Method for producing retinal progenitor cells from retinal organoid and use thereof
The method of dissociating neural retina layers from retinal organoids and culturing them in a specific inhibitor-rich medium enables the continuous production of retinal progenitor cells with maintained differentiation potential, addressing the limitations of current methods and offering a viable therapy for retinal degeneration.
Patent Information
- Application Number
- PCT/KR2024/018260
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-21
- Filing Date
- 2024-11-19
- Publication Date
- 2025-05-30
AI Technical Summary
Current methods for producing retinal progenitor cells from human fetal retinas face challenges such as loss of differentiation ability during long-term culture, and ethical and acquisition issues related to human fetal retinas. Additionally, existing methods for isolating retinal progenitor cells from retinal organoids are complex and limited in mass production due to low cell yield.
A method involving the dissociation of the neural retina layer from retinal organoids derived from human embryonic stem cells into single cells, followed by passaging these cells in a medium containing GSK3, ALK5, MEK inhibitors, and a Hedgehog signaling pathway activator to produce retinal progenitor cells with excellent differentiation potential.
The method allows for continuous subculture of retinal progenitor cells while maintaining their differentiation ability into neurons, effectively suppressing morphological degeneration of photoreceptor cells in retinal degeneration models, thus offering a promising cell therapy for retinal diseases.
Smart Images

Figure KR2024018260_30052025_PF_FP_ABST
Abstract
Description
Method for producing retinal progenitor cells from retinal organoids and use thereof
[0001] This application claims priority to Republic of Korea Patent Application No. 10-2023-0161852, filed on November 21, 2023, the entire disclosure of which is incorporated herein by reference.
[0002] The present invention relates to a method for producing retinal progenitor cells from retinal organoids and to uses thereof.
[0003] The retina is a key neural tissue responsible for visual sensation in mammals, including humans. Retinal degeneration is a major cause of intractable blindness diseases such as retinitis pigmentosa (RP). A common pathological process in degenerative retinal diseases is known to involve the gradual loss of photoreceptor cells. Therefore, stem cell transplantation, which can restore dysfunctional photoreceptor cells or replace them with new ones, has recently been proposed as a treatment strategy for degenerative retinal diseases.
[0004] Retinal progenitor cells (RPCs) are attracting attention as a promising cell source for stem cell transplantation. RPCs are self-renewing and possess the ability to differentiate into all neurons and Müller glial cells that make up the retina. Research has reported methods for isolating and culturing RPCs from human fetal retinas, and human RPCs produced using these methods are being studied in preclinical and clinical trials to determine their therapeutic effects on degenerative retinal diseases.
[0005] However, treatments using these retinal progenitor cell transplants require a large number of cells. To secure these cells, it is necessary to either secure the required number of human fetal retinas or expand the cells through subculture. However, retinal progenitor cells isolated and cultured from human fetal retinas using methods developed to date have problems with their unique properties (characteristics), such as their differentiation capacity (multipotency), being lost during long-term culture or subculture. Furthermore, the use of human fetal retinas is limited due to availability and ethical issues.
[0006] Another approach to mass-producing retinal progenitor cells is to use retinal organoids derived from pluripotent stem cells (PSCs). A recent study demonstrated that specific retinal progenitor cells expressing the cell surface marker C-kit could be isolated from three-dimensional retinal organoids formed from human embryonic stem cells (hESCs). Transplanting these cells, passaged three times, into an animal model of retinal degeneration inhibited retinal degeneration. However, isolating specific retinal progenitor cells using these markers requires techniques such as fluorescence-activated cell sorting (FACS) or magnetic activated cell sorting (MACS). This complicates the process and results in low cell yields, limiting their potential for mass production as cell therapy. Therefore, research is urgently needed to develop methods for producing retinal progenitor cells capable of continuous passage.
[0007] Meanwhile, Korean Patent No. 2146007 discloses a 'method for obtaining retinal progenitor cells, retinal pigment epithelial cells, and neural retinal cells', and Korean Patent No. 1357851 discloses a 'method for inducing differentiation of retinal pigment epithelial cells from cystic structures', but there is no description of a method for producing retinal progenitor cells from retinal organoids of the present invention and its use.
[0008] The present invention was derived from the above-mentioned needs, and the inventors of the present invention dissociated the layer structure including the neural retina from a retinal organoid prepared from human embryonic stem cells and into single cells, and then passaged the retinal progenitor cells in a retinal progenitor cell expansion medium containing a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator to produce retinal progenitor cells. In addition, the inventors confirmed that the retinal progenitor cells can be passaged continuously and maintain their differentiation ability into neurons even as passage progresses, and when the retinal progenitor cells were transplanted into a retinal degenerative mouse, they confirmed that the morphological degeneration of photoreceptor cells was suppressed, thereby completing the present invention.
[0009] To solve the above problem, the present invention provides a method for producing retinal progenitor cells with excellent differentiation potential, comprising a step of culturing cells isolated from retinal organoids in a medium containing a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
[0010] In the present invention, the GSK3 inhibitor may be CHIR99021, the ALK5 inhibitor may be SB431542, the MEK inhibitor may be PD0325901, and the Hedgehog signaling pathway activator may be purmorphamine.
[0011] In the present invention, CHIR99021, SB431542, PD0325901 and purmorphamine may be included at concentrations of 2 to 4 μM, 0.5 to 1.5 μM, 0.5 to 1.5 μM and 0.5 to 1.5 μM, respectively.
[0012] In the present invention, the manufacturing method may include the following steps (a) to (c):
[0013] (a) a step of producing retinal organoids from embryonic stem cells;
[0014] (b) a step of peeling off the layer structure containing the neural retina from the manufactured retinal organoid and dissociating it into single cells; and
[0015] (c) A step of subculturing the dissociated single cells 2 to 4 times every 5.5 to 7.5 days in a medium containing a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
[0016] A method for producing retinal progenitor cells with excellent differentiation potential, wherein the retinal organoid produced in step (a) has a layered structure of the neural retina and includes a pigmented domain composed of retinal pigment epithelium.
[0017] In the present invention, the layer structure including the neural retina of step (b) can be obtained by removing the pigmented domain from the retinal organoid prepared in step (a).
[0018] In the present invention, the manufacturing method may further include, between steps (b) and (c), a step of (b-1) culturing dissociated single cells in a medium containing a ROCK inhibitor; and a step of (b-2) replacing the medium with a medium for maintaining retinal progenitor cells and then performing additional culturing.
[0019] In the present invention, the step (b-1) may be performed for 0.5 to 2 days, and the step (b-2) may be performed for 2 to 4 days.
[0020] In addition, the present invention provides a medium composition for producing retinal progenitor cells with excellent differentiation potential, comprising a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a hedgehog signaling pathway activator as active ingredients.
[0021] Additionally, the present invention provides the use of a composition comprising a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a hedgehog signaling pathway activator as active ingredients for use in a medium for producing retinal progenitor cells with excellent differentiation potential.
[0022] In the present invention, the medium composition may additionally include at least one selected from a carbon source, a nitrogen source, an inorganic salt, an amino acid, and an antibiotic.
[0023] In addition, the present invention provides retinal progenitor cells produced by the above method.
[0024] In the present invention, the manufactured retinal progenitor cells can be continuously subcultured and maintain differentiation ability into neurons even as subculture progresses.
[0025] In addition, the present invention provides a pharmaceutical composition for preventing or treating retinal diseases, which contains the retinal progenitor cells as an active ingredient.
[0026] Additionally, the present invention provides a method for preventing or treating retinal diseases, which comprises administering a therapeutically effective amount of the manufactured retinal progenitor cells or a pharmaceutical composition containing the same to a subject in need thereof.
[0027] In the present invention, the retinal disease may be any one selected from the group consisting of macular degeneration, retinitis pigmentosa, macular degeneration, traumatic retinal damage, and light-induced retinal damage.
[0028] Retinal progenitor cells produced by the method of the present invention maintain differentiation ability even after passage culture and have an excellent effect in suppressing morphological degeneration of photoreceptor cells in retinal degeneration mice, and therefore can be usefully utilized as a cell therapy agent for preventing, improving, or treating retinal diseases.
[0029] Figure 1 is a schematic diagram showing the process of producing retinal progenitor cells from human embryonic stem cell-derived retinal organoids.
[0030] Figure 2A is a photograph of human embryonic stem cells cultured to produce retinal organoids observed under an optical microscope, and Figure 2B is a photograph of retinal organoids (white arrow) produced through differentiation for 40 days from human embryonic stem cells observed under an optical microscope.
[0031] Figure 3 shows optical micrographs of the pigmented domain composed of retinal pigmented epithelium (RPE) in a retinal organoid before (A) and after (B) peeling. NR (neural retina): neural retina; dotted line: peeled layered structure.
[0032] Figure 4 is a photograph of retinal progenitor cells produced from retinal organoids, which were continuously subcultured and observed under an optical microscope.
[0033] Figure 5 shows the results of confirming the expression of Chx10, Pax6, Sox2, and Ki67 proteins in retinal progenitor cells manufactured by the method according to the present invention through immunocytochemical staining.
[0034] Figure 6 is a graph quantitatively analyzing the number of cells positive for both Chx10 and Pax6 and cells positive for both Sox2 and Ki67 in the results of Figure 5.
[0035] Figure 7 shows the results of analyzing the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes by qRT-PCR during the subculture of retinal progenitor cells manufactured by the method according to the present invention. RO (retinal organoid): retinal organoid.
[0036] Figure 8 shows the results of confirming the expression of Rhodopsin protein (A), a photoreceptor cell marker, and Brn3a and TUJ1 proteins (B), which are retinal ganglion cell markers, after culturing retinal progenitor cells manufactured by the method according to the present invention under photoreceptor cell or retinal ganglion cell differentiation conditions.
[0037] Figure 9 shows the results of quantitative analysis of the number of cells positive for Rhodopsin (A) and the number of cells positive for Brn3a (B) in fluorescence images stained with immunocytochemical staining to confirm the differentiation ability of retinal progenitor cells manufactured by the method according to the present invention during subculture.
[0038] Figure 10 shows the results of measuring the doubling time for each passage during 9 consecutive passages of retinal progenitor cells manufactured by the method according to the present invention.
[0039] Figure 11 shows the results of measuring the number of cells at each passage during three consecutive passages of retinal progenitor cells manufactured by the method according to the present invention.
[0040] Figure 12 shows the results of immunocytochemical staining for the expression of Chx10, Pax6, Sox2, and Ki67 proteins in cells cultured for 3 or 7 passages in RPCEM medium containing a mixture of CHIR99021, SB431542, PD0325901, and Purmorphamine.
[0041] Figure 13 is a graph quantitatively analyzing the number of cells positive for both Chx10 and Pax6 and cells positive for both Sox2 and Ki67 in the results of Figure 12.
[0042] Figure 14 shows the results of qRT-PCR analysis of the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes in cells cultured three times in RPCEM medium containing CHIR99021, SB431542, PD0325901, and a mixture of permorphamine.
[0043] Figure 15 shows the results of confirming the expression of Ascl1 protein in cells cultured three times in RPCEM medium containing CHIR99021, SB431542, PD0325901, and a mixture of permorphamine.
[0044] Figure 16 shows the results of qRT-PCR analysis of the expression levels of Rhodopsin, Opn1mw / lw, Recoverin, Math5, and NeuroD1 genes in cells cultured three times in RPCEM medium containing CHIR99021, SB431542, PD0325901, and a mixture of permorphamine.
[0045] Figure 17 shows the results of immunohistochemical staining to confirm the thickness of the outer nuclear layer (ONL) of the retina after transplanting retinal progenitor cells manufactured by the method according to the present invention into retinal degeneration mice. The control group is a group administered only HBSS (Hank's Balanced Salt Solution).
[0046] Figure 18 shows the results of a quantitative analysis of the thickness of the outer nuclear layer (ONL) of the retina after transplanting retinal progenitor cells manufactured by the method of the present invention into retinal degeneration mice. The control group is a group administered HBSS alone.
[0047] Figure 19 shows the results of immunocytochemical staining to confirm the expression of rhodosin and peanut agglutinin lectin (PNA) proteins and the length of the outer segment (OS) after transplanting retinal progenitor cells manufactured by the method according to the present invention into retinal degeneration mice. The control group is a group administered HBSS alone.
[0048] Figure 20 shows the results of quantitative analysis of changes in the amplitude of the a-wave (A) and b-wave (B) according to increased light stimulation through an electroretinogram examination of the retina after transplanting retinal progenitor cells manufactured by the method according to the present invention into retinal degeneration mice. The control group is a group administered HBSS alone.
[0049] In order to achieve the purpose of the present invention, the present invention provides a method for producing retinal progenitor cells with excellent differentiation potential, comprising the step of culturing cells isolated from retinal organoids in a medium containing a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
[0050] In the method for producing retinal progenitor cells of the present invention, the GSK-3 inhibitor may be at least one selected from the group consisting of CHIR99021, CP21R7, CHIR98014, LY2090314, kenpaullone, AR-AO144-18, TDZD-8, SB216763, BIO, TWS-119, and SB415286, and preferably at least one selected from the group consisting of CHIR99021, CHIR98014, LY2090314, and SB415286, but is not limited thereto.
[0051] In the method for producing retinal progenitor cells of the present invention, the ALK5 inhibitor may be at least one selected from the group consisting of SB431542, SB505124, SB525334 and A-83-01, and preferably at least one selected from the group consisting of SB431542, SB505124 and SB525334, but is not limited thereto.
[0052] In the method for producing retinal progenitor cells of the present invention, the MEK inhibitor may be PD0325901.
[0053] In the method for producing retinal progenitor cells of the present invention, the hedgehog signaling pathway activator may be purmorphamine, but is not limited thereto.
[0054] According to a specific embodiment of the present invention, the GSK3 inhibitor may be CHIR99021, the ALK5 inhibitor may be SB431542, the MEK inhibitor may be PD0325901, and the Hedgehog signaling pathway activator may be purmorphamine, but is not limited thereto.
[0055] In addition, the CHIR99021, SB431542, PD0325901 and purmorphamine may be included at concentrations of preferably 2 to 4 μM, 0.5 to 1.5 μM, 0.5 to 1.5 μM and 0.5 to 1.5 μM, respectively, and more preferably at concentrations of 3 μM, 1 μM, 1 μM and 1 μM, respectively, but are not limited thereto.
[0056] The term "retinal organoid" as used herein refers to a mass of cells with a three-dimensional structure, and refers to an organoid that mimics retinal tissue with a simplified structure, manufactured through an artificial culture process rather than collecting or acquiring cells from animals or other sources. The cells constituting the organoid may be derived from embryonic stem cells or induced pluripotent stem cells.
[0057] A method for producing retinal progenitor cells according to one embodiment of the present invention preferably comprises:
[0058] (a) a step of producing retinal organoids from embryonic stem cells;
[0059] (b) a step of peeling off the layer structure containing the neural retina from the manufactured retinal organoid and dissociating it into single cells; and
[0060] (c) a step of subculturing the dissociated single cells 2 to 4 times every 5.5 to 7.5 days in a medium containing a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a Hedgehog signaling pathway activator as active ingredients; may include;
[0061] More preferably,
[0062] (a) a step of producing retinal organoids from embryonic stem cells;
[0063] (b) a step of peeling off the layer structure containing the neural retina from the manufactured retinal organoid and dissociating it into single cells;
[0064] (c) a step of culturing the dissociated single cells for 3 to 5 days in RPCM medium prepared by mixing DMEM and F-12 in a ratio of 3:1 and adding B27 supplement, MEM NEAA, penicillin-streptomycin, heparin, EGF, and bFGF (PeproTech); and
[0065] (d) a step of expanding the cultured cells by subculturing them three times every 5.5 to 7.5 days in RPCEM medium prepared by mixing DMEM and F-12 in a ratio of 3:1 and adding B27 supplement, MEM NEAA, penicillin-streptomycin, heparin, EGF, bFGF, CHIR99021, SB431542, PD0325901, and Purmorphamine; but is not limited thereto.
[0066] In the method for producing retinal progenitor cells of the present invention, step (a) is a step for producing retinal organoids from embryonic stem cells, and various methods known in the art can be used.
[0067] In the method for producing retinal progenitor cells of the present invention, the retinal organoids produced in step (a) can be selected according to the following conditions and used to produce retinal progenitor cells with excellent differentiation potential: (1) the layer structure of the neural retina is formed; and (2) it includes a pigmented domain composed of retinal pigment epithelium.
[0068] In the method for producing retinal progenitor cells of the present invention, step (b) may be comprised of a step of dissociating a single cell from the produced retinal organoid, a step of dissociating a layer structure including a neural retina from a retinal organoid selected according to the conditions, and a step of dissociating a single cell from the dissociated layer structure.
[0069] First, the step of detaching the layer structure containing the neural retina from the manufactured retinal organoid can be performed using microscissors or a syringe needle. Specifically, the pigmented domain is removed using microscissors or a syringe needle, resulting in detachment of only the layer structure containing the neural retina.
[0070] Next, the step of dissociating single cells from the detached layer structure can be performed by treating the detached layer structure with an enzyme used to detach adherent cells and / or a deoxyribonuclease, but is not limited thereto.
[0071] In the method for producing retinal progenitor cells of the present invention, the step (c) is a preliminary step for expanding retinal progenitor cells, and may be composed of a step of culturing dissociated single cells in a medium containing a ROCK inhibitor and a culturing step for maintenance of retinal progenitor cells.
[0072] First, the dissociated single cells can be cultured for 0.5 to 2 days in a retinal differentiation medium containing a ROCK inhibitor. At this time, the ROCK inhibitor may be at least one selected from the group consisting of Fasudil, Y-27632, HA-1077, Y-39983, and Wf-536, and preferably Y-27632, but is not limited thereto.
[0073] Additionally, the dissociated single cells can be cultured by attachment to a culture vessel coated with a substrate protein for cell attachment.
[0074] The culture vessel used for the above-mentioned attachment culture is not particularly limited as long as it can perform "attachment culture", and a person skilled in the art can appropriately select a suitable culture vessel according to the culture scale, culture conditions, and culture period. Examples of such culture vessels include flasks, tissue culture flasks, culture dishes (plates), tissue culture dishes, multi-dishes, microplates, microwell plates, multiplates, multiwell plates, chamber slides, petri dishes, tube trays, culture bags, microcarriers, beads, stack plates, spinner flasks, and roller bottles.
[0075] The above glycoprotein may be at least one selected from the group consisting of vitronectin, laminin, gelatin, collagen, fibronectin, and elastin, but is not limited thereto.
[0076] Next, the cultured cells can be cultured for an additional 2 to 4 days in a medium for maintaining retinal progenitor cells. This process promotes retinal development and expands retinal progenitor cells while maintaining pluripotency. The medium for maintaining retinal progenitor cells can additionally include B27 supplement, non-essential amino acids (particularly, MEM non-essential amino acids), penicillin-streptomycin, heparin, EGF, and bFGF.
[0077] In the method for producing retinal progenitor cells of the present invention, the medium used in the step (c) may include BME medium, BGJb medium, CMRL 1066 medium, Glasgow MEM (GMEM) medium, modified MEM zinc option medium, IMDM medium, Medium 199 medium, Eagle MEM medium, αMEM medium, DMEM medium, F-12 medium, DMEM / F-12 medium, IMDM / F12 medium, Ham's medium, RPMI 1640 medium, Fischer's medium, and mixed medium thereof.
[0078] In the method for producing retinal progenitor cells of the present invention, step (d) is a step for subculturing and expanding retinal progenitor cells, and is characterized in that, compared to step (c), a medium composition for producing retinal progenitor cells according to the present invention is additionally treated in the medium.
[0079] The medium composition for producing retinal progenitor cells according to the present invention comprises a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator. Since the description of these components is the same as described above, the description thereof is omitted.
[0080] In the above step (d), the cells can be expanded by subculturing three times every 5.5 to 7.5 days in a medium to which the medium composition for producing retinal progenitor cells has been added.
[0081] The present invention also provides a medium composition for producing retinal progenitor cells with excellent differentiation potential, comprising a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
[0082] Additionally, the present invention provides the use of a composition comprising a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a hedgehog signaling pathway activator as active ingredients for producing a medium for producing retinal progenitor cells with excellent differentiation potential.
[0083] Furthermore, the present invention provides a composition comprising a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a hedgehog signaling pathway activator as active ingredients for use in a medium for producing retinal progenitor cells with excellent differentiation potential.
[0084] In the composition of the present invention, the GSK3 inhibitor, ALK5 inhibitor, MEK inhibitor, and hedgehog signaling pathway activator are the same as described above, and therefore, their description is omitted.
[0085] In addition, the above-described medium composition may additionally include at least one selected from a carbon source, a nitrogen source, an inorganic salt, an amino acid, and an antibiotic, but is not limited thereto.
[0086] By using the medium composition of the present invention, continuous subculture of retinal progenitor cells is possible, and retinal progenitor cells that maintain differentiation ability even as subculture progresses can be produced.
[0087] The present invention also provides retinal progenitor cells produced by the above production method.
[0088] The above retinal progenitor cells are characterized by the ability to undergo continuous subculture and the maintenance of differentiation potential even as subculture progresses.
[0089] As used herein, the term "passaging" or "passaging" refers to the step of transferring some or all cells from a previous culture to fresh growth medium and / or plating the cells onto a new culture dish and further culturing them. Passaging can be performed, for example, to extend the lifespan, enrich a population of desired cells, or expand the number of cells in a culture. For example, passaging may include transferring some or all cells to a new culture vessel, culturing them, or plating them at a lower cell density to allow cell proliferation.
[0090] The above retinal progenitor cells can exhibit characteristics unique to retinal progenitor cells during 0 to 10 passages of culture. Specifically, the retinal progenitor cells can exhibit positivity for any one or more proteins selected from the group consisting of Chx10, Pax6, Sox2, and Ki67 proteins.
[0091] According to a specific embodiment of the present invention, a retinal progenitor cell cluster having a purity of about 98% can be obtained through 2 to 5 subcultures using the above-described manufacturing method.
[0092] According to a specific embodiment of the present invention, even if retinal progenitor cells produced by the above-described production method are subjected to continuous subculture, the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes can be maintained similarly to or further increased than the expression levels in retinal organoids.
[0093] For example, the expression level of the genes in the manufactured retinal progenitor cells may be 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 100% or more, 120% or more, 140% or more, 160% or more, 180% or more, 200% or more, 220% or more, or 240% or more of the expression level in the retinal organoid.
[0094] When the above genes are limited to Ascl1, the expression level of the genes in the manufactured retinal progenitor cells can be more than 1700% of the expression level in retinal organoids.
[0095] The expression levels of the above genes can be maintained for 0 to 10 passages, preferably 0 to 9 passages, 0 to 8 passages or 0 to 7 passages.
[0096] According to another specific embodiment of the present invention, the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes in retinal progenitor cells produced by the above-described production method can be significantly increased compared to retinal progenitor cells cultured without being treated with the medium composition of the present invention.
[0097] According to another specific embodiment of the present invention, the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes in retinal progenitor cells produced by the above-described production method can be significantly increased compared to retinal progenitor cells cultured without being treated with the medium composition of the present invention.
[0098] In addition, the retinal progenitor cells produced by the above production method can maintain their differentiation ability during 0 to 10 passages, preferably 0 to 9 passages, 0 to 8 passages, or 0 to 7 passages.
[0099] According to a specific embodiment of the present invention, it was confirmed that retinal progenitor cells manufactured by the above-described manufacturing method maintain the ability to differentiate into photoreceptor cells and retinal ganglion cells even when continuous subculture is performed.
[0100] According to another specific embodiment of the present invention, it was confirmed that the retinal progenitor cells produced by the above-described production method had a significantly improved differentiation ability into photoreceptor cells and retinal ganglion cells compared to the retinal progenitor cells cultured without being treated with the medium composition of the present invention.
[0101] For example, the retinal progenitor cells produced by the production method of the present invention can have an expression level of the photoreceptor cell markers Rhodopsin, Opn1mw / lw, and Recoverin genes increased by 1000% to 2500% compared to the retinal progenitor cells cultured without being treated with the medium composition of the present invention. In addition, the retinal progenitor cells produced by the above-described production method can have an expression level of the retinal ganglion cell markers Math5 and NeuroD1 genes increased by 3000% to 5000% compared to the retinal progenitor cells cultured without being treated with the medium composition of the present invention.
[0102] Therefore, retinal progenitor cells produced by the production method of the present invention can exhibit improved differentiation ability compared to retinal progenitor cells produced without treatment with the composition of the present invention, i.e., a composition comprising a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a hedgehog signaling pathway activator.
[0103] The present invention also provides a pharmaceutical composition for preventing or treating retinal diseases, which comprises retinal progenitor cells produced by the production method of the present invention as an active ingredient.
[0104] Furthermore, the present invention provides a method for preventing or treating retinal diseases, which comprises administering a therapeutically effective amount of retinal progenitor cells (or a pharmaceutical composition containing the retinal progenitor cells) manufactured by the above manufacturing method to a subject in need thereof.
[0105] In the present invention, the retinal disease may be any one selected from macular degeneration, retinitis pigmentosa, macular degeneration, traumatic retinal damage, and light-induced retinal damage.
[0106] The term "prevention" as used herein refers to any action that suppresses or delays the symptoms of a retinal disease by administering a composition comprising retinal progenitor cells according to the present invention. The term "treatment" as used herein refers to any action that improves or beneficially alters the symptoms of a retinal disease by administering a composition comprising retinal progenitor cells according to the present invention.
[0107] In the pharmaceutical composition of the present invention, in addition to the retinal progenitor cells, a pharmaceutically acceptable carrier, excipient or diluent may be further included. The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is one commonly used in formulation, and includes, but is not limited to, saline solution, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
[0108] In addition to the above ingredients, the pharmaceutical composition of the present invention may further include antioxidants, buffers, bacteriostatic agents, diluents, surfactants, binders, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, or preservatives. The appropriate dosage of the pharmaceutical composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, administration method, patient age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity.
[0109] The retinal progenitor cells of the present invention or a pharmaceutical composition comprising them may be formulated according to the route of administration. For example, the retinal progenitor cells or a pharmaceutical composition comprising them may be formulated for administration into the subretinal space of the eye or into the vitreous cavity of the eye.
[0110] The above retinal progenitor cells or pharmaceutical compositions containing them can be prepared as a suspension by suspending them in an appropriate physiological aqueous solvent (e.g., saline, buffer, serum-free medium). If necessary, they can be cryopreserved by adding a cryopreservative, and when in use, they can be thawed, washed with a buffer, and used for transplantation therapy.
[0111] As used herein, the term "administration" may refer to therapeutic, pharmacokinetic, diagnostic, research, placebo, and experimental methods. "Administration" also encompasses in vitro and ex vivo treatments. Administration includes self-administration and administration by others. Administration may be performed by any suitable route. A suitable route of administration allows the composition to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.
[0112] As used herein, the term "subject" refers to any mammalian subject, particularly a human, for whom diagnosis, treatment, or therapy is desired. The methods described herein are applicable to both human therapy and veterinary applications. In some embodiments, the subject is a mammal, and in certain embodiments, the subject is a human.
[0113] As used herein, the term "therapeutically effective amount" refers to an amount sufficient to provide the intended benefit of treatment. However, dosage levels are based on various factors, including the type of injury, age, weight, sex, the patient's medical condition, the severity of the condition, the route of administration, the anticipated cell transplantation, long-term survival, and / or the specific active agent used. Therefore, the dosage regimen may vary widely but can be routinely determined by a physician using standard methods. Additionally, the terms "therapeutic amount," "therapeutically effective amount," and "pharmaceutically effective amount" encompass a prophylactic amount of a composition of the present invention. In prophylactic applications of the present invention, the pharmaceutical composition or agent is administered to a patient susceptible to or otherwise at risk for a disease, disorder, or condition in an amount sufficient to eliminate or reduce the risk, reduce the severity, or delay the onset of the disease, disorder, or condition, including biochemical, histological, and / or behavioral symptoms of the disease, disorder, or condition, its complications, and intermediate pathological phenotypes that appear during the development of the disease, disorder, or condition. In general, the maximum dose, i.e., the highest safe dose according to some medical judgment, is preferred. The terms "dosage" and "administration amount" are used interchangeably herein.
[0114] As used herein, the term "therapeutic effect" refers to a desired and beneficial outcome of treatment. The therapeutic effect may directly or indirectly include the arrest, reduction, or elimination of disease symptoms. The therapeutic effect may also directly or indirectly include the elimination or elimination of the progression of disease symptoms. For the compositions of the present invention, the therapeutically effective dose may initially be determined from preliminary in vitro studies and / or animal models. The therapeutically effective dosage may also be determined from human data. The applied dosage may be adjusted based on the relative bioavailability and efficacy of the administered composition. Adjusting the dosage to achieve maximum efficacy is within the capabilities of a skilled practitioner.
[0115] The retinal progenitor cells of the present invention or the pharmaceutical composition containing them may be administered via any common route as long as they can reach the target tissue. The pharmaceutical composition of the present invention is not particularly limited thereto, but may be administered via oral administration, ophthalmic administration, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, or transdermal patch administration, depending on the intended purpose, and oral administration or ophthalmic administration is preferred.
[0116] The retinal progenitor cells of the present invention or a pharmaceutical composition comprising them may be administered together with other therapeutic cells or agents. For example, the retinal progenitor cells or a pharmaceutical composition comprising them may be administered simultaneously or sequentially in combination or in separate formulations.
[0117] When administered by intraocular injection, the retinal progenitor cells of the present invention or a pharmaceutical composition comprising the same may be administered periodically one or more times. For example, the retinal progenitor cells or a pharmaceutical composition comprising the same may be delivered to a patient with a retinal disease once a year, once every 6 to 12 months, once every 3 to 6 months, once every 1 to 3 months, or once every 1 to 4 weeks, but is not limited thereto. When administered by implant or device, the retinal progenitor cells or a pharmaceutical composition comprising the same may be administered once or periodically throughout the life of the patient with a retinal disease. The patient may also receive immunosuppressive therapy prior to, concurrently with, or after administration of the retinal progenitor cells or a pharmaceutical composition comprising the same. Immunosuppressive therapy may be required throughout the patient's life or for a shorter period of time. Examples of immunosuppressive therapies include, but are not limited to, one or more of anti-lymphocyte globulin (ALG) polyclonal antibodies, anti-thymocyte globulin (ATG) polyclonal antibodies, azathioprine, BASILIXIMAB® (anti-IL-2Ra receptor antibody), cyclosporine (cyclosporin A), DACLIZUMAB® (anti-IL-2Ra receptor antibody), everolimus, mycophenolic acid, RITUX1MAB® (anti-CD20 antibody), sirolimus, tacrolimus (Prograf™), and mycopemolate mofetil (MMF).
[0118] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.
[0119] Example 1. Production of retinal progenitor cells from human embryonic stem cell-derived organoids.
[0120] The method for producing retinal progenitor cells from human embryonic stem cell-derived organoids consists of three major steps (retinal organoid production, tissue dissociation and cell dissociation, and cell expansion) (Figure 1).
[0121]
[0122] 1-1. Production of embryonic stem cell-derived retinal organoids
[0123] Human retinal organoids were produced by inducing differentiation from embryonic stem cells based on a previously published method (Cowan CS, et al., Cell, 2000, 182;1623-1640).
[0124] Specifically, human embryonic stem cells (H9 cells, WiCell) were seeded on culture dishes coated with vitronectin (Gibco) and cultured in StemFlex medium (Gibco) at 5% CO2 and 37°C. When seeding the cells, they were treated with 10 μM of Y-27632 dihydrochloride (Tocris), a known ROCK (rho-associated protein kinase) inhibitor, for one day, and the medium was replaced daily, culturing until the cells reached approximately 70-80% confluence (Fig. 2A).
[0125] Afterwards, to form embryoid bodies, the cultured embryonic stem cells were washed twice with DPBS (Dulbecco's phosphate buffered saline) and suspended using StemFlex medium containing 10 μM blebbistatin (Sigma, B0560) and 10 μM Y-27632. The suspended cells were seeded at 5 x 10 per well in an ultra-low attachment 6-well plate (Corning). 5Differentiation was induced by inoculating with a dog and culturing under 5% CO2, 37℃ conditions. On the first day of differentiation, the medium was replaced with a 3:1 mixture of StemFlex medium and NIM [Neural induction medium, neural differentiation medium: DMEM (Dulbecco's Modified Eagle Medium) medium and F-12 (GlutaMAX supplement, Gibco) mixed in a 1:1 ratio, supplemented with 1% N2 supplement (Gibco), 1% MEM NEAA (MEM Non-Essential Amino Acids solution, Gibco), and 0.2 ㎍ / ㎖ heparin (Sigma-Aldrich)], and on the second day, the medium was replaced with a 1:1 mixture of StemFlex medium and NIM medium. From the third day onwards, culture was performed only with NIM medium. On day 6 of differentiation, embryoid bodies formed in 6-well plates coated with GFR matrigel matrix (GFR-matrigel matrix, Corning) at a concentration of 0.33 mg / ml were seeded at a density of 80–90 per well and cultured in NIM medium. On day 15 of differentiation, the medium was replaced with RDM [retinal differentiation medium: DMEM and F-12 mixed in a 3:1 ratio, supplemented with 2% B27 supplement without vitamin A (Gibco), 1% MEM NEAA, and 1% penicillin-streptomycin (Welgene)] and cultured, and the medium was replaced with fresh RDM every other day. Between days 28 and 30 of differentiation, retinal structures similar to optic vesicles were microdissected using a 26-gauge syringe needle, seeded 20 cells per well in ULA 6-well plates, and cultured in three dimensions for up to 40 days (Fig. 2B).
[0126]
[0127] 1-2. Isolation and acquisition of retinal progenitor cells from retinal organoids
[0128] Retinal progenitor cells were prepared using retinal organoids produced by the method described in Example 1-1. Specifically, retinal organoids on day 40 of differentiation were observed using an optical microscope (EVOS, Thermo Fisher) and selectively selected. Only organoids with a maximum diameter of 300 μm or more, a clearly formed layered structure of the neural retina (NR) on the outside, and a pigmented domain composed of retinal pigmented epithelium (RPE) were selected (Fig. 2). The selected retinal organoids were then excised under a microscope using a Vannas microscissor or a 26-gauge syringe needle to remove the pigmented domain, thereby isolating only the layered structure containing the neural retina (Fig. 3). 48-60 detached structures were washed twice with DPBS, treated with TrypLE select for 10 min at 37°C, and then dissociated into single cells by up-and-down pipetting in RDM medium containing 1 μg / ml DNase (Worthington) (Fig. 3). These cells were seeded at 1.2 x 10 on vitronectin-coated culture dishes. 5 / cm 2 The cells were seeded at a density of 10 μM and cultured for 1 day in RDM medium containing 10 μM Y-27632. Then, the medium was replaced with RPCM [RPC maintenance medium: DMEM and F-12 mixed in a ratio of 3:1, supplemented with 2% B27 supplement, 1% MEM NEAA, 1% penicillin-streptomycin, 0.5 μg / mL heparin, 20 ng / mL EGF (PeproTech), and 20 ng / mL bFGF (PeproTech)] and cultured.
[0129]
[0130] 1-3. Subculture and expansion of retinal progenitor cells
[0131] For the numerical expansion of cells cultured using the method described in Example 1-2 above, on the 4th day of culture, RPCM was replaced with RPCEM [RPC expansion medium: DMEM and F-12 mixed in a 3:1 ratio, 2% B27 supplement, 1% MEM NEAA, 1% penicillin-streptomycin, 0.5 μg / ml heparin, 20 ng / ml EGF, 10 ng / ml bFGF, 3 μM CHIR99021 (Tocris), 1 μM SB431542 (Tocris), 1 μM PD0325901 (Tocris), 1 μM Purmorphamine (Tocris) added) and cultured. The CHIR99021 used in the production of RPCEM is a GSK3 (Glycogen synthase kinase 3) inhibitor, the SB431542 is an ALK5 (Activin receptor-like kinase 5) inhibitor, the PD0325901 is a MEK (Mitogen-activated protein kinase kinase) inhibitor, and the purmorphamine is a Hedgehog signaling agonist.
[0132] On the 8th day of culture, the cells were washed twice with DPBS, and the cells were harvested using TrypLE select. Then, they were suspended in RPCM medium containing 10 μM Y-27632 and seeded at 1.2 x 10 in vitronectin-coated culture dishes or 25T flasks. 5 / cm 2 The medium was inoculated at a density of 100 μm. From the next day, the medium was replaced with RPCEM medium every other day, and subculture was performed every 6 or 7 days using the same method as above for cell expansion.
[0133]
[0134] Example 2. Characterization of manufactured retinal progenitor cells
[0135] 2-1. Morphological analysis of retinal progenitor cells
[0136] The retinal progenitor cells prepared by the method of Example 1 above were observed for their morphological characteristics using an optical microscope.
[0137] As a result, the retinal progenitor cells exhibited a bright neuronal morphology, grew in clusters during culture, and it was confirmed that these morphological characteristics were maintained during 7 passages (Fig. 4).
[0138]
[0139] 2-2. Expression analysis of retinal progenitor cell-specific molecular markers
[0140] Retinal progenitor cells are known to specifically express the Chx10 protein, and also express the neural stem cell markers Pax6 and Sox2 proteins and the cell proliferation marker Ki67 protein at high levels. Therefore, immunocytochemistry for the Chx10, Pax6, Sox2, and Ki67 proteins was performed on the retinal progenitor cells prepared by the method of Example 1. Specifically, the retinal progenitor cells were fixed with 4% paraformaldehyde on vitronectin-coated cover glasses, and then blocked with PBS containing 2% bovine serum albumin (BSA, Gibco), 5% normal goat serum (NGS, Jackson Immunoresearch), and 0.1% Triton X-100 (Sigma-Aldrich) for 1 hour at room temperature. Then, the primary antibody was reacted overnight at 4°C. The primary antibodies used were anti-Chx10 (Exalpa), anti-Pax6 (BioLegend), anti-Sox2 (Santa Cruz), and anti-Ki67 (Vector). After washing three times with PBS containing 0.1% Triton X-100, the cells were incubated with secondary antibodies conjugated with Alexa Fluor 488 or Cy3 for 1 hour at room temperature, and then the nuclei of the cells were stained using Hoechst 33342 dye. Afterwards, fluorescence images were obtained using a Zeiss Axio Imager 2 fluorescence microscope equipped with an AxioCam camera or a Zeiss LSM700 confocal microscope.
[0141] As a result, it was confirmed that Chx10, Pax6, Sox2, and Ki67 proteins were expressed in the nucleus in retinal progenitor cells of passages 0, 3, and 7 (Fig. 5).
[0142] In addition, in order to analyze changes during the subculture of retinal progenitor cells manufactured by the method of Example 1, the number of cells positive for Chx10, Pax6, Sox2, and Ki67 proteins was measured in the immunocytochemically stained fluorescent images.
[0143] As a result, cells positive for both Chx10 and Pax6 accounted for 72.38±5.17% in passage 0, 92.48±6.30% in passage 3, and 63.91±7.05% in passage 7, and cells positive for both Sox2 and Ki67 accounted for 61.58±7.91% in passage 0, 79.75±7.49% in passage 3, and 72.33±5.45% in passage 7 (Fig. 6).
[0144] Based on the above results, it was found that retinal progenitor cells manufactured by the method according to the present invention maintain their characteristics even after multiple passages, and that highly pure retinal progenitor cells of up to 98% can be obtained through at least three passages.
[0145]
[0146] 2-3. Marker gene expression analysis of retinal progenitor cells
[0147] Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes are known to be abundantly expressed in retinal progenitor cells during retinal development. qRT-PCR was performed on retinal progenitor cell marker genes during serial passage of retinal progenitor cells prepared by the method of Example 1. Specifically, total RNA was extracted from retinal progenitor cells using TRIzol (Invitrogen), and cDNA was synthesized using the SuperScript III First-Strand Synthesis Kit (Invitrogen). The synthesized cDNA was mixed with specific primers (Table 1) for Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes, which are markers of retinal progenitor cells, and SYBR Green Mastermix (SmartGene) to perform qRT-PCR on a CFX96 Real-Time PCR System (Bio-Rad). The expression levels of all genes were corrected based on the expression level of GAPDH, an internal control.
[0148] Primer information used in qRT-PCR analysis Gene Primer sequence 5'-3' (SEQ ID NO) Lhx2F:TAGCATCTACTGCAAGGAAGAC (1) R:GTGATAAACCAAGTCCCGAG (2) Pax6F:AACATACCAAGCGTGTCATC (3) R:AATTTGCTCTTGGGTAAAGG (4) Chx10F:GAAGACAGGATACAGGTCTGG (5) R:AATGCTGTTCTCCCTCAGTT (6) Sox2F:AGACGCTCATGAAGAAGGAT (7) R:CGAGTAGGACATGCTGTAGG (8) Six6F:GGTGGGCAACTGGTTCAA (9) R:GATGGAGATGGCTGAAGT (10) Ascl1F:CGGCCAACAAGAAGATGAGTAAG (11) R:AAGTCGTTGGAGTAGTTGGGG (12)GAPDHF:GAAGATGGTGATGGGATTTC (13)R:GAAGGTGAAGGTCGGAGT (14)
[0149] As a result, it was confirmed that the expression levels of Lhx2, Pax6, Chx10, Sox2, and Six6 genes in retinal progenitor cells increased until the third passage and then decreased, but the expression level of Ascl1 gene showed a tendency to continuously increase until the seventh passage. In addition, it was confirmed that the expression level of Ascl1 gene in retinal progenitor cells was significantly higher than that in retinal organoids (Fig. 7).
[0150] Based on the above results, it was predicted that retinal progenitor cells manufactured by the method according to the present invention would maintain their characteristics even after multiple passages, and that the Ascl1 gene is a pre-neuronal transcription factor necessary for differentiation of retinal photoreceptor cells, and thus retinal progenitor cells manufactured by the method according to the present invention would have high differentiation potential through passages.
[0151]
[0152] 2-4. Verification of differentiation potential of retinal progenitor cells
[0153] Retinal progenitor cells have the ability to differentiate into neurons that make up the retina. The differentiation ability was confirmed by culturing the retinal progenitor cells prepared by the method of Example 1 under the differentiation conditions of photoreceptor cells and retinal ganglion cells. Specifically, 2.5X10 retinal progenitor cells were seeded into each well of a 24-well plate containing cover glass. 5 Each cell was inoculated and cultured in RPCEM medium. Cover glass was used at 2 ㎍ / cm 2 Poly-D-lysine (Gibco) and 1 μg / cm 2Lamin (Sigma-Aldrich)-coated medium was used. To induce photoreceptor cell differentiation, the medium was replaced with a photoreceptor cell differentiation medium [DMEM and F-12 mixed at a 1:1 ratio, supplemented with 1% N2 supplement, 2% B27 supplement, 1% MEM NEAA, 1% penicillin-streptomycin (Welgene), 10 ng / mL bFGF, and 10 ng / mL BDNF (brain-derived neurotrophic factor)] every other day from the second day of culture and cultured for 35 days. In addition, to induce retinal ganglion cell differentiation, the medium was replaced with a retinal ganglion cell differentiation medium [DMEM and F-12 mixed at a 1:1 ratio, supplemented with 1% N2 supplement, 10% FBS (Corning), and 0.5 μM retinoic acid] every other day from the second day of culture and cultured for 20 days. Differentiation-induced cells were subjected to immunocytochemical staining using antibodies against Rhodopsin, a photoreceptor cell marker, Brn3a, a retinal ganglion cell marker, and TUJ1 protein, a neuron marker, using the method of Example 2-2.
[0154] As a result, it was confirmed that Rhodopsin, Brn3a, and TUJ1 proteins were expressed in retinal progenitor cells (Fig. 8).
[0155] In addition, the number of rhodopsin-positive photoreceptor cells differentiated from retinal progenitor cells obtained at passages 1, 3, and 7 was confirmed to be 15.93±2.27% at passage 1, 21.80±4.19% at passage 3, and 12.18±3.41% at passage 7, and the number of Brn3a-positive retinal ganglion cells differentiated from retinal progenitor cells obtained at passages 1, 3, and 7 was confirmed to be 32.13±4.89% at passage 1, 37.84±5.32% at passage 3, and 23.40±3.98% at passage 7 (Fig. 9).
[0156] Based on the above results, it was found that retinal progenitor cells manufactured by the method according to the present invention maintain differentiation ability even after multiple passages, and that retinal progenitor cells obtained through three passages have the greatest differentiation ability.
[0157]
[0158] Example 3: Evaluation of the expandability of manufactured retinal progenitor cells
[0159] 3-1. Growth rate analysis using doubling time of retinal progenitor cells
[0160] In order to analyze the expandability of retinal progenitor cells manufactured by the method of Example 1 above, the doubling time of each cell obtained through 9 consecutive subcultures was calculated according to the following formula.
[0161] Cell doubling time = t X [lg2 / (lgN t - lgN0)]
[0162] t = incubation period, N t = number of cells during period t, N0 = number of cells initially inoculated
[0163]
[0164] As a result, it was confirmed that the doubling time was rapidly shortened from the third passage onwards (Fig. 10), and it was found that the retinal progenitor cells produced by the method according to the present invention had an accelerated growth rate from the third passage onwards.
[0165]
[0166] 3-2. Scalability analysis using the number of cells obtained per passage of retinal progenitor cells
[0167] To confirm the expandability of retinal progenitor cells manufactured by the method of Example 1, the number of cells per passage was analyzed. Specifically, 1X10 cells obtained from 8 to 10 retinal organoids were cultured in a 3.5 cm culture dish coated with vitronectin. 6The cells were inoculated and subcultured three times every 7 days according to the method of Example 1-3. Thereafter, the cell number of each passage was measured using an automatic cell counter (Countess II, ThermoFisher).
[0168] As a result, in the 0th generation, 2.74±0.28Х10 6 Dog, 6.32±0.96Х10 in the 1st passage 6 Dog, 17.53±2.81Х10 in the 2nd passage 6 Dog, 74.15±9.45Х10 in the 3rd passage 6 It was confirmed that the dog was obtained (Fig. 11).
[0169]
[0170] Example 4. Verification of a medium composition for producing retinal progenitor cells.
[0171] The purpose of this study was to verify whether CHIR99021, SB431542, PD0325901 and Purmorphamine included in the RPCEM used in the above Examples 1-3 are essential compositions that can maintain the characteristics of retinal progenitor cells even after multiple consecutive subcultures.
[0172]
[0173] 4-1. Comparative Analysis of Retinal Progenitor Cell-Specific Molecular Marker Expression
[0174] The retinal progenitor cells prepared by the method of Example 1 were cultured for 3 or 7 passages in a medium [RPC expansion medium: DMEM and F-12 mixed in a 3:1 ratio, 2% B27 supplement, 1% MEM NEAA, 1% penicillin-streptomycin, 0.5 ㎍ / ㎖ heparin, 20 ng / ㎖ EGF, 10 ng / ㎖ bFGF] without the addition of CHIR99021, SB431542, PD0325901 and a mixture of permorphamine. The expression of Chx10, Pax6, Sox2 and Ki67 proteins was analyzed using the immunocytochemical staining method described in Example 2-2.
[0175] As a result, it was confirmed that most cells were Sox2 and Ki67 positive, and only a few cells were Chx10 and Pax6 positive (Fig. 12).
[0176] Additionally, the number of Chx10 and Pax6 positive cells and the number of Sox2 and Ki67 positive cells were measured in the above immunocytochemically stained fluorescent images.
[0177] As a result, Chx10 and Pax6 positive cells were confirmed to account for 12.92±3.93% of total cells in passage 3 and 3.90±2.55% of total cells in passage 7, and Sox2 and Ki67 positive cells were confirmed to account for 79.09±4.05% of total cells in passage 3 and 71.01±6.27% of total cells in passage 7 (Fig. 13).
[0178] When these results are compared with the results of subculturing in a medium containing the mixture of CHIR99021, SB431542, PD0325901 and puropamine in Example 2-2 (Fig. 6), the number of Sox2 and Ki67 positive cells did not show a significant difference, but the number of Chx10 and Pax6 positive cells was confirmed to decrease by about 80% in passage 3 and 60% in passage 7, indicating that the characteristics of retinal progenitor cells are lost when subculturing is performed without the mixture of CHIR99021, SB431542, PD0325901 and puropamine.
[0179]
[0180] 4-2. Comparative analysis of marker gene expression in retinal progenitor cells
[0181] The expression levels of Lhx2, Pax6, Chx10, Sox2, Six6 and Ascl1 genes were analyzed using the qRT-PCR method described in Example 2-2 using cells cultured three times in a medium supplemented with or without CHIR99021, SB431542, PD0325901 and a mixture of permorphamine.
[0182] As a result, it was confirmed that the expression levels of Lhx2, Pax6, Chx10, Sox2, Six6, and Ascl1 genes in retinal progenitor cells cultured in a medium containing a mixture of CHIR99021, SB431542, PD0325901, and puropamine were higher than those in retinal progenitor cells prepared in a medium not containing a mixture of CHIR99021, SB431542, PD0325901, and puropamine (Fig. 14). In particular, it was confirmed that the expression levels of the Ascl1 gene, known as a preneuronal transcription factor essential for differentiation into neurons, showed a very large difference, and it was confirmed that this difference was also shown in the results of immunocytochemical staining image analysis using an anti-Ascl1 antibody (Fig. 15).
[0183]
[0184] 4-3. Comparative analysis of differentiation potential of retinal progenitor cells
[0185] Cells were cultured three times in a medium supplemented with or without CHIR99021, SB431542, PD0325901 and a mixture of permorphamine, and differentiation was induced using the method described in Example 2-4. Then, qRT-PCR was performed using primers for the photoreceptor cell markers Rhodopsin, Opn1mw / lw, and Recoverin genes and the retinal ganglion cell markers Math5 and NeuroD1 genes (Table 2).
[0186] Primer information used in qRT-PCR analysis Gene Primer sequence 5'-3' (SEQ ID NO) Rhodopsin F:TCAAGCCGGAGGTCAACAAC (15) R:TCTTGGACACGGTAGCAGAG (16) Opn1mw / lw F:GAACCAGGTCTATGGCTACTTCG (17) R:TCTCACATTGCCAAAGGGCTT (18) Recoverin F:GACCATCAGCAAGAATGAAG (19) R:TCAGTCGCAGAATTTCCTTA (20) Math5 F:CCGAACAGGACAAACTCACA (21) R:TCGCATCATCAGACCTATGG (22) NeuroD1 F:ATTATGCCTTTACCATGCAC (23) R:ACTGTAAGCACAGTGGGTTC (24)
[0187] As a result, it was confirmed that the expression levels of Rhodopsin, Opn1mw / lw, Recoverin, Math5, and NeuroD1 genes in retinal progenitor cells prepared in a medium containing a mixture of CHIR99021, SB431542, PD0325901, and puropamine were higher than those in retinal progenitor cells prepared in a medium not containing a mixture of CHIR99021, SB431542, PD0325901, and puropamine (Fig. 16).
[0188] Based on the above results, it was found that the mixture of CHIR99021, SB431542, PD0325901 and permorphamine was an important component of a medium for producing retinal progenitor cells with excellent differentiation potential.
[0189]
[0190] Example 5. Confirmation of the inhibitory effect of manufactured retinal progenitor cells on retinal degeneration.
[0191] In order to confirm whether the retinal progenitor cells manufactured by the method of Example 1 are effective as a cell therapy, the cells were transplanted into the eyes of retinal degeneration mice and the inhibitory effect on retinal degeneration was analyzed. The retinal degeneration mice used were RhoP23H / + mice (The Jackson Laboratory), which are used as an animal model of retinitis pigmentosa. RhoP23H / + mice show a characteristic of gradual decrease in the thickness of the outer nuclear layer (ONL) of the retina due to the death of photoreceptor cells, with retinal degeneration beginning two weeks after birth. All animal experiments were conducted in compliance with the approval of the Institutional Animal Care and Use Committee (IACUC) of Konyang University and the guidelines for the use of experimental animals in ophthalmic and vision research of the Korean Society for Vision and Ophthalmology. Cell transplantation was performed on the 30th day after birth. 1X10 retinal progenitor cells obtained through three passages by the method of Examples 1-3 were cultured in 1 ㎕ of HBSS (Hank's Balanced Salt Solution, Gibco). 5 After suspension at a concentration of 10 mg / mL, the solution was injected into the vitreous cavity of the mouse eye using a 33-gauge Hamilton needle. The contralateral eye was injected with the same volume of HBSS alone to serve as a control. Afterwards, all mice were administered 210 mg / L cyclosporine A dissolved in water for 6 weeks for immunosuppression.
[0192]
[0193] 5-1. Analysis of morphological changes in the retina
[0194] To confirm the inhibitory effect of retinal progenitor cells on retinal degeneration, some experimental animals were sacrificed 12 weeks after cell transplantation, and the eyes were enucleated. The eyes were frozen and sectioned for immunohistochemical staining. The eye tissue sections were triturated in 0.5% Triton X-100, washed with PBS, and blocked with PBS containing 2% BSA and 5% NGS. Subsequently, the sections were reacted overnight at 4°C with anti-Rhodosin (Santa Cruz) antibody and Alexa Fluor 488-conjugated peanut agglutinin lectin (PNA, ThermoFisher), washed three times with PBS containing 0.1% Triton X-100, and then reacted with a secondary antibody conjugated to Cy3 for 1 hour at room temperature, and the nuclei were stained using Hoechst 33342 dye. Subsequently, fluorescence images were obtained using a Zeiss Axio Imager 2 fluorescence microscope equipped with an AxioCam camera or a Zeiss LSM700 confocal microscope.
[0195] As a result, it was confirmed that the outer nuclear layer (ONL) of the retina of the experimental group injected with retinal progenitor cells was thicker than that of the control group (HBSS only administered group) (Fig. 17).
[0196] In addition, for quantitative analysis of the thickness of the outer nuclear layer (ONL) of the retina, the thickness of the ONL was measured at 300 μM intervals from the center of the optic nerve head (ONH) toward the upper and lower edges, and it was confirmed that the ONL thickness of the experimental group injected with retinal progenitor cells was significantly different from that of the control group (HBSS only administered group) (Fig. 18).
[0197] The outer nuclear layer (ONL) of the retina is composed of photoreceptor cells, both rods and cones, which form a specialized light-receiving structure called the outer segment (OS). Rhodosin and peanut agglutinin lectin (PNA) are used as specific markers for rods and cones, respectively. Therefore, immunohistochemical staining for rhodosin and PNA was performed on eyes from the experimental group injected with retinal progenitor cells.
[0198] As a result, the expression of rhodosin and PNA in the experimental group injected with retinal progenitor cells was higher than that in the control group (HBSS alone administration group), and the length of OS was longer than that in the control group (HBSS alone administration group) (Fig. 19). This indicates that the number of photoreceptor cells increased in the retina of the experimental group injected with retinal progenitor cells.
[0199] Based on the above results, it was found that the morphological degeneration of photoreceptor cells in the retina can be suppressed through transplantation of retinal progenitor cells manufactured by the method according to the present invention.
[0200]
[0201] 5-2. Electroretinogram examination of the retina
[0202] To confirm the retinal function recovery effect of retinal progenitor cells, 12 weeks after injection, mice were acclimated in a darkroom for 12 hours, anesthetized, and then instilled with 1% (w / v) tropicamide to induce mydriasis (pupil dilation). Two electrodes were then placed on each cornea, and electroretinograms (ERGs) were recorded while providing light stimulation. All procedures were performed in a darkroom at a body temperature of 37°C, and the ERG device used was a Celeris model from Diagnosys LLC.
[0203] As a result, the control group (HBSS only administered group) showed a slight increase in the amplitude of the a-wave and b-wave as the light stimulus increased, whereas the experimental group injected with retinal progenitor cells showed a significant increase in the amplitude of the a-wave and b-wave as the light stimulus increased, and it was confirmed that there was a significant difference in the amplitude of the a-wave and b-wave between the two groups (Fig. 20).
[0204] Based on the above results, it was found that transplantation of retinal progenitor cells manufactured by the method according to the present invention can suppress retinal function loss due to morphological degeneration of the retina, and thus has the potential to be used as a cell therapy for degenerative retinal diseases such as retinitis pigmentosa.
Claims
1. A method for producing retinal progenitor cells with excellent differentiation potential, comprising the step of culturing cells isolated from retinal organoids in a medium containing a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
2. A method for producing retinal progenitor cells with excellent differentiation potential, wherein in paragraph 1, the GSK3 inhibitor is CHIR99021, the ALK5 inhibitor is SB431542, the MEK inhibitor is PD0325901, and the Hedgehog signaling pathway activator is purmorphamine.
3. A method for producing retinal progenitor cells with excellent differentiation ability, wherein in the second paragraph, CHIR99021, SB431542, PD0325901 and purmorphamine are contained at concentrations of 2 to 4 μM, 0.5 to 1.5 μM, 0.5 to 1.5 μM and 0.5 to 1.5 μM, respectively.
4. In paragraph 1, (a) a step of producing retinal organoids from embryonic stem cells; (b) a step of detaching the layer structure containing the neural retina from the manufactured retinal organoid and dissociating it into single cells; and (c) a step of subculturing the dissociated single cells 2 to 4 times every 5.5 to 7.5 days in a medium containing a GSK3 inhibitor, an ALK5 inhibitor, a MEK inhibitor, and a Hedgehog signaling pathway activator as active ingredients; a method for producing retinal progenitor cells with excellent differentiation potential, comprising:
5. A method for producing retinal progenitor cells with excellent differentiation potential, wherein the retinal organoid produced in step (a) has a layered structure of the neural retina and includes a pigmented domain composed of retinal pigment epithelium.
6. In the fourth paragraph, the layer structure including the neural retina of step (b) is a method for producing retinal progenitor cells with excellent differentiation ability, obtained by removing a pigmented domain from the retinal organoid produced in step (a).
7. In paragraph 4, between steps (b) and (c) (b-1) culturing the dissociated single cells in a medium containing a ROCK inhibitor; and (b-2) Step of additional culture after replacing with a medium for maintaining retinal progenitor cells; A method for producing retinal progenitor cells with excellent differentiation potential, which additionally includes:
8. A method for producing retinal progenitor cells with excellent differentiation ability, wherein in paragraph 7, step (b-1) is performed for 0.5 to 2 days, and step (b-2) is performed for 2 to 4 days.
9. A medium composition for producing retinal progenitor cells with excellent differentiation potential, comprising a GSK3 (Glycogen synthase kinase 3) inhibitor, an ALK5 (Activin receptor-like kinase 5) inhibitor, a MEK (Mitogen-activated protein kinase kinase) inhibitor, and a Hedgehog signaling pathway activator as active ingredients.
10. A medium composition for producing retinal progenitor cells with excellent differentiation potential in claim 9, wherein the GSK3 inhibitor is CHIR99021, the ALK5 inhibitor is SB431542, the MEK inhibitor is PD0325901, and the hedgehog signaling pathway activator is purmorphamine.
11. A medium composition for producing retinal progenitor cells with excellent differentiation ability, characterized in that in clause 10, CHIR99021, SB431542, PD0325901 and purmorphamine are contained in concentrations of 2 to 4 μM, 0.5 to 1.5 μM, 0.5 to 1.5 μM and 0.5 to 1.5 μM, respectively.
12. A medium composition for producing retinal progenitor cells with excellent differentiation ability, characterized in that in claim 9, the medium composition additionally contains at least one selected from a carbon source, a nitrogen source, an inorganic salt, an amino acid, and an antibiotic.
13. Retinal progenitor cells produced by any one of the methods of claims 1 to 8.
14. In claim 13, the manufactured retinal progenitor cells are characterized in that they can be continuously subcultured and maintain differentiation ability into neurons even as subculture progresses.
15. A pharmaceutical composition for preventing or treating retinal diseases, comprising the retinal progenitor cells of Article 13 as an active ingredient.
16. A pharmaceutical composition for preventing or treating a retinal disease, wherein the retinal disease in clause 15 is any one selected from the group consisting of macular degeneration, retinitis pigmentosa, macular degeneration, traumatic retinal damage, and light-induced retinal damage.
17. A method for preventing or treating a retinal disease, comprising administering a therapeutically effective amount of the retinal progenitor cells of clause 13 or the pharmaceutical composition of clause 15 to a subject in need thereof.
18. A method for preventing or treating a retinal disease in claim 17, wherein the retinal disease is any one selected from the group consisting of macular degeneration, retinitis pigmentosa, macular degeneration, traumatic retinal damage, and light-induced retinal damage.
Citation Information
Patent Citations
Method for inducing human pluripotent stem cell to differentiate into RPE cell
CN109136184A
Method for producing retinal tissues
CN111094554A
Method for differentiation into retinal cells from stem cells
KR1020110037907A
Card reader type access control system and method
KR1020210128192A
Connection structure of an integrated circuit and method of manufacturing the same
KR1020230121014A