Composition for treating cancer comprising gene carrier based on gold nanoparticle-nucleic acid conjugate

Abstract

The present invention relates to a gold nanoparticle carrier or a pharmaceutical composition for the prevention or treatment of cancer comprising the same, wherein the gold nanoparticle carrier includes gold nanoparticles, an antisense oligonucleotide (ASO) bound to the surface of the gold nanoparticles and binding specifically to a cancer-causing mutant gene, and an aptamer specific for a protein expressed by cancer cells.

Description

A composition for treating cancer comprising a gene carrier based on a gold nanoparticle-nucleic acid conjugate

[0001] The present invention relates to a carrier comprising gold nanoparticles and a cancer-specific antisense oligonucleotide (ASO) bound to the surface of the gold nanoparticles, and its use as a drug delivery vehicle, particularly to an anticancer agent comprising the carrier or a pharmaceutical composition comprising the same.

[0002] Nanoparticles are particles with nanometer-sized dimensions. Their small size and high surface area allow them to possess diverse physical and chemical properties. Gold nanoparticles, the most widely used nanoparticles, exhibit surface electromagnetic resonance (SPR) in the visible light range, which occurs due to light absorption and scattering depending on their size and shape. This allows them to be utilized for detection and imaging based on fluorescent labels. Furthermore, their ease of introducing surface functional groups, coupled with their high biocompatibility and stability, make them ideal for the delivery of biological substances such as DNA, RNA, proteins, and antibodies, as well as various drugs.

[0003] Technologies for delivering genetic material into cells, such as cell therapy, to produce antigens or proteins for treatment or prevention are being continuously researched, and in particular, vaccine development technology has grown significantly due to the recent pandemic, leading to the development of various genetic vaccines such as DNA vaccines, mRNA vaccines, and viral vector vaccines.

[0004] DNA is the simplest genetic material, making it easily genetically modified, potentially shortening the development period for vaccines and other therapeutics. Furthermore, it offers significant advantages over other vaccine candidates, such as viruses, proteins, and RNA, in terms of production facility construction and production costs. Furthermore, its superior stability facilitates easy storage and distribution. However, DNA vaccines require delivery to the nucleus of the cell, where mRNA is directly produced. While DNA injected into the nucleus can continuously produce mRNA and antigen proteins, the introduction of a different genetic trait into the cell nucleus raises concerns about adverse effects, such as innate immune responses. Furthermore, when delivered via plasmids, DNA can carry bacterial genes in addition to antigens, potentially leading to adverse effects such as mutations in the body. Therefore, research into carriers and delivery technologies for the safe delivery of DNA into cells is necessary.

[0005] Accordingly, the present inventors have made extensive research efforts to develop a nucleic acid delivery technology to efficiently deliver nucleic acid molecules that can be delivered into cells and expressed independently to the nucleus of cells. As a result, they have developed a delivery system that can deliver nucleic acid molecules into cells by attaching them to the surface of metal nanoparticles, and have completed the present invention for an anticancer agent using the same or a pharmaceutical composition for treating cancer containing the same.

[0006] Accordingly, an object of the present invention is to provide a gold nanoparticle carrier comprising a gold nanoparticle; and an antisense oligonucleotide (ASO) that binds to mRNA of a gene containing a cancer-causing mutation and an aptamer specific for a cancer cell-expressed protein, which are bound to the surface of the gold nanoparticle.

[0007] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating cancer comprising the carrier.

[0008] To achieve the above-described purpose, the present invention provides a gold nanoparticle carrier comprising: a gold nanoparticle; and an antisense oligonucleotide (ASO) that binds to mRNA of a gene containing a cancer-causing mutation and an aptamer specific for a cancer cell-expressed protein, which are bound to the surface of the gold nanoparticle.

[0009] In order to achieve another object of the present invention, the present invention provides a pharmaceutical composition for preventing or treating cancer comprising the carrier.

[0010] Hereinafter, the present invention will be described in detail.

[0011] In one aspect, the present invention relates to a gold nanoparticle carrier comprising a gold nanoparticle; and an antisense oligonucleotide (ASO) that binds to mRNA of a gene containing a cancer-causing mutation and an aptamer specific for a cancer cell-expressed protein, the ASO being bound to the surface of the gold nanoparticle.

[0012] Antisense oligonucleotides (ASOs) are single-stranded deoxyribonucleotides complementary to specific mRNAs, as well as noncoding RNAs such as microRNAs or long noncoding RNAs (Beermann, Piccoli, Viereck, & Thum, 2016; Bennett, 2019). Antisense oligonucleotides specifically bind to target RNA sequences through Watson–Crick base pairing and promote the degradation of bound RNA by endogenous nucleases such as RNaseH (Watts & Corey, 2012). Specifically, RNaseH can recognize RNA / DNA hybrid duplex structures and induce mRNA cleavage and genome degradation (Bennett, Baker, Pham, Swayze, & Geary, 2017).

[0013] That is, the term "antisense oligonucleotide (ASO)" in the present invention refers to an RNA or DNA molecule that binds to another RNA or DNA (target RNA, DNA). For example, if it is an RNA oligonucleotide, it binds to another RNA target through RNA-RNA interaction and modulates the activity of the target RNA. Antisense oligonucleotides can upregulate or downregulate the expression and / or function of a specific polynucleotide. This definition is intended to include any foreign RNA or DNA molecule that is useful from a therapeutic, diagnostic, or other perspective. As examples, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNA, decoy RNA molecules, siRNA, enzymatic RNA, therapeutic editing RNA, and antisense oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, primers, probes, and other oligomeric compounds that hybridize to at least a portion of a target nucleic acid may be included. Therefore, these compounds can be introduced in the form of single-stranded, double-stranded, partially single-stranded, or circular oligomeric compounds.

[0014] In one embodiment, the antisense oligonucleotide (ASO) of the present invention binds to a mutation in a gene selected from the group consisting of a cancer-causing mutant gene, for example, KRAS, BRAF, EGFR (Epidermal Growth Factor Receptor), ALK (Anaplastic Lymphoma Kinase), HER2 (Human Epidermal Growth Factor Receptor 2), PIK3CA (Phosphoinositide 3-kinase catalytic subunit alpha), IDH1 / IDH2 (Isocitrate Dehydrogenase 1 / 2), BRCA1, BRCA2, PD-1, PD-L1, and FGFR (Fibroblast Growth Factor Receptor), and inhibits the expression and activity thereof, and in one embodiment, the ASO binds to KRAS or BRAF mRNA, particularly, binds to a mutated KRAS or BRAF mRNA, and comprises a base sequence of SEQ ID NO: 1 to SEQ ID NO: 16 or a modified form thereof, SEQ ID NO: 17 to SEQ ID NO: 22. It can be selected from among ASOs consisting of sequences.

[0015] In particular, the KRAS used in one embodiment of the present invention is one of the RAS gene family and is known as a key factor in promoting the survival, proliferation, and invasion of cancer cells. It plays an important role in the cell signaling pathway and, under normal conditions, regulates cell growth and differentiation processes. When a mutation occurs in the KRAS, this process is abnormally activated and causes cancer. The KRAS mutation can be recognized as an antigen and targeted, and the mutation site can include, for example, G12C, G12D, or G13D.

[0016] BRAF, used in another embodiment, is an important member of the RAS-RAF-MEK-ERK signaling pathway (aka MAPK pathway), which plays a key role in cell growth and differentiation. When a mutation occurs in BRAF, it can cause excessive proliferation of cancer cells by abnormally activating the pathway. In particular, mutations in BRAF are known to cause melanoma, colon cancer, thyroid cancer, lung cancer, or ovarian cancer, and the V600E (valine (V) -> glutamic acid (E) modification) mutation is a representative example, which continuously activates the MAPK / ERK pathway and promotes the proliferation of cancer cells.

[0017] The carrier of the present invention comprises a metal nanoparticle. The metal nanoparticle has a diameter in the nanometer unit, and although the size is not limited thereto, it preferably has a diameter of 5 to 500 nm, more preferably 10 to 200 nm. Nanoparticles of this size are easy to manufacture in the form of stable particles, and their size can be easily controlled during the manufacturing process. In addition, in the case of the metal nanoparticles for use as a gene carrier as in the present invention, if the diameter increases to more than 500 nm, not only are the characteristics as nanoparticles lost, but also the bonding between the metal surface and the functional group becomes weak, making it difficult to manufacture a carrier using the nanoparticles.

[0018] In addition, the metal nanoparticles may preferably be gold nanoparticles, and the gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium.

[0019] As an example, the gold nanoparticles used in the present invention can be manufactured as follows: HAuCl4 is used as a gold source, and HAuCl4 is reduced using sodium citrate as a reducing agent to manufacture gold nanoparticles. In this case, the size of the gold nanoparticles can be controlled by varying the amount of citrate added. That is, as the amount of citrate added increases, nucleation increases, and thus the size of the gold nanoparticles decreases.

[0020] The gene delivery system of the present invention comprises a nucleic acid molecule bound to the surface of a gold nanoparticle. The nucleic acid molecule comprises one or more functionalities for binding to the surface of the gold nanoparticle. The functionalities may be a thiol group or an amine group, and may be included in one or more residues of the antisense oligonucleotide or the RNAI that binds to the antisense oligonucleotide. Although not limited thereto, the antisense oligonucleotide or the RNAI that binds to the antisense oligonucleotide comprises one or more thiolated residues, thereby enabling direct binding to the surface of the gold nanoparticle.

[0021] In one embodiment of the present invention, a thiolated RNAI oligo is bound to the surface of a gold nanoparticle, and the thiolated RNAI oligo binds the antisense oligonucleotide to the surface of the gold nanoparticle through specific binding to the antisense oligonucleotide sequence of the present invention.

[0022] In addition, the gold nanoparticles of the present invention may include an aptamer on the surface. In the present invention, the "aptamer" refers to a single-stranded nucleic acid (DNA, RNA, or modified nucleic acid) that has a stable tertiary structure in itself and has the characteristic of being able to bind to a target molecule with high affinity and specificity, and an aptamer for various desired target substances (proteins, sugars, dyes, DNA, metal ions, cells, etc.) can be developed using a method called SELEX (Systematic Evolution of Ligands of Exponential Enrichment).

[0023] In the present invention, the aptamer that binds to the gold nanoparticles may be any type of aptamer with various tags or protein-specific aptamer, particularly for recognizing proteins or polypeptides expressed in cancer cells, and is not particularly limited in its type. In one embodiment, the protein or polypeptide expressed from the cancer cell is KRAS, BRAF, EGFR (Epidermal Growth Factor Receptor), HER2 (Human Epidermal Growth Factor Receptor 2), VEGFR (Vascular Endothelial Growth Factor Receptor), TfR (Transferrin Receptor), PD-L1 (Programmed Death-Ligand 1), KRAS (Kirsten Rat Sarcoma Virus Oncogene), BRAF (v-Raf Murine Sarcoma Viral Oncogene Homolog B1), PI3K (Phosphoinositide 3-Kinase), c-MET (Mesenchymal Epithelial Transition Factor), Cyclin D1, p53 (Tumor Protein 53), BRCA1 / BRCA2 (Breast Cancer Genes 1 and 2), GLUT1 (Glucose Transporter 1), LDHA (Lactate Dehydrogenase A), E-cadherin, MMPs MSLN, Her2 / neu(erbB2), Her3(erb-B3), Her4(erb-B4), BCMA, CEA, CAIX, CMV, MUC1, MUC16, PSCA, PSMA, αvβ6 integrin, L1-CAM, B7-H3, B7-H6, NY-ESO-1, CCL-1, CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD133, CD138, CD171, CSPG4, EPG-2, EPG-40,It may include a protein selected from among FCRL5, FBP, HMW-MAA, HLA-A1, HLA-A2, IL-22 R-α, L1-CAM, (MAGE)-A1, MAGE-A3, MAGE-A6, MAGE-A10, NCAM, ROR1, Melan-A, survivin, TRP1, folate receptor-a, estrogen receptor, progesterone receptor, Wilms tumor (WT-1), pathogen-specific or expressed antigens and antigens associated with universal tags.

[0024] In one embodiment of the present invention, the gold nanoparticle carrier comprises an antisense oligonucleotide (ASO) for mRNA of a cancer-causing mutant gene bound to the surface at least once and an aptamer that specifically binds to a protein or polypeptide expressed from a cancer cell, wherein the antisense oligonucleotide can bind to the surface of the gold nanoparticle directly or through RNAI. That is, the total number of oligos including RNAI, antisense oligonucleotide, and aptamer bound to the surface of the gold nanoparticle is not limited thereto, but may be 1 to 100, and preferably 40 to 50.

[0025] In another aspect, the present invention relates to a pharmaceutical composition comprising the above-described gold nanoparticles and a gene carrier comprising double-stranded DNA. The pharmaceutical composition is intended for the prevention, improvement, or treatment of a disease, and may be, but is not limited to, a composition for the prevention or treatment of cancer.

[0026] The above pharmaceutical composition may be a cell gene therapy agent including a cell therapy agent, a genetically modified cell therapy agent, a gene therapy agent, or an RNA therapy agent, and the cell gene therapy agent may include a vaccine, an antibiotic, and an anticancer agent.

[0027] In particular, the pharmaceutical composition of the present invention may include an anticancer agent, and the anticancer agent may be selected from various cancers and tumors related thereto. The cancer may be, but is not limited to, breast cancer, cervical cancer, bladder cancer, prostate cancer, ovarian cancer, endometrial cancer, lung cancer, lung cancer, neuroendocrine cancer, soft tissue cancer, pancreatic cancer, stomach cancer, gallbladder cancer, esophageal cancer, melanoma, epithelial cancer, bone cancer, myeloma, osteosarcoma, lymphoma, leukemia, hematological tumors, or metastatic tumors.

[0028] The above cell therapy agent refers to a medicine used for the purpose of treatment, diagnosis, and prevention through a series of actions such as proliferating, selecting, or otherwise changing the biological characteristics of living autologous, allogenic, or xenogeneic cells in vitro to restore the tissue and function of cells. When the genes within the cells are modified, it is also classified as a genetically modified cell therapy agent. In addition, the gene therapy agent is a medicine manufactured for the purpose of treating or preventing genetic defects by correcting defective genes or adding new functions to cells by introducing normal genes and therapeutic genes into the patient's cells using genetic manipulation such as genetic recombination.

[0029] In addition, the RNA therapeutic agent exhibits drug efficacy by inhibiting the process of producing a protein that induces a disease from a target gene, and may include mRNA, RNAi, ASO (Antisense oligonucleotide), RNA aptamer, etc.

[0030] The pharmaceutical composition according to the present invention may further comprise suitable carriers, excipients, and diluents commonly used in the manufacture of pharmaceutical compositions. The excipients may be, for example, one or more selected from the group consisting of diluents, binders, disintegrants, lubricants, adsorbents, moisturizers, film-coating materials, and controlled-release additives.

[0031] The pharmaceutical composition according to the present invention may be formulated and used in the form of external preparations such as powders, granules, sustained-release granules, enteric-coated granules, liquids, eye drops, ellipsoids, emulsions, suspensions, alcohols, troches, aromatic waters, limonades, tablets, sustained-release tablets, enteric-coated tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, irrigation solutions, ointments, lotions, pastes, sprays, inhalants, patches, sterile injection solutions, or aerosols, according to a conventional method, and the external preparations may have formulations such as creams, gels, patches, sprays, ointments, ointments, lotions, liniments, pastes, or cataplasmas.

[0032] Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharides, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

[0033] When formulating, it is usually prepared using diluents or excipients such as fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants.

[0034] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The effective dosage level can be determined based on factors including the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and the excretion rate, the duration of treatment, concurrently used drugs, and other factors well known in the medical field. The pharmaceutical composition according to the present invention can be administered as an individual therapeutic agent or in combination with other therapeutic agents, can be administered sequentially or simultaneously with conventional therapeutic agents, and can be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that can achieve the maximum effect with the minimum amount without side effects, and this can be easily determined by a person skilled in the art to which the present invention pertains.

[0035] The pharmaceutical composition of the present invention can be administered to a subject via various routes. All modes of administration are conceivable, including oral ingestion, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, intrathecal injection, sublingual administration, buccal mucosal administration, rectal insertion, vaginal insertion, ocular administration, otic administration, nasal administration, inhalation, oral or nasal spraying, dermal administration, and transdermal administration.

[0036] The pharmaceutical composition of the present invention is determined based on the type of drug as the active ingredient, along with various related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease. As used herein, "subject" refers to a subject requiring treatment for a disease, and more specifically, mammals such as humans or non-human primates, mice, rats, dogs, cats, horses, and cows.

[0037] In the present invention, “administration” means providing a predetermined composition of the present invention to an individual by any appropriate method.

[0038] In the present invention, “prevention” means any action that suppresses or delays the onset of a target disease, “treatment” means any action that improves or beneficially changes a target disease and its metabolic abnormality symptoms by administering a pharmaceutical composition according to the present invention, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administering a composition according to the present invention.

[0039] As one aspect of the present invention, the present invention provides a vaccine composition comprising a metal nanoparticle of the present invention and a gene carrier comprising a nucleic acid molecule containing a gene of interest. The term "vaccine" refers to a biological preparation containing an antigen that provides immunity to an individual, and refers to an immunogenic or antigenic substance that induces immunity in humans or animals by administering it intravenously, for example, by injection or oral administration, for the purpose of disease prevention.

[0040] The vaccine may be a DNA vaccine. The term "DNA vaccine" refers to a vaccine that induces an immune response by artificially replicating a portion of the genes of pathogens or viruses and then administering the resulting vaccine. The vaccine composition may be capable of cultivating immunity against various infectious diseases, genetic diseases, other diseases, or cancer.

[0041] The above vaccine composition can be injected into a subject in various forms. The 'injection' can be performed by any method selected from the group consisting of subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, nasal administration, oral administration, transdermal administration, and oral administration, and more preferably, it can be administered by any route suitable for administering a DNA vaccine, for example, subcutaneous, intramuscular, intraperitoneal, or intravenous injection.

[0042] The above vaccine composition may include one or more adjuvants to improve or enhance the immune response. Suitable adjuvants may include compositions comprising peptides, aluminum hydroxide, aluminum phosphate, aluminum oxide, and mineral or vegetable oils such as Marcol 52 and one or more emulsifiers, or surface-active substances such as lysoxazole, polycations, and polyanions.

[0043] The present invention relates to a gold nanoparticle carrier comprising a gold nanoparticle; an antisense oligonucleotide (ASO) that specifically binds to a modified KRAS mRNA and an aptamer specific for a cancer cell-expressed protein, which are bound to the surface of the gold nanoparticle; and a pharmaceutical composition for preventing or treating cancer comprising the same, wherein the carrier technology using the gold nanoparticle can enhance targeting ability toward cancer cells and have an excellent anticancer effect through inhibition and degradation of KRAS mutations.

[0044] Figure 1 is a schematic diagram showing the structure of a gold nanoparticle carrier having a cancer therapeutic effect, including a gold nanoparticle of the present invention and an aptamer and an ASO of KRAS bound thereto.

[0045] Figure 2 shows the results of confirming the efficacy of KRAS ASO treatment in pancreatic cancer cells.

[0046] Figure 3 shows the results of confirming the efficacy of KRAS ASO treatment in colon cancer cells.

[0047] Figure 4 shows the results of confirming the efficacy of KRAS ASO treatment in lung cancer cells.

[0048] Figure 5 shows the results of confirming the efficacy of KRAS ASO by inducing pancreatic cancer and colon cancer tissues in a xenograft mouse model.

[0049] Figure 6 shows the results of confirming cell survival rate when BRAF ASO was treated in melanoma cancer (A2058) with V600E mutation.

[0050] Figure 7 shows the results of confirming the effect of inhibiting the expression of BRAF V600E protein in melanoma cancer cells with the V600E mutation of BRAF ASO.

[0051] Figure 8 shows the results of confirming the change in tumor volume when BRAF ASO was treated to tumor tissue of mice that induced melanoma.

[0052] Figure 9 is a schematic diagram of the binding site of the ASO with confirmed efficacy and the KRAS gene.

[0053] Figure 10 is a schematic diagram and sequence of a modified ASO synthesized for improved stability.

[0054] Figure 11 shows the results confirming the degree to which the stability of the modified ASO is improved.

[0055] Figure 12 shows the results of confirming the protein expression efficacy of the modified ASO through pancreatic cancer cells.

[0056] Figure 13 shows the results confirming the effect of ASO-aptamer conjugated gold nanoparticle targeting delivery system in a xenograft mouse model.

[0057] Figure 14 shows the results of confirming the delivery of ASO through a target delivery vehicle and the effect of suppressing the expression of KRAS mRNA by inducing pancreatic cancer tissue in a xenograft mouse model.

[0058] Hereinafter, examples will be described in detail to specifically explain this specification. However, the embodiments according to this specification may be modified in various different forms, and the scope of this specification is not limited to the embodiments described below. The embodiments of this specification are provided to more fully explain this specification to those of average skill in the art.

[0059]

[0060] Example 1. Preparation of ASO-functionalized gold nanoparticles (AuNP-RNAI-ASO)

[0061] A nanocomplex was manufactured by covalently binding antisense oligonucleotides (ASOs) that complementarily bind to KRAS mRNA and BRAF mRNA to gold nanoparticles, and a schematic diagram of the manufacturing process is shown in Fig. 1.

[0062] 1-1. Fabrication of 13nm gold nanoparticles

[0063] The gold nanoparticles used in the present invention were prepared by reducing HAuCl4 using HAuCl4 as a gold source and sodium citrate as a reducing agent. More specifically, 545 ml of a 0.92 mM HAuCl4 solution and 5 ml of a 388 mM sodium citrate solution were mixed and reacted at 100°C for 15 minutes. The reaction product was analyzed using a transmission electron microscope to confirm the synthesis and size of nanoparticles.

[0064] 1-2. Pretreatment of Cargo DNA

[0065] In order to manufacture a gene carrier according to the present invention, Anti RNAI-DNA that detects and specifically binds to an RNAI sequence was used as Cargo DNA (see Prior Patent Registration No. 10-1230913). More specifically, the Cargo DNA is a DNA whose 3' end is modified with a thiol group and consists of the base sequence 5'- ATCTCGGCTCTGCTAGCGAAAAAAAAAA-SH- 3' (SEQ ID NO: 25). The dried DNA was dissolved in water to a final concentration of 100 μM, and then 20 μl of 3 M sodium acetate and 30 μl of 1 N DTT (dithiothreitol) were added to 150 μl of oligo, and the mixture was reacted at room temperature for 60 minutes. To remove DTT containing unwanted thiol molecules, 200 μl of ethyl acetate was added, mixed, and the supernatant was removed by centrifugation. This process was repeated three times. Afterwards, cargo DNA was precipitated using the ethanol precipitation method.

[0066] 1-3. Binding of gold nanoparticles and cargo DNA (AuNP-RNAI)

[0067] Cargo DNA precipitated by pretreatment as in Example 1-2 was dissolved in water, added to the gold nanoparticles synthesized in Example 1-1, and then bound using the salt aging method.

[0068] Specifically, cargo DNA was added to 6 nM gold nanoparticles (AuNP: anti RNAi DNA ratio = 1:300) and mixed sufficiently, then NaCl was added to a concentration of 0.1 M and mixed for 4 hours. After 4 hours, NaCl was added to a concentration of 0.2 M and mixed for 4 hours. After 4 hours, NaCl was added to a concentration of 0.3 M and mixed for 12 hours. After 12 hours, the DNA aptamer and gold mixture was collected by centrifugation at ~10,000*g for 20 minutes, and the unreacted DNA aptamer in the supernatant was removed. This process was repeated three times. The final gold nanoparticle-cargo DNA complex was dispersed in 10 mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl. The manufactured gold nanoparticle-cargo DNA complex was analyzed by electrophoresis using a 10% acrylamide 8M urea gel, and it was confirmed that 130 to 150 cargo DNAs were bound to one gold nanoparticle.

[0069] 1-4. Preparation of AuNP-RNAI-ASO conjugate

[0070] ASOs (SEQ ID NO: 1 to SEQ ID NO: 16) shown in Table 1 below that can bind to KRAS mRNA and BRAF mRNA were prepared and combined with AuNP-RNAI It was coupled to a transporter. ASO-1 to ASO-6 of SEQ ID NO: 1 to SEQ ID NO: 6 are ASOs for KRAS mRNA, and ASOs of SEQ ID NO: 7 to SEQ ID NO: 16 were produced as ASOs for BRAF mRNA. Specifically, the following ASOs and AuNP-RNAI were mixed in 10 mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl, reacted at 55°C for 10 minutes, and reacted at 4°C for about 30 minutes. The resulting conjugate was centrifuged at 15,000 xg for 10 minutes, the supernatant was removed, and binding was confirmed by electrophoresis on a 10% acrylamide 8 M urea gel.

[0071] order Number Name Sequence 1ASO-1CGCTAGCAGAGCCGAGATGCCTACGCCATCAGCTCCAAC2ASO-2CGCTAGCAGAGCCGAGATCCATCAGCTCCAACTACCACAA3ASO-3CGCTAGCAGAGCCGAGATCCATCAGCAGGAACTACCACAA4ASO-4CGCTAGCAGAGCCGAGATGCTATTAGGAGTCTTT5 ASO-5CGCTAGCAGAGCCGAGATTTGCCTACGTCATAAGCTC6ASO-6CGCTAGCAGAGCCGAGATTACTGGTCCCTCATTGCAC7BRAF-M1CGCTAGCAGAGCCGAGATTATCTGTACGAAGACCAAAAT8BRAF-M2CGCTAGCAGAGCCGAGATTTATCTGTACGAAGACCAAAA9BRAF -M3CGCTAGCAGAGCCGAGATTTTATCTGTACGAAGACCAAA10BRAF-M4CGCTAGCAGAGCCGAGATATTTATCTGTACGAAGACCAA11BRAF-M5CGCTAGCAGAGCCGAGATGATTTATCTGTACGAAGACCA12BRAF-M6CGCTAGCAGAGCCGAGATTTCCCTTGTAGACTGTTCC 13BRAF-M7CGCTAGCAGAGCCGAGATAACAATAGCCAGTTGTGGC14BRAF-M8CGCTAGCAGAGCCGAGATTTATATGCACATTGGGAG15BRAF-M9CGCTAGCAGAGCCGAGATATGATCCAGATCCAATTCT16BRAF-M10CGCTAGCAGAGCCGAGATATCGAGATTTCTCTGTAGC

[0072]

[0073] Example 2. Confirmation of model ASO efficacy in cancer cells with KRAS G12D mutation.

[0074] Pancreatic cancer (Panc-1), colon cancer (LS174T), and lung cancer (SKLU-1) cells (1 x 10 6) were seeded in 60 plates for 24 h and functionalized AuNP-RNAI-ASO was transfected into the cells. After 48 h of transfection, the cells were lysed in NP-40 lysis buffer (50 mM Tris-HCl (pH 8.0), 0.15 M NaCl, and 1% NP-40) containing 10% protease inhibitor cocktail (Sigma). For quantitative protein analysis, a standard curve was established using a standard BSA solution (Pierce, Rockford, IL, USA), and cell lysates containing equal amounts of total protein were separated on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane for Western blot analysis. Anti-KRAS G12D monoclonal antibody (Cell Signaling Technology), anti-KRAS polyclonal antibody (Cell Signaling Technology), and anti-β-actin monoclonal antibody (Santa Cruz Biotechnology) were used to detect KRAS G12D, KRAS, and β-actin, respectively. The inhibitory effect of each ASO on KRAS expression was confirmed and is shown in Figures 2, 3, and 4.

[0075]

[0076] Example 3. Confirmation of the efficacy of KRAS ASO against pancreatic / colon cancer tumors using a xenograft mouse model.

[0077] Panc-1 and LS174T cells (1 × 10) were injected into 7-week-old BALB / c nu / nu immunodeficient mice (Saeron Bio) weighing 18–20 g, respectively. 6 (dog) was injected subcutaneously. Mice were randomly assigned to two groups, and tumors were formed (tumor volume: ~0.1 cm 3 ), AuNP-RNAI, AuNP-RNAI-ASO1, or AuNP-RNAI-ASO3 suspended in PBS were directly injected into the tumor site once every two days.

[0078] The body weight of the mice was measured and the tumor size was measured every other day. The volume of each tumor (cm) was measured 30 days after xenografting. 3 )((length × width 2 × π) / 6) was measured. Six and 15 days after the first injection of the functionalized AuNP composite, the tumor-bearing mice were euthanized by cervical dislocation. As a result, as shown in Fig. 5, after cell injection, the tumor volume gradually increased, but AuNP-RNAI-ASO1 or AuNP-RNAI-ASO3 In the group administered, it was confirmed that the rate of increase in tumor volume was reduced compared to the control group.

[0079]

[0080] Example 4. Confirmation of ASO efficacy in melanoma cancer cells with the V600E mutation in the BRAF gene.

[0081] Melanoma cancer (A2058) cells with V600E mutation of the BRAF gene (1 x 10 6 ) were seeded on 60 plates, and then functionalized AuNP-RNAI-BRAF ASO was transfected into the cells 24 hours later. After 48 hours of culture, the cells were washed with phosphate-buffered saline solution and detached from the plate by treatment with trypsin-EDTA. The suspension containing the detached cells was transferred to a new tube, mixed with the same volume of cell culture medium as the trypsin-EDTA, centrifuged, and the supernatant was removed. 1 mL of cell culture medium was added to the cell pellet and uniformly resuspended into single cells by pipetting. For cell counting, 20 μL of the cell suspension and 20 μL of trypan blue were uniformly mixed, and 10 μL of the mixture was evenly spread between the hemocytometer plate and the cover glass, and observed and counted using a 10X objective and a 10X eyepiece of an optical microscope. As a result, it was confirmed that the number of cells decreased when BRAF M1 and M7 ASOs were inoculated (Fig. 6).

[0082] Afterwards, the same sample was subjected to Western blot analysis in the same manner as in Example 2. Anti-BRAF V600E monoclonal antibody (abcam), anti-BRAF monoclonal antibody (abcam), and anti-β-actin monoclonal antibody (Santa Cruz Biotechnology) were used to detect BRAF V600E, BRAF, and β-actin, respectively. The inhibitory effect of BRAF M1 and BRAF M7 on the expression of BRAF V600E protein was confirmed, and this is shown in Figure 7.

[0083]

[0084] Example 5. Confirmation of the efficacy of BRAF ASO against melanoma tumors using a xenograft mouse model.

[0085] A2058 cells (1 × 10) were injected into 7-week-old BALB / c nu / nu immunodeficient mice (Saeron Bio) weighing 18–20 g each. 6 (dog) was injected subcutaneously. Mice were randomly assigned to three groups, and tumors were formed (tumor volume: ~0.1 cm 3 ), AuNP-RNAI, AuNP-RNAI-BRAF M1, or AuNP-RNAI-BRAF M7 suspended in PBS were directly injected into the tumor site once every two days.

[0086] The body weight of the mice was measured and the tumor size was measured every other day. The volume of each tumor (cm) was measured 30 days after xenografting. 3 )((length × width 2 × π) / 6) was measured. The tumor-bearing mice were euthanized by cervical dislocation 15 days after the first injection of the functionalized AuNP composite. As a result, as shown in Fig. 8, the tumor volume gradually increased after cell injection, but AuNP-RNAI-BRAF M1 or AuNP-RNAI-BRAF M7 In the group administered, it was confirmed that the rate of increase in tumor volume was reduced compared to the control group.

[0087]

[0088] Example 6. Modified ASO and stability verification

[0089] To increase the stability of ASO in vivo, KRAS ASO was synthesized with some bases substituted with 2'-O-methoxy-ethyl (2'-MOE) or Locked Nucleic Acids (LNA), including phosphorothioate (PS) linkages. Among the KRAS ASOs in Table 1 above, some bases were modified using ASO-3, and specifically, in the RNAI sequence and KRAS sequence functionalized on gold nanoparticles, one containing a phosphorothioate (PS) bond between the 3'-terminal 5 bases of KRAS (ASO3-1), one containing a phosphorothioate (PS) bond between each of the 3' and 5'-terminal 5 bases (ASO3-2), one containing a phosphorothioate (PS) bond between each of the 5'-terminal of RNAI and the 3'-terminal of KRAS (ASO3-3), one containing a phosphorothioate (PS) bond between all bases included in KRAS ASO (ASO3-a), one containing 2'-O-methoxy-ethyl (2'-MOE) in each of the 5 bases included at both ends in ASO3-a (ASO3-b), and one containing 5 bases included at both ends in ASO3-a ASO3-c, in which each base is replaced with Locked Nucleic Acids (LNA), ASO3-d, in which three bases included at both ends of ASO3-a are replaced with Locked Nucleic Acids (LNA), and ASO3-e, in which the fifth base of KRAS in ASO3-d contains 2'-O-methoxy-ethyl (2'-MOE). Schematic diagrams of the specific sequences and modified parts thereof are shown in FIGS. 9 and 10, and SEQ ID NOS. 17 to 24 (Table 2). In order to confirm the stability of the ASO modified as described above, 5 pmol of ASO was added to 10 ul of HeLa cell lysate (10 ug / ul of protein), and the concentration of ASO was measured by reacting at 37°C.As a result, it was confirmed that the half-life of ASO including LNA was improved by more than twice compared to the existing ASO (Fig. 11).

[0090] Sequence number 17ASO3-1CGCTAGCAGAGCCGAGATCCATCAGCAGGAACTACC[PS]A[PS]C[PS]A[PS]ASequence number 18ASO3-2CGCTAGCAGAGCCGAGATC[PS]C[PS]A[PS]T[PS]CAGCAGGAACTACC[PS]A[PS] C[PS]A[PS]ASequence number 19ASO3-3C[PS]G[PS]C[PS]T[PS]AGCAGAGCCGAGATCCATCAGCAGGAACTACC[PS]A[PS] C[PS]A[PS]ASequence number 20ASO3-aCGCTAGCAGAGCCGAGATC[PS]C[PS]A[PS]T[PS]C[PS]A[PS]G[PS]C[PS]A[PS]G[PS]G[PS]A[PS]A[PS]C[PS]T[PS]A[PS]C[PS]C[PS]A[PS]C[PS]A[PS]ASEQ ID NO. 21ASO3-bCGCTAGCAGAGCCGAGATC * [PS]C * [PS]A * [PS]T * [PS]C * [PS]A[PS]G[PS]C[PS]A[PS]G[PS]G[PS]A[PS]A[PS]C[PS]T[PS]A[PS]C[PS]C * [PS]A * [PS]C * [PS]A * [PS]A * Sequence number 22ASO3-cCGCTAGCAGAGCCGAGATC ** [PS]C ** [PS]A ** [PS]T ** [PS]C ** [PS]A[PS]G[PS]C[PS]A[PS]G[PS]G[PS]A[PS]A[PS]C[PS]T[PS]A[PS]C[PS]C ** [PS]A ** [PS]C ** [PS]A ** [PS]A** Sequence number 23ASO3-dCGCTAGCAGAGCCGAGATC ** [PS]C ** [PS]A ** [PS]T[PS]C[PS]A[PS]G[PS]C[PS]A[PS]G[PS]G[PS]A[PS]A[PS]C[PS]T[PS]A[PS]C[PS]C[PS]A[PS]C ** [PS]A ** [PS]A ** Sequence number 24ASO3-eCGCTAGCAGAGCCGAGATC ** [PS]C ** [PS]A ** [PS]T[PS]C * [PS]A[PS]G[PS]C[PS]A[PS]G[PS]G[PS]A[PS]A[PS]C[PS]T[PS]A[PS]C[PS]C[PS]A[PS]C ** [PS]A ** [PS]A **

[0091] *: 2'MOE, **: LNA, [PS]: phosphorothioate

[0092] Example 7. Confirmation of the cancer-inhibiting efficacy of modified ASOs.

[0093] To confirm the effect of the modified ASO, pancreatic cancer (Panc-1) cells (1 x 10 6 ) were inoculated into 60 plates for 24 hours; ASO1C and ASO3C were transfected into the cells using Lipofectamine 3000 reagent (Invitrogen). Western blotting was then performed in the same manner as in Example 2, and it was confirmed that KRAS G12D expression was suppressed using ASO1C and ASO3C. In addition, p-ERK and p-MEK, which are in the downstream pathway of KRAS, were also reduced. (Fig. 12)

[0094]

[0095] Example 8. Confirmation of the efficiency of target delivery using aptamers.

[0096] 8-1. Confirmation of EGFR and TfR protein expression levels in cancer cells

[0097] To determine the amount of EGFR and TfR proteins in each cell line, HeL1, Hec-1-b, Panc-1, LS174T, and AsPC-1 cells (1 x 10 6 ) were cultured in 60Φ plates for 48 h, and then the cells were lysed in NP-40 lysis buffer (50 mM Tris-HCl (pH 8.0), 0.15 M NaCl, and 1% NP-40) containing 10% protease inhibitor cocktail (Sigma). For quantitative protein analysis, a standard curve was established using a standard BSA solution (Pierce, Rockford, IL, USA), and cell lysates containing equal amounts of total protein were separated on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane for Western blot analysis. Anti-KRAS G12D monoclonal antibody (cell signaling technology), anti-EGFR polyclonal antibody (cell signaling technology), and anti-TfR polyclonal antibody (cell signaling technology) were used to detect KRAS G12D, EGFR, and TfR, respectively. The expression levels of EGFR and TfR for each cell line were confirmed and are shown in Figure 13.

[0098]

[0099] 8-2. Confirmation of targeted delivery using a xenograft mouse model

[0100] AuNP-RNAI according to the method of Example 1 above cy5 , AuNP-TfR cy5 and AuNP-EGFR cy5We produced AuNP-RNAI, and TfR and EGFR were bound to gold nanoparticles via aptamers (SEQ ID NO: 24 and SEQ ID NO: 25). To confirm tumor-specific delivery, these were injected into a xenograft tumor mouse model. Pancreatic cancer was induced by injecting Panc-1 cells into 6-week-old BALB / c-nu / nu mice (JABIO, Korea), and AuNP-RNAI Cy5 , AuNP-TfR cy5 and AuNP-EGFR cy5was injected into the tail vein. After 2 hours, the xenograft tumors were extracted and frozen sections were prepared. The xenograft tumors were extracted and fixed with 4% PFA (paraformaldehyde) dissolved in 1X PBS buffer at 4℃ for 1 day. The tissues were washed with 1X PBS buffer and dehydrated by sequentially immersing them in 10%, 20%, and 30% sucrose solutions dissolved in 1X PBS buffer at 4℃. The dehydrated tissues were wrapped in OCT solution, sectioned at 20 μm thickness in a cryostat, and mounted on poly-L-Lysine-coated slides. After drying the tissues in the air to a certain level, the membrane permeability was increased by treating them with 0.2% Triton X-100 dissolved in 1X PBS buffer for 15 minutes at room temperature. After washing the above sections with 1X PBS buffer solution, nonspecific binding was blocked by treating with 1% BSA dissolved in 1X PBST (0.05% Tween20 dissolved in 1X PBS buffer solution) for 1 hour at room temperature. To amplify and detect Cy5 in the sections, the primary antibody against Cy5 was diluted 1:100 in blocking solution, treated with the sections, and left at 4°C for 1 day. After washing the sections with 1X PBST solution, the secondary antibody conjugated to Cy3 was diluted 1:1000 in blocking solution, treated with the sections, and left at room temperature for 1 hour. After washing the sections with 1X PBST solution, the sections were covered with coverslips using mounting solution containing DAPI. After drying the samples at room temperature for 1 hour, the Cy3 fluorescence signal was observed under a fluorescence microscope. In addition, the amount of ASO delivered into the tumor was measured by immunohistochemical staining with Cy5 fluorescent dye, and it was confirmed that the delivery efficiency of AuNPs conjugated with EGFR and TfR aptamers was improved (Fig. 13).

[0101]

[0102] Example 9. Efficacy of ASO using a targeting carrier in a xenograft mouse model

[0103] 9-1. AuNP TfR -RNAI-ASO production

[0104] It was manufactured according to the method of Example 1 above, and the ratio of AuNP: Anti RNAI DNA: TfR Aptamer DNA was mixed at 1:200:100 during salt aging. The manufactured gold nanoparticle-RNAI-TfR Aptamer complex was analyzed by electrophoresis using 10% acrylamide 8M urea gel, and it was confirmed that 100 to 120 RNAIs were bound to one gold nanoparticle, and 20 to 40 TfR Aptamers were bound.

[0105] By conjugating ASO to the manufactured AuNP-RNAI-TfR Aptamer carrier using the method of Example 1-4, AuNP TfR -RNAI-ASO was produced.

[0106]

[0107] 9-2. Confirmation of ASO efficacy through target delivery system

[0108] Hec1-b cells (1 × 10) were injected into 7-week-old BALB / c nu / nu immunodeficient mice (Saeron Bio) weighing 18–20 g. 6 (dog) was injected subcutaneously. Mice were randomly assigned to two groups, and tumors were formed (tumor volume: ~0.1 cm 3 ), AuNP suspended in PBS apt -RNAI-scr-c, AuNP apt -RNAI-ASO1c was directly injected into the tail vein three times, once every two days. Two hours after the third injection, the mice were euthanized, and tumors were extracted and subjected to Western blotting. As a result, AuNP apt - It was confirmed that the expression level of KRAS G12D protein was reduced by more than 50% in mice injected with RNAI-ASO1c (Fig. 14).

[0109]

[0110] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than restrictive. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

[0111]

[0112] In one aspect, the present invention provides a gold nanoparticle carrier comprising a gold nanoparticle; and an antisense oligonucleotide (ASO) that complementarily binds to mRNA of a gene containing a cancer-causing mutation and an aptamer that specifically binds to a cancer cell-expressed protein, the ASO being bound to the surface of the gold nanoparticle.

[0113] In one embodiment, the cancer-causing mutation may be a mutation caused in a gene selected from the group consisting of KRAS, BRAF, EGFR (Epidermal Growth Factor Receptor), ALK (Anaplastic Lymphoma Kinase), HER2 (Human Epidermal Growth Factor Receptor 2), PIK3CA (Phosphoinositide 3-kinase catalytic subunit alpha), IDH1 / IDH2 (Isocitrate Dehydrogenase 1 / 2), BRCA1, BRCA2, PD-1, PD-L1, and FGFR (Fibroblast Growth Factor Receptor).

[0114] In one embodiment, the mutation induced in said KRAS comprises a G12C, G12D or G13D mutation.

[0115] In one embodiment, the cancer cell expressed protein is EGFR, HER2, VEGFR, TfR, PD-L1, KRAS, BRAF, PI3K, c-MET, Cyclin D1, p53, BRCA1 / BRCA2, GLUT1, LDHA, E-cadherin, MMPs MSLN, Her2 / neu(erbB2), Her3(erb-B3), Her4(erb-B4), BCMA, CEA, CAIX, CMV, MUC1, MUC16, PSCA, PSMA, αvβ6 integrin, L1-CAM, B7-H3, B7-H6, NY-ESO-1, CCL-1, CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, It may be a protein selected from the group consisting of CD133, CD138, CD171, CSPG4, EPG-2, EPG-40, FCRL5, FBP, HMW-MAA, HLA-A1, HLA-A2, IL-22 R-α, L1-CAM, (MAGE)-A1, MAGE-A3, MAGE-A6, MAGE-A10, NCAM, ROR1, Melan-A, survivin, TRP1, folate receptor-a, estrogen receptor, progesterone receptor, Wilms tumor (WT-1), pathogen-specific or expressed antigens and antigens associated with universal tags.

[0116] In one embodiment, the antisense oligonucleotide (ASO) may comprise a nucleotide sequence selected from those having a base sequence of SEQ ID NO: 1 to 16.

[0117] In one embodiment, the antisense oligonucleotide (ASO) may comprise bases modified with Phosphorothioate (PS), 2'-O-methoxy-ethyl (2'-MOE) or Locked Nucleic Acids (LNA).

[0118] In one embodiment, the antisense oligonucleotide (ASO) comprising the modified base is selected from the group consisting of base sequences of SEQ ID NO: 17 to SEQ ID NO: 24.

[0119] In one embodiment, the antisense oligonucleotide (ASO) or aptamer is bound to the gold nano surface via a moiety comprising a functional group, wherein the moiety comprising the functional group comprises a thiol group or an amine group. Furthermore, the moiety comprising the functional group may be one or more moieties included at the 3' end, the 5' end, or within the base sequence of the ASO or aptamer.

[0120] In one embodiment, the gold nanoparticles of the present invention have a size of 5 to 500 nm.

[0121] In another aspect, the present invention relates to a pharmaceutical composition for preventing or treating cancer comprising the gold nanoparticle carrier of the present invention.

[0122] The cancer may be selected from breast cancer, cervical cancer, bladder cancer, prostate cancer, ovarian cancer, endometrial cancer, lung cancer, lung cancer, neuroendocrine cancer, soft tissue cancer, pancreatic cancer, stomach cancer, gallbladder cancer, or esophageal cancer, melanoma, epithelial cancer, bone cancer, myeloma, osteosarcoma, lymphoma, leukemia, blood tumor or metastatic tumor.

[0123] In another aspect, the present invention relates to a method for preventing or treating cancer using a gold nanoparticle delivery system, comprising the steps of: delivering into a cell an antisense oligonucleotide (ASO) that complementarily binds to mRNA of a gene containing a cancer-causing mutation bound to the surface of a gold nanoparticle and an aptamer that specifically binds to a cancer cell-expressed protein; binding the gold nanoparticle to a target cancer cell through specific binding of the aptamer to the cancer cell-expressed protein; and inhibiting the expression of the mutant gene by binding the antisense oligonucleotide (ASO) to the mRNA of the gene containing the cancer-causing mutation.

[0124] In another aspect, the present invention relates to a use for preventing or treating cancer of gold nanoparticles having an antisense oligonucleotide (ASO) that complementarily binds to the mRNA of a cancer-causing mutant gene; and an aptamer that specifically binds to a cancer cell-expressed protein, bound to the surface thereof.

Claims

1. Gold nanoparticles; and A gold nanoparticle carrier comprising an antisense oligonucleotide (ASO) that complementarily binds to mRNA of a gene containing a cancer-causing mutation and an aptamer that specifically binds to a cancer cell-expressed protein, which is bound to the surface of the gold nanoparticle.

2. In paragraph 1, A gold nanoparticle carrier, wherein the cancer-causing mutation is a mutation induced in a gene selected from the group consisting of KRAS, BRAF, EGFR (Epidermal Growth Factor Receptor), ALK (Anaplastic Lymphoma Kinase), HER2 (Human Epidermal Growth Factor Receptor 2), PIK3CA (Phosphoinositide 3-kinase catalytic subunit alpha), IDH1 / IDH2 (Isocitrate Dehydrogenase 1 / 2), BRCA1, BRCA2, PD-1, PD-L1, and FGFR (Fibroblast Growth Factor Receptor).

3. In paragraph 2, A gold nanoparticle carrier, wherein the mutation induced in the above KRAS comprises a G12C, G12D or G13D mutation.

4. In paragraph 1, The above cancer cell-expressed proteins are EGFR, HER2, VEGFR, TfR, PD-L1, KRAS, BRAF, PI3K, c-MET, Cyclin D1, p53, BRCA1 / BRCA2, GLUT1, LDHA, E-cadherin, MMPs MSLN, Her2 / neu(erbB2), Her3(erb-B3), Her4(erb-B4), BCMA, CEA, CAIX, CMV, MUC1, MUC16, PSCA, PSMA, αvβ6 integrin, L1-CAM, B7-H3, B7-H6, NY-ESO-1, CCL-1, CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, A gold nanoparticle carrier, wherein the protein is selected from the group consisting of CD133, CD138, CD171, CSPG4, EPG-2, EPG-40, FCRL5, FBP, HMW-MAA, HLA-A1, HLA-A2, IL-22 R-α, L1-CAM, (MAGE)-A1, MAGE-A3, MAGE-A6, MAGE-A10, NCAM, ROR1, Melan-A, survivin, TRP1, folate receptor-a, estrogen receptor, progesterone receptor, Wilms tumor-1 (WT-1), pathogen specific or expressed antigens and antigens associated with universal tags.

5. In paragraph 1, A gold nanoparticle carrier, wherein the antisense oligonucleotide (ASO) comprises a nucleotide sequence selected from those consisting of SEQ ID NOs: 1 to 16.

6. In paragraph 5, A gold nanoparticle carrier, wherein the antisense oligonucleotide (ASO) comprises a base modified with Phosphorothioate (PS), 2'-O-methoxy-ethyl (2'-MOE) or Locked Nucleic Acids (LNA).

7. In paragraph 6, A gold nanoparticle carrier comprising an antisense oligonucleotide (ASO) comprising the modified base selected from those consisting of the base sequences of SEQ ID NO: 17 to SEQ ID NO:

24.

8. In paragraph 1, A gold nanoparticle carrier wherein the antisense oligonucleotide (ASO) or aptamer is bound to the gold nano surface through a moiety containing a functional group.

9. In paragraph 8, A gold nanoparticle carrier, wherein the residue containing the above functional group contains a thiol group or an amine group.

10. In paragraph 8, A gold nanoparticle carrier, wherein the residue containing the above functional group is one or more residues included at the 3'-terminal, 5'-terminal, or within the base sequence of the ASO or aptamer.

11. In paragraph 1, A gold nanoparticle carrier, wherein the gold nanoparticles have a size of 5 to 500 nm.

12. A pharmaceutical composition for preventing or treating cancer comprising a gold nanoparticle carrier according to any one of claims 1 to 11.

13. In paragraph 12, A pharmaceutical composition for preventing or treating cancer, wherein the cancer is selected from breast cancer, cervical cancer, bladder cancer, prostate cancer, ovarian cancer, endometrial cancer, lung cancer, neuroendocrine cancer, soft tissue cancer, pancreatic cancer, stomach cancer, gallbladder cancer, or esophageal cancer, melanoma, epithelial cancer, bone cancer, myeloma, osteosarcoma, lymphoma, leukemia, blood tumor, or metastatic tumor.

14. A step of delivering into a cell an antisense oligonucleotide (ASO) that complementarily binds to the mRNA of a gene containing a cancer-causing mutation bound to the surface of a gold nanoparticle and an aptamer that specifically binds to a cancer cell-expressed protein; A step of binding the gold nanoparticles to target cancer cells through specific binding between the aptamer and a cancer cell-expressed protein; and A method for preventing or treating cancer using a gold nanoparticle carrier, comprising a step of binding an antisense oligonucleotide (ASO) to mRNA of a gene containing a mutation causing the cancer, thereby inhibiting the expression of the mutant gene.

15. Antisense oligonucleotide (ASO) that complementarily binds to mRNA of a cancer-causing mutant gene; and gold nanoparticles having an aptamer that specifically binds to a cancer cell-expressed protein bound to their surface for use in preventing or treating cancer.

Images