Corynebacterium sp. microorganism having improved l-amino acid productivity and method for producing l-amino acids using same

Abstract

The present invention relates to a Corynebacterium sp. microorganism having improved L-amino acid productivity and a method for producing L-amino acids using same. The Corynebacterium sp. microorganism can have an improved production yield of L-amino acids, compared to a parent strain, due to weakened activity or inactivity of a carotenoid biosynthesis enzyme.

Description

Microorganisms of the genus Corynebacterium with enhanced L-amino acid production capacity and methods for producing L-amino acids using the same

[0001] The present invention relates to a microorganism of the genus Corynebacterium having improved L-amino acid production ability and a method for producing L-amino acid using the same.

[0002] Amino acids are the basic building blocks of proteins in living organisms. They are divided into essential amino acids, which are not synthesized or are difficult to synthesize in the body and must be consumed through food, and nonessential amino acids, which can be synthesized metabolically within the body. Naturally synthesized L-amino acids are used not only as amino acid fortifiers but also as raw materials in various fields, including food, health functional foods, pharmaceuticals, and cosmetics.

[0003] L-amino acids have been industrially produced through fermentation using naturally occurring microorganisms or mutant microorganisms modified to enhance amino acid production. Recently, genetic recombination technology has been utilized in microorganisms such as Escherichia coli and Corynebacterium to improve L-amino acid production efficiency. Using genetic recombination technology, amino acid production can be enhanced by increasing the activity of enzymes involved in amino acid biosynthesis or suppressing feedback from produced L-amino acids. Furthermore, amino acid production can be improved by regulating the expression of amino acid export genes. U.S. Patent No. 5,972,663 describes artificially overexpressing genes mex, bmr, qacA, etc. of various strains including E. coli to improve the production ability of L-cysteine, L-cystine, N-acetylserine, and thiazolidine derivatives, and European Patent No. 1016710 describes artificially overexpressing genes yahN, yeaS, yfiK, and yggA of Escherichia spp. strains to improve the production ability of L-glutamic acid, L-lysine, L-threonine, L-alanine, L-histidine, L-proline, L-arginine, L-valine, and L-isoleucine, and Korean Patent No. 10-1023925 describes artificially overexpressing genes yddG of Escherichia spp. strains to improve the production ability of L-tryptophan, It is described that the production of L-phenylalanine is improved.

[0004] However, since various proteins such as enzymes, transcription factors, and transport proteins are involved in the biosynthetic pathway of amino acids, much research is still needed to develop recombinant microorganisms or mutant strains with improved L-amino acid production ability.

[0005] [Prior Art Literature]

[0006] [Patent Document]

[0007] U.S. Patent No. 5,972,663

[0008] European Patent No. 1016710

[0009] Korean Patent No. 10-1023925

[0010] The purpose of the present invention is to provide a microorganism of the genus Corynebacterium having improved L-amino acid production ability.

[0011] In addition, the present invention aims to provide a method for producing L-amino acid using the above microorganism.

[0012] One aspect of the present invention provides a microorganism of the genus Corynebacterium having an enhanced L-amino acid production ability by weakening or inactivating the activity of a carotenoid biosynthetic enzyme.

[0013] The term “carotenoid biosynthetic enzyme” used in the present invention refers to an enzyme involved in the carotenoid biosynthetic pathway. In the case of Corynebacterium glutamicum, it contains the glycosylated C50 carotenoid decaprenoxanthin as a yellow pigment, which is synthesized from isopentenyl pyrophosphate generated in the non-mevalonate pathway as a starting material through farnesyl pyrophosphate, geranylgeranyl pyrophosphate, lycopene, and flavuxanthin. It is known that genes such as crtE, crtB, crtB2, crtI, crtEb, and crtYe / f are involved in this carotenoid biosynthetic pathway.

[0014] The above crtB gene encodes phytoene synthase and is a cluster including the Cgl0626 (geranylgeranyl pyrophosphate synthase) gene, the Cgl0624 (phytoene / squalene synthetase) gene, and the Cgl0623 (phytoene dehydrogenase and related proteins) gene.

[0015] The above crtB2 gene encodes phytoene synthase and is a cluster including the Cgl2433 (phytoene / squalene synthetase) gene, the Cgl2432 (phytoene dehydrogenase and related proteins) gene, and the Cgl2431 (phytoene dehydrogenase and related proteins) gene.

[0016] The carotenoid biosynthetic enzyme in the present invention may be a polypeptide having the activity of phytoene synthase encoded by a crtB gene, a crtB2 gene, or a gene constituting a crtB / crtB2 gene cluster, but is not limited thereto.

[0017] Nucleic acid sequence and protein sequence information for the above carotenoid biosynthetic enzyme can be obtained through known sequence databases (e.g., GenBank, UniProt).

[0018] As used herein, “weakening of activity” means that the expression level of a gene encoding a protein such as a target enzyme, transcription factor, transport protein, etc. is reduced compared to the original microorganism, i.e., a wild-type strain or a strain before modification. Such weakening of activity includes cases where the activity of the protein itself is reduced compared to the activity of the protein possessed by the original microorganism through nucleotide substitution, insertion, deletion, or a combination thereof encoding the gene, and cases where the overall level of protein activity within the cell is lower than that of the wild-type strain or a strain before modification due to inhibition of expression or translation of the gene encoding it, and combinations thereof.

[0019] According to one specific example of the present invention, the weakening of the activity of the carotenoid biosynthesis enzyme may be due to insertion, substitution, deletion or a combination thereof of all or part of the gene encoding the carotenoid biosynthesis enzyme.

[0020] “Inactivation” as used in the present invention means a case where the expression of a gene encoding a protein such as an enzyme, transcription factor, or transport protein is not expressed at all compared to the original microorganism, i.e., a wild type strain or a strain before modification, or where the expression is not active.

[0021] According to one specific example of the present invention, the gene encoding the carotenoid biosynthetic enzyme may be at least one selected from the group consisting of Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432, and Cgl2431.

[0022] According to one specific example of the present invention, the Cgl0626 gene may include the base sequence of SEQ ID NO: 1 and encode the amino acid sequence of SEQ ID NO: 2. In addition, the Cgl0624 gene may include the base sequence of SEQ ID NO: 3 and encode the amino acid sequence of SEQ ID NO: 4. In addition, the Cgl0623 gene may include the base sequence of SEQ ID NO: 5 and encode the amino acid sequence of SEQ ID NO: 6. In addition, the Cgl2433 gene may include the base sequence of SEQ ID NO: 7 and encode the amino acid sequence of SEQ ID NO: 8. In addition, the Cgl2432 gene may include the base sequence of SEQ ID NO: 9 and encode the amino acid sequence of SEQ ID NO: 10. In addition, the Cgl2431 gene may include the base sequence of SEQ ID NO: 11 and encode the amino acid sequence of SEQ ID NO: 12.

[0023] The base sequence or amino acid sequence of the carotenoid biosynthetic enzyme according to the present invention may be composed of or essentially include a sequence having 70% or more, 80% or more, 90% or more, 98% or more, 99% or more, or 99.9% or more homology with the base sequence of SEQ ID NO: 1, 3, 5, 7, 9, or 11, or the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, or 12, and may have an original function.

[0024] As used herein, “improved productivity” means increased productivity of L-amino acids compared to the parent strain. The parent strain refers to a wild type or mutant strain that is the target of mutation, and includes a strain that is directly the target of mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a wild type Corynebacterium microorganism or a Corynebacterium microorganism or strain that has been mutated from the wild type.

[0025] The above-mentioned Corynebacterium genus microorganism may be known in the art, and examples thereof include Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi or Corynebacterium flavescens.

[0026] According to one specific example of the present invention, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0027] The Corynebacterium genus microorganism with improved L-amino acid production ability according to the present invention can have improved L-amino acid production ability by weakening or inactivating the activity of carotenoid biosynthesis enzymes.

[0028] According to one specific example of the present invention, the Corynebacterium genus microorganism having improved L-amino acid production ability may be one in which at least one selected from the group consisting of Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432 and Cgl2431 encoding carotenoid biosynthetic enzymes is deleted.

[0029] Specifically, the Corynebacterium genus microorganism having improved L-amino acid production ability exhibits increased L-amino acid production ability compared to the parent strain, and in particular, the L-amino acid production is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, 7.5 times, 8 times, 8.5 times, It may be increased by, but is not limited to, 9x, 9.5x, 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, or 100x.

[0030] According to one specific example of the present invention, the L-amino acid may be at least one selected from the group consisting of L-alanine, L-isoleucine, L-valine, L-leucine, L-methionine, L-asparagine, L-cysteine, L-glutamine, L-serine, L-threonine, L-phenylalanine, L-tryptophan, L-tyrosine, L-aspartic acid, L-glutamic acid, L-arginine, L-histidine, L-lysine, L-glycine, L-proline, and L-citrulline.

[0031] For example, the L-amino acid may be, but is not limited to, L-arginine, L-citrulline, L-lysine or L-glutamine.

[0032]

[0033] A microorganism of the genus Corynebacterium according to one specific example of the present invention can be implemented through a recombinant vector that deletes a gene encoding a carotenoid biosynthetic enzyme from a parent strain.

[0034] The term "vector" as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene into a host cell. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences operably linked to allow the gene insert to be expressed, and "operably linked" means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and a "regulatory sequence" includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating the termination of transcription and translation.

[0035] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0036] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0037] The "recombinant vector" used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell's genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0038] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0039] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0040] When transforming prokaryotic cells to produce recombinant microorganisms, various intestinal bacteria and strains such as E. coli DH5α, E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, E. coli XL1-Blue, Corynebacterium genus, Bacillus genus such as Bacillus subtilis and Bacillus thuringiensis, Salmonella typhimurium, Serratia marcescens and Pseudomonas genus may be used as host cells, but are not limited thereto.

[0041] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0042] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0043] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0044] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0045] Genes inserted into the recombinant vector for transformation of the present invention can be substituted into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0046] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0047]

[0048] In addition, another aspect of the present invention provides a method for producing L-amino acids, comprising the steps of culturing the above-described Corynebacterium microorganism in a medium; and recovering L-amino acids from the microorganism or the medium in which the microorganism is cultured.

[0049] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0050] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0051] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0052] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0053] According to one specific example of the present invention, the step of recovering L-amino acids from the cultured Corynebacterium microorganism and the medium in which the microorganism is cultured may collect or recover the L-amino acids produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0054] According to one specific example of the present invention, the step of recovering the L-amino acid may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0055] According to one specific example of the present invention, the step of recovering the L-amino acid may include a process of purifying the L-amino acid.

[0056] According to one specific example of the present invention, the L-amino acid may be at least one selected from the group consisting of L-alanine, L-isoleucine, L-valine, L-leucine, L-methionine, L-asparagine, L-cysteine, L-glutamine, L-serine, L-threonine, L-phenylalanine, L-tryptophan, L-tyrosine, L-aspartic acid, L-glutamic acid, L-arginine, L-histidine, L-lysine, L-glycine, L-proline, and L-citrulline.

[0057] For example, the L-amino acid may be, but is not limited to, L-arginine, L-citrulline, L-lysine or L-glutamine.

[0058] The Corynebacterium microorganism according to the present invention can improve the production yield of L-amino acids compared to the parent strain by weakening or inactivating the activity of carotenoid biosynthesis enzymes.

[0059] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0060]

[0061] Example 1. Production of a strain for producing L-arginine with a disrupted gene for carotenoid biosynthesis enzymes.

[0062] To produce a strain in which one or more of the Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432 and Cgl2431 genes constituting carotenoid biosynthetic enzymes were disrupted in an L-arginine-producing strain derived from Corynebacterium glutamicum, Corynebacterium glutamicum 14GR (KCCM13219P) and E. coli DH5a (HIT Competent cells™, Cat No. RH618), which are L-arginine-producing strains, were used.

[0063] The above Corynebacterium glutamicum 14GR was cultured at 30°C in ARG-broth medium (pH 7.2) containing 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, and 40 g of (NH4)2SO4 in 1 L of distilled water.

[0064] The above E. coliDH5a was cultured at 37°C on LB medium containing 10.0 g of tryptone, 10.0 g of NaCl, and 5.0 g of yeast extract in 1 L of distilled water.

[0065] The antibiotic kanamycin was a product from Sigma.

[0066] DNA sequencing analysis and gene synthesis were performed by Macrogen, Inc.

[0067]

[0068] 1-1. Recombinant vector

[0069] A recombinant vector was constructed to disrupt one or more of the Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432, and Cgl2431 genes that constitute carotenoid biosynthetic enzymes. A 600-650 bp region on the left arm and a 600-650 bp region on the right arm based on the start and stop codons of each gene in the Corynebacterium glutamicum genome were amplified by PCR, linked using the overlap PCR method, and cloned into the pk19mobsacB (ATCC, 87098) vector. To construct the plasmid, the primers in Table 1 below were used to amplify each gene fragment.

[0070] Primer name Primer (5'-3') Sequence number Cgl0626 and Cgl0624 Destruction primer LF1tgattacgccGCATCGCCTCTCCACGAGTG13LF2GCATCGCCTCTCCACGAGTG14LR1TCGTTGTATATGGCGCTTTA15LR2AAATTCCCAATCGTTGTATA16RF1TTGGGAATTTATGAAGGTCTCGACTAAAAC17RF2ATGAAGGTCTCGACTAAAAC18RR1GGAAGACAGGAAGACTGCTG19RR2TAGTGGGTCGGGAAGACAGG20Cgl0623 Destruction primer PrimerLF1tgattacgccGCTTATGGTGAAACTGCCCG21LF2GCTTATGGTGAAACTGCCCG22LR1TTTCTGTAGATGCTCATAGA23LR2tCACGAATTCTTTCTGTAGA24RF 1GAATTCGTGaATTTTGATCCCTATCATCGA25RF2ATTTTGATCCCTATCATCGA26RR1AGGTTATCAAATATGATAGT27RR2CCAAACCATGAGGTTATCAA28Cgl2433Shred PrimerLF1tgattacgccGGGGACCGACCATCATCCAC29LF2GGGGACCGACCATCATCCAC30LR1ACCGCGAGAAATCCAGACAA31LR2AGGAAACTTTACCGCGAGAA32R F1AAAGTTTTCCTGTGGAAAGAAGTGTTTCAAA33RF2GTGGAAAGAAGTGTTTCAAA34RR1GGGTAGCTTAAGATTTGGCG35RR2GAAAACTGCGGGGTAGCTTA36Cgl2432 and Cgl2431 crushing PrimerLF1tgattacgccTCAGTTTGTCCGTTCCTTTT37LF2TCAGTTTGTCCGTTCCTTTT38LR1AACACTTCTTTCcacATTGC39LR2TCATTTTTGAAACACTTCTT 40RF1TCAAAAATGACCTGGAGCGGCGGGTCCATT41RF2CCTGGAGCGGGCGGGTCCATT42RR1GAATGTTGGTGAACCATTTG43RR2TCGGCTGCATGAATGTTGGT44

[0071]

[0072] PCR was performed using the above primers under the following conditions. Using a thermocycler (TP600, TAKARA BIO Inc., Japan), 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) was added to the reaction solution. 1 pM of oligonucleotides and 10 ng of chromosomal DNA of Corynebacterium glutamicum ATCC 13032 were used as templates, and 25 to 30 cycles were performed in the presence of 1 unit of pfu-X DNA polymerase mixture (Solgent). PCR was performed under the following conditions: (i) denaturation step: 94°C for 30 seconds, (ii) annealing step: 58°C for 30 seconds, and (iii) extension step: 72°C for 1 to 2 minutes (providing a polymerization time of 2 minutes per 1 kb).

[0073] The gene fragment thus produced was cloned into the pk19mobsacB vector using self-assembly cloning. The vector was transformed into E. coliDH5a, plated on LB agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was accurately present in the vector. The vector was then isolated and used for recombination in a Corynebacterium glutamicum strain.

[0074] As a common process in the above method, the amplification of the corresponding genes was performed by PCR from the genomic DNA of Corynebacterium glutamicum ATCC 13032, and then inserted into the pk19mobsacB vector by self-assembled cloning according to the strategy, and then selected in E. coliDH5a. Chromosomal base substitution was performed by individually amplifying each fragment of the gene and producing the target DNA fragment by overlap PCR. For the genetic manipulation, Ex Taq polymerase (Takara) and Pfu polymerase (Solgent) were used as PCR amplification enzymes, and various restriction enzymes and DNA modifying enzymes were used from NEB products, and were used according to the supplied buffer and protocol.

[0075] The Cgl0626 and Cgl0624 fragmentation recombinant vectors produced in this manner were designated CD1, the Cgl0623 fragmentation recombinant vector was designated CD2, the Cgl2433 fragmentation recombinant vector was designated CD3, and the Cgl2432 and Cgl2431 fragmentation recombinant vectors were designated CD4.

[0076]

[0077] 1-2. Corynebacterium glutamicum mutant strain

[0078] Mutant strains were prepared using the constructed cloning vectors CD1 to CD4. The strain prepared using CD1, a Cgl0626 and Cgl0624 fragmentation recombination vector, was named DR1, the strain prepared using CD2, a Cgl0623 fragmentation recombination vector, was named DR2, the strain prepared using CD3, a Cgl2433 fragmentation recombination vector, was named DR3, and the strain prepared using CD4, a Cgl2432 and Cgl2431 fragmentation recombination vector, was named DR4. The process of preparing each recombinant strain is as follows.

[0079] The cloning vector was prepared to have a final concentration of 1 μg / μl or higher, and the first recombination was induced in Corynebacterium glutamicum 14GR using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). At this time, the electroporated strain was spread on an agar medium containing 50 μg / μl of kanamycin, and colonies were isolated. Then, whether the strain was properly inserted into the induced site in the genome was confirmed through PCR and base sequence analysis. To induce the second recombination, the isolated strain was inoculated into a liquid medium, cultured for more than one night, and spread on an agar medium containing 10% sucrose to isolate colonies. After confirming the resistance to kanamycin among the finally isolated colonies, the presence or absence of the corresponding gene was confirmed through base sequence analysis among the strains without antibiotic resistance (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, Corynebacterium glutamicum mutant strains DR1, DR2, DR3, and DR4 capable of producing L-arginine, in which the gene encoding the carotenoid biosynthetic enzyme was disrupted, were constructed.

[0080]

[0081] Experimental Example 1. Evaluation of L-arginine production capacity of L-arginine producing strain with disrupted carotenoid biosynthetic enzyme gene.

[0082] The L-arginine production ability of the parent strain Corynebacterium glutamicum 14GR and the L-arginine production Corynebacterium glutamicum DR1, DR2, DR3 and DR4 produced in Example 1 was evaluated.

[0083] Each strain was patched onto a flask-derived solid medium and cultured at 30°C for 24 hours. The cultured colonies were inoculated into 10 ml of a flask titer medium and cultured at 32°C, 200 rpm, for 30 hours. The composition of the medium used here is shown in Table 2 below. After the culture was completed, the culture solution was diluted 50-fold with distilled water, filtered through a 0.45 μm filter, and then the L-arginine production was analyzed using high-performance liquid chromatography (HPLC) (Agilent technologies 1260 infinity, Agilent technologies) equipped with a column (DionexIonPacTM CS12A) and a UV detector (195 mm), and the results are shown in Table 3 below.

[0084] Flask starter medium solid medium ( / L) 98% Glucose 10.5 g, Beef extract 1 g, Yeast extract 4 g, Polypeptone 2 g, NaCl 2 g, (NH4)2SO4 40 g, Agar 20 gFlask titer medium ( / L) 98% Glucose 120 g, MgSO4 1 g, KH2PO4 2 g, (NH4)2SO4 45 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g

[0085] strain OD 610 L-Arginine (%) Yield (%) 14GR40.02.126.4DR137.72.531.3DR238.02.430.0DR337.12.733.6DR438.22.430.0

[0086]

[0087] As shown in Table 3 above, it was confirmed that Corynebacterium glutamicum DR1, DR2, DR3 and DR4 showed an increase in L-arginine production by approximately 14.3 to 28.6% and an increase in L-arginine production yield by approximately 3.6 to 7.2%p compared to the parent strain, Corynebacterium glutamicum 14GR, by disrupting the gene encoding the carotenoid biosynthesis enzyme.

[0088]

[0089] Example 2. Production of a strain for producing L-citrulline with a disrupted gene for carotenoid biosynthesis enzymes.

[0090] To produce a strain in which one or more of the Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432 and Cgl2431 genes constituting carotenoid biosynthetic enzymes were disrupted in an L-citrulline-producing strain derived from Corynebacterium glutamicum, Corynebacterium glutamicum CT4 and E. coli DH5a (HIT Competent cells™, Cat No. RH618), which are L-citrulline-producing strains, were used.

[0091] The above Corynebacterium glutamicum CT4 is a strain for producing L-citrulline with enhanced activities of ornithine carbamoyltransferase and carbamoyl phosphate synthetase to produce citrulline in excess (see Korean Patent Application No. 10-2019-0151321). It was cultured at 30°C on a medium composed of 1 L of distilled water, 10.5% Glucose, 1 g of beef extract, 4 g of yeast extract, 2 g of polypeptone, 2 g of NaCl, 40 g of (NH4)2SO4, and 20 g of agar.

[0092] Other culture conditions of E. coliDH5a and the method for producing recombinant vectors CD1 to CD4 are the same as in Example 1-1.

[0093] Mutant strains were prepared using the constructed cloning vectors CD1 to CD4. The strain prepared using CD1, a Cgl0626 and Cgl0624 fragmentation recombination vector, was named DC1. The strain prepared using CD2, a Cgl0623 fragmentation recombination vector, was named DC2. The strain prepared using CD3, a Cgl2433 fragmentation recombination vector, was named DC3. The strain prepared using CD4, a Cgl2432 and Cgl2431 fragmentation recombination vector, was named DC4. The process of preparing each recombinant strain is as follows.

[0094] The cloning vector was prepared to have a final concentration of 1 μg / μl or higher, and the first recombination was induced in Corynebacterium glutamicum CT4 using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). At this time, the electroporated strain was spread on an agar medium containing 50 μg / μl of kanamycin, and colonies were isolated. Proper insertion into the induced site in the genome was confirmed through PCR and base sequence analysis. The isolated strain was inoculated into a liquid medium to induce a second recombination, cultured for more than one night, and spread on an agar medium containing 10% sucrose to isolate colonies. After confirming the resistance to kanamycin among the finally isolated colonies, the presence or absence of the corresponding gene was confirmed through base sequence analysis among the strains without antibiotic resistance (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, Corynebacterium glutamicum mutants DC1, DC2, DC3, and DC4 capable of producing L-citrulline, in which the gene encoding the carotenoid biosynthetic enzyme was disrupted, were constructed.

[0095]

[0096] Experimental Example 2. Evaluation of L-citrulline production capacity of an L-citrulline-producing strain with a disrupted carotenoid biosynthetic enzyme gene.

[0097] The L-citrulline production ability of the parent strain Corynebacterium glutamicum CT4 and the L-citrulline production strains Corynebacterium glutamicum DC1, DC2, DC3 and DC4 produced in Example 2 was evaluated.

[0098] Each strain was patched onto a flask-derived solid medium and cultured at 30°C for 24 hours. The cultured colonies were inoculated into 10 ml of a flask-derived medium and cultured at 30°C, 180 rpm, for 30 hours. The composition of the medium used here is shown in Table 4 below. After the culture was completed, the culture solution was diluted 50-fold with distilled water, filtered through a 0.45 μm filter, and then the L-citrulline production was analyzed using high-performance liquid chromatography (HPLC) (Agilent technologies 1260 infinity, Agilent technologies) equipped with a column (DionexIonPacTM CS12A) and a UV detector (195 mm), and the results are shown in Table 5 below.

[0099] Flask starter medium solid medium ( / L) 98% Glucose 10.5 g, Beef extract 1 g, Yeast extract 4 g, Polypeptone 2 g, NaCl 2 g, (NH4)2SO4 40 g, Agar 20 gFlask titer medium ( / L) Glucose 105.3 g (95%), MgSO4 1 g, YPA 4 g, KH2PO4 0.8 g, Na2HPO4 1.2 g, (NH4)2SO4 30 g, Fe S O420 mg, MnSO420 mg, ZnSO410 mg, Arginine 100 mg, Biotin 100 ug, Thiamine 200 ug

[0100] strain OD 610 L-Citrulline (%)Yield (%)CT435.11.212.2DC133.51.616.2DC233.91.514.8DC333.21.717.2DC433.81.515.2

[0101]

[0102] As shown in Table 5 above, it was confirmed that Corynebacterium glutamicum DC1, DC2, DC3 and DC4 showed an increase in L-citrulline production by approximately 25.0 to 41.7% and an increase in L-citrulline production yield by approximately 2.6 to 5.0%p compared to the parent strain Corynebacterium glutamicum CT4 by disrupting the gene encoding the carotenoid biosynthesis enzyme.

[0103]

[0104] Example 3. Production of a strain for producing L-lysine with a disrupted gene for carotenoid biosynthesis enzymes.

[0105] To produce a strain in which one or more of the Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432 and Cgl2431 genes constituting carotenoid biosynthetic enzymes were disrupted in an L-lysine-producing strain derived from Corynebacterium glutamicum, the L-lysine-producing strain Corynebacterium glutamicum DS1 (KCCM12969P) and E. coliDH5a (HIT competent cells, Cgl2433, Cg618) were used.

[0106] The above Corynebacterium glutamicum DS1 was cultured at 30°C in a medium (pH 7.2) containing 5 g of 98% Glucose, 5 g of Beef extract, 4 g of Yeast extract, 5 g of Polypeptone, 2 g of NaCl, 40 g of (NH4)2SO4, and 20 g of Agar in 1 L of distilled water.

[0107] Other culture conditions of E. coliDH5a and the method for producing recombinant vectors CD1 to CD4 are the same as in Example 1-1.

[0108] Mutant strains were prepared using the constructed cloning vectors CD1 to CD4. The strain prepared using CD1, a Cgl0626 and Cgl0624 fragmentation recombination vector, was named DK1, the strain prepared using CD2, a Cgl0623 fragmentation recombination vector, was named DK2, the strain prepared using CD3, a Cgl2433 fragmentation recombination vector, was named DK3, and the strain prepared using CD4, a Cgl2432 and Cgl2431 fragmentation recombination vector, was named DK4. The process of preparing each recombinant strain is as follows.

[0109] The cloning vector was prepared to have a final concentration of 1 μg / μl or higher, and the first recombination was induced in Corynebacterium glutamicum DS1 using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). At this time, the electroporated strain was spread on an agar medium containing 50 μg / μl of kanamycin, and colonies were isolated. Then, whether the strain was properly inserted into the induced site in the genome was confirmed through PCR and base sequence analysis. To induce the second recombination, the isolated strain was inoculated into a liquid medium, cultured for more than one night, and spread on an agar medium containing 10% sucrose to isolate colonies. After confirming the resistance to kanamycin among the finally isolated colonies, the presence or absence of the corresponding gene was confirmed through base sequence analysis among the strains without antibiotic resistance (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, Corynebacterium glutamicum mutants DK1, DK2, DK3, and DK4 capable of producing L-lysine, in which the gene encoding the carotenoid biosynthetic enzyme was disrupted, were constructed.

[0110]

[0111] Experimental Example 3. Evaluation of L-lysine production capacity of an L-lysine producing strain with a disrupted carotenoid biosynthetic enzyme gene.

[0112] The L-lysine production ability of the parent strain Corynebacterium glutamicum DS1 and the L-lysine production strains Corynebacterium glutamicum DK1, DK2, DK3 and DK4 produced in Example 3 was evaluated.

[0113] Each strain was patched onto a flask-derived solid medium and cultured at 30°C for 24 hours. The cultured colonies were inoculated into 10 ml of a flask titer medium and cultured at 30°C, 180 rpm, for 28 hours. The composition of the medium used here is shown in Table 6 below. After the culture was completed, the culture solution was diluted 10-fold with distilled water, filtered through a 0.45 μm filter, and then the L-lysine production was analyzed using high-performance liquid chromatography (HPLC) (Agilent technologies 1260 infinity, Agilent technologies) equipped with a column (DionexIonPacTM CS12A) and a UV detector (195 mm), and the results are shown in Table 7 below.

[0114] Flask starter medium solid medium ( / L) 98% Glucose 5 g, Beef extract 5 g, Yeast extract 4 g, Polypeptone 5 g, NaCl 2 g, (NH4)2SO4 40 g, Agar 20 gFlask titer medium ( / L) 98% Glucose 100 g, MgSO4 1 g, KH2PO4 1 g, (NH4)2SO4 55 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g

[0115] strain OD 610 L-Lysine (%) Yield (%) DS1326.060.0 DK1306.666.6 DK2306.464.1 DK3286.767.1 DK4316.464.0

[0116]

[0117] As shown in Table 7 above, Corynebacterium glutamicum DK1, DK2, DK3 and DK4 were confirmed to have an increase in L-lysine production by approximately 6.7 to 11.7% and an increase in L-lysine production yield by 4.0 to 7.1%p compared to the parent strain Corynebacterium glutamicum DS1 by disrupting the gene encoding the carotenoid biosynthesis enzyme.

[0118]

[0119] Example 4. Production of a strain for producing L-glutamine with a disrupted gene for carotenoid biosynthesis enzymes.

[0120] To produce a strain in which one or more of the Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432 and Cgl2431 genes constituting carotenoid biosynthetic enzymes were disrupted in an L-glutamine-producing strain derived from Corynebacterium glutamicum, the L-glutamine-producing strains Corynebacterium glutamicum DQ3-6 (KCCM13398P) and E. coli DH5a (HIT Competent cells, Cat No. RH618) were used.

[0121] The above Corynebacterium glutamicum DQ3-6 was cultured at 30°C in a broth medium (pH 7.2) containing 10.5 g of 98% Glucose, 1 g of Beef extract, 4 g of Yeast extract, 2 g of Polypeptone, 2 g of NaCl, 5 g of Urea, 50 mg of alanine, and 40 g of (NH4)2SO4 in 1 L of distilled water.

[0122] Other culture conditions of E. coliDH5a and the method for producing recombinant vectors CD1 to CD4 are the same as in Example 1-1.

[0123] Mutant strains were prepared using the constructed cloning vectors CD1 to CD4. The strain prepared using CD1, a Cgl0626 and Cgl0624 fragmentation recombination vector, was named DE1, the strain prepared using CD2, a Cgl0623 fragmentation recombination vector, was named DE2, the strain prepared using CD3, a Cgl2433 fragmentation recombination vector, was named DE3, and the strain prepared using CD4, a Cgl2432 and Cgl2431 fragmentation recombination vector, was named DE4. The process of preparing each recombinant strain is as follows.

[0124] The cloning vector was prepared to have a final concentration of 1 μg / μl or higher, and the first recombination was induced in Corynebacterium glutamicum DQ3-6 using electroporation (see literature [Tauch et al., FEMS Microbiology letters 123 (1994) 343-347]). At this time, the electroporated strain was spread on an agar medium containing 50 μg / μl of kanamycin, and colonies were isolated. Then, whether the strain was properly inserted into the induced site in the genome was confirmed through PCR and base sequence analysis. To induce the second recombination, the isolated strain was inoculated into a liquid medium, cultured for more than one night, and spread on an agar medium containing 10% sucrose to isolate colonies. After confirming the resistance to kanamycin among the finally isolated colonies, the presence or absence of the corresponding gene was confirmed through base sequence analysis among the strains without antibiotic resistance (see literature [Schafer et al., Gene 145 (1994) 69-73]). Finally, Corynebacterium glutamicum mutant strains DE1, DE2, DE3, and DE4 capable of producing L-glutamine, in which the gene encoding the carotenoid biosynthetic enzyme was disrupted, were constructed.

[0125]

[0126] Experimental Example 4. Evaluation of L-glutamine production capacity of an L-glutamine-producing strain with a disrupted carotenoid biosynthetic enzyme gene.

[0127] The L-glutamine production ability of the parent strain Corynebacterium glutamicum DQ3-6 and the L-glutamine production Corynebacterium glutamicum DE1, DE2, DE3 and DE4 produced in Example 4 was evaluated.

[0128] Each strain was patched onto a flask-derived solid medium and cultured at 30°C for 24 hours. The cultured colonies were inoculated into 10 ml of a flask titer medium and cultured at 30°C, 160 rpm, for 72 hours. The composition of the medium used here is shown in Table 8 below. After the culture was completed, the culture solution was diluted 100-fold with distilled water, filtered through a 0.45 μm filter, and then the L-glutamine production was analyzed using high-performance liquid chromatography (HPLC) (Agilent technologies 1260 infinity, Agilent technologies) equipped with a column (DionexIonPacTM CS12A) and a UV detector (195 mm), and the results are shown in Table 9 below.

[0129] Flask starter medium solid medium ( / L) 98% Glucose 5 g, Beef extract 1 g, Yeast extract 4 g, Polypeptone 2 g, NaCl 2 g, (NH4)2SO4 40 g, Agar 20 gFlask titer medium ( / L) 98% Glucose 100 g, MgSO4 1 g, KH2PO4 2 g, (NH4)2SO4 45 g, FeSO4 20 mg, MnSO4 20 mg, Biotin 100 μg, Thiamine 100 μg, YSP 4 g and Urea 2 g, L-alanine 50 mg, L-cysteine ​​50 mg

[0130] strain OD 610 L-Glutamine (%) Yield (%) DQ3-625.62.929.4DE124.33.332.8DE225.13.332.6DE324.23.433.5DE424.83.532.6

[0131]

[0132] As shown in Table 9 above, it was confirmed that Corynebacterium glutamicum DE1, DE2 DE3 and DE4, which had the gene encoding the carotenoid biosynthetic enzyme disrupted, had an increase in L-glutamine production of approximately 13.8 to 20.7% and an increase in L-glutamine production yield of approximately 3.2 to 4.1%p compared to the parent strain Corynebacterium glutamicum DQ3-6.

[0133]

[0134] In summary, the above results suggest that by weakening or inactivating the activity of carotenoid biosynthetic enzymes encoded by the crtB gene, the crtB2 gene, or the genes constituting the crtB / crtB2 gene cluster in a Corynebacterium genus microorganism, the production and production yield of L-amino acids, including L-arginine, L-citrulline, L-lysine, and L-glutamine, can be improved compared to the microorganism before mutation.

[0135]

[0136] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0137] [Trustee]

[0138] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0139] Accession number: KCCM13219P

[0140] Date of acceptance: 20220629

[0141]

[0142] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0143] Accession number: KCCM12969P

[0144] Date of acceptance: 20210402

[0145]

[0146] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0147] Accession number: KCCM13398P

[0148] Date of acceptance: 20230926

[0149]

[0150]

[0151]

Claims

1. A microorganism of the genus Corynebacterium with enhanced L-amino acid production ability due to weakened or inactivated activity of carotenoid biosynthetic enzymes.

2. In claim 1, A microorganism of the genus Corynebacterium in which the activity of the above carotenoid biosynthetic enzyme is weakened due to insertion, substitution, deletion or a combination thereof of all or part of a gene encoding the carotenoid biosynthetic enzyme.

3. In claim 2, A microorganism of the genus Corynebacterium, wherein the gene encoding the carotenoid biosynthetic enzyme is at least one selected from the group consisting of Cgl0626, Cgl0624, Cgl0623, Cgl2433, Cgl2432, and Cgl2431.

4. In claim 3, The above Cgl0626 gene contains the base sequence of sequence number 1, The above Cgl0624 gene contains the base sequence of sequence number 3, The above Cgl0623 gene contains the base sequence of sequence number 5, The above Cgl2433 gene contains the base sequence of sequence number 7, The above Cgl2432 gene comprises the base sequence of sequence number 9, and A microorganism of the genus Corynebacterium, wherein the Cgl2431 gene comprises a base sequence of sequence number 11.

5. In claim 1, The above Corynebacterium genus microorganism is Corynebacterium glutamicum.

6. In claim 1, A microorganism of the genus Corynebacterium, wherein the L-amino acid is at least one selected from the group consisting of L-alanine, L-isoleucine, L-valine, L-leucine, L-methionine, L-asparagine, L-cysteine, L-glutamine, L-serine, L-threonine, L-phenylalanine, L-tryptophan, L-tyrosine, L-aspartic acid, L-glutamic acid, L-arginine, L-histidine, L-lysine, L-glycine, L-proline, and L-citrulline.

7. A step of culturing the microorganism of the genus Corynebacterium of claim 1 in a medium; and A method for producing L-amino acid, comprising a step of recovering L-amino acid from the microorganism or a medium in which the microorganism is cultured.

8. In claim 1, A method for producing an L-amino acid, wherein the L-amino acid is at least one selected from the group consisting of L-alanine, L-isoleucine, L-valine, L-leucine, L-methionine, L-asparagine, L-cysteine, L-glutamine, L-serine, L-threonine, L-phenylalanine, L-tryptophan, L-tyrosine, L-aspartic acid, L-glutamic acid, L-arginine, L-histidine, L-lysine, L-glycine, L-proline and L-citrulline.

Images