Escherichia coli chassis strain for producing 1,4-butanediamine and use thereof

Abstract

The present invention belongs to the field of genetic engineering, and relates to breeding of industrial microorganisms, in particular to an Escherichia coli chassis strain for producing 1,4-butanediamine and the use thereof. The present invention first constructs the Escherichia coli chassis strain for efficiently producing 1,4-butanediamine, which does not express the following genes: argR, patA, puuA, speED, speG, puuP and argF, or further does not express genes ydcSTUV, potFGHI and plaP. The present invention further proves that the chassis strain has a good application prospect in constructing engineering strains highly producing 1,4-butanediamine, and thus provides an excellent chassis strain for microbial fermentation production of 1,4-butanediamine.

Description

Escherichia coli chassis strain for producing 1,4-butanediamine and its application

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on November 27, 2023, with application number CN202311595033 and invention name “Escherichia coli chassis strain for producing 1,4-butanediamine and its application”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The invention belongs to the field of genetic engineering and relates to the breeding of industrial microorganisms, in particular to an Escherichia coli chassis strain for producing 1,4-butanediamine and an application thereof. Background Art

[0003] 1,4-Butanediamine (1,4-diaminobutane), also known as putrescine, is a small, nitrogen-containing, positively charged aliphatic compound. It is the simplest of the biogenic amines (which include putrescine, spermine, spermidine, and cadaverine). Ludwig Brieger, a physician in Berlin, Germany, first discovered biogenic amines in 1885 from decomposing corpses, and subsequently gave them the names putrescine, spermine, spermidine, and cadaverine. It can polymerize with dibasic acids to form polyamide (PA) materials (commonly known as nylon) with varying properties, such as PA46 and PA4T. PA46, in particular, is widely used in textiles, mechanical chemicals, electronics, automotive manufacturing, aerospace, and packaging due to its high melting point, high crystallinity, high heat resistance, and high mechanical strength. It is considered a high-quality nylon.

[0004] Currently, the industrial production of 1,4-butanediamine relies primarily on chemical synthesis based on petrochemicals, a process monopolized by DSM. Due to the general environmental and economic issues associated with chemical synthesis routes, the raw materials required for chemical synthesis are non-renewable petroleum resources, and the reaction process requires expensive catalysts. Furthermore, the synthesis process is highly toxic and flammable, causing adverse effects on both humans and the environment. With the increasing focus on environmental protection and resource recycling, as well as the implementation of the national "dual carbon" strategy, green biomanufacturing of 1,4-butanediamine has become an inevitable trend in future 1,4-butanediamine production.

[0005] One of the keys to green biomanufacturing of 1,4-butanediamine is to construct an engineered strain that produces high 1,4-butanediamine yields. Escherichia coli is a natural strain that synthesizes 1,4-butanediamine through both the ornithine decarboxylase pathway (ODC pathway) and the arginine decarboxylase pathway (ADC pathway). Qian et al. constructed the first chassis strain for 1,4-butanediamine synthesis, XQ26 (∆argI ∆speE ∆speG ∆puuPA), by knocking out argI in the 1,4-butanediamine ADC synthesis pathway, speE in the 1,4-butanediamine degradation pathway, speG and puuA in the 1,4-butanediamine recycling pathway, and the 1,4-butanediamine uptake transporter puuP in Escherichia coli W3110. They further knocked out the ornithine synthesis repressor gene ArgR to construct the second chassis strain for 1,4-butanediamine synthesis, XQ38. Based on this, they overexpressed genes in the 1,4-butanediamine biosynthesis pathway and constructed a series of strains that synthesized 1,4-butanediamine, effectively improving the yield of 1,4-butanediamine (Qian, ZG; Xia, XX; Lee, SY Metabolic engineering of Escherichia coli for the production of putrescine, a four carbon diamine. Biotechnol. Bioeng. 2009, 104, 651−662.). However, they did not knock out the PatA pathway gene PatA / YgjG, which is involved in the recycling of 1,4-butanediamine, because they believed that the degradation of 1,4-butanediamine by the PatA pathway was negligible. Summary of the Invention

[0006] In view of the problem that the existing technology lacks efficient 1,4-butanediamine-producing bacteria, the purpose of the present invention is to provide an Escherichia coli chassis strain that efficiently produces 1,4-butanediamine by modifying a genetically engineered host.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides a genetically engineered Escherichia coli bacterium, which does not express the following genes on the Escherichia coli genome: argR, patA, puuA, speED, speG, puuP and argF.

[0009] In a second aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the first aspect and does not express the gene ydcSTUV.

[0010] In a third aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the second aspect and does not express the gene potFGHI.

[0011] In a fourth aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the third aspect and does not express the gene plaP.

[0012] In a fifth aspect, the present invention further provides a genetically engineered bacterium for producing 1,4-butanediamine, which overexpresses the gene argJ based on the genetically engineered bacteria of the first to fourth aspects.

[0013] In a sixth aspect, the present invention provides a method for producing 1,4-butanediamine using the genetically engineered bacteria according to the first to fifth aspects above, comprising: culturing the genetically engineered bacteria in a culture medium to produce 1,4-butanediamine; and collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.

[0014] The advantages and beneficial effects of the present invention are as follows:

[0015] The present invention first constructed Escherichia coli chassis strains (PUT7, PUT8, PUT9, and PUT10) that are conducive to the efficient synthesis of 1,4-butanediamine. Compared with the starting strain, the 1,4-butanediamine yield was increased by 1363.03%, 1428.74%, 1686.88%, and 1887.52%, respectively, demonstrating significant inventive benefits. The present invention systematically investigated regulatory genes associated with 1,4-butanediamine biosynthesis, genes involved in 1,4-butanediamine degradation and recycling, and genes involved in 1,4-butanediamine transport. Experiments demonstrated the effect of not expressing the E. coli genes argF, ydcSTUV, potFGHI, and plaP on 1,4-butanediamine synthesis.

[0016] This study further demonstrates the promising application of E. coli chassis strains in constructing engineered strains for high-yield 1,4-butanediamine production, providing an excellent chassis strain for microbial fermentation-based production of 1,4-butanediamine. Overexpressing the argJ gene from Corynebacterium glutamicum in chassis strains (PUT7, PUT8, PUT9, and PUT10) in shake flasks after 24 hours increased 1,4-butanediamine production by 1633.29%, 1734.64%, 2044.44%, and 2499.26%, respectively, compared to the starting strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1: Map of the knockout target plasmid pGRB constructed in Example 1 for knocking out the target gene.

[0018] Figure 2: Electrophoresis diagram of the donor DNA fragment for verification of ArgR gene knockout in Example 1. M: DNA marker; 1, 2: donor DNA fragment (892 bp).

[0019] Figure 3: Electrophoresis of colony PCR verification after gene knockout of PUT1-PUT10 in Example 1. M is a DNA marker; ah are PCR bands of the original strain MG1655 genes argR, patA, puuA, speE, speG, puuP, ydcS, and potF; AH are colony PCR verification bands after knockout of the genes argR, patA, puuA, speE, speG, puuP, ydcS, and potF; 1 is a PCR band of the original strain MG1655 gene plap; 2 and 3 are colony PCR bands of the successfully knocked-out gene plap.

[0020] Figure 4: HPLC detection results of 1,4-butanediamine in Example 2.

[0021] Figure 5: HPLC detection results of 1,4-butanediamine in Example 3. DETAILED DESCRIPTION

[0022] The present invention is described below by specific embodiments. Unless otherwise specified, the technical means used in the present invention are methods well known to those skilled in the art. In addition, the embodiments should be understood to be illustrative rather than limiting the scope of the present invention, and the spirit and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications to the material components and dosages in these embodiments, without departing from the spirit and scope of the present invention, also fall within the scope of protection of the present invention.

[0023] In a first aspect, the present invention provides a genetically engineered Escherichia coli bacterium, which does not express the following genes on the Escherichia coli genome: argR, patA, puuA, speED, speG, puuP and argF.

[0024] In a second aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the first aspect and does not express the gene ydcSTUV.

[0025] In a third aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the second aspect and does not express the gene potFGHI.

[0026] In a fourth aspect, the present invention further provides a genetically engineered Escherichia coli bacterium, which is based on the genetically engineered bacterium in the third aspect and does not express the gene plaP.

[0027] According to the first to fourth aspects of the present invention, the method of not expressing the above-mentioned gene can adopt conventional means in the art, for example, inactivating the gene or knocking out the gene by conventional means in the art.

[0028] According to the first to fourth aspects of the present invention, the non-expression means that the amount of the gene expression product is significantly lower than the original level, for example, significantly reduced by at least 50%, 60%, 70%, 80%, 90%, 100%.

[0029] According to a preferred embodiment of the present invention, the following genes in the E. coli genome: argR, patA, puuA, speED, speG, puuP and argF are deleted. The deletion can be performed by conventional methods in the art.

[0030] According to the first to fourth aspects of the present invention, the starting strain used to construct the genetically engineered bacteria can be any Escherichia coli, for example, model strains such as E. coli MG1655, E. coli W3110, E. coli BL21, and E. coli BW25113 commonly used in the art.

[0031] According to a preferred embodiment of the present invention, the starting strain is E. coli MG1655.

[0032] The genetically engineered Escherichia coli according to the first to fourth aspects of the present invention can be used as a chassis strain for producing 1,4-butanediamine.

[0033] In a fifth aspect, the present invention further provides a genetically engineered bacterium for producing 1,4-butanediamine, which overexpresses the gene argJ based on the genetically engineered bacteria of the first to fourth aspects.

[0034] According to the fifth aspect of the present invention, the overexpression means that the amount of the gene expression product is significantly higher than the original level, for example, significantly increased by 150% or more, 200% or more, 300% or more.

[0035] According to the fifth aspect of the present invention, the overexpression of gene argJ can be achieved by introducing and / or increasing the copy number of gene argJ into the bacterial genome (for example, increasing the copy number of gene argJ through autonomously replicating plasmids such as pET22b, pET28a, pTrc99a, pSTV28, or increasing the copy number of gene argJ in the bacterial chromosome), or modifying the expression regulatory sequence of gene argJ (for example, promoter, ribosome binding site, etc.), or a combination of the above methods.

[0036] According to a preferred embodiment of the present invention, the gene argJ originates from Corynebacterium glutamicum.

[0037] In a sixth aspect, the present invention provides a method for producing 1,4-butanediamine using the genetically engineered bacteria according to the first to fifth aspects above, comprising: culturing the genetically engineered bacteria in a culture medium to produce 1,4-butanediamine; and collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.

[0038] According to the sixth aspect of the present invention, the 1,4-butanediamine includes not only free 1,4-butanediamine but also a salt or hydrate of 1,4-butanediamine.

[0039] According to the sixth aspect of the present invention, the genetically engineered bacteria can be cultured using conventional methods in the art. The culture medium used to produce 1,4-butanediamine can be a synthetic or natural culture medium, such as a typical culture medium containing a carbon source, a nitrogen source, a sulfur source, inorganic ions, and other required organic and inorganic components.

[0040] The genetically engineered bacteria can be cultured under aerobic conditions for 12 to 72 hours, or 16 to 48 hours, or 20 to 30 hours; the culture temperature can be controlled within 30 to 45° C., or 30 to 37° C.; and the pH can be adjusted between 5.0 and 8.0, or between 6.0 and 7.5, or between 6.8 and 7.2.

[0041] After cultivation, solids such as cells and cell debris can be removed from the liquid culture medium by conventional techniques (e.g., centrifugation, membrane filtration), and 1,4-butanediamine can then be recovered from the fermentation broth by any combination of conventional techniques (e.g., concentration, ion exchange chromatography, crystallization).

[0042] Other specific operational means such as molecular biology and genetic engineering involved can be implemented according to technical manuals, textbooks, or literature reports readily available to those skilled in the art, and it is not necessary to describe the operational procedures in detail here. In addition, specific starting strains were selected in the following examples, and thus specific target genes and primers thereof were selected based on the starting strains. However, this does not mean that the objectives of the present invention can be achieved only through these specific selections, and the scope of the present invention is not limited to this. The spirit and scope of the present invention are defined solely by the claims.

[0043] The present invention will be described in more detail below through specific examples.

[0044] Example 1: Construction of Escherichia coli chassis strain

[0045] In this example, Escherichia coli MG1655 (Escherichia coli str. K-12 substr. MG1655) was used as the starting strain. The following genes in E. coli were knocked out one by one using CRISPR-Cas9 technology: argR, patA, puuA, speED, speG, puuP, argF, ydcSTUV, potFGHI, and plaP, to construct an E. coli chassis strain for 1,4-butanediamine synthesis. The operation is summarized as follows: Using the Escherichia coli MG1655 genome as a template, the upstream homology arm sequence fragments and downstream homology arm sequence fragments of the target genes: argR, patA, puuA, speED, speG, puuP, argF, ydcSTUV, potFGHI, and plaP were amplified by PCR reaction; the upstream homology arm sequence fragments and downstream homology arm sequence fragments of the gene were connected by overlapping PCR to obtain recombinant DNA fragments; using the target gene sequence as a template, the CRISPR RGEN tool was used to obtain a 20 bp target sequence, and then a pair of complementary primers were synthesized and annealed to form double-stranded DNA. The double-stranded DNA was then ligated with Solution I ligase to the pGRB-BbsI plasmid vector, digested with the BbsI restriction endonuclease, to construct the knockout target plasmid pGRB-target. The recombinant DNA fragment of the corresponding gene and the knockout target plasmid pGRB-target were co-transformed into electrocompetent Escherichia coli MG1655 cells harboring the pRED-Cas9 plasmid. The electrotransformed cells were revived in 1 ml of SOC medium at 32°C for 2 hours and then plated on LB medium supplemented with spectinomycin and ampicillin and cultured at 32°C for 15 hours. Single colonies were selected by colony PCR to verify positive colonies and obtain gene knockout strains. 0.2% L-arabinose was used to eliminate the knockout target plasmid pGRB-target from the correct colonies. The pREDCas9 plasmid was further eliminated from each strain by raising the culture temperature to 42°C, resulting in E. coli chassis strains lacking the pREDCas9 plasmid and containing the corresponding target gene.

[0046] Taking the construction of the argR gene knockout strain PUT1 as an example, the steps include:

[0047] (1) Construction of argR gene knockout target plasmid pGRB-argR

[0048] Using the argR gene sequence as a template, the CRISPR RGEN tool was used to generate a 20-bp target sequence: cggagccgtagagtggcaag. A pair of complementary primers, gapA-argR-U and gapA-argR-D, were then synthesized and annealed to form double-stranded DNA. The DNA was then linked to the pGRB plasmid, which had been digested with BbsI. The DNA was then transformed into competent E. coli JM109 cells and evenly plated on solid LB medium containing 100 µg / mL ampicillin. The cells were incubated inverted overnight at 37°C. Single colonies were picked and verified by colony PCR to obtain the argR gene knockout target plasmid, pGRB-argR. The map of the constructed knockout target plasmid for target gene knockout is shown in Figure 1.

[0049] The LB solid medium containing ampicillin resistance contains: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder. Sterilize at 121°C for 20 min. After cooling to approximately 50°C, add ampicillin to a final concentration of 100 µg / mL.

[0050] (2) Obtaining a donor DNA fragment for knocking out the argR gene

[0051] The upstream homology arm primer pair argR-U1 / argR-U2 and the downstream homology arm primer pair argR-D1 / argR-D2 of the argR gene were designed. Using the Escherichia coli MG1655 genome as a template, the upstream homology arm fragment and the downstream homology arm fragment of the argR gene were amplified by PCR, respectively. The donor DNA fragment for knocking out the ArgR gene was then amplified by overlapping PCR. The verification electrophoresis pattern is shown in Figure 2.

[0052] (3) Construction of the argR gene knockout strain PUT1

[0053] Escherichia coli MG1655 harboring the pRED-Cas9 plasmid was co-transformed with the argR knockout donor DNA fragment and the target knockout plasmid pGRB-argR. After electroporation, the cells were revived in 1 ml of SOC medium at 32°C for 2 hours. The cells were then plated on LB medium supplemented with spectinomycin and ampicillin and incubated at 32°C for 15 hours. Single colonies were selected from the plates and verified by colony PCR (Figure 3, A). This screened strain, PUT1, was the argR knockout strain.

[0054] The target plasmid pGRB-argR was induced and knocked out with 0.2% L-arabinose. The argR gene knockout strain PUT1 was inoculated into 5 mL LB liquid medium, spectinomycin was added to a final concentration of 50 μg / mL, L-arabinose was added to a final concentration of 0.2%, and the culture was incubated at 32°C and 220 rpm.-1 The culture was shaken overnight on a shaker; the induced bacterial liquid was streaked on an LB plate containing spectinomycin and cultured overnight at 32°C; single colonies were then picked and inoculated one by one on an LB plate containing spectinomycin and an LB plate containing spectinomycin and ampicillin, and cultured overnight at 32°C; colonies that did not grow on the LB plate containing spectinomycin and ampicillin but grew on the LB plate containing spectinomycin were colonies in which the knockout target plasmid pGRB-argR had been eliminated.

[0055] The pREDCas9 plasmid was eliminated as follows: the argR gene knockout strain PUT1 was inoculated into 5 mL LB liquid medium and incubated at 42°C and 220 rpm. -1 Culture overnight; streak the bacterial solution after 42°C induction culture on an antibiotic-free LB plate and culture it at 37°C overnight; pick single colonies and inoculate them one by one on an LB plate containing spectinomycin and an LB plate without antibiotics, and culture them at 37°C overnight; colonies that do not grow on the LB plate containing spectinomycin but grow on the LB plate without antibiotics are strains that have eliminated the pREDCas9 plasmid.

[0056] The gene knockout transformation method is Escherichia coli electroporation.

[0057] The SOC medium is prepared as follows: For each liter of medium, add 20 g of tryptone, 5 g of yeast extract, and 0.5 g of NaCl to 950 ml of deionized water. Shake the container to completely dissolve the solutes. Add 10 ml of 250 mmol / L KCl solution (dissolve 1.86 g of KCl in 100 ml of deionized water to make a 250 mmol / L KCl solution). Adjust the pH to 7.0 with 5 mol / L NaOH, and bring the volume to 1 L with deionized water. Sterilize the medium by steam autoclaving at 15 psi for 20 minutes, cool to 60°C or below, and add 20 ml of sterile 1 mol / L glucose solution. Before use, add 5 ml of sterile 2 mol / L MgCl2 solution.

[0058] The same steps as above were used to knock out each target gene and construct E. coli chassis strains PUT1-PUT10, as shown in Table 1.

[0059] Table 1 Constructed knockout strains

[0060] Strain nomenclature Genes deleted in MG1655 PUT1 MG1655 ∆argGPUT2 MG1655 ∆argG ∆patAPUT3 MG1655 ∆argR ∆patA∆puuAPUT4 MG1655 ∆argR ∆patA∆puuA∆speEDPUT5 MG1655 ∆argR ∆patA∆puuA∆speED∆speGPUT6 MG1655 ∆argR ∆patA∆puuA∆speED∆speG∆puuPPUT7 MG1655 ∆argR ∆patA∆puuA∆speED∆speG∆puuP∆argFPUT8 MG1655 ∆argR ∆patA∆puuA∆speED∆speG∆puuP∆argF∆ydcSTUVPUT9 MG1655 ∆argR ∆patA∆puuA∆speED∆speG∆puuP∆argF∆ydcSTUV∆potFGHIPUT10MG1655 ∆argR ∆patA∆puuA∆speED∆speG∆puuP∆argF∆ydcSTUV∆potFGHI∆plaP

[0061] The primer sequences used in this example are shown in Table 2.

[0062] Table 2 Primer sequences

[0063] gRNA-speG-UtagtCGTAAAATCTTCACGCTCCAG32gRNA-speG-DaaacCTGGAGCGTGAAGATTTACG33speG-U1taatttcacacagcgcagtagc34speG-U2ctattgtgcggtcggcttcattagggggtaataacgcggc35speG-D1gccgcgttattacccccctaa tgaagccgaccgcacaatag36speG-D2attattaccgtgatgccgagacg37gRNA-plaP-1tagtCTGTCGGCTTTATGGTGGGT38gRNA-plaP-2aaacACCCACCATAAAAGCCGACAG39plaP-U1ttgaacccgtctggattggc40plaP-U2gattacggaagctcttg gtgacgataggctgtcggcacatgac41plaP-D1gtcatgtgccgacagcctatcgtcaccaagagcttccgtaatc42plaP-D2cac ctataacagtaccaagccacg43gRNA-ydcS-1tagtTTACGGCAACCTTACCAAT44gRNA-ydcS-2aaacATTGGTAAGGTGTGCC GTAA45ydcS-U1aggcggtaaaacaattaggcaa46ydcS-U2caatgggcagcagcagtaacacgttacccagtcgtattgtttatca g47ydcS-D1ctgataaacaatacgactgggtaacgtgttatgctgctgcccattg48ydcS-D2ttatgaccattgtcgccttcgc49

[0064] Example 2: Application of Escherichia coli chassis strains in the fermentation synthesis of 1,4-butanediamine

[0065] The method for producing 1,4-butanediamine by fermentation in a shake flask using the Escherichia coli gene knockout strains PUT1-PUT10 constructed in Example 1 comprises the following specific steps:

[0066] First, inoculate single colonies of PUT1-PUT10 into 5 mL LB liquid medium and incubate at 37°C and 220 rpm. -1Culture overnight to prepare seed solution. Then, transfer 500 μL of seed solution to a 250 mL flask containing 25 mL of LB medium at a 2% inoculation ratio and incubate at 37°C and 220 rpm. -1 The shake flask fermentation was carried out, and the fermentation supernatant was collected after culturing for 24 hours. The test sample was prepared, and the content of 1,4-butanediamine in the fermentation broth was determined by HPLC.

[0067] The components and preparation method of the Escherichia coli 1,4-butanediamine fermentation medium are as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride (NaCl), water as the solvent, and autoclaving at 121°C for 20 min.

[0068] The test sample preparation method: The present invention uses dansyl chloride pre-column derivatization combined with HPLC to quantitatively detect the product 1,4-butanediamine. The dansyl chloride pre-column derivatization operation is as follows:

[0069] Treatment of standard samples: Preparation of 1,4-butanediamine hydrochloride standard sample, take 2.5 mL of 800 mg·L -1 1,4-Butanediamine hydrochloride solution was used as the sample. 2.5 mL of saturated NaHCO3 solution was added and mixed evenly. The pH was adjusted to 10 with saturated NaOH solution. Then, 5 mL of the derivatization reagent dansyl chloride (5 g·L -1 , dissolved in acetone) and mixed thoroughly. Incubate the mixture in a dark water bath at 60°C for 1 hour. Add 10 mL of anhydrous ether and extract for 10 minutes. Collect the upper organic phase and allow the ether to evaporate naturally. Repeat the extraction process twice. Add 2.5 mL of acetonitrile to dissolve the derivative. Filter through a 0.22 μm filter membrane and use for HPLC analysis to generate a 1,4-butanediamine hydrochloride standard curve.

[0070] Table 3 Preparation of standard samples with different concentrations

[0071] Diaminobenzene hydrochloride standard sample concentration (mg / L) 400 200 100 50 25 1 5 100 Diaminobenzene hydrochloride sample addition amount (μL) 500 250 1 25 6 2.5 3 1.2 5 1 8.7 5 1 2.50 Acetonitrile addition amount (μL) 500 7 50 8 7 59 3 7.5 9 6 8.7 5 9 8 1.2 5 9 8 7.5 1 0 0

[0072] Treatment of fermentation broth: The fermentation broth was heated at 12000 r·min -1After centrifugation for 10 min, 500 μL of the supernatant was taken as the sample, 500 μL of saturated NaHCO3 solution was added and mixed evenly, the pH was adjusted to 10 with saturated NaOH solution, and then 1 mL of the derivatization reagent dansyl chloride (5 g·L -1 , dissolved in acetone) and mixed thoroughly. The mixture was incubated in a dark water bath at 60°C for 1 hour. Extraction was performed with 2 mL of anhydrous ether for 10 minutes, and the upper organic phase was collected. The ether was evaporated naturally, and the extraction process was repeated twice. The derivative compound was dissolved in 1 mL of acetonitrile solution, filtered through a 0.22 μm filter, and then analyzed by HPLC.

[0073] The detection column was a C18 column (InfinityLab Poroshell 120 EC-C18), the temperature was 30°C, the UV detection wavelength was 254 nm, the injection volume was 10 μL, the mobile phase A was ultrapure water, and the mobile phase B was chromatography-grade acetonitrile. Both mobile phases were filtered through a 0.22 μm filter membrane and sonicated before use. The gradient elution program was set as 0-5 min, 55%-70% B; 5-10 min, 70% B; 10-15 min, 70%-95% B; 15-20 min, 95% B; 20-25 min, 95%-55% B. The total flow rate was set to 0.7 mL min. -1 .

[0074] The HPLC test results of 1,4-butanediamine fermentation by Escherichia coli MG1655 and chassis strains PUT1-PUT10 are shown in Figure 4: the yield of 1,4-butanediamine fermentation by chassis strains PUT1-PUT10 is improved to varying degrees compared with the starting strain MG1655, and as the number of gene knockouts increases, the yield of 1,4-butanediamine synthesized by the chassis strains also gradually increases. The fermentation yields of 1,4-butanediamine by the chassis strains PUT7, PUT8, PUT9, and PUT10 reached 670.36 mg / L, 700.47 mg / L, 818.75 mg / L, and 910.68 mg / L, respectively. These increases were 1363.03%, 1428.74%, 1686.88%, and 1887.52% compared to the starting strain MG1655 (45.82 mg / L), and 25.19%, 30.81%, 52.90%, and 70.07% compared to the knockout strain PUT6 (535.47 mg / L). This indicates that the fermentation yields of 1,4-butanediamine by the chassis strains PUT7, PUT8, PUT9, and PUT10 were significantly increased.

[0075] Example 3: Construction of a 1,4-butanediamine high-yielding strain based on an Escherichia coli chassis strain

[0076] (1) Construction of MG1655 and PUT6-PUT10 overexpressing argJ engineered strains

[0077] Using the chassis strains PUT7-PUT10 constructed by the present invention, engineered strains PUT7+argJ, PUT8+argJ, PUT9+argJ and PUT10+argJ overexpressing the gene argJ, as well as control strains MG1655+argJ and PUT6+argJ overexpressing argJ using strains MG1655 and PUT6 were further constructed. By overexpressing the gene argJ from Corynebacterium glutamicum, the fermentation production of 1,4-butanediamine by the chassis strains PUT7-PUT10 was studied.

[0078] The main process of engineering strain construction is as follows:

[0079] Based on the argJ gene (Gene ID: 69621908), the primer pair argJF (GGGAATTCcatatggcagaaaaaggcattaccg) (No. 50) / argJR (GGactagtTGAATTCttaagagctgtacgcggagttg) (No. 51) was designed and amplified using the Corynebacterium glutamicum SCgG2 gene sequence as a template to obtain the argJ gene fragment. The argJ gene fragment was digested with NdeI and SpeI and ligated into the pETPgapA plasmid (constructed by replacing the fragment between BssH II and NdeI in the pET22b plasmid with the PgapA promoter) that had been digested with the same enzymes. The plasmid was then transformed into E. coli JM109, and single colonies were identified and verified by colony PCR to generate the vector pETPgapA-argJ. The pETPgapA-argJ plasmid was transformed into MG1655 and PUT6-PUT10, respectively, and the engineered bacteria PUT6+argJ, PUT7+argJ, PUT8+argJ, PUT9+argJ, PUT10+argJ and MG1655+argJ overexpressing the argJ gene were screened.

[0080] (2) Detection of 1,4-butanediamine fermentation by an engineered strain overexpressing argJ

[0081] The above-mentioned engineered bacteria PUT7+argJ, PUT8+argJ, PUT9+argJ and PUT10+argJ were used for shake flask fermentation to detect the production of 1,4-butanediamine, and MG1655+argJ and PUT6+argJ were used for control. The specific fermentation and detection methods were the same as those in Example 2.

[0082] The HPLC detection results of the engineered strains for 1,4-butanediamine synthesis are shown in Figure 5: the yields of 1,4-butanediamine synthesized by the engineered strains PUT7+argJ, PUT8+argJ, PUT9+argJ, and PUT10+argJ overexpressing the argJ gene reached 1032.35 mg / L, 1092.71 mg / L, 1277.23 mg / L, and 1548.12 mg / L, respectively, which were 1633.29%, 1734.64%, 2044.44%, and 2499.26% higher than the yield of 1,4-butanediamine synthesized by the engineered strain MG1655+argJ overexpressing the argJ gene (59.56 mg / L); and the yields of 1,4-butanediamine synthesized by the PUT6+argJ strain overexpressing the argJ gene (835.33 mg / L) were 23.59%, 30.80%, 52.91%, and 85.33% higher, respectively. Furthermore, when the chassis strains PUT7-PUT10 overexpressed the argJ gene, their 1,4-butanediamine production increased by 53.99%, 55.80%, 56.02%, and 70.00%, respectively, compared to when they did not express the argJ gene. This indicates that the E. coli chassis strains of the present invention are of great significance for constructing engineered strains that produce high 1,4-butanediamine yields, can effectively increase 1,4-butanediamine production, and provide excellent chassis strains for the production of 1,4-butanediamine by microbial fermentation.

[0083] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A genetically engineered Escherichia coli, characterized in that: The genetically engineered bacteria do not express the following genes on the Escherichia coli genome: argR, patA, puuA, speED, speG, puuP and argF.

2. The genetically engineered bacterium according to claim 1, characterized in that: The genetically engineered bacteria also do not express the gene ydcSTUV.

3. The genetically engineered bacterium according to claim 2, characterized in that: The genetically engineered bacteria also do not express the gene potFGHI.

4. The genetically engineered bacterium according to claim 3, characterized in that: The genetically engineered bacteria also do not express the gene plaP.

5. A genetically engineered bacterium for producing 1,4-butanediamine, characterized in that: Based on the genetically engineered bacteria described in claims 1-4, the gene argJ is overexpressed.

6. The genetically engineered bacteria according to claim 5, characterized in that: The starting strain of the genetically engineered bacteria is E. coli MG1655.

7. The genetically engineered bacteria according to claim 5, characterized in that: The gene argJ is the Corynebacterium glutamicum gene argJ.

8. Use of the genetically engineered bacteria according to claims 1-7 in fermentation production of 1,4-butanediamine.

9. A method for producing 1,4-butanediamine using the genetically engineered bacteria of claims 1-7, comprising: Cultivating the genetically engineered bacteria in a culture medium to produce 1,4-butanediamine; And, collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.

Images