-familial) or mixed dyslipidemia. Zilebesi-rna is composed of a small interfering RNA (siRNA) covalently linked to an N-acetylgalactosamine (GalNac) ligand, which can specifically reduce the level of hepatic angiotensinogen mRNA, thereby reducing angiotensinogen levels and continuously lowering blood pressure for 24 weeks. This shows that a new stage has been opened for the use of nucleic acid drugs to treat cardiovascular diseases. This provides a new option for the prevention and control strategy of diabetic complications.

[0005] In preliminary studies of this application, it was found that diabetes-induced circulating-associated circRNAs (DICAR) - mm9_circ_008009 and hsa_circ_0131202 - have an inhibitory effect on diabetic encephalopathy (DCM). Therefore, DICAR and the synthetic DICAR-JP may be candidate drugs for the treatment of DCM. At the molecular level, DICAR-JP binds to valosin-containing protein (VCP) to form the DICAR-JP / VCP complex, which inhibits pyroptosis caused by advanced glycation end products (AGEs) through degradation of Med12 mediated by the ubiquitin-proteasome (Ub-Pr) pathway. DICAR-JP is the junction site that distinguishes DICAR from its parent gene, with a unique stem-loop structure, and DICAR-JP is the core functional fragment of DICAR that performs its function. However, the existing synthetic DICAR-JP cannot completely inhibit AGE-induced myocardial damage. Therefore, how to optimize the DICAR-JP sequence to make it more effective in cardioprotection is an urgent problem to be solved. Summary of the Invention

[0006] To address the above-mentioned problems in the prior art, the present application provides a small molecule RNA drug, its preparation, and its use in the prevention and / or treatment of cardiomyopathy. This small molecule RNA has a significant effect within 24 hours, has a high affinity for binding to the nascent polypeptide-associated complex α (NACα) protein, and has strong activity in inhibiting the expression of cell pyroptosis-related proteins ASC and GSDMD. It can effectively protect myocardial cells and enhance the therapeutic effect on diabetic cardiomyopathy, etc. At the same time, it has the advantages of low onset concentration and high biosafety, and has the potential for clinical drug development and application as a nucleic acid drug.

[0007] To achieve the above objectives, this application is specifically implemented through the following technical solutions:

[0008] The present application provides a small molecule RNA for treating diabetic cardiomyopathy, the nucleotide sequence of which is shown in SEQ ID NO.10.

[0009] In a second aspect, the present application provides a DNA molecule encoding the small molecule RNA as described above.

[0010] The third aspect of the present application provides a recombinant expression vector, which contains the DNA molecule described above.

[0011] In a fourth aspect, the present application provides a host cell, which carries the DNA molecule or the recombinant expression vector as described above.

[0012] In a fifth aspect, the present application provides the use of the small molecule RNA, the DNA molecule, the recombinant expression vector or the host cell described above in the preparation of a drug for treating cardiomyopathy.

[0013] In a sixth aspect, the present application provides a drug for preventing and / or treating cardiomyopathy, wherein the active ingredient is any one or more of the following ADs:

[0014] A, small RNA, the nucleotide sequence of which is shown in SEQ ID NO.10;

[0015] B, a DNA molecule encoding the small RNA described in A;

[0016] C. a recombinant expression vector carrying the DNA molecule described in B;

[0017] D. A host cell carrying the DNA molecule described in B or the recombinant expression vector described in C.

[0018] In addition, the concentration of the small molecule RNA is 1-50 nm; further, the concentration of the small molecule RNA is 30-50 nm.

[0019] The advantages and positive effects of this application are:

[0020] 1. In the present application, by mutating the 39th base of DICAR-JP from C to U, a novel small molecule RNA, namely DICAR-JP45, is obtained with a nucleotide sequence as shown in SEQ ID NO. 10. DICAR-JP45 has a high spatial structural stability, which is beneficial for improving the half-life of the drug in vivo, and its pharmacodynamics can be maintained for more than 24 hours.

[0021] 2. The small molecule RNA DICAR-JP45 provided in this application has a high affinity for binding to NACα protein and has strong activity in inhibiting the expression of cell pyroptosis-related proteins ASC and GSDMD. It can effectively protect myocardial cells and enhance the therapeutic effect on diabetic cardiomyopathy, etc., providing new ideas for the development and application of nucleic acid drugs for the treatment of heart damage caused by various diseases.

[0022] 3. The small molecule RNA DICAR-JP45 provided in this application has a half-effective concentration as low as 17.93nM in the treatment of cardiomyocyte damage caused by advanced glycation end products (AGEs). Compared with the half-effective concentration of 26.19nM of DICAR-JP, it has the characteristics of lower onset concentration and wider drug safety range. It has the potential for clinical drug development and application as a nucleic acid drug, high clinical value and good market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following briefly introduces the drawings required for describing the embodiments.

[0024] FIG1 is a spatial conformation diagram of DICAR-JPN binding to NACα protein in an embodiment of the present application;

[0025] FIG2 is a secondary structure diagram of DICAR-JP45 according to an embodiment of the present application;

[0026] FIG3 shows the effects of DICAR-JP45 and AGEs on the relative activity of AC16 cardiomyocytes after 24 h and 48 h of treatment in the present invention;

[0027] FIG4 shows the effects of gradient concentrations of DICAR-JP45 and DICAR-JP on the relative activity of AC16 cells after 24 hours of treatment with AGEs in the examples of the present application;

[0028] FIG5 is a trend diagram of the median effective concentration of DICAR-JP45 and DICAR-JP for AGEs in Examples of the present application;

[0029] FIG6 shows the effect of DICAR-JP45 and DICAR-JP on ASC protein expression in diabetic cardiomyopathy after 24 hours of treatment with AGEs in the examples of the present application, wherein A is an SDS-PAGE electrophoresis graph and B is a bar graph of the relative expression of ASC protein;

[0030] FIG7 shows the effect of DICAR-JP45 and DICAR-JP on GSDMD protein expression in diabetic cardiomyopathy after 24 hours of treatment with AGEs in the examples of the present application, wherein A is an SDS-PAGE electrophoresis graph and B is a bar graph of the relative expression of GSDMD protein;

[0031] FIG8 is an affinity curve of DICAR-JP45 and DICAR-JP binding to NACα protein in Examples of the present application;

[0032] Figure 9 shows the results of Example 6 of the present application; wherein A is a schematic diagram of the implementation scheme for db / db mice; B is the result of qPCR detection of DICAR-JP expression to evaluate AAV9-DICAR-JP infection of heart tissue; C is the result of small animal B-ultrasound detection of cardiac function; D is a representative gross picture of mouse heart tissue; E is the result of Masson staining of the four-chamber heart of mice; and F is a statistical graph of myocardial cell area. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solutions and advantages of this application more clear, the following further describes this application in detail with reference to the embodiments. The embodiments described herein are only used to explain this application and are not intended to limit this application.

[0034] Based on the information contained in this application, it is easy for those skilled in the art to make various changes to the precise description of this application without departing from the spirit and scope of the appended claims. It should be understood that the scope of this application is not limited to the defined processes, properties or components, as these embodiments and other descriptions are merely for the purpose of illustrating specific aspects of this application. In fact, various changes that those skilled in the art or related fields can obviously make to the embodiments of this application are encompassed within the scope of the appended claims.

[0035] For a better understanding of the present application and not to limit the scope of the present application, all numbers expressing amounts, percentages and other numerical values ​​used in the present application should be understood as being modified by the word "about" in all cases. The term "about" has its ordinary meaning and is used to indicate that a value includes the inherent variation of error of the device or method used to determine the value, or includes values ​​close to the value, for example, within 10% of the value (or range of values). Therefore, unless otherwise indicated, the numerical parameters listed in the specification and the appended claims are approximate values ​​and may vary depending on the desired properties sought to be obtained.

[0036] The terms "include," "comprising," "containing," "having," and similar expressions are non-limiting, i.e., other steps and other components that do not affect the result may be added. The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" will be considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0037] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the present application is described in detail below with reference to the accompanying drawings.

[0038] In a previous study of this application (literature: [Yuan, Q., Sun, Y., Yang, F. et al. CircRNA DICAR as a novel endogenous regulator for diabetic cardiomyopathy and diabetic pyroptosis of cardiomyocytes. Sig Transduct Target Ther 8, 99 (2023). https: / / doi.org / 10.1038 / s41392-022-01306-2]), a diabetes-induced circulating microRNA (DICAR) was discovered. At the cellular level, DICAR overexpression inhibited the effects of advanced glycation end products (AGEs) on GSDMD, NLRP3, caspase-1, and ASC activation, thereby helping to inhibit diabetic cardiomyocyte pyroptosis, while knocking down DICAR enhanced diabetic cardiomyocyte pyroptosis. At the molecular level, DICAR-VCP-Med12 degradation may be the underlying molecular mechanism of DICAR-mediated effects. After DICAR binds to valosin-containing protein (VCP), it inhibits AGE-induced pyroptosis through Med12 degradation mediated by the ubiquitin-proteasome (Ub-Pr) pathway. The synthetic DICAR junction part (DICAR-JP) showed similar results to the entire DICAR. This suggests that DICAR and the synthetic DICAR-JP may be candidate drugs for the treatment of diabetic cardiomyopathy (DCM). The aforementioned DICAR-JP nucleotide sequence is:

[0039] CAACCUCCGGGGCCACAAUAGCGAGAUUUGUAAGACUCCAGGGCCUCCCAG (see SEQ ID NO. 12).

[0040] Furthermore, ChIRP-MS experiments in previous studies have confirmed that DICAR strongly binds to NACα. NACα is a nascent polypeptide-associated complex (NAC) of a class of spliced ​​proteins, composed of an α subunit (NACα) and a β subunit (NACβ). It is an evolutionarily conserved and ubiquitously expressed protein essential for the survival of organisms. NAC binds to ribosome-associated nascent polypeptides and competes with the signal recognition particle (SRP) to prevent the mistargeting of cytoplasmic and mitochondrial proteins to the endoplasmic reticulum, thereby preventing endoplasmic reticulum stress. In some species and cell lines, NAC deficiency activates the endoplasmic reticulum stress response, ultimately leading to cell death through JNK and caspase activation. Therefore, NAC plays a crucial role in protein quality control and maintaining cellular homeostasis.

[0041] The activity of existing DICAR-JP sequences and structures in inhibiting AGEs-induced myocardial damage and protecting the heart needs to be improved. Therefore, optimizing the DICAR-JP nucleic acid sequence and increasing its binding ability to NACα so that it can better play a protective role in myocardial cells and thus have more effective cardioprotective effects and treat DCM is of great significance and has broad application prospects.

[0042] Based on this, the present invention provides a small molecule RNA, the nucleotide sequence of which is shown below:

[0043] CAACCUCCGGGGCCACAAUAGCGAGAUUUGUAAGACUCUAGGGCC UCCCAG (see SEQ ID NO. 10), wherein the bold and underlined sites are the mutation sites compared to DICAR-JP.

[0044] In order to optimize the DICAR-JP sequence fragment so that it can better play a protective role in cardiac cells, the present application subjected DICAR-JP to single-base mutations to obtain 64 mutant sequences DICAR-JPN (N is any integer from 1 to 64). The molecular docking software HDOCK was then used to evaluate the binding activity of the mutant sequences to the target protein NACα. Based on the docking score and the structural stability of the nucleic acid sequence, the mutant sequences with unreasonable spatial conformations were eliminated, and a total of 10 candidate sequences, including DICAR-JP4, DICAR-JP6, DICAR-JP18, DICAR-JP23, DICAR-JP27, DICAR-JP28, DICAR-JP29, DICAR-JP32, DICAR-JP40 and DICAR-JP45, were screened out. The molecular conformations of the above 10 candidate sequences are shown in Figure 1. The protective activity of the candidate sequences against cardiomyocytes treated with advanced glycation end products (AGEs) was further evaluated based on CCK8 assays. It was found that the cardiomyocyte viability was highest when DICAR-JP45 was added. At the same time, the pharmacodynamics experiments found that the half-maximal effect concentration (EC 50 ) was 17.93 nM, lower than DICAR-JP's 26.19 nM. This reveals that DICAR-JP45 is superior to DICAR-JP in resisting AGEs and has a lower onset concentration, demonstrating a good cardiomyocyte protective effect. Furthermore, DICAR-JP45 significantly inhibited the expression of ASC and GSDMD proteins compared to DICAR-JP, indicating that it can be used to treat diabetic cardiomyopathy by inhibiting AGE-induced cardiomyocyte pyroptosis, and its therapeutic effect in protecting against myocardial damage caused by diabetic cardiomyopathy is stronger than that of the original sequence DICAR-JP. Furthermore, SPR molecular interaction results showed that the affinity of DICAR-JP45 for NACα protein was 6.09 × 10 -9 (M), higher than DICAR-JP, indicating a better potential for cardiomyocyte protection.

[0045] The above results show that the present application greatly improves the spatial structural stability of the small molecule RNA DICAR-JP45 by mutating the 39th base from base C to base U, which is beneficial to increasing its half-life in vivo and ensuring that the drug effect is maintained for more than 24 hours. Figure 2 shows the secondary structure of DICAR-JP45; and after structural optimization, the affinity for binding to NACα protein is improved, and the activity of inhibiting the expression of cell pyroptosis-related proteins ASC and GSDMD is increased, thereby more effectively protecting myocardial cells and enhancing the damaging effects of advanced glycation end products (AGEs), providing a new candidate nucleic acid sequence for the development and application of nucleic acid drugs for the treatment of cardiac damage caused by various diseases; and the small nucleic acid RNA sequence DICAR-JP45 of the present application has the characteristics of lower effective concentration and wider drug safety range in disease treatment, and has greater potential for clinical drug development and application as a nucleic acid drug, and has good market development prospects and clinical value.

[0046] Using the small molecule RNA described in the above technical solution of this application or a DNA molecule, a recombinant expression vector or a host cell that can express the small molecule RNA described in the above technical solution as the active ingredient of the drug can inhibit the pyroptosis of myocardial cells and play a role in preventing, alleviating or treating cardiomyopathy.

[0047] Optionally, when the drug is formulated into a liquid preparation or an intravenous injection dosage form, the concentration of the small molecule RNA is 1-50 nm, preferably 30-50 nm.

[0048] The present invention is further described below with reference to specific examples. Experimental methods in the following examples, where specific conditions are not specified, generally follow the conditions recommended by the manufacturer. Materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0049] Example 1 Nucleic acid sequence optimization

[0050] The small RNA DICAR-JP was subjected to single-base mutation to obtain 64 mutant sequences DICAR-JP N (N is any integer from 1 to 64). The docking scores of the mutant sequences with the target protein NACα were calculated using the molecular docking software HDO CK. This score is a comprehensive score, and a more negative score indicates better binding ability, which is a suggestive score. Based on the docking score and the stability of the nucleic acid sequence structure, the mutant sequences with unreasonable spatial conformations were eliminated, and a total of 10 candidate sequences, DICAR-JP4, DICAR-JP6, DICAR-JP18, DICAR-JP23, DICAR-JP27, DICAR-JP28, DICAR-JP29, DICAR-JP32, DICAR-JP40 and DICAR-JP45, were screened out. The specific nucleotide sequences and docking scores are shown in Table 1. The spatial conformations of the 10 candidate sequences bound to the NACα protein are shown in Figure 1. 1 to DICAR-JP10 represent the aforementioned 10 candidate sequences, respectively. FIG2 shows the secondary structure of DICAR-JP45.

[0051] Table 1 Nucleotide sequences of candidate sequences in this example and their docking scores for binding to NACα protein

[0052] Example 2 Nucleic acid sequence screening

[0053] This example uses a CCK8 assay to evaluate the protective activity of candidate sequences against cardiomyocytes treated with advanced glycolysis end products (AGEs, purchased from Bioss, catalog number bs-1158P) to screen for small RNAs with superior cardiomyocyte protective effects. The assay includes the following steps:

[0054] Cell culture: Human cardiomyocytes AC16 (purchased from Guangzhou Geneo Biotechnology Co., Ltd., sourced from ATCC) were cultured in DMEM high-glucose complete medium (containing 10% FBS and 1% triple antibody) at 37°C in an incubator containing 5% CO2.

[0055] Experimental groups: control group, AGEs (200 μg / mL, 24h / 48h), nucleic acid negative control group (negative control, NC, 20 nM, 24h), DICAR-JP4 (20 nM, 24h), DICAR-JP6 (20 nM, 24h), DICAR-JP18 (20 nM, 24h), DICAR-JP23 (20 nM, 24h), DICAR-JP27 (20 nM, 24h), DICAR-JP28 (20 nM, 24h), DICAR-JP29 (20 nM, 24h), DICAR-JP32 (20 nM, 24h), DICAR-JP40 (20 nM, 24h), DICAR-JP45 (20 nM, 24h), DICAR-JP (20 nM, 24h).

[0056] Nucleic acid transfection method: Dilute 2 μL of medium (50 μL) RNAi MAX (purchased from Thermo Fisher Scientific, product number 13778-500) and DICAR-JPN were added, and the two reagents were thoroughly mixed and incubated at room temperature for 5 minutes. RNAi MAX-DICAR-JPN complex was incubated with AC16 cell supernatant (50 μL / well, 24 hours) in a 24-well plate. The complete medium was then replaced with serum-free DMEM, and the cell cycle was synchronized for 2 hours. AC16 cells were treated with 200 μg / mL of AGEs for 24 hours and 48 hours, and cell viability was assessed using a CCK8 assay.

[0057] CCK8 cell viability assessment: Wash cells twice with PBS in the dark, add serum-free DMEM medium containing CCK8 (CCK8:DMEM = 1:9); return the plate to the cell culture incubator and incubate for 1 hour. Measure the absorbance at 450 nm using a microplate reader and calculate cell viability (%) according to the following formula:

[0058] Cell viability = [(A 450nm Experiment-A 450nm blank)] / [(A 450nm Control-A 450nm blank)] × 100%, where blank refers to serum-free DMEM medium.

[0059] Figure 3 shows the relative survival of cardiomyocytes in different treatment groups. The results showed that DICAR-JP40 and DICAR-JP45 had a significant protective effect on cardiomyocytes after 24 hours of AGEs (200 μg / mL) treatment compared with DICAR-JP. The relative cell activity of these two groups was significantly higher than that of the model group. The cell activity of DICAR-JP45 was even close to that of the untreated group. The protective effects of both disappeared around 48 hours.

[0060] Example 3 DICAR-JP45 pharmacodynamics test

[0061] DICAR-JP45EC 50 Calculation: To compare the safety of DICAR-JP45 and DICAR-JP, the experiments were divided into the normal control group, AGEs (200 μg / mL), NC (50 nM, 24 hours) + AGEs (200 μg / mL, 24 hours), metformin (20 μM, 24 hours) + AGEs (200 μg / mL, 24 hours), and DICAR-JP45 / DICAR-JP (1 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 24 hours) + AGEs (200 μg / mL, 24 hours). CCK8 cell activity was assayed 24 hours after cell treatment. The absorbance was measured at 450 nm using a microplate reader to calculate the median effective concentration (EC50). 50 ). Calculate EC according to the following formula 50 :

[0062] EC 50 ={[(A 450nm Nucleic Acid-A 450nm blank)]-[(A 450nm Model-A 450nm blank)]} / {[(A 450nm Negative-A 450nm blank)]-[(A 450nm Model-A 450nm blank)]}×100%, where blank refers to serum-free DMEM medium.

[0063] Figure 4 shows the relative survival of cardiomyocytes with increasing concentrations of DICAR-JP45 and DICAR-JP. The results show that the protective effects of DICAR-JP and DICAR-JP45 continue to increase within the concentration gradient range. The EC value of DICAR-JP45 was calculated by fitting the curve (see Figure 5). 50 =17.93 nM, EC of DICAR-JP 50=26.19 nM, indicating that DICAR-JP45 has a better effect than DICAR-JP in resisting myocardial cell damage caused by AGEs, has a lower half effective dose and higher biosafety, and therefore has greater potential for drug development and application.

[0064] Example 4 Effect of DICAR-JP45 Treatment on the Expression of Pyroptosis-Related Proteins in Diabetic Cardiomyopathy Model

[0065] AC16 cells were transfected with DICAR-JP45 (40 nM) and DICAR-JP sequences for 24 hours. The cells were then starved for 2 hours using serum-free medium and treated with AGEs (200 μg / mL) for 24 hours. Following treatment, the expression of pyroptosis-associated proteins GSDMD and apoptosis-associated speck-like protein containing a CARD (ASC) was assessed by Western blotting, using β-actin as an internal control. The Western blotting protocol was as follows:

[0066] Rinse cells twice with PBS, add 100 μL / well of protein lysis buffer, and lyse on ice for 30 minutes. Collect the lysate and centrifuge at 12,000 rpm and 4°C for 30 minutes. After centrifugation, collect the supernatant. Mix the protein sample with protein loading buffer in a 4:1 ratio, heat in a 95°C metal bath for 10 minutes, and store the sample at 4°C. Separate proteins by 12.5% ​​sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) at 80 V for 30 minutes, followed by 110 V. After protein electrophoresis is complete, transfer to the membrane at a constant current of 300 mA for 90 minutes. The membrane was removed and placed in an antibody incubation box, washed three times with TBST for 5 minutes, and blocked with rapid blocking buffer for 30 minutes. The membrane was incubated with primary antibodies (Rabbit polyclonal antibody to GSDMD purchased from Affinity, Catalog No. AF4012; ASCASC / TMS1 / PYCARD (B-3) antibody purchased from Santa Cruz, Catalog No. sc-514414; β-actin monoclonal antibody purchased from Proteinuech, Catalog No. 66009-1-Ig) at 4°C overnight, washed three times with TBST for 5 minutes, and incubated with secondary antibodies (HRP-conjugated affinipure goat anti-mouse IgG (H+L, Proteintech, SA00001-1); HRP-conjugated affinipure goat anti-Rabbit IgG (H+L) (Proteintech, Catalog No. SA00001-2)) at room temperature for 50 minutes. The membrane was washed three times with TBST for 10 minutes. Signal detection was performed using an enhanced chemiluminescence reagent, and Western blot analysis was performed using Image J software. The expression of GSDMD and ASC is shown in Figures 6-7, where Figure A is an SDS-PAGE electrophoresis diagram and Figure B is a bar graph of relative protein expression. In this example, the groups were divided into a negative control group (40 nM NC, 24 hours) + AGEs (200 μg / mL, 24 hours), a DICAR-JP45 / DICAR-JP (40 nM, 24 hours) + AGEs (200 μg / mL, 24 hours), and a group treated with NC, DICAR-JP45, or DICAR-JP alone. The groups in the upper and lower figures correspond one to one.

[0067] Pyroptosis is primarily mediated by the activation of multiple caspases, including caspase-1, through the inflammasome. Activated inflammasomes recruit the inflammasome adaptor protein ASC and the protease caspase-1 to form a macromolecular complex. Activated caspase-1 directly cleaves gasdermin D (GSDMD), causing cell membrane perforation and ultimately cell death. Figures 6-7 show that after treatment of human cardiomyocytes AC16 with DICAR-JP45 or DICAR-JP, DICAR-JP45 significantly inhibited the expression of pyroptosis-related proteins ASC and GSDMD compared to DICAR-JP. This suggests that DICAR-JP45 has the ability to protect against diabetic cardiomyopathy-induced myocardial damage by inhibiting cardiomyocyte pyroptosis, and its efficacy is superior to that of DICAR-JP.

[0068] Example 5 Affinity of DICAR-JP45 for NACα Protein in Cardiac Myocytes

[0069] The localized surface plasmon resonance (LSPR) technique (Wuhan Yanjin Biotechnology Co., Ltd.) was used to compare the binding affinities of DICAR-JP45 and DICAR-JP to NACα protein. NC, DICAR-JP45, and DICAR-JP were set at 7.8 nM, 15.625 nM, 31.25 nM, 62.5 nM, and 125 nM, respectively. The binding response values ​​(vertical axis) of NACα protein and the target concentration RNA sequence were observed in DEPC aqueous solution at 25°C.

[0070] Figure 8 shows the affinity curves of DICAR-JP45 and DICAR-JP binding to NACα protein. The affinity constants obtained by curve fitting and calculation are shown in Table 2. off The constant used to characterize the dissociation rate of DICAR-JP45 and NACα protein, the binding coefficient K on Affinity constant K, used to characterize the binding rate of DICAR-JP45 to NACα protein D K off / K on The ratio of DICAR-JP45 to NACα protein represents the equilibrium dissociation constant between DICAR-JP45 and NACα protein. D (M) = 6.09 × 10 -9 DICAR-JP and NACα protein K D (M) = 3.83 × 10 -8 It can be seen that DICAR-JP45 has a stronger affinity and is more conducive to regulating the synthesis and folding of downstream proteins by binding to NACα protein, thereby exerting the potential for cardiomyocyte protection.

[0071] Table 2 Results of affinity-related parameters of DICAR-JP45 and DICAR-JP

[0072] It should be noted that the nucleotide sequence of the nonsense sequence (NC) used for negative control in the above examples of this application is as follows: UUGUACUACACAAAAGUACUG (see SEQ ID NO.11).

[0073] Example 6 AAV9-DICAR-JP and AAV9-DICAR-JP45 improve cardiac function in db / db mice

[0074] Shanghai GeneCare Gene Medical Technology Co., Ltd. was commissioned to construct AAV9-DICAR-JP and AAV9-DICAR-JP45 viruses based on the sequences shown in SEQ ID NO. 12 and SEQ ID NO. 10. These constructs include: a viral plasmid backbone consisting of CMV bGlobin-EGFP-MCS-WPRE-hGH polyA, vector number GV412, and cloning sites NheI and Hind III; and a microRNA uplink construct that extends the microRNA precursor sequence approximately 100 bp upstream and downstream of the genome to ensure efficient microRNA cleavage. Amplification primers for the target fragment are shown in Table 3.

[0075] Table 3 Amplification primers for target fragments

[0076] Mice were divided into db / m+AAV9-GFP (control empty virus, 5×10 11 vg), db / db+AAV9-GFP (5×10 11 vg), db / db+AAV9-DICAR-JP(5×10 11 vg), db / db+AAV9-DICAR-JP45(5×10 11 vg), db / db + dapagliflozin (DAPA: 1.5 mg / kg / day). AAV9 was injected into the tail vein of mice at 4 months of age. DAPA was administered orally to the db / db group at 5 months of age, while the db / m group served as a control group and did not receive DAPA. Cardiac function was assessed by small animal ultrasound at 5, 6, and 7 months of age, cardiac remodeling was assessed by Masson staining, and myocardial hypertrophy was assessed by WGA staining.

[0077] Figure 9 shows that AAV9-DICAR-JP and AAV9-DICAR-JP45 improved cardiac function to varying degrees three months after tail vein injection in db / db mice at four months of age. The EF value in db / db mice was 57.5%, while DICAR-JP45 improved it to 71.07%. The E' / a value in db / db mice was 1.14, which was improved to 1.73 by DICAR-JP (p < 0.05), and to 1.45 by DICAR-JP45, though these improvements were not statistically significant. In addition, DICAR-JP45 improved FS and LVVs, and the effects were comparable to those of a DAPA-positive drug. WGA results showed that DICAR-JP effectively inhibited cardiomyocyte hypertrophy, while DICAR-JP45 had no such effect. Thus, animal studies suggest that DICAR-JP45 has some effect on improving cardiac function in DCM, but has no significant effect on myocardial hypertrophy, whereas DICAR-JP effectively improves myocardial hypertrophy. The two nucleic acid drug candidates may have different protective effects on the heart due to their different sequences.

[0078] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements and improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application.

Claims

1. A small molecule RNA, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

10.

2. A DNA molecule, characterized in that The DNA molecule encodes the small molecule RNA according to claim 1.

3. A recombinant expression vector, characterized in that: The recombinant expression vector contains the DNA molecule according to claim 2.

4. A host cell, characterized in that The host cell carries the DNA molecule according to claim 2 or the recombinant expression vector according to claim 3.

5. Use of the small molecule RNA according to claim 1, the DNA molecule according to claim 2, the recombinant expression vector according to claim 3 or the host cell according to claim 4 in the preparation of a drug for treating cardiomyopathy.

6. A drug for preventing and / or treating cardiomyopathy, characterized in that: The active ingredient is any one or more of the following ADs: A. The small molecule RNA according to claim 1; B. The DNA molecule according to claim 2; C. The recombinant expression vector according to claim 3; D. The host cell according to claim 4.

7. The drug according to claim 6, characterized in that The dosage form of the drug is a liquid preparation.

8. The drug according to claim 7, characterized in that The liquid preparation is an intravenous injection.

9. The drug according to any one of claims 6 to 8, characterized in that When the active ingredient is a small molecule RNA, the concentration of the small molecule RNA in the drug is 1-50 nm.

10. The drug according to claim 9, characterized in that The concentration of the small molecule RNA in the drug is 30-50 nm.

11. The drug according to any one of claims 6 to 8, characterized in that The cardiomyopathy is diabetic cardiomyopathy.

12. Use of the small molecule RNA according to claim 1, the DNA molecule according to claim 2, the recombinant expression vector according to claim 3, the host cell according to claim 4 or the drug according to any one of claims 6 to 11 in preventing, alleviating or treating cardiomyopathy.

13. The use according to claim 12, characterized in that: The cardiomyopathy is diabetic cardiomyopathy.

14. The use according to claim 13, characterized in that The treatment of cardiomyopathy is the treatment of myocardial cell damage caused by diabetic cardiomyopathy.

15. The use according to claim 14, characterized in that: The half effective concentration of the small molecule RNA for treating myocardial cell injury is 17.93 nM.

16. Use of the small molecule RNA according to claim 1, the DNA molecule according to claim 2, the recombinant expression vector according to claim 3, the host cell according to claim 4 or the drug according to any one of claims 6 to 11 in inhibiting myocardial cell pyroptosis.

17. Use of the small molecule RNA according to claim 1, the DNA molecule according to claim 2, the recombinant expression vector according to claim 3, the host cell according to claim 4 or the drug according to any one of claims 6 to 11 in inhibiting the expression of ASC protein and / or GSDMD protein.

Citation Information

Patent Citations

  • Nucleic acid medicine for diabetic cardiomyopathy and application thereof

    CN113975409A

  • Application of circular RNA (Ribonucleic Acid) in preparation of medicine for preventing and / or treating ischemic stroke

    CN116785309A

  • Micromolecule RNA candidate drug sequence optimization and application of micromolecule RNA candidate drug sequence optimization in treatment of diabetic cardiomyopathy

    CN117701563A

  • Oligonucleotide decoys and methods of use

    US20090099108A1