Multiplex digital polymerase chain reaction assays based on luminescence lifetimes

By encoding distinct luminescence lifetimes for different targets using LRET, the method overcomes the limitations of current multiplex digital PCR, enabling simultaneous detection of multiple analytes with enhanced accuracy and multiplexing capacity.

WO2025111651A1PCT designated stage expired Publication Date: 2025-06-05MACQUARIE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/AU2024/051271
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-29
Filing Date
2024-11-28
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current multiplex digital PCR methods face limitations in multiplexing capacity due to fluorescence spillover and crosstalk, which restricts the number of analytes that can be tested simultaneously while maintaining accuracy and reliability.

Method used

The method employs luminescence resonance energy transfer (LRET) to encode distinct luminescence lifetimes for different target nucleic acids, allowing for simultaneous identification of multiple targets within a single sample, independent of wavelength and intensity.

Benefits of technology

This approach significantly enhances the multiplexing capacity of digital PCR by utilizing the temporal dimension of luminescence lifetimes, achieving accurate and reliable simultaneous detection of multiple target nucleic acids with minimal crosstalk.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure AU2024051271_05062025_PF_FP_ABST
    Figure AU2024051271_05062025_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed are methods, systems and / or tags for digital polymerase chain reaction (PCR) assays. A method is provided for a lifetime-multiplex digital polymerase chain reaction assay, comprising forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached. A first target nucleic acid and a second target nucleic acid are subjected to polymerase chain reaction amplification. First acceptor-tags hybridize with the conjugated donor-tags when the first target nucleic acid is present. Second acceptor-tags hybridize with the conjugated donor-tags when the second target nucleic acid is present. A first lifetime is measured of luminescence of the acceptors of the first acceptor-tags. A second lifetime is measured of luminescence of the acceptors of the second acceptor-tags. The first lifetime is different to the second lifetime.
Need to check novelty before this filing date? Find Prior Art

Description

MULTIPLEX DIGITAL POLYMERASE CHAIN REACTION ASSAYS BASED ON LUMINESCENCE LIFETIMESTechnical Field

[0001] The present invention generally relates to methods, systems and / or tags for providing polymerase chain reaction (PCR) assays, and particularly to methods, systems and / or tags for providing multiplex digital polymerase chain reaction assays based on luminescence lifetimes. In various examples, the methods, systems and / or tags can be used in a wide variety of applications, for example in the general fields of biotechnology and life sciences, such as, disease diagnosis, pathogen detection, food security (e.g. detecting genetically modified species), water quality assessment, forensic studies, cancer immunotherapy, and other applications for public health.Background

[0002] Nucleic acid amplification tests are the gold standard for identification of specific genetic materials (i.e. DNA / RNA sequences). Commonly performed by polymerase chain reaction (PCR) methods, nucleic acid amplification tests play a pivotal role in the rapid detection of infectious diseases, such as COVID, and personalised medicine for cancer and other genetic-related diseases. PCR identification of specific genetic materials is estimated to have a global market size of approximately USD 36.84 billion in 2022 and is expected to expand.

[0003] Among various PCR methods, digital polymerase chain reaction (digital PCR or dPCR) methods are widely acknowledged for their superior capability of absolute quantification compared to other PCR methods of testing, offering excellent sensitivity and accuracy as well as reduced susceptibility to inhibition or competition. During digital PCR methods, a sample is subdivided into a large number of partitions, which contain either none ('0') or some (T) of a target nucleic acid(s) to be subject to independent PCR amplification. The precise number of copies of the target nucleic acid(s) originally presented in the sample is then determined based on the fractions of negative and positive partitions according to a Poisson distribution.

[0004] Over the last decade, digital PCR methods have found increasingly diverse applications, including but not limited to pathogen detection, food security, water quality assessment, forensic studies, diagnosis and prognosis, and cancer immunotherapy. For many of these applications, it is often desirable to test a sample against multiple analytes of target nucleic acids at the same time. Multiplexing, i.e. testing a sample against multiple analytes at the same time, is desirable as not only does such multiplexing contribute to efficient screening at reduced cost and time, but it also minimises the risk of false negatives potentially caused by sample splitting. Since PCR methods and digital PCR methods typically rely on fluorescence readouts, multiplexing may be realised by employing fluorescent colours alongside intensity ratios assigned to different targets. This ratiometric approach requires delicate manipulation of the concentrations for the fluorescent probes as well as the primers of each analyte to ensure distinct colour intensity levels for different targets. In practice, however, the overall range to accommodate multiple colour intensity levels is only a few folds at best, and sometimes even below 2-fold. The results are prone to crosstalk caused by fluorescence spillover, limiting the multiplexing capacity and imposing extra burdens on quality control and compensation to ensure reliability and quantification accuracy.

[0005] Thus, there are problems to overcome or ameliorate so as to provide new or improved methods, systems and / or tags for providing multiplex digital PCR assays.

[0006] The reference in this specification to any prior publication (or information derived from the prior publication), or to any matter which is known, is not, and should not be taken as an acknowledgment or admission or any form of suggestion that the prior publication (or information derived from the prior publication) or known matter forms part of the common general knowledge in the field of endeavour to which this specification relates.Summary

[0007] This Summary is provided to introduce a selection of concepts in a simplified form that are further described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.

[0008] In various forms there are provided methods, systems and / or tags for providing a multiplex digital polymerase chain reaction (digital PCR) assay. In particular examples, there are provided methods, systems and / or tags for providing a multiplex digital polymerase chain reaction assay based on luminescence lifetimes (i.e. a lifetime-multiplex digital polymerase chain reaction assay). A luminescence lifetime is preferably an encoded luminescence lifetime that can be used to identify a target nucleic acid.

[0009] Being independent of the colour (wavelength) and the intensity, the time-domain feature of lifetimes provide another dimension for multiplexing. Luminescence donors / acceptors (i.e. donor probes / acceptor probes) with tunable lifetimes in the microsecond-to-millisecond range can be differentiated and are immune to short-lived background interference. Present methods and systems use lifetime-multiplexing in digital PCR as encoded luminescence lifetimes for identification of different target nucleic acids (i.e. a plurality of target nucleic acids), simultaneously contained in one sample. Lifetime encoding is based on luminescence resonance energy transfer (LRET) to generate distinct identities for each target nucleic acid, and preferably decoding uses time-resolved luminescence imaging.

[0010] In one aspect, the method uses switch on (i.e. stimulation, activation or inducement) of the luminescence, for example photoluminescence, after PCR amplification of target nucleic acids. Then, target nucleic acids can be identified according to measured luminescence lifetimes. Preferably, to satisfy both requirements at the same time, luminescence resonance energy transfer (LRET) is used, preferably from a relatively longlifetime donor to an acceptor, and the luminescence of the acceptor is measured.[Oi l] In another aspect, there is provided a method for providing a lifetime-multiplex digital polymerase chain reaction assay. A combined mixture is made of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached. The first target nucleic acid and the second target nucleic acid are subjected to polymerase chain reaction amplification, if present, using the reaction mixture. First acceptor-tags hybridize with the conjugated donor-tags at a first position when the first target nucleic acid is present. Second acceptor-tags hybridize with the conjugated donor-tags at a second position when the second target nucleic acid is present. The first position is different to the second position. A first lifetime of luminescence of the acceptors is measured, withluminescence of the acceptors of the first acceptor-tags only occurring if the first acceptortags have hybridized with the conjugated donor-tags. A second lifetime of luminescence of the acceptors is measured, with luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donor-tags. The first lifetime is different to the second lifetime, enabling identification of the first target nucleic acid based on the first lifetime, if present in the sample, and identification of the second target nucleic acid based on the second lifetime, if present in the sample.

[0012] In one aspect there is provided a method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; partitioning the combined mixture into partitions, a first partition potentially including a first target nucleic acid of the two or more target nucleic acids, and a second partition potentially including a second target nucleic acid of the two or more target nucleic acids; subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags hybridize with the conjugated donor-tags at a first position on the conjugated donor-tags when the first target nucleic acid is present in the first partition; wherein, second acceptor-tags hybridize with the conjugated donor-tags at a second position on the conjugated donor-tags when the second target nucleic acid is present in the second partition; wherein, the first position is different to the second position; measuring a first lifetime of luminescence of the acceptors of the first acceptor-tags, the luminescence of the acceptors of the first acceptor-tags only occurring if the first acceptor-tags have hybridized with the conjugated donor-tags in the first partition; measuring a second lifetime of luminescence of the acceptors of the second acceptor-tags, the luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donor-tags in the second partition; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

[0013] In another aspect there is provided a method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reactionmixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; partitioning the combined mixture into partitions, a first partition potentially including a first target nucleic acid of the two or more target nucleic acids, and a second partition potentially including a second target nucleic acid of the two or more target nucleic acids; subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags each with a first acceptor attached hybridize with first conjugated donor-tags each with a first donor attached, the first acceptor and the first donor separated by a first distance, when the first target nucleic acid is present in the first partition; wherein, second acceptor-tags each with a second acceptor attached hybridize with second conjugated donortags each with a second donor attached, the second acceptor and the second donor separated by a second distance, when the second target nucleic acid is present in the second partition; wherein, the first distance is different to the second distance; measuring a first lifetime of luminescence of the first acceptors of the first acceptor-tags, the luminescence of the first acceptors only occurring if the first acceptor-tags have hybridized with the first conjugated donor-tags in the first partition; measuring a second lifetime of luminescence of the second acceptors of the second acceptor-tags, the luminescence of the second acceptors only occurring if the second acceptor-tags have hybridized with the second conjugated donortags in the second partition; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

[0014] In another aspect there is provided a method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; subjecting a first target nucleic acid and a second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags hybridize with the conjugated donor-tags at a first position on the conjugated donor-tags when the first target nucleic acid is present; wherein, second acceptor-tags hybridize with the conjugated donor-tags at a second position on theconjugated donor-tags when the second target nucleic acid is present; wherein, the first position is different to the second position; measuring a first lifetime of luminescence of the acceptors of the first acceptor-tags, the luminescence of the acceptors of the first acceptortags only occurring if the first acceptor-tags have hybridized with the conjugated donor-tags; measuring a second lifetime of luminescence of the acceptors of the second acceptor-tags, the luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donor-tags; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

[0015] In another aspect there is provided a method for providing a lifetime-multiplex polymerase chain reaction assay, comprising the steps of forming a combined mixture of a reaction mixture and a sample that potentially contains a target nucleic acid, the target nucleic acid being one of two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; subjecting the two or more target nucleic acids, if present in the sample, to polymerase chain reaction amplification using the reaction mixture; wherein, two or more acceptor-tags hybridize with a single conjugated donor-tag at two or more different positions on the single conjugated donor-tag when the two or more target nucleic acids are present in the sample, and wherein the donor of the single conjugated donor-tag and a first acceptor are separated by a first distance, and the donor of the single conjugated donor-tag and a second acceptor are separated by a second distance, the first distance being different to the second distance; switching on of a luminescence of the first acceptor and a luminescence of the second acceptor after the two or more acceptor-tags hybridize with the single conjugated donor-tag due to the polymerase chain reaction amplification of the two or more target nucleic acids, if present in the sample; measuring a first lifetime of the luminescence of the first acceptor, and measuring a second lifetime of the luminescence of the second acceptor; identifying a first target nucleic acid of the two or more target nucleic acids, if present in the sample, based on the measured first lifetime, and identifying a second target nucleic acid of the two or more target nucleic acids, if present in the sample, based on the measured second lifetime.

[0016] Preferably, the luminescence is based on luminescence resonance energy transfer (LRET). In another example, varying the first position produces a different first lifetime, and / or varying the second position produces a different second lifetime. In another example, the first lifetime and the second lifetime are encoded for simultaneous identification of different target nucleic acids contained in the sample. In another example, the conjugated donor-tags are complementary donor-tags that overlap the first acceptor-tags and the second acceptor-tags.

[0017] Preferably, the partitions are droplets. Preferably, the luminescence is photoluminescence. In another example, the first lifetime is dependent on a first distance between the acceptors of the first acceptor-tags and the donors of the conjugated donor-tags, and the second lifetime is dependent on a second distance between the acceptors of the second acceptor-tags and the donors of the conjugated donor-tags.

[0018] In another example, the luminescence is over a single colour frequency band. In another example, the luminescence is over two or more colours frequency bands. Optionally, the first lifetime and the second lifetime are in the microsecond-to-millisecond range. In another example, subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification includes thermal cycling over a thermal range. Preferably, the conjugated donor-tags are thermally stable over the thermal range. Preferably, the droplets are thermally stable over the thermal range.

[0019] In another example, the donor comprises a rare earth element or a lanthanide. In another example, the donor comprises at least one element selected from the group of: Scandium, Yttrium, Lanthanum, Cerium, Praseodymium, Neodymium, Promethium, Samarium, Europium, Gadolinium, Terbium, Dysprosium, Holmium, Erbium, Thulium, Ytterbium, and Lutetium.

[0020] In another example, the method further includes: stimulating the donors of the conjugated donor-tags to produce luminescence of the acceptors of the acceptor-tags; and, time-resolving the luminescence to identify the position of the acceptor-tags on the conjugated donor-tags.

[0021] Preferably, stimulating the donors involves exposing the donors to electromagnetic radiation. In another example, the time-resolved luminescence provides lifetime-basedpopulations of different target nucleic acids. In another example, the lifetime is varied by altering a donor-to-acceptor distance. Optionally, the acceptors of the acceptor-tags are doped with a sensitizer.

[0022] In another example, the method further includes: partitioning the combined mixture into partitions including a third partition potentially including a third target nucleic acid; subjecting the third target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, third acceptor-tags hybridize with the conjugated donortags at a third position on the conjugated donor-tags when the third target nucleic acid is present in the third partition; wherein, the third position is different to the first position and the second position; measuring a third lifetime of luminescence of the acceptors of the third acceptor-tags, the luminescence of the acceptors of the third acceptor-tags only occurring if the third acceptor-tags have hybridized with the conjugated donor-tags in the third partition; wherein, the third lifetime is different to the first lifetime and the second lifetime; and, identifying the third target nucleic acid based on the third lifetime, if present in the sample.

[0023] In another aspect there is provided a donor-tag for use in a lifetime-multiplex digital polymerase chain reaction assay, the donor-tag including a donor attached to one end, the donor comprising a rare earth element, the donor-tag capable of being hybridized to an acceptor-tag at different positions on the donor-tag, and the donor able to produce LRET in an acceptor of the hybridized acceptor-tag.

[0024] Preferably, the donor-tag is an oligonucleotide. Preferably, the acceptor-tag is an oligonucleotide. Optionally, the rare earth element is europium. In another example, the donor comprises a trivalent europium complex. In another example, the donor is attached to a 5'-end of the donor-tag. In another example, the acceptor comprises an organic dye, and preferably the organic dye is Cyanine-5.5. In another example, the acceptor is attached to a 3 '-end of the acceptor-tag.Brief Description of Figures

[0025] Example embodiments should become apparent from the following description, which is given by way of example only, of at least one preferred but non-limiting embodiment, described in connection with the accompanying figures.

[0026] Figure 1 illustrates an overview of an example method for lifetime based multiplexing for digital PCR, the figure shows method steps illustrating an example lifetimemultiplex digital PCR assay.

[0027] Figure 2 further illustrates an overview of an example method for lifetime based multiplexing for digital PCR, the figure shows method steps illustrating example lifetime encoding for individual partitions undergoing digital PCR amplification.

[0028] Figure 3 illustrates example tags for lifetime encoding using overlapping oligonucleotides. The figure shows example overlapping acceptor-tags with a common conjugated donor-tag, with the bases on the conjugated donor-tag representing mismatch.

[0029] Figure 4 illustrates example results for lifetime encoding using the example tags of Figure 3. The figure shows emission spectra of DTBTA-Eu (excitation at 365 nm) and Cy5.5 (solid line, excitation at 650 nm), and absorption spectrum of Cy5.5 (dashed line), are measured at 1 pM in sodium carbonate buffer with pH 8.0. Grey shade indicates the transmission window of the optical filter used for time-resolved photoluminescence measurement.

[0030] Figure 5 illustrates example results for lifetime encoding using the example tags of Figure 3. The figure shows lifetimes of the sensitized Cy5.5 emission, fitted from the exponential decays (inset), as the number of unpaired nucleobases varies. All the samples were measured at 0.2 pM in the DNA hybridisation buffer.

[0031] Figure 6 illustrates an example system for droplet generation and lifetime decoding. Illustrated is an example microfluidic device fabricated for sample partition into droplets, with magnification of regions showing formation of droplets.

[0032] Figure 7 illustrates example bright-field and luminescence lifetime images of the double-layered droplets containing one particular type of lifetime-encoded LRET pairs (n = 7). Scale bar: 300 pm.

[0033] Figure 8 illustrates example lifetime populations obtained from exponential fitting of the sensitized acceptor emission from individual droplets, for 8 batches of droplets with n varying from 0 to 15.

[0034] Figures 9-13 illustrate example results of a lifetime-multiplex digital PCR assay and a method of lifetime encoding. Figure 9 illustrates a sample subjected to the method for lifetime-multiplex digital PCR assay testing, including bright-field imaging to determine the total number of partitions, luminescence intensity imaging to count the number of positive partitions, and luminescence lifetime imaging to identify the target nucleic acid for each positive partition. Scale bar: 1 mm.

[0035] Figure 10 illustrates lifetime imaging and identification using three simplex samples (i.e. containing the multiplex assay panel, but only one type of target nucleic acid sequence was added).

[0036] Figure 11 illustrates detection sensitivity and dynamic range evaluated for individual simplex samples.

[0037] Figure 12 illustrates a histogram result of a typical multiplex sample containing all three types of target nucleic acid sequences, which were identified by the lifetime ranges as determined in Figure 10.

[0038] Figure 13 illustrates quantitative measurement of multiplex samples with different mixing ratios of the three target nucleic acids.Detailed Description

[0039] The following modes, given by way of example only, are described in order to provide a more precise understanding of one or more embodiments. In the figures, like reference numerals are used to identify like parts throughout the figures.Overview

[0040] Polymerase chain reaction (PCR) methods, and particularly digital polymerase chain reaction (digital PCR or dPCR) methods, are widely used for precise and absolute quantification of target nucleic acids (i.e. "target sequences", "target DNA", or "targets"), for example in health and environmental specimens. However, when restricted to a fluorescence-based ratiometric coding strategy, the multiplexing capability of the methods are limited by the spectral overlap associated with conventional fluorescence probes, which is a distinct disadvantage. To overcome this problem, the inventors developed novelmethods, systems and / or tags for providing a multiplex digital polymerase chain reaction assay by utilising novel lifetime-encoded tags having attached luminescent probes (i.e. attached donors / acceptors). This allowed the realisation of lifetime-multiplex digital PCR detection for the first time.

[0041] In one example, the lifetime-encoded luminescent probes are based on luminescence resonance energy transfer (LRET). A microfluidic chip was used for sample partitioning into tens of thousands of thermally stable droplets for PCR amplification in parallel, and time- resolved luminescence microscopy was employed to count the positive partitions (i.e. having the presence of a target nucleic acid) and decode their lifetime based identities. Utilising this new method, the inventors achieved simultaneous detection for three to seven target nucleic acids (i.e. target nucleic acid sequences) upon a single luminescence colour band, thus opening a new avenue to enhanced multiplexing capacity for digital PCR methods, systems and / or tags, based on lifetime-encoding of luminescent probes, which are preferably provided as donors / acceptors attached to tags, while maintaining the excellent detection sensitivity and accuracy of digital PCR methods / systems.

[0042] Being independent of the colour (wavelength) and the intensity, the time-domain feature of lifetime provides another dimension for multiplexing. Long-lived luminescence probes with tunable lifetimes in the microsecond-to-millisecond range can be differentiated and are immune to short-lived background interference. Lifetime-multiplex digital PCR utilises encoded luminescence lifetimes for identification of different target nucleic acids simultaneously contained in one sample. The lifetime encoding is designed based on luminescence resonance energy transfer (LRET) to generate distinct identities for each target nucleic acid, and decoding uses time-resolved luminescence imaging. In a preferred example for digital PCR, partitioning is realised by microfluidics to produce droplets, preferably microscopic droplets, that are thermally stable so as to execute PCR amplification in parallel across the droplets, after which the droplets are read out using time-resolved luminescence microscopy. Lifetime-multiplex digital PCR is achieved for simultaneous quantification of multiple pathogenic gene fragments. Lifetime-multiplex digital PCR using luminescence lifetimes creates a new dimension of time that can be utilised in addition to the intensities and colours for multiplex digital PCR. While microfluidic droplet generation is a preferred method for partitioning, other examples for achieving partitioning can be used, for example,using a chip of microwells and spreading the sample on the chip to provide partitioning of the sample.Lifetime-multiplex digital PCR

[0043] Figure 1 illustrates an overview of an example method 100 for lifetime based multiplexing for digital PCR. A sample 105 that potentially contains target nucleic acids (i.e. one or more target nucleic acid, two or more target nucleic acids, or a plurality of target nucleic acids) is first added into a PCR reaction mixture 110, which is a buffer solution incorporating a forward primer and a reverse primer for each target nucleic acid of the multiple target nucleic acids, as well as DNA polymerases, deoxynucleoside triphosphates, and bivalent cations. The combined mixture 115 of the sample 105 and the PCR reaction mixture 110 is then subdivided (i.e. partitioned) into a large number of partitions 120, such as droplets, for example by interspersing a flow of the combined mixture 115 in a channel with oil 130, resulting in either zero (0) or one (1) copy of a particular target nucleic acid in each partition 120. The partitions 120 (i.e. droplets) of the combined mixture, preferably all or at least most, then undergo PCR amplification 140 involving thermal cycling, as illustrated in Figure 2, to replicate the specific target nucleic acid in each partition, if any is present. This is followed by luminescence, preferably photoluminescence, detection. A bright partition (i.e. a partition that shows luminescence) corresponds to one copy of a target nucleic acid (i.e. a target sequence), for example first partition 150 and second partition 160. A partition that is not bright (i.e. a partition that does not luminescence) corresponds to no copies of a target nucleic acid being present in the partition, for example third partition 170. The luminescence lifetime that is measured indicates which target nucleic acid is present, altogether revealing the precise number of copies for each target nucleic acid of interest originally present in the sample 105.

[0044] The method 100 requires: (1) switch on (i.e. stimulation, activation or inducement) of the luminescence, preferably photoluminescence, after PCR amplification of a target nucleic acid, regardless of which target nucleic acid; and (2) identification of the target nucleic acid according to the luminescence lifetime. To fulfil both requirements at the same time, luminescence resonance energy transfer (LRET), a known technique, was used from a relatively long-lifetime donor, such as a lanthanide complex, to an acceptor, and the sensitized luminescence of the acceptor was measured.

[0045] Specifically, as shown in Figure 2, each forward primer 205 was modified corresponding to a potential target nucleic acid 200 (Target ) with an additional upstream section 210 to form a modified forward primer 205, 210 (FPx). An oligonucleotide was designed that is perfectly complementary to the additional upstream section 210 with an acceptor 220 (i.e. an "acceptor molecule", or an "acceptor probe") attached on its 3'-end, the oligonucleotide and the acceptor 220 are collectively denoted as an acceptor-tag 215 (i.e. an "A-tag") (A-tagx). Included in the reaction mixture is a conjugated donor-tag 225 (i.e. a "D- tag") (D-tagx), which is nearly complementary to the acceptor-tag 215 except for a singlebase mismatch. The conjugated donor-tag 225 has an attached donor 240 (i.e. a "donor molecule", or a "donor probe"). Also in the reaction mixture is reverse primer 235 (RPx).

[0046] During PCR amplification 140, the presence of any target nucleic acid 200 in a partition 120 (i.e. a droplet) of the combined mixture 115 leads to extension of its corresponding primers, eventually coming up with fully elongated sequences that occupy the upstream section supposed to hybridize with the acceptor-tag 215. The annealing temperature should be carefully chosen to prevent the acceptor-tags from hybridisation during the thermal cycles over the thermal range, so that they are not cleaved by the DNA polymerases. At the end of the thermal cycles, as the temperature gradually reduces, those fully elongated sequences from the primers (forward primers 205 and reverse primers 235) preferentially bind with each other, so that the corresponding acceptor-tag 215 has nothing but the conjugated donor-tag 225 to hybridize with (i.e. bind with). Whereas, other acceptortags whose target nucleic acids are absent in the partition still bind back to their respective forward primers after the whole process (not illustrated in the figure for clarity). As illustrated in Figure 2 at the 'End point' part, the hybridisation between the acceptor-tag 215 and the conjugated donor-tag 225 results in the donor 240 and the acceptor 220 being brought into close proximity (i.e. being brought together or near), inducing LRET to switch on (i.e. to activate, stimulate or induce) the luminescence of the acceptor 220, with a distinct lifetime measurable depending on the distance between the donor-acceptor pair 240, 220.Lifetime encoding using overlapping oligonucleotides

[0047] To generate lifetime identities based on varying the LRET distance between donoracceptor pairs, i.e. encoded lifetimes, examples include individually designing pairs of acceptor-tag and conjugated donor-tag for each target nucleic acid, or, preferably, designingoverlapping acceptor-tags and a single or common conjugated donor-tag containing the complementary sequences to all of the acceptor-tags.

[0048] Figures 3-5 illustrate example tags and results for lifetime encoding using overlapping oligonucleotides. As shown in Figure 3, there are overlapping acceptor-tag 255 (A-tagx) having an acceptor 257 (a first acceptor-tag 255 having a first acceptor 257 attached), acceptor-tag 265 (A-tagy) having an acceptor 267 (a second acceptor-tag 265 having a second acceptor 267 attached), and acceptor-tag 275 (A-tagz) having an acceptor 277 (a third acceptor-tag 275 having a third acceptor 277 attached). The overlapping acceptor-tags 255, 265, 275 hybridize with different sections on conjugated donor-tags 280 (D-tag) having a donor 282 attached, so that the LRET distance between different donoracceptor pairs for luminescence becomes dependent on the number of unpaired nucleobases (n) at the 5'-end of the conjugated donor-tags 280 where the donors 282 are attached.

[0049] In one specific non-limiting example, a trivalent europium complex, DTBTA-Eu, was used as the donor 282 attached to the 5'-end of the conjugated donor-tag 280, while the 3'-end of the acceptor-tags 255, 265, 275 was modified with an organic dye Cyanine-5.5 (Cy5.5) as the acceptor 257, 267, 277. Under 365 nm wavelength excitation, DTBTA-Eu emitted long-lived luminescence (with a lifetime at or about 1 ms) in the wavelength range of 580 to 710 nm, which can be absorbed by Cy5.5 to yield emission further beyond 710 nm (see Figure 4). Because of the sensitised nature, the luminescence lifetime of Cy5.5 emission followed that of the Eu emission, and the latter remained unchanged in the case of radiative energy transfer. But when the donor-acceptor pair were brought close as a result of DNA hybridization, resonance energy transfer occurred and induced an additional non-radiative relaxation pathway for the donor, reducing its lifetime as the LRET distance shortened. The lifetime of the long-lived luminescence of the acceptor emission around a wavelength of 730 nm (i.e. acceptor lifetime TA) can be thus assigned to each respective hybridized position of each acceptor-tag 255, 265, 275 as its identity for lifetime based multiplexing.

[0050] As illustrated in Figure 4, the spectral overlap integral between the donor 282 and the acceptor 257, 267, 277 was calculated as 3.35* 1015M-1cm-1nm4, leading to a critical distance of 5.02 nm (at which 50% of the energy is transferred resonantly). By comparison, the length of a base pair in double-strand DNA is approximately 0.34 nm. Taking the potential steric hindrance into account, testing was performed on a series of overlappingacceptor-tags 255, 265, 275 mixed with the conjugated donor-tag 280, respectively, with the number of unpaired nucleobases n between 0 and 15. Each pair was measured separately in the DNA hybridisation buffer, and was denatured and annealed ahead of the measurement to minimise nonspecific binding. The photoluminescence decay curves measured at the wavelength of 730 nm were then fitted to exponentials to calculate their luminescence lifetimes. Figure 5 shows that, as n increased from 0 to 15, the acceptor lifetime was effectively tuned to at or between 342.2 and 692.8 ps. Specifically, the lifetime increased for n = 0 to 7 bases, jumped to the longest value at n = 9, and then gradually decreased as n increased further to 15. The inventors attribute the turning point in lifetimes to the conformational change of the unpaired single-strand DNA in the salt buffer that may result in shortened LRET distance. Importantly, even though the lifetimes of the sensitised acceptor luminescence did not change monotonically, the lifetimes are suited for encoding as long as the differences remain distinct in the digital PCR format.

[0051] Thus in a general example, there is provided a method for providing a lifetimemultiplex digital polymerase chain reaction assay. A combined mixture is made of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached. The first target nucleic acid and the second target nucleic acid are subjected to polymerase chain reaction amplification, if present, using the reaction mixture. First acceptor-tags hybridize with the conjugated donor-tags at a first position when the first target nucleic acid is present. Second acceptor-tags hybridize with the conjugated donor-tags at a second position when the second target nucleic acid is present. The first position is different to the second position. A first lifetime of luminescence of the acceptors is measured, with luminescence of the acceptors of the first acceptor-tags only occurring if the first acceptor-tags have hybridized with the conjugated donor-tags. A second lifetime of luminescence of the acceptors is measured, with luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donor-tags. The first lifetime is different to the second lifetime, enabling identification of the first target nucleic acid based on the first lifetime, if present in the sample, and identification of the second target nucleic acid based on the second lifetime, if present in the sample.

[0052] In other forms, there is provided a method, system and / or tags for a lifetimemultiplex digital polymerase chain reaction assay, comprising forming a combined mixture 115 of a reaction mixture 110 and a sample 105 that potentially contains two or more target nucleic acids. The reaction mixture 110 includes acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached. The combined mixture 115 is partitioned into partitions (droplets 120) including a first partition (e.g. droplet 150) potentially including a first target nucleic acid of the two or more target nucleic acids and a second partition (e.g. droplet 160) potentially including a second target nucleic acid of the two or more target nucleic acids. The first target nucleic acid and the second target nucleic acid are subjected to polymerase chain reaction amplification, at step 140, if present, using the reaction mixture 110.

[0053] First acceptor-tags 255 hybridize with the conjugated donor-tags 280 at a first position (nx) on the conjugated donor-tags when the first target nucleic acid is present in the first partition (e.g. droplet 150). Second acceptor-tags 265 hybridize with the conjugated donor-tags 280 at a second position (ny) on the conjugated donor-tags when the second target nucleic acid is present in the second partition (e.g. droplet 160). The first position (nx) is different to the second position (ny). A first lifetime is measured of luminescence of the acceptors 257 of the first acceptor-tags 255, the luminescence of the acceptors of the first acceptor-tags 255 only occurring if the first acceptor-tags 255 have hybridized with the conjugated donor-tags 280 in the first partition. A second lifetime is measured of luminescence of the acceptors 267 of the second acceptor-tags 265, the luminescence of the acceptors 267 of the second acceptor-tags 265 only occurring if the second acceptor-tags 265 have hybridized with the conjugated donor-tags 280 in the second partition. The first lifetime is different to the second lifetime. The first target nucleic acid is identified based on the first lifetime, if present in the sample, and the second target nucleic acid is identified based on the second lifetime, if present in the sample.

[0054] Preferably, the luminescence is based on luminescence resonance energy transfer (LRET), and varying the first position produces a different first lifetime, and / or varying the second position produces a different second lifetime. Preferably, the first lifetime and the second lifetime are encoded for simultaneous identification of different target nucleic acids contained in the sample. Also preferably, the conjugated donor-tags are complementarydonor-tags that overlap the first acceptor-tags and the second acceptor-tags. Optionally, the luminescence is photoluminescence.

[0055] In various modifications, the first lifetime is dependent on a first distance between the acceptors of the first acceptor-tags and the donors of the conjugated donor-tags, and the second lifetime is dependent on a second distance between the acceptors of the second acceptor-tags and the donors of the conjugated donor-tags.Droplet (partition) generation and lifetime decoding

[0056] To implement a method and / or system for a digital PCR assay, each sample was subdivided into droplets (i.e. partitions) using a purpose-built microfluidic chip 300 manufactured by soft lithography. While microfluidic droplet generation is a preferred method for partitioning, other examples for achieving partitioning can be used, for example, using a chip of microwells and spreading the sample on the chip to provide partitioning of the sample. Figures 6-8 illustrates an example system for droplet generation and lifetime decoding. As shown in Figure 6, two stages of emulsion (water-in-oil followed by oil-in- water) were included to form double-layered droplets composed of an inner aqueous phase (95 ± 3 pm diameter) and an outer oil phase (168 ± 5 pm diameter). The cation concentration of the outer aqueous buffer was adjusted in balance to the sample, so that the droplets stayed stable when stored at room temperature, with change in the inner diameter less than 2 % at 3 days after generation.

[0057] Each sample measured collectively in Figure 5 was processed by the microfluidic chip 300 to produce one batch of droplets, which were filled in a microcentrifuge tube to undergo 35 thermal cycles (from 24 to 95 °C) in a PCR machine. The sample was then spread into a small petri dish with glass bottom to form a single layer of densely packed droplets, and subject to imaging using a time-resolved luminescence microscope. As shown in Figure 7, most droplets maintained intact, indicating excellent thermal stability of the formula for digital PCR. The double-layered design was also beneficial in case of possible merging (occurrence less than 0.1%), when it is the outer oil phase merged while the partitions can still be clearly defined using simple image segmentation for counting and lifetime identification.

[0058] Figure 8 summarises the acceptor lifetimes of individual droplets, concluded as one histogram per sample that was fitted to a normal distribution. Except for two samples (n = 3 and 5), these lifetime populations were well separated from each other, with coefficient of variation in the range of 3.1 to 6.6%. The mean lifetime of each population increased from 342 to 680 ps for n from 0 to 9, and then decreased to 517 ps when n increased further up to 15. These values remained largely consistent with those measured from the whole samples in Figure 5, while the smearing can be attributed to the lower signal from individual droplet that is more susceptible to random fluctuation. Nonetheless, recognition of the lifetime identities was accurate for most populations at error rate less than 3%, which can be improved further when fewer populations are present at the same time.

[0059] In one example, the luminescence is over a single colour frequency band. In another example, the luminescence is over two or more colours frequency bands. Preferably, the first lifetime and / or the second lifetime are in the microsecond-to-millisecond range. In another example, subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification includes thermal cycling over a thermal range. The conjugated donor-tags are thermally stable over the thermal range, and the droplets are thermally stable over the thermal range.

[0060] Preferably, the donor comprises a rare earth element or a lanthanide. In other examples, the donor comprises at least one element selected from the group of: Scandium, Yttrium, Lanthanum, Cerium, Praseodymium, Neodymium, Promethium, Samarium, Europium, Gadolinium, Terbium, Dysprosium, Holmium, Erbium, Thulium, Ytterbium, and Lutetium.

[0061] In another example, the method further includes: stimulating the donors of the conjugated donor-tags to produce luminescence of the acceptors of the acceptor-tags; and, time-resolving the luminescence to identify the position of the acceptor-tags on the conjugated donor-tags. Preferably, stimulating the donors involves exposing the donors to electromagnetic radiation. The time-resolved luminescence can provide lifetime-based populations of different target nucleic acids, and the lifetime can be varied by altering a donor-to-acceptor distance. In another example, the acceptors of the acceptor-tags are doped with one or more sensitizers.

[0062] In another example, the method provided further includes partitioning the combined mixture into partitions including a third partition potentially including a third target nucleic acid, and similarly subjecting the third target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture. Third acceptor-tags hybridize with the conjugated donor-tags at a third position on the conjugated donor-tags when the third target nucleic acid is present in the third partition. The third position is different to the first position and the second position. A third lifetime of luminescence of the acceptors of the third acceptor-tags is measured, the luminescence of the acceptors of the third acceptor-tags only occurring if the third acceptor-tags have hybridized with the conjugated donor-tags in the third partition. The third lifetime is different to the first lifetime and the second lifetime. Thus, identifying the third target nucleic acid based on the third lifetime, if present in the sample.

[0063] In another example, there is provided a method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached. The combined mixture is partitioned into partitions, a first partition potentially including a first target nucleic acid of the two or more target nucleic acids, and a second partition potentially including a second target nucleic acid of the two or more target nucleic acids. The first target nucleic acid and the second target nucleic acid are subjected to polymerase chain reaction amplification, if present, using the reaction mixture. First acceptor-tags each with a first acceptor attached hybridize with first conjugated donor-tags each with a first donor attached, the first acceptor and the first donor separated by a first distance, when the first target nucleic acid is present in the first partition. Second acceptor-tags each with a second acceptor attached hybridize with second conjugated donor-tags each with a second donor attached, the second acceptor and the second donor separated by a second distance, when the second target nucleic acid is present in the second partition. The first distance is different to the second distance. A first lifetime is measured of luminescence of the first acceptors of the first acceptor-tags, the luminescence of the first acceptors only occurring if the first acceptor-tags have hybridized with the first conjugated donor-tags in the first partition. A second lifetime is measured of luminescence of the second acceptors of the second acceptor-tags, the luminescence of the second acceptors only occurring if the second acceptor-tags have hybridized with the secondconjugated donor-tags in the second partition. The first lifetime is different to the second lifetime. The first target nucleic acid is identified based on the first lifetime, if present in the sample, and the second target nucleic acid is identified based on the second lifetime, if present in the sample.

[0064] In another example, there is provided the donor-tag for use in a lifetime-multiplex digital polymerase chain reaction assay. The donor-tag including the donor attached to one end, the donor comprising a rare earth element. The donor-tag is capable of being hybridized to an acceptor-tag at different positions on the donor-tag, and the donor is able to produce LRET in an acceptor of the hybridized acceptor-tag.

[0065] Preferably, the donor-tag is an oligonucleotide. Also preferably, the acceptor-tag is an oligonucleotide. In another example, the rare earth element is europium. In another example, the donor comprises a trivalent europium complex. In another example, the donor is attached to a 5'-end of the donor-tag. In another example, the acceptor comprises an organic dye, optionally the organic dye is Cyanine-5.5. In another example, the acceptor is attached to a 3 '-end of the acceptor-tag.Demonstration of lifetime-multiplex digital PCR

[0066] The above configurations for lifetime encoding and decoding were integrated together into the overall design to realise a method and / or system for providing a lifetimemultiplex digital PCR assay. Clinically used DNA segments for detecting two bacteria causing severe diseases, IS6110 and rpoB from M. tuberculosis and ctrA from N. meningitidis, were selected as example target nucleic acids and assigned to n = 3, 15 and 9 lifetime identities, respectively. The forward primers, reverse primers, acceptor-tags and the conjugated donor-tag were designed accordingly. The melting temperatures of all the sequences were carefully verified, so that an appropriate annealing temperature can be set for thermal cycling to achieve the desired binding preferences. Again, the droplets after PCR amplification were spread in a small petri dish for bright-field and time-resolved luminescence imaging at the sensitized Cy5.5 emission around a wavelength of 730 nm.

[0067] Figures 9-13 illustrates example results of a lifetime-multiplex digital PCR assay and a method of lifetime encoding. Figure 9 shows the measurement of an area of 7.75 x 7.75 mm2from one typical testing sample containing about 1200 droplets based on the bright-field image. The positive droplets, whose sensitized luminescence was switched on (i.e. activated or induced) after PCR amplification of a target nucleic acid, were recognised based on their long-lived luminescence lifetime against the negative droplets. Each positive droplet was then allocated to one of the target nucleic acids of interest based on its lifetime identity. The measurement was performed for different areas of the petri dish to obtain a large total number of partitions (N), so that absolute quantification of all the target nucleic acids originally present in the sample was achieved according to Poisson statistics.

[0068] To verify the performance, simplex samples containing a single target nucleic acid were tested first, which were prepared at a serial dilution to obtain a concentration from 400 down to 25 aM (i.e. 10'18M) in the master mix (containing probes for all three target nucleic acids). Given the droplet volume of 0.52 nL, the target nucleic acid occupancy (i.e. average copy per droplet) was 0.12 to 0.0078. As shown in Figure 10, the lifetime populations for each simplex sample were consistent with those measured in Figure 8, allowing simple identification based on the lifetime ranges. The fractions of positive droplets in relation to the target nucleic acid occupancy, measured in triplicates, were in good agreement to the Poisson statistics of standard digital PCR (see Figure 11). The detection limit was calculated as 25 aM for a single type of target nucleic acid, as determined by the sampling statistics. The dynamic range, on the other hand, depended on the total number of partitions N in each measurement, which was about 5000 copies / reaction in the current testing but can be increased straightforwardly if required.

[0069] Multiplex specimens containing a mixture of the three target nucleic acids at different ratios were tested, including IS6110.rpoB.ctrA = 1 :2:3, 3:2: 1, and 2:0:2. Using the lifetime ranges determined based on the simplex results in Figure 10, the positive partitions detected from the multiplex sample were categorised to each target nucleic acid (see Figure 12). The quantification results are summarised in Figure 13, which correlated excellently with the target nucleic acid ratios of each sample prepared, confirming superb accuracy and minimum crosstalk for the lifetime-multiplex digital PCR assay.

[0070] Thus, there is provided a novel multiplexing strategy for digital PCR using the temporal dimension of luminescence lifetimes. Detection and identification were based on luminescence resonance energy transfer (LRET) to switch on (i.e. activate, stimulate or induce) the relatively long-lived acceptor emission, offering distinctive lifetimes in the rangeof about 342 to about 693 ps with respect to the LRET distance between a donor and acceptor. The lifetime identities were then implemented in a digital PCR system that employed microfluidics to generate tens of thousands of double-layered droplets with excellent stability during thermal cycling. Time-resolved luminescence imaging of these droplets provided a simple and reliable readout of the multiplexed detection results, yielding absolute quantification of multiple genes (i.e. target nucleic acids) in the sample with a detection limit down to 15 copy numbers / pL.

[0071] Implementation of the lifetime identities made use of overlapping acceptor-tags, which is an advantageous design in terms of the single conjugated donor-tag requiring conjugation with the europium complex. Acceptor-tags (i.e. single-strand DNAs conjugated with Cy5.5) are readily available commercially, reducing complexity and cost. Moreover, the approach minimises the residual conjugated donor-tags unbound to acceptor-tags, which may be important for reducing background effects interfering with radiative energy transfer. Double-stranded DNAs also may be used that are even more consistent and predictable to tune the LRET distance in a controlled fashion. Besides LRET that uses long-lifetime donors, it is also possible to use long-lifetime acceptors (such as dye-sensitized upconversion nanoparticles) for lifetime multiplexing in digital PCR assays, as long as the two requirements (switch on of luminescence after PCR amplification and distinct luminescence lifetime identity) are met.

[0072] Encoding of the lifetime identities can be combined with others features such as colour to geometrically extend the multiplexing capacity for digital PCR assays. For example, terbium complexes can be paired with Cy3 to introduce another LRET channel. One may also include intensity levels that have been implemented in digital PCR to achieve even higher order multiplexing, but as the order keeps increasing, the ultimate challenge lies in the number of reagents needed in these tiny partitions that will eventually limit the signal- to-noise ratio in practice.

[0073] It should be noted that lifetime encoding is not limited to the droplet format previously discussed, but is also compatible with chip-based digital PCR assays where the same imaging-based decoding applies. For decoding, the droplet-based digital PCR can also be measured by flow cytometry to improve the analytical throughput. A wide range of applications can benefit from lifetime-multiplex digital PCR detection, facilitating high-throughput genetic testing. Example applications include disease diagnosis, pathogen detection, food security (i.e. detecting genetically modified species), water quality assessment, forensic studies, cancer immunotherapy, and other applications for public health.Further examples

[0074] The following examples provide a more detailed discussion of particular embodiments. The examples are intended to be merely illustrative and not limiting to the scope of the present invention.

[0075] Lifetime-multiplexing is based on the temporal domain as an extra dimension in addition to spectrum and intensity. In other examples, other lanthanides can be selected as example luminescent donor probes to realise lifetime-multiplexing in a digital PCR assay. Lanthanides have an extensive dynamic range associated with their exceptionally-long lifetimes (greater than 100 ps), as well as other attractive properties including narrow emission spectra. Various other example embodiments can use any of the lanthanides, including Lanthanum, Cerium, Praseodymium, Neodymium, Promethium, Samarium, Europium, Gadolinium, Terbium, Dysprosium, Holmium, Erbium, Thulium, Ytterbium, and Lutetium, either individually or in any combination. Other example embodiments can use any of the rare earth elements as luminescent donor probes to realise lifetime-multiplexing in a digital PCR assay, which include any of the fifteen lanthanides in addition to Scandium and Yttrium, either individually or in any combination.Example chemical reagents

[0076] Europium (III) chloride (99.99%), dimethyl sulfoxide (DMSO), acetone, sodium tetraborate decahydrate, cyanuric chloride, magnesium chloride, Pluornic F-127, Tween-20, and bovine serum albumin (BSA) were obtained from Sigma Aldrich. {2,2',2",2"'-{4'- (aminobiphenyl-4-yl)-2,2':6',2"-terpyridine-6,6"-diyl]bis(methylenenitrilo)}- tetrakis(acetato)} europium(III) (ATBTA-Eu; > 90%) was obtained from TCI Chemicals. All the reagents were used without further purification. All the DNA oligonucleotides, including those with amino or Cy5.5 modification, were obtained from Integrated DNA Technologies. Non-modified oligonucleotides were purified with a cartridge gold desaltingmethod, while all the modified oligonucleotides were purified with HPLC. Example sequences used in this study are summarized Table 1 and Table 2.Table 1. Detailed sequences of example Eu-tag and Cy5.5-tags.Oligonucleotides 5’-Sequence-3’Cy5.5-tag0 TAC ACT TTA TCC AAT CTT ACA ATC / 3Cy55Sp / Cy5.5-tag3 ATC TAC ACT TTA TCC AAT CTT ACA / 3Cy55Sp / Cy5.5-tag5 CTA TCT ACC CTT TAT CAA ATC TTA / 3Cy55Sp / Cy5.5-tag7 AAC TAT CTA CCC TTT ATC AAA TCT / 3Cy55Sp / Cy5.5-tag9 CTA ACT ATC TCC ACT TTA TCA AAT / 3Cy55Sp / Cy5.5-tagl 1 TTC TAA CTA TCT ACC CTT TAT CAA / 3Cy55Sp / Cy5.5-tagl3 CAT TCT AAC TAT CTC CAC TTT ATC / 3Cy55Sp / Cy5.5-tagl5 TAC ATT CTA CCT ATC TAC ACT TTA / 3Cy55Sp / Table 2. Detailed sequences of example primers and PCR amplicons.Name 5’-Sequence-3’TGT AAG ATT GGA TAA AGT GTA GAT 1S6110-FP-tagCGC CGC AGT ACT GGT AGAIS6110-RP CGG TCG GAA GCT CCT ATG ACATT TGA TAA AGG GTA GAT AGT TAG ctrA-FP-tagCC GCA TTA TTC TGC ACC ActrA-RP GCCTTTCTTCGATGGGCTTAA AGT GTA GAT AGG TAG AAT GTA rpoB-FP-tag CGTGGC TCG AGT TTG ACGrpoB-RP GTT GTC CTT CTC CAG CGT CCGC CGC AGT ACT GGT AGA GGC GGC GAT GGT TGAACC AGT CGA CCC AGC GCG CGG TGG CCA ACT CGA CATM. tuberculosis CCT CGA TGG ACC GCC AGG GCT TGC CGG GTT TGA TCAIS6110 GCT CGG TCT TGT ATA GGC CGT TGA TCG TCT CGG CTA_ GTG CAT TGT CAT AGG AGC TTC CGA CCG _CCG CAT TAT TCT GCA CCA AAC GCA CCA TCA CTT GTG GCT GAT TGG CCA TTT TTT TCA GGC GGC CTT TAA TAA N. meningitidis TTT CCT GAA CCT GAC CAG GCG TTT TAC CGA CCA CCG ctrA AAA TAT CGC CAA CAA ACG GCA CAG AAA CCG TAC CACGTG CCG TGA CCA ACT GCT CTG GCA ACT TAG TTT GAT_ GCG CAC TAC CCG AGC CCA TCG AAG AAA GGCCGT GGC TCG AGT TTG ACG TCG ACA AGC GCG ACAM tuberculosisCCG TCG GCG TGC GCA TCG ACC GCA AAC GCC GGC AACrpoBCGG TCA CCG TGC TGC TCA AGG CGC TGG GCT GGA CCAGCG AGC AGA TTG TCG AGC GGT TCG GGT TCT CCG AGATCA TGC GAT CGA CGC TGG AGA AGG ACA ACPreparation of a conjugated donor -tag

[0077] 1.5 mg ATBTA-Eu was dissolved in 40 pL acetate buffer (0.1 M, pH 4.9), which was mixed with 0.33 mg cyanuric chloride in 25 pL acetone. The mixture was stirred for 30 min, and then added dropwise into 1 mL acetone. The formed precipitate was collected via centrifugation, washed twice with 0.5 mL acetone, and dried in vacuum for 1 h to obtain the yellow powder of DTBTA-Eu (2,2',2",2"'-{4'-{[(4,6-dichloro-l,3,5-triazin-2-yl)amino] biphenyl-4-yl}-2,2':6',2"-terpyridine-6,6"-diyl} bis(methylenenitrilo)}tetrakis (acetato) europium). To a solution of 2 mM DTBTA-Eu in 10 pL ofDMSO, 10 pL of water containing 100 pM oligo DNA (5’- / AmMC6 / GAT TGT AAG ATT TGA TAA AGT GT A GAT AGT TAG AAT GTA / Phos / -3’) and 4.0 pL of 500 mM carbonate buffer (pH 8.0) were added. After stirring for 24 h at room temperature, the formed conjugated donor-tag was purified using the ethanol precipitation method by adding sodium acetate solution (2 pL, pH 5.5, 3M) and ethanol (400 pL). The mixture was vortexed, cooled to -80 °C, and kept for 15 min. The precipitated product was then collected by centrifuging for 2 min at 16,000 rpm and redissolved in 20 pL of milli-Q water. The purification procedure was repeated twice. The product was verified using absorption measurement, showing both peaks at wavelengths of 340 nm from the DTBTA-Eu and at 260 nm from the DNA. The conjugation ratio of DTBTA-Eu to the oligos were determined from the respective absorbance values of the DTBTA (molar extinction coefficient of 31,400 M^cm'1) and the oligo.Photophysical characterization

[0078] UV-Vis-NIR absorption was measured by a Cary 5000 spectrophotometer. Luminescence emission spectra were measured by a FLS980 fluorescence spectrometer. All LRET samples were prepared in the DNA hybridization buffer (25mM HEPES buffer, 150 mM NaCl, 10 mM MgCh, 0.1% BSA, pH7.4), each containinglOO pL conjugated donor-tag and 100 pL acceptor-tag with the same final concentration of 0.2 pM. After mixing, samples were incubated in centrifuge tubes for 30 min at 59 °C. The luminescence decay curves were acquired on a time-resolved orthogonal scanning automated microscope (TR-OSAM) under a wavelength of 365 nm LED (M365LP1-C1, Thorlabs) excitation. An optical bandpass filter with transmission wavelengths of 735 ± 14 nm (Semrock) was used to select the Cy5.5 emission.Microfluidic droplets generation

[0079] Referring to Figure 6, the microfluidic chip 300 comprises two layers: a shallow channel of about 80 pm with a hydrophobic cross-junction droplet generator 310 and a deep channel of about 100 pm with a hydrophilic flow-focusing droplet generator 330. The crossjunction droplet generator 310 used to create w / o single emulsions has widths of 80 pm for an inner aqueous phase and an oil phase. After the stabilization using a narrow U-shaped microchannel 320 (70 pm in width 4.1 mm, in length and an inner radius of 100 pm), the flow-focusing droplet generator 330 was used to produce double-layered droplets in two parts with widths of 150 and 250 pm for an outer phase. There is a sample inlet 340 for supplying the sample, an inner phase inlet 350 for injecting into the sample an inner phase, being an oil phase, and an outer phase inlet 360 for injecting an outer phase, respectively, as the oil phase and the outer customized PBS to maintain the ion concentration balance between the inner phase and outer phase. For droplets generation, the inner phase was prepared by adding 0.1% Tween-20 into the PCR reaction mixture. The oil phase was the Bio-Rad oil. The outer phase was prepared by adding 1% Pluomic F-127 and 1% Tween-20 to PBS and maintain the ion concentration balance between the inner and outer phase. The flow velocity of inner, oil, and outer phase was set as 1, 4 and 18 pL / min, respectively. The generated droplets were collected at outlet 370 and spread in a glass-bottom Petri dish.Lifetime imaging

[0080] The lifetime images were obtained on a purpose-built time-resolved luminescence microscope, equipped with an electron-multiplying charge-coupled device (EMCCD) (iXonEM+ 885), a 365-nm LED (M365LP1-C1, Thorlabs), and an optical chopper (C995, Terahertz Technologies). A multifunction data acquisition card (PXIe-6358, National Instruments) was used to interface these components with a computer, and a Lab VIEW program was built to realise time-resolved luminescence imaging.

[0081] The droplets in the Petri dish were imaged by a 10X objective lens (UMPlanFl 10x / 0.30, Olympus). The emission was separated from the 365 nm excitation wavelength by a dichroic mirror (570 nm long pass, U-MWG2, Olympus), and further purified by a bandpass filter (FF01-735 / 28-25, Semrock) before entering the time-gating unit comprising the chopper and the EMCCD camera. Time-gating was implemented by feeding the transistor-transistor logic (TTL) signal output from the chopper to the computer, which generated time-delayed pulses to trigger the LED excitation. The EMCCD camera was also synchronised for image acquisition. To obtain the lifetime image, a series of time-gated images were acquired with incremental time delays. Frequency of the optical chopper was set as 200 Hz, and the exposure time of each image was 1 s. Then, for each droplet, its intensity values were extracted from these time-gated images to obtain its luminescence decay, allowing the lifetime to be calculated based on mono-exponential fitting. The microscope was equipped with a motorized stage for scanning the entire sample area.Lifetime-multiplex digital PCR protocol

[0082] PCR reactions were performed using the MyTaq HS DNA Polymerase kit (Bioline, 5mM dNTPs and 15 mM MgCh). Each 22 pL of reaction mixture contained 0.2 mM of dNTP and 0.4 U of polymerase, 3.12 mM MgCh, 50 mM NaCl, 0.2 pM of each primer, conjugated donor-tag and acceptor-tags (see the examples provided in Table 3). The collected droplets were then thermally cycled in a PCR machine (Eppendorf Mastercycler), including a 5 min hot start at 94 °C, and 35 cycles incorporating 30 s at 95 °C, 30 s at 57 °C and 30 s 72 °C, followed by 2 min at 72 °C and 30 min at 53 °C for final extension and annealing. For the simplex tests, each mixture contained 100 aM of IS6110, ctrA or rpoB, respectively. For the multiplex tests, sample A contained 50 aM, 100 aM and 150 aM, sampleB contained 150 aM, 100 aM and 50 aM, sample C contained 200 aM, 0 aM and 200 aM for IS6110, rpoB, and ctrA, respectively.Table 3. Example reaction mixtures for lifetime-multiplex digital PCR.Reaction mixture Initial Con. V (pL)5x MyTaq Reaction Buffer 5mM dNTPs 3.4MyTaq HS DNA Polymerase 0.6IS6110-FP-tag 10 pM 0.44IS6110-RP 10 pM 0.44 ctrA-FP-tag 10 pM 0.44 ctrA-RP 10 pM 0.44 rpoB-RP 10 pM 0.44 rpoB-RP 10 pM 0.44Eu-tag 1 pM 4.4Cy-5.5 tag3 2 pM 2.2Cy5.5-tag9 2 pM 2.2Cy5.5-tagl5 2 pM 2.2NaCl 550 mM 2MgCh 8.8 mM 2Targets 0.4Total volume 22

[0083] Additional verification was performed by breaking the droplets after the PCR thermal cycling and loading the products in 2% agarose gel (containing GelRed Nucleic Acid Stain; 4 pL stain per 100 mL gel) in Tris-acetate-EDTA buffer for electrophoresis. The results of gel electrophoresis demonstrated successful PCR amplification, showing excellent specificity of the primers for amplifying the corresponding DNA sequences in the droplets.

[0084] It should also be noted that the different examples described herein can be combined in different ways. That is, parts of one or more examples can be combined with parts of one or more other examples. All such combinations are contemplated herein.

[0085] Optional embodiments of the present invention may also be said to broadly consist in the parts, elements and features referred to or indicated herein, individually or collectively, in any or all combinations of two or more of the parts, elements or features, and wherein specific integers are mentioned herein which have known equivalents in the art to which the invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.

[0086] As used herein, a, an, the, at least one, and one or more are used interchangeably, and refer to one or to more than one (i.e. at least one) of the grammatical object. By way of example, “an element” means one element, at least one element, or one or more elements.

[0087] Although a preferred embodiment has been described in detail, it should be understood that many modifications, changes, substitutions or alterations will be apparent to those skilled in the art without departing from the scope of the present invention.

Claims

The claims.

1. A method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; partitioning the combined mixture into partitions, a first partition potentially including a first target nucleic acid of the two or more target nucleic acids, and a second partition potentially including a second target nucleic acid of the two or more target nucleic acids; subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags hybridize with the conjugated donor-tags at a first position on the conjugated donor-tags when the first target nucleic acid is present in the first partition; wherein, second acceptor-tags hybridize with the conjugated donor-tags at a second position on the conjugated donor-tags when the second target nucleic acid is present in the second partition; wherein, the first position is different to the second position; measuring a first lifetime of luminescence of the acceptors of the first acceptor-tags, the luminescence of the acceptors of the first acceptor-tags only occurring if the first acceptor-tags have hybridized with the conjugated donor-tags in the first partition; measuring a second lifetime of luminescence of the acceptors of the second acceptor-tags, the luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donor-tags in the second partition; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

2. The method of claim 1, wherein the luminescence is based on luminescence resonance energy transfer (LRET).

3. The method of claim 1 or 2, wherein varying the first position produces a different first lifetime, and / or varying the second position produces a different second lifetime.

4. The method of any one of claims 1 to 3, wherein the first lifetime and the second lifetime are encoded for simultaneous identification of different target nucleic acids contained in the sample.

5. The method of any one of claims 1 to 4, wherein the conjugated donor-tags are complementary donor-tags that overlap the first acceptor-tags and the second acceptor-tags.

6. The method of any one of claims 1 to 5, wherein the partitions are droplets.

7. The method of any one of claims 1 to 6, wherein the luminescence is photoluminescence.

8. The method of any one of claims 1 to 7, wherein the first lifetime is dependent on a first distance between the acceptors of the first acceptor-tags and the donors of the conjugated donor-tags, and the second lifetime is dependent on a second distance between the acceptors of the second acceptor-tags and the donors of the conjugated donor-tags.

9. The method of any one of claims 1 to 8, wherein the luminescence is over a single colour frequency band.

10. The method of any one of claims 1 to 8, wherein the luminescence is over two or more colours frequency bands.

11. The method of any one of claims 1 to 10, wherein the first lifetime and the second lifetime are in the microsecond-to-millisecond range.

12. The method of any one of claims 1 to 11, wherein subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification includes thermal cycling over a thermal range.

13. The method of claim 12, wherein the conjugated donor-tags are thermally stable over the thermal range.

14. The method of claim 12 or 13, wherein the droplets are thermally stable over the thermal range.

15. The method of any one of claims 1 to 14, wherein the donor comprises a rare earth element or a lanthanide.

16. The method of any one of claims 1 to 14, wherein the donor comprises at least one element selected from the group of: Scandium, Yttrium, Lanthanum, Cerium, Praseodymium, Neodymium, Promethium, Samarium, Europium, Gadolinium, Terbium, Dysprosium, Holmium, Erbium, Thulium, Ytterbium, and Lutetium.

17. The method of any one of claims 1 to 16, further including: stimulating the donors of the conjugated donor-tags to produce luminescence of the acceptors of the acceptor-tags; and, time-resolving the luminescence to identify the position of the acceptor-tags on the conjugated donor-tags.

18. The method of claim 17, wherein stimulating the donors involves exposing the donors to electromagnetic radiation.

19. The method of claim 17, wherein the time-resolved luminescence provides lifetimebased populations of different target nucleic acids.

20. The method of any one of claims 1 to 19, wherein the lifetime is varied by altering a donor-to-acceptor distance.

21. The method of any one of claims 1 to 20, wherein the acceptors of the acceptor-tags are doped with a sensitizer.

22. The method of any one of claims 1 to 21, further including: partitioning the combined mixture into partitions including a third partition potentially including a third target nucleic acid; subjecting the third target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, third acceptor-tags hybridize with the conjugated donor-tags at a third position on the conjugated donor-tags when the third target nucleic acid is present in the third partition; wherein, the third position is different to the first position and the second position; measuring a third lifetime of luminescence of the acceptors of the third acceptor-tags, the luminescence of the acceptors of the third acceptor-tags only occurring if the third acceptor-tags have hybridized with the conjugated donor-tags in the third partition; wherein, the third lifetime is different to the first lifetime and the second lifetime; and, identifying the third target nucleic acid based on the third lifetime, if present in the sample.

23. A method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; partitioning the combined mixture into partitions, a first partition potentially including a first target nucleic acid of the two or more target nucleic acids, and a second partition potentially including a second target nucleic acid of the two or more target nucleic acids;subjecting the first target nucleic acid and the second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags each with a first acceptor attached hybridize with first conjugated donor-tags each with a first donor attached, the first acceptor and the first donor separated by a first distance, when the first target nucleic acid is present in the first partition; wherein, second acceptor-tags each with a second acceptor attached hybridize with second conjugated donor-tags each with a second donor attached, the second acceptor and the second donor separated by a second distance, when the second target nucleic acid is present in the second partition; wherein, the first distance is different to the second distance; measuring a first lifetime of luminescence of the first acceptors of the first acceptor-tags, the luminescence of the first acceptors only occurring if the first acceptor-tags have hybridized with the first conjugated donor-tags in the first partition; measuring a second lifetime of luminescence of the second acceptors of the second acceptor-tags, the luminescence of the second acceptors only occurring if the second acceptor-tags have hybridized with the second conjugated donor-tags in the second partition; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

24. A donor-tag for use in a lifetime-multiplex digital polymerase chain reaction assay, the donor-tag including a donor attached to one end, the donor comprising a rare earth element, the donor-tag capable of being hybridized to an acceptor-tag at different positions on the donor-tag, and the donor able to produce LRET in an acceptor of the hybridized acceptor-tag.

25. The donor-tag of claim 24, wherein the donor-tag is an oligonucleotide.

26. The donor-tag of claim 24 or 25, wherein the acceptor-tag is an oligonucleotide.

27. The donor-tag of any one of claims 24 to 26, wherein the rare earth element is europium.

28. The donor-tag of any one of claims 24 to 27, wherein the donor comprises a trivalent europium complex.

29. The donor-tag of any one of claims 24 to 28, wherein the donor is attached to a 5'- end of the donor-tag.

30. The donor-tag of any one of claims 24 to 29, wherein the acceptor comprises an organic dye, and preferably the organic dye is Cyanine-5.5.

31. The donor-tag of claim 30, wherein the acceptor is attached to a 3'-end of the acceptor-tag.

32. A method for providing a lifetime-multiplex digital polymerase chain reaction assay, comprising: forming a combined mixture of a reaction mixture and a sample that potentially contains two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; subjecting a first target nucleic acid and a second target nucleic acid to polymerase chain reaction amplification, if present, using the reaction mixture; wherein, first acceptor-tags hybridize with the conjugated donor-tags at a first position on the conjugated donor-tags when the first target nucleic acid is present; wherein, second acceptor-tags hybridize with the conjugated donor-tags at a second position on the conjugated donor-tags when the second target nucleic acid is present; wherein, the first position is different to the second position; measuring a first lifetime of luminescence of the acceptors of the first acceptor-tags, the luminescence of the acceptors of the first acceptor-tags only occurring if the first acceptor-tags have hybridized with the conjugated donor-tags;measuring a second lifetime of luminescence of the acceptors of the second acceptor-tags, the luminescence of the acceptors of the second acceptor-tags only occurring if the second acceptor-tags have hybridized with the conjugated donortags; wherein, the first lifetime is different to the second lifetime; and, identifying the first target nucleic acid based on the first lifetime, if present in the sample, and identifying the second target nucleic acid based on the second lifetime, if present in the sample.

33. A method for providing a lifetime-multiplex polymerase chain reaction assay, comprising the steps of: forming a combined mixture of a reaction mixture and a sample that potentially contains a target nucleic acid, the target nucleic acid being one of two or more target nucleic acids, the reaction mixture including acceptor-tags each with an acceptor attached, and conjugated donor-tags each with a donor attached; subjecting the two or more target nucleic acids, if present in the sample, to polymerase chain reaction amplification using the reaction mixture; wherein, two or more acceptor-tags hybridize with a single conjugated donortag at two or more different positions on the single conjugated donor-tag when the two or more target nucleic acids are present in the sample, and wherein the donor of the single conjugated donor-tag and a first acceptor are separated by a first distance, and the donor of the single conjugated donor-tag and a second acceptor are separated by a second distance, the first distance being different to the second distance; switching on of a luminescence of the first acceptor and a luminescence of the second acceptor after the two or more acceptor-tags hybridize with the single conjugated donor-tag due to the polymerase chain reaction amplification of the two or more target nucleic acids, if present in the sample; measuring a first lifetime of the luminescence of the first acceptor, and measuring a second lifetime of the luminescence of the second acceptor; identifying a first target nucleic acid of the two or more target nucleic acids, if present in the sample, based on the measured first lifetime, and identifying a second target nucleic acid of the two or more target nucleic acids, if present in the sample, based on the measured second lifetime.