Parabacteroides strain, culture, microbial agent and use thereof

Through the newly discovered strains of Parabacteroidetes and their metabolites, the problem of insufficient research on this bacteria was solved, and effective prevention and treatment of various diseases such as tumors were achieved.

WO2025113521A1PCT designated stage expired Publication Date: 2025-06-05MOON (GUANGZHOU) BIOTECH CO LTD

Patent Information

Application Number
PCT/CN2024/135050
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-11-27
Filing Date
2024-11-27
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

There are few studies on parabacteroides bacteria in the prior art, especially their potential in tumor treatment has not been fully explored.

Method used

A new strain of Parabacteroidetes and its cultures and bacterial agents are proposed. Through high yields of short-chain fatty acids and acetic acid, it has a good effect on preventing or treating tumors, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases.

Benefits of technology

This strain or its product has shown significant effects in tumor treatment and has the prevention and treatment potential of a variety of diseases by regulating the immune system and inhibiting tumor cell growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024135050_05062025_PF_FP_ABST
    Figure CN2024135050_05062025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a Parabacteroides strain, a culture, a microbial agent and the use thereof. Specifically provided is a Parabacteroides strain, which can be a strain having a deposit number of GDMCC No: 62664 or 62665, or a strain having at least 96.74% identity to the 16S rRNA of the strain, and / or a strain having at least 87% average nucleotide identity to the genome of the strain. The strain or a product based on the strain has good effects in terms of preventing or treating tumors or cancers, metabolic diseases, inflammation or autoimmune diseases, infectious diseases and central nervous system diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Parabacteroides strains, cultures, bacterial agents and their applications Technical Field

[0001] The present application relates to the technical field of microbiology, and in particular to Parabacteroides strains, cultures, bacterial agents and applications thereof. Background Art

[0002] The intestine is the largest microecological environment in the human body. It participates in many important physiological processes such as nutrient absorption, energy metabolism, tissue and organ development, immune defense and endocrine regulation, and is closely related to human health. In the past decade or so, intestinal microecology has made great strides, and human understanding of it has continued to deepen. There are a large number of symbiotic microorganisms in the human intestine, and the total amount of genetic information they carry is 50 to 100 times that of the human genome. This is the "gut microbiome", also known as the "second genome" of humans. The intestinal microbiome is the largest and most direct external environment of the human body, and plays an indispensable role in maintaining human health.

[0003] Intestinal microorganisms include bacteria, chlamydia, rickettsia, mycoplasma, spirochetes, etc. Intestinal bacteria account for more than 95% of intestinal microorganisms, so intestinal microorganisms mainly refer to intestinal flora. With the continuous deepening of research, the impact and role of intestinal flora on intestinal and extraintestinal diseases are becoming more and more clear. The intestinal flora is more like an organ with metabolic, immune and endocrine functions, which can affect the human digestive system, circulatory system and nervous system, and is closely related to the occurrence of various human chronic diseases (diabetes, hypertension, cardiovascular disease and brain disease, etc.) and tumors. Studying the relationship between intestinal flora and human health and disease is not only an important scientific research, but also has important significance and value in clinical diagnosis, treatment, and even transformation.

[0004] The two largest taxa in the gut microbiota of most adults are the Gram-positive Firmicutes and the Gram-negative Bacteroidetes. Others include smaller groups of Proteobacteria, Actinomycetes, Fusobacteria, and Methanogens. Some Bacteroidetes bacteria can benefit the host by preventing infection with potential pathogens, but some also become opportunistic pathogens. Currently, the most extensively studied Bacteroidetes genera are Bacteroides, Prevotella, and Porphyromonas, while less research has been conducted on Parabacteroides bacteria. Existing studies have shown that Parabacteroides goldsteinii and Parabacteroides distasonis have certain anti-inflammatory effects, and Parabacteroides distasonis is a potential probiotic for inhibiting colon cancer. Therefore, further exploration of intestinal Parabacteroides bacteria is necessary to identify strains with therapeutic potential. Summary of the Invention

[0005] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes a new Parabacteroides strain, culture, bacterial agent and application thereof, which has a good therapeutic effect on tumors.

[0006] In a first aspect of the present application, a Parabacteroides strain is provided, wherein the Parabacteroides strain is any one of the following A1) to A5):

[0007] A1) strains whose 16S rRNA is at least 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identical to the sequence set forth in SEQ ID NO: 1;

[0008] A2) strains with a deposit number of GDMCC No: 62664 or GDMCC No: 62665;

[0009] A3) strains having at least 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity to the 16S rRNA of the strain described in A2);

[0010] A4) a strain having 16S rRNA that is at least 97%, 98%, 98.65%, 99%, 99.5%, 99.9%, or 100% identical to the sequence shown in SEQ ID NO: 2; preferably, the strain is selected from the species Parabacteroides hominis;

[0011] A5) a strain whose genome has an average nucleotide identity of at least 87%, 88%, 88.81%, 88.89%, 89%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% with the genome of any one of the strains A1) to A4); and / or a strain whose genome has an alignment score of at least 70%, 73.54%, 74.55%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% with the genome of any one of the strains A1) to A4).

[0012] In some embodiments, A2) the 16S rRNA sequence of the strain with a deposit number of GDMCC No: 62664 is shown as SEQ ID NO: 1, and the 16S rRNA sequence of the strain with a deposit number of GDMCC No: 62665 is shown as SEQ ID NO: 2.

[0013] In some embodiments, the strain is derived from the human intestine.

[0014] In some embodiments, the strain is capable of high production of short-chain fatty acids.

[0015] In some embodiments, the strain is capable of high production of acetic acid and / or propionic acid.

[0016] The strains according to the embodiments of the present application have at least the following beneficial effects:

[0017] The present invention discloses a novel strain of the genus Parabacteroides, which or a product based on the strain has a good effect in preventing or treating tumors or cancer, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases.

[0018] In a second aspect of the present application, a culture of the aforementioned strain is provided.

[0019] In some embodiments, the culture comprises any one of the following B1) to B5):

[0020] B1) fermentation medium of the strain; B2) supernatant of fermentation medium of the strain; B3) concentrated product of B1) or B2); B4) extract of B1) or B2); B5) dried product of any one of B1) to B4);

[0021] In some embodiments, the fermentation medium is a liquid medium.

[0022] In some embodiments, the culture is obtained using liquid culture medium under anaerobic culture conditions.

[0023] In some embodiments, the fermentation medium is MM01 liquid medium, and / or the culture temperature is 35-42° C., and / or the culture time is 24-72 hours, and / or the pH of the culture medium is 6-10.

[0024] In a third aspect of the present application, a bacterial agent is further provided, comprising the aforementioned Parabacteroides strain, or a metabolite thereof, or the aforementioned culture.

[0025] In a fourth aspect, the present application further provides a composition, wherein the composition or the raw materials of the composition include the aforementioned Parabacteroides strain, or its metabolites, or the aforementioned culture, or the aforementioned bacterial agent.

[0026] In some embodiments, the composition further comprises at least one of an excipient, a diluent, and a carrier.

[0027] In some embodiments, the composition further comprises an excipient.

[0028] In some embodiments, the auxiliary material further includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring.

[0029] In some embodiments, the composition is at least one of a medicine, a nutritional supplement, a food, a food additive, a feed, and a feed additive.

[0030] In some embodiments, the composition is a solid preparation or a liquid preparation.

[0031] In some embodiments, the dosage form of the composition is any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral solutions, ointments, emulsions, and irrigation solutions.

[0032] In some embodiments, the composition further comprises product instructions.

[0033] In a fifth aspect of the present application, a pharmaceutical composition is provided, comprising the following C1) and C2):

[0034] C1) the aforementioned strain, or a metabolite of the aforementioned strain, or the aforementioned culture, or the aforementioned bacterial agent;

[0035] C2) Combination drugs.

[0036] In some embodiments, the combination drug of C2) includes at least one of a tumor drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug.

[0037] In some embodiments, the tumor drug includes at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug.

[0038] In some embodiments, the chemotherapy drug comprises at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, and epirubicin.

[0039] In some embodiments, the photosensitizer comprises at least one of boron dipyrrole, chlorin, and rose bengal.

[0040] In some embodiments, the photothermal agent comprises at least one of noble metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials.

[0041] In some embodiments, the immunotherapy drug includes at least one of an immune cell therapy drug and an immune checkpoint inhibitor.

[0042] In some embodiments, the immune cell therapy drug includes at least one of a T cell therapy drug, a tumor infiltrating lymphocyte therapy drug, and a NK cell therapy drug.

[0043] In some embodiments, the immune checkpoint inhibitor comprises an inhibitor targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA.

[0044] In some embodiments, the pharmaceutical composition comprises 1×10 3 CFU / g~1×10 13 CFU / g or 1×10 3 CFU / mL~1×10 13 CFU / mL of Parabacteroides strains.

[0045] In some embodiments, each gram or each mL of the pharmaceutical composition comprises at least 1×103 , 2×10 3 , 5×10 3 , 1×10 4 , 2×10 4 , 5×10 4 , 1×10 5 , 2×10 5 , 5×10 5 , 1×10 6 , 2×10 6 , 5×10 6 , 1×10 7 , 2×10 7 , 5×10 7 , 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , 1×10 10 , 2×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 5×10 11 , 1×10 12 , 2×10 12 , 5×10 12 , 1×10 13 colony-forming units (CFU) of the Parabacteroides spp.

[0046] In some embodiments, the Parabacteroides strain in the pharmaceutical composition is a live bacterium, an attenuated bacterium, a killed bacterium, a freeze-dried bacterium, or an irradiated bacterium.

[0047] In some embodiments, the pharmaceutical composition or the raw materials of the pharmaceutical composition include about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, %, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% of C1).

[0048] In some embodiments, the pharmaceutical composition or the raw materials of the pharmaceutical composition include C1) in an amount of 1-80%, 2-70%, 5-60%, 10-50%, 20-40%, or 40-60% by mass.

[0049] In some embodiments, the pharmaceutical composition further comprises at least one of an excipient, a diluent, and a carrier.

[0050] In some embodiments, the pharmaceutical composition further comprises an excipient.

[0051] In some embodiments, the auxiliary material further includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring.

[0052] In some embodiments, the pharmaceutical composition is in an infant-suitable dosage form, a child-suitable dosage form, or an adult-suitable dosage form.

[0053] In some embodiments, the pharmaceutical composition is in a parenteral or enteral dosage form.

[0054] In some embodiments, the pharmaceutical composition is an oral dosage or an injectable dosage.

[0055] In some embodiments, the dosage form of the pharmaceutical composition is any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral solutions, ointments, emulsions, and irrigation solutions.

[0056] In some embodiments, the strain is capable of at least partially proliferating in the intestinal tract of a subject.

[0057] In some embodiments, the pharmaceutical composition further comprises product instructions.

[0058] The sixth aspect of the present application provides a pharmaceutical combination product comprising independently:

[0059] A first product, comprising the aforementioned Parabacteroides strain, or a metabolite thereof, or the aforementioned culture, or the aforementioned bacterial agent;

[0060] The second product, the second product includes combination drugs.

[0061] In some embodiments, the combination drug includes at least one of a tumor drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug.

[0062] In some embodiments, the tumor drug includes at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug.

[0063] In some embodiments, the chemotherapy drug comprises at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, and epirubicin.

[0064] In some embodiments, the photosensitizer comprises at least one of boron dipyrrole, chlorin, and rose bengal.

[0065] In some embodiments, the photothermal agent comprises at least one of noble metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials.

[0066] In some embodiments, the immunotherapy drug includes at least one of an immune cell therapy drug and an immune checkpoint inhibitor.

[0067] In some embodiments, the immune cell therapy drug includes at least one of a T cell therapy drug, a tumor infiltrating lymphocyte therapy drug, and a NK cell therapy drug.

[0068] In some embodiments, the immune checkpoint inhibitor comprises an inhibitor targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA.

[0069] In some embodiments, the first product comprises 1×10 3 CFU / g~1×10 13CFU / g or 1×10 3 CFU / mL~1×10 13 CFU / mL of Parabacteroides strains.

[0070] In some embodiments, the first product comprises at least 1×10 3 , 2×10 3 , 5×10 3 , 1×10 4 , 2×10 4 , 5×10 4 , 1×10 5 , 2×10 5 , 5×10 5 , 1×10 6 , 2×10 6 , 5×10 6 , 1×10 7 , 2×10 7 , 5×10 7 , 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , 1×10 10 , 2×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 5×10 11 , 1×10 12 , 2×10 12 , 5×10 12 , 1×10 13 colony-forming units (CFU) of the Parabacteroides spp.

[0071] In some embodiments, the Parabacteroides strain in the first product is a live bacterium, an attenuated bacterium, a killed bacterium, a freeze-dried bacterium, or an irradiated bacterium.

[0072] In some embodiments, the first product and / or the second product further comprises at least one of an excipient, a diluent, and a carrier.

[0073] In some embodiments, the first product and the second product further independently include at least one auxiliary material.

[0074] In some embodiments, the auxiliary material further includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring.

[0075] In some embodiments, the pharmaceutical combination product is in an infant-appropriate dosage form, a pediatric-appropriate dosage form, or an adult-appropriate dosage form.

[0076] In some embodiments, the first product and the second product are each independently a dosage form for parenteral administration or a dosage form for non-gastrointestinal administration.

[0077] In some embodiments, the first product and the second product are each independently an oral dosage form or an injectable dosage form.

[0078] In some embodiments, the dosage forms of the first product and the second product are independently any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral liquids, ointments, emulsions, and irrigation solutions.

[0079] In some embodiments, the Parabacteroides strain is capable of at least partially proliferating in the intestinal tract of a subject.

[0080] In some embodiments, the pharmaceutical combination product further comprises product instructions.

[0081] In a seventh aspect, the present application provides use of the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product in the preparation of a drug for preventing and / or treating a disease.

[0082] In some embodiments, the disease comprises at least one of a tumor or cancer, a metabolic disease, an inflammatory or autoimmune disease, an infectious disease, and a central nervous system disease.

[0083] In some embodiments, the tumor or cancer comprises at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor.

[0084] In some embodiments, the solid tumor comprises at least one of head and neck cancer, upper gastrointestinal cancer, lower gastrointestinal cancer, hepatobiliary system cancer, neuroendocrine tumor, thoracic cancer, bone tumor, soft tissue sarcoma, skin cancer, breast cancer, female reproductive system cancer, male reproductive system cancer, urinary system cancer, eye cancer, central nervous system cancer, and endocrine system cancer.

[0085] In some embodiments, the hematopoietic neoplasm comprises a neoplasm of at least one of the blood, lymphoid, and bone marrow.

[0086] In some embodiments, the tumor or cancer comprises oral cancer, salivary gland cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, nasal cavity cancer, paranasal sinus cancer, laryngeal cancer, esophageal cancer, gastric cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, anal canal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, hilar bile duct cancer, distal bile duct cancer, hepatopancreatic ampullary cancer, pancreatic cancer, gastric neuroendocrine tumor, duodenal and ampullary neuroendocrine tumor, jejunal-ileal neuroendocrine tumor, appendiceal neuroendocrine tumor, colorectal neuroendocrine tumor, pancreatic neuroendocrine tumor, thymic cancer, lung cancer, malignant pleural mesothelioma, angiosarcoma, desmoid tumor, Ewing sarcoma, fibrosarcoma, gastrointestinal stromal tumor, Kaposi sarcoma, leiomyosarcoma, liposarcoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, rhabdomyosarcoma at least one of: sarcoma, synovial sarcoma, undifferentiated pleomorphic sarcoma, cutaneous fibrosarcoma protuberans, Merkel cell carcinoma, malignant melanoma of the skin, vulvar cancer, vaginal cancer, cervical cancer, uterine corpus cancer, uterine carcinosarcoma, uterine corpus sarcoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gestational trophoblastic tumor, penile cancer, prostate cancer, testicular cancer, kidney cancer, renal pelvis cancer, ureter cancer, bladder cancer, urethra cancer, eyelid cancer, conjunctival cancer, conjunctival melanoma, uveal melanoma, retinoblastoma, lacrimal gland cancer, orbital sarcoma, lymphoma of the ocular adnexa, brain cancer, spinal cord tumor, differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, parathyroid cancer, adrenal cortical cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, cutaneous lymphoma, plasma cell myeloma, and leukemia.

[0087] In some embodiments, the tumor or cancer comprises a tumor or cancer caused by bacteria or a virus.

[0088] In some embodiments, the bacteria or virus comprises at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori, and Fusobacterium nucleatum.

[0089] In some embodiments, the metabolic disease includes a disease involving abnormal metabolism of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia, and metal ions.

[0090] In some embodiments, the inflammatory or autoimmune disease comprises at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behçet's disease, asthma, atopic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis, and Sjögren's syndrome.

[0091] In some embodiments, the infectious disease includes a disease caused by at least one of bacteria, viruses, and fungi.

[0092] In some embodiments, the central nervous system disease comprises at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder, and depression.

[0093] In some embodiments, the prevention and / or treatment of tumors includes at least one of the following (a) to (l): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of acetic acid or acetate, propionic acid or propionate, butyric acid or butyrate, valeric acid or valerate in SCFA; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue.

[0094] In an eighth aspect of the present application, there is provided use of the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, and the aforementioned pharmaceutical combination product in preventing and / or treating diseases.

[0095] In some embodiments, the disease comprises at least one of a tumor or cancer, a metabolic disease, an inflammatory or autoimmune disease, an infectious disease, and a central nervous system disease.

[0096] In some embodiments, the tumor or cancer comprises at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor.

[0097] In some embodiments, the solid tumor comprises at least one of head and neck cancer, upper gastrointestinal cancer, lower gastrointestinal cancer, hepatobiliary system cancer, neuroendocrine tumor, thoracic cancer, bone tumor, soft tissue sarcoma, skin cancer, breast cancer, female reproductive system cancer, male reproductive system cancer, urinary system cancer, eye cancer, central nervous system cancer, and endocrine system cancer.

[0098] In some embodiments, the hematopoietic neoplasm comprises a neoplasm of at least one of the blood, lymphoid, and bone marrow.

[0099] In some embodiments, the tumor or cancer comprises oral cancer, salivary gland cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, nasal cavity cancer, paranasal sinus cancer, laryngeal cancer, esophageal cancer, gastric cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, anal canal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, hilar bile duct cancer, distal bile duct cancer, hepatopancreatic ampullary cancer, pancreatic cancer, gastric neuroendocrine tumor, duodenal and ampullary neuroendocrine tumor, jejunal-ileal neuroendocrine tumor, appendiceal neuroendocrine tumor, colorectal neuroendocrine tumor, pancreatic neuroendocrine tumor, thymic cancer, lung cancer, malignant pleural mesothelioma, angiosarcoma, desmoid tumor, Ewing sarcoma, fibrosarcoma, gastrointestinal stromal tumor, Kaposi sarcoma, leiomyosarcoma, liposarcoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, rhabdomyosarcoma at least one of: sarcoma, synovial sarcoma, undifferentiated pleomorphic sarcoma, cutaneous fibrosarcoma protuberans, Merkel cell carcinoma, malignant melanoma of the skin, vulvar cancer, vaginal cancer, cervical cancer, uterine corpus cancer, uterine carcinosarcoma, uterine corpus sarcoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gestational trophoblastic tumor, penile cancer, prostate cancer, testicular cancer, kidney cancer, renal pelvis cancer, ureter cancer, bladder cancer, urethra cancer, eyelid cancer, conjunctival cancer, conjunctival melanoma, uveal melanoma, retinoblastoma, lacrimal gland cancer, orbital sarcoma, lymphoma of the ocular adnexa, brain cancer, spinal cord tumor, differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, parathyroid cancer, adrenal cortical cancer, Hodgkin lymphoma, non-Hodgkin lymphoma, cutaneous lymphoma, plasma cell myeloma, and leukemia.

[0100] In some embodiments, the tumor or cancer comprises a tumor or cancer caused by bacteria or a virus.

[0101] In some embodiments, the bacteria or virus comprises at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori, and Fusobacterium nucleatum.

[0102] In some embodiments, the metabolic disease includes a disease involving abnormal metabolism of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia, and metal ions.

[0103] In some embodiments, the inflammatory or autoimmune disease comprises at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behçet's disease, asthma, atopic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis, and Sjögren's syndrome.

[0104] In some embodiments, the infectious disease includes a disease caused by at least one of bacteria, viruses, and fungi.

[0105] In some embodiments, the central nervous system disease comprises at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder, and depression.

[0106] In some embodiments, the prevention and / or treatment of tumors comprises achieving at least one of the following (a) to (k): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of acetate or acetate, propionate or propionate, butyrate or butyrate, valeric acid or valeric acid in SCFA; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue, (m) improving the action of cytotoxic tumor immune cells; (n) local tumor immunotherapy; (o) relieving tumor microenvironment immunosuppression.

[0107] In a ninth aspect of the present application, a method for treating a disease is provided, comprising administering to a subject an effective dose of the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product;

[0108] In some embodiments, the disease comprises at least one of a tumor or cancer, a metabolic disease, an inflammatory or autoimmune disease, an infectious disease, and a central nervous system disease.

[0109] In some embodiments, the tumor or cancer comprises at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor.

[0110] In some embodiments, the composition further comprises at least one probiotic selected from at least one of the following: Bifidobacterium spp., Lactobacillus spp., Lactococcus spp., Lacticaseibacillus spp., Pediococcus acidilactici, Akkermansia, Pediococcus pentosaceus and / or Saccharomyces boulardii;

[0111] Preferably, the probiotic is selected from the group consisting of: Bifidobacterium adolescentis, Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii subsp. Bulgaricus, Lactobacillus delbrueckii subsp. subsp. Lactis), Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus kefiranofaciens subsp.Kefiranofaciens), Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosus, Limosilactobacillus fermentum, Limosilactobacillus reuteri, Lactiplantibacillus plantarum, Ligilactobacillus salivarius, Latilactobacillus curvatus, Latilactobacillus sakei, Streptococcus salivarius subsp. thermophilus, Lactococcus lactis subsp. lactis, Lactococcus lactis subsp. lactis (diacetyl type) biovardiacetylactis), Lactococcus cremoris, Akkermansia muciniphila;.

[0112] In some embodiments, the bacteria or virus comprises at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori, and Fusobacterium nucleatum.

[0113] In some embodiments, the metabolic disease includes a disease involving abnormal metabolism of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia, and metal ions.

[0114] In some embodiments, the inflammatory or autoimmune disease comprises at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behçet's disease, asthma, atopic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis, and Sjögren's syndrome.

[0115] In some embodiments, the infectious disease includes a disease caused by at least one of bacteria, viruses, and fungi.

[0116] In some embodiments, the central nervous system disease comprises at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder, and depression.

[0117] In some embodiments, the prevention and / or treatment of tumors includes achieving at least one of the following (a) to (k): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of acetic acid or acetate, propionic acid or propionate, butyric acid or butyrate, valeric acid or valerate in SCFA; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue.

[0118] In some embodiments, the Parabacteroides strain, culture, agent, composition, pharmaceutical composition, or pharmaceutical combination is administered at least once daily.

[0119] In some embodiments, when the administration frequency is twice a day or more, the same dose is administered each time.

[0120] In some embodiments, when the administration frequency is twice or more per day, each administration is at a different dose.

[0121] In some embodiments, the administration route includes at least one of oral administration, sublingual administration, nasal administration, rectal administration, inhalation administration, transdermal administration, intraperitoneal injection, subcutaneous injection, intradermal injection, intramuscular injection, and intravenous injection.

[0122] In a tenth aspect of the present application, a method for preparing the aforementioned culture is provided, the method comprising the following steps:

[0123] The aforementioned Parabacteroides strain is inoculated into a fermentation medium to obtain a culture.

[0124] In some embodiments, the method further comprises centrifuging the culture to collect the fermentation medium supernatant.

[0125] In some embodiments, the method further comprises concentrating the fermentation medium or the fermentation medium supernatant by at least one of evaporation, freeze-drying, dialysis, extraction, and membrane separation to obtain a concentrated product.

[0126] In some embodiments, the method further comprises subjecting the fermentation medium or the fermentation medium supernatant to at least one of extraction and solvent extraction to obtain an extract.

[0127] In some embodiments, the method further comprises drying any one of the fermentation medium, the fermentation medium supernatant, the concentrated product, and the extract to obtain a dried product.

[0128] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become obvious from the description below, or will be learned through practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0129] A and B in Figure 1 are the colony morphologies of strains MNH 26621 and MNH 20645, respectively, after 48 h of culture on anaerobic blood plates.

[0130] Figure 2 A and B show the microscopic morphologies of strains MNH 26621 and MNH 20645, respectively, with a scale bar of 5 μm.

[0131] A and B in FIG3 are Gram-stained microscopic morphologies of strains MNH 26621 and MNH 20645, respectively.

[0132] Figure 4 A and B are the results of the tolerance of strains MNH 26621 and MNH 20645 to different pH values, respectively.

[0133] Figure 5 A and B are the results of the tolerance of strains MNH 26621 and MNH 20645 to different concentrations of NaCl, respectively.

[0134] Figure 6 A and B are graphs showing the tolerance of strains MNH 26621 and MNH 20645 to different concentrations of bile salts, respectively.

[0135] Figures 7, 8, and 9 are phylogenetic trees constructed based on 16S rRNA of strain MNH 26621, strain MNH 20645, and other related strains.

[0136] FIG10 shows the results of the regulation of macrophage immune activity by strain MNH 26621.

[0137] FIG11 shows the results of the regulation of macrophage immune activity by strain MNH 20645.

[0138] FIG12 shows the results of the regulation of the immune activity of Primary PBMC by strain MNH 26621.

[0139] Figure 13 A and B show the effects of strain MNH 26621 and strain MNH 20645 on IFNβ expression, respectively.

[0140] Figures A to F in Figure 14 show the weight change curves of the experimental and control groups of mice treated with strain MNH 20645 in the example, the tumor volume change curves of the experimental and control groups, the endpoint tumor volume of the experimental and control groups, the endpoint tumor growth inhibition rate (TGI) of the experimental and control groups, the response rate of the control group, and the response rate of the experimental group, respectively. The response rate is presented as tumor volume, with the dotted line representing the tumor volume at a 40% tumor inhibition rate relative to that of the control group. A tumor volume greater than the tumor volume at a 40% tumor inhibition rate of the control group at the endpoint indicates a non-response, while a tumor volume less than or equal to the tumor volume at a 40% tumor inhibition rate of the control group indicates a response.

[0141] Figures A to C in Figure 15 show the tumor volume change curves for the experimental and control groups of mice treated with strain MNH 26621 in the examples, as well as the response rates of the control and experimental groups, respectively. The response rate is presented as tumor volume, with the dotted line representing the tumor volume at 40% tumor inhibition relative to the control group. A mouse with a tumor volume greater than the control group's tumor volume at 40% tumor inhibition at the endpoint of the study represents a non-response, while a mouse with a tumor volume less than or equal to the control group's tumor volume at 40% tumor inhibition represents a response.

[0142] Figures A to C in Figure 16 show the tumor volume change curves for the experimental and control groups of mice treated with strain MNH 20645 in the examples, and the response rates of the control and experimental groups, respectively. The response rate is presented as tumor volume, with the dotted line representing the tumor volume at 40% tumor inhibition relative to the control group. A mouse with a tumor volume greater than the control group's tumor volume at 40% tumor inhibition at the endpoint of the experiment represents a non-response, while a mouse with a tumor volume less than or equal to the control group's tumor volume at 40% tumor inhibition represents a response.

[0143] A to H in Figure 17 are the tumor change curve of the A / B / C group using the strain MNH20645 combined with Gemcitabine in the embodiment, the endpoint tumor volume size of the A / B / C group, the endpoint tumor weight of the A / B / C group, the endpoint tumor growth inhibition rate TGI of the A / B / C group, the mouse weight change curve of the A / B / C group, the response rate of Group A, the response rate of Group B and the response rate of Group G, respectively.

[0144] FIG18 shows the results of immunoassay analysis of mice with lung cancer tumors activated by strain MNH 26621 in the example.

[0145] FIG19 is the correlation analysis result of the relevant cells in the tumor tissue and the tumor endpoint volume in the embodiment.

[0146] FIG20 is the correlation analysis result of M2 macrophages, killer cells CD8+IFNγ+ cells and tumor weight in tumor tissues in the embodiment.

[0147] FIG21 is a flow cytometric analysis of the surface molecules MHCII, CD80 and CD86 of DC cells in the MNH 26621 group in the Example.

[0148] FIG22 is a flow cytometric analysis of MHCII and CD86 on the surface molecules of DC cells in the MNH20645 group in the Example.

[0149] FIG. 23 shows the expression of M2 markers CD206 and Arg1 in RAW264.7 cells detected by QPCR in the MNH 26621 group in the Example.

[0150] FIG. 24 shows the expression of M2 markers CD206 and Arg1 in RAW264.7 cells detected by QPCR in the MNH20645 group in the Example.

[0151] In the above result figures, if significance analysis was involved, unpaired t test, two-way ANOVA, Student's t test, etc. were used for significance analysis: no significant difference (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001. DETAILED DESCRIPTION

[0152] The following will clearly and completely describe the concept and technical effects of this application in conjunction with the embodiments to fully understand the purpose, features and effects of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of this application.

[0153] The embodiments of the present application are described in detail below. The described embodiments are exemplary and are only used to explain the present application, and should not be understood as limiting the present application.

[0154] In the description of this application, "several" means more than one, "plurality" means more than two, "greater than," "less than," and "exceed" are understood to exclude the number itself, while "above," "below," and "within" are understood to include the number itself. "About" means within the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1%, etc. of the number itself. The terms "first" and "second" are used solely to distinguish technical features and are not to be construed as indicating or implying relative importance, or as implicitly indicating the quantity of the indicated technical features, or as implicitly indicating the order of the indicated technical features.

[0155] In the description of this application, reference to the terms "one embodiment," "some embodiments," "illustrative embodiments," "examples," "specific examples," or "some examples" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of this application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples.

[0156] The first aspect of the embodiments of the present application relates to Parabacteroides strains, including two strains named MNH 26621 and MNH 20645. Among them, strain MNH 26621 is deposited in the Guangdong Microbial Culture Collection Center (GDMCC), with the deposit name being Parabacteroides sp. MNH 26621, the deposit number being GDMCC No: 62664, the deposit date being July 28, 2022, and the deposit address being the Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, and the proposed taxonomic name being Parabacteroides sp. The strain MNH 20645 was deposited in the Guangdong Provincial Microbial Culture Collection Center with the deposited name Parabacteroides sp. MNH 20645, the deposited number GDMCC No: 62665, the deposited date July 28, 2022, and the deposited address is the 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Institute of Microbiology, Guangdong Academy of Sciences. The proposed taxonomic name is Parabacteroides sp.

[0157] Among them, the term "strain" refers to a member of a bacterial species with genetic characteristics that make it distinguishable from closely related members of the same bacterial species. The genetic characteristic can be the total or partial absence of at least one gene, the total or partial absence of at least one regulatory region (e.g., promoter, terminator, riboswitch, ribosome binding site), the presence of at least one recombinant gene, the presence of at least one mutant gene, the presence of at least one exogenous gene (a gene from another species), the presence of at least one non-natural plasmid, the presence of at least one antibiotic resistance box, or a combination thereof. The genetic characteristics between different strains can be identified by PCR amplification, optionally followed by DNA sequencing of the genomic region of interest or the entire genome. In the case where a strain (compared to another strain of the same species) gains or loses antibiotic resistance or gains or loses biosynthetic ability (e.g., auxotrophic strains), strains or nutrients / metabolites can be distinguished by selection or counter-selection using antibiotics.

[0158] It is known in the art that bacterial species can be classified and identified by traditional classification methods and molecular biology methods. Traditional classification methods include, for example, cell morphology observation, Gram staining, flagellar staining, various metabolic experiments, etc. Molecular biological methods include ribosomal RNA sequence determination, determination methods based on whole genome sequencing, etc. The strains MNH 26621 and strain MNH 20645 involved in the embodiments of the present application are identified as a new strain under the genus Parabacteroides based on the following traditional taxonomic characteristics and molecular biological methods, wherein the taxonomic characteristics include bacterial characteristics and colony characteristics, the bacteria have no spores, no flagella, no movement, rod-shaped or short rod-shaped, with a diameter of about (3-5) μm × (8-20) μm, and Gram staining is negative; under anaerobic culture conditions (for example, anaerobic culture at 37°C for 48 hours), visible colonies are formed, the colonies are round, the edges are regular and smooth, opaque, and no secretions are formed around the colonies.

[0159] In some embodiments, the above-mentioned strains are derived from the intestine, for example, any one of the large intestine, small intestine, rectum, etc. of mammals, such as monotremes, marsupials, insectivoras, shrews, scaphoids, dermoptera, chiroptera, primates, edentata, phlonotida, lagomorpha, rodents, carnivores, sirenians, hyraxes, tubulodonta, odd-toed ungulates, even-toed ungulates, cetaceans, etc. Common mammals include rodents (such as mice, rats, hamsters, guinea pigs), lagomorphs (such as rabbits), odd-toed ungulates (such as horses, donkeys), even-toed ungulates (such as sheep, goats, camels, cattle, pigs), primates (such as monkeys, gorillas, chimpanzees, humans), carnivores (such as dogs, cats), etc. It is understood that strains derived from the intestine can be isolated and extracted from feces.

[0160] In some embodiments, the strains or strain variants described above have the characteristic of high production of short-chain fatty acids. Short-chain fatty acids generally include saturated fatty acids with a chain length of 1 to 6 carbon atoms, such as formic acid, acetic acid, propionic acid, n-butyric acid, isobutyric acid, n-valeric acid, isovaleric acid, pivalic acid, and hexanoic acid. High production refers to a production of 100 μg / g or more, as measured by a short-chain fatty acid (SCFA) assay.

[0161] In some embodiments, the strain or strain variant has the characteristic of high acetic acid and / or propionic acid production. High acetic acid production refers to an acetic acid production of ≥100 μg / g in a short-chain fatty acid (SCFA) assay, and high acetic acid production refers to a propionic acid production of ≥100 μg / g in a short-chain fatty acid (SCFA) assay. For example, the above-mentioned strain or strain variant is inoculated into TSB liquid culture medium and anaerobically cultured at 37°C for 48 hours. After the bacteria are collected by centrifugation, the acetic acid production is detected to be ≥100 μg / g, ≥200 μg / g, ≥300 μg / g, ≥400 μg / g, ≥500 μg / g, ≥600 μg / g, ≥700 μg / g, ≥800 μg / g, ≥900 μg / g, ≥1000 μg / g, and ≥1100 μg / g; the propionic acid production is detected to be ≥100 μg / g, ≥200 μg / g, ≥300 μg / g, ≥400 μg / g, ≥500 μg / g, ≥600 μg / g, ≥700 μg / g, ≥800 μg / g, ≥900 μg / g, ≥1000 μg / g, and ≥1100 μg / g.

[0162] Sequencing results for the 16S rRNA of strain MNH 26621 showed the sequence shown in SEQ ID NO: 1, and sequencing results for the 16S rRNA of strain MNH 20645 showed the sequence shown in SEQ ID NO: 2. 16S rRNA is a type of ribosomal RNA in prokaryotes. The 16S rRNA gene consists of variable and conserved regions. The conserved regions are common to all bacteria, while the variable regions vary to varying degrees among different bacteria. By comparing bacterial 16S rRNA gene sequences and basing their evolutionary distances on the number of sequence differences, a phylogenetic tree can be constructed.

[0163] When the identity between the 16S rRNA gene sequences of two strains is less than 98.65%, they can be judged to belong to different species (see, Kim, M., Oh, H.-S., Park, S.-C., & Chun, J. (2014). Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, 64(Pt 2), 346-351, and Liu, C., Du, M.-X., Abuduaini, R., Yu, H.-Y., Li, D.-H., Wang, Y.-J., Liu, S.-J. (2021). Enlightening the taxonomy darkness of human gut microbiomes with a cultured biobank. Microbiome, 9(1), page P23; Pablo Yarza, Uniting the classification of cultured and uncultured bacteria and archaea using 16S rRNA gene sequences, Microbiology, volume 12, pages P635-P645, 2014).

[0164] When the identity between the 16S rRNA gene sequences of two strains is less than 95%, they can be judged to belong to different genera ("Agenus definition for Bacteria and Archaea based on genome relatedness and taxonomic affiliation", RA Barco, bioRxiv (doi: https: / / doi.org / 10.1101 / 392480); Evaluation of 16S rRNA gene sequencing for species and strain-level microbiome analysis, Jethro S. Johnson, Nature Communications 10, Article number: 5029 (2019)).

[0165] To this end, in some embodiments, variants of strain MNH 26621 based on the aforementioned 16S rRNA sequence are provided. These strain variants have at least 95%, 96%, 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity in the 16S rRNA sequence to strain MNH 26621 deposited with GDMCC No. 62664, and are therefore strains of the same species or different species within the same genus as strain MNH 26621. Based on this, it is reasonable to infer that these strains of the same species or different species within the same genus have similar biological activities. In other embodiments, the variant has at least 95%, 96%, 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity with the sequence shown in SEQ ID NO:1 in the 16S rRNA sequence.

[0166] In some embodiments, variants of strain MNH 20645 based on the aforementioned 16S rRNA sequence are also provided. These strain variants have at least 95%, 96%, 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identity in the 16S rRNA sequence to strain MNH 20645 deposited with GDMCC No. 62665, and thus are strains of the same species or different species within the same genus as strain MNH 20645. Based on this, it is reasonable to infer that these strains of the same species or different species within the same genus have similar biological activities. In yet other embodiments, the variant is at least 95%, 96%, 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% identical to the sequence shown in SEQ ID NO:2 in the 16S rRNA sequence.

[0167] The "identity" between the sequences of two nucleic acid molecules can be determined using a known computer algorithm, such as at least one of the GCG program packages, BLASTN or FASTA. Other commercially or publicly available programs may include the DNAStar "MegAlign" program.

[0168] In addition, with the rapid development of second-generation and third-generation sequencing technologies, bacterial species identification based on whole-genome sequencing has become possible, making the results of bacterial species identification more accurate. The average nucleotide identity (ANI) of bacterial genomes refers to the similarity of homologous genes between two bacterial genomes. In the field of bacterial taxonomy, it is generally believed that the ANI value needs to reach 95% or above to be identified as belonging to the same species (Jain C, Rodriguez-R LM, Phillippy AM, et al. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries[J]. Nature Communications, 2018, 9(1): 5114.).

[0169] Using the above method, those skilled in the art can determine whether an isolated strain belongs to a new strain of the genus Parabacteroides that is the same species or a different species from strain MNH 26621 or MNH 20645. For example, when the average nucleotide identity ANI value with the strain with the deposit number GDMCC No: 62664 is at least 87%, for example, at least 87%, 88%, 88.81%, 88.89%, 89%, 90%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, 100%, it can be determined to belong to a different species or the same species within the genus Parabacteroides; when the average nucleotide identity ANI value with the strain with the deposit number GDMCC No: 62664 is at least 87%, for example, at least 87%, 88%, 88.81%, 88.89%, 89%, 90%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, 100%, it can be determined to belong to a different species or the same species within the genus Parabacteroides; When the average nucleotide identity ANI value of the strain No. 62665 is at least 87%, for example, at least 87%, 88%, 88.81%, 88.89%, 89%, 90%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100%, it can be determined to belong to different species or the same species within the genus Parabacteroides.

[0170] Currently, various mature tools for calculating ANI values ​​are available, such as the local calculation software Jspecies ( / jspecies) and Gegenees ( / documentation.html), and the online calculation tools ANI Calculator (http: / / enveomics.gatech.edu / ), EzGenome ( / ezgenome / ani), and ANItools. Therefore, the ANI value of the isolate and MNH 26621 or MNH 20645 can be calculated using any of these local calculation software or online calculation tools, or other tools or methods known in the art.

[0171] To this end, in some embodiments, variants of strains MNH 26621 or MNH 20645 based on the above genomes are provided. These strain variants have an average nucleotide identity of at least 95%, 96%, 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% compared to the strain deposited with GDMCC No: 62664 or GDMCC No: 62665, or any of the other variants described above. Thus, they are strains of the same species or different species within the genus Parabacteroides as strains MNH 26621 or MNH 20645. Based on this, it is reasonable to infer that these strains of the same genus, species, or different species have similar biological activities. In addition, it can also be judged by the alignment score of the corresponding genome. For example, compared with the strain with the deposit number of GDMCC No: 62664 or GDMCC No: 62665 or any other variant mentioned above, variants with an alignment score of at least 60%, 70%, 73.54%, 74.55%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% also have the same or similar biological activity.

[0172] The term "variant" includes any bacteria derived from strain MNH 26621 or MNH 20645, such as bacteria derived from natural mutation or recombination (e.g., mutations resulting from cell proliferation or cell division), resistance selection, or mutation or recombination caused by any other mechanism, such as radiation, viruses, transposons, or mutagenic chemicals. Furthermore, variants also include other strains isolated from the natural environment that have the same or similar taxonomic characteristics and properties as strains MNH 26621 or MNH 20645, generally including other strains of the genus Parabacteroides that are different species from MNH 26621 or MNH 20645, or other strains within the same species that have different phenotypic variations.

[0173] A second aspect of the embodiments of the present application relates to a culture of a strain. The term "culture" refers to a product obtained by culturing an isolated strain in a fermentation medium. The fermentation medium can be a natural or artificial culture medium, for example, a solid culture medium or a liquid culture medium. In some embodiments, the fermentation medium includes peptone, such as at least one of meat peptone, casein peptone, whey peptone, and soy peptone. In addition, the fermentation medium may also include other inorganic salts or organic substances to promote bacterial growth.

[0174] In some embodiments, the culture can be a fermentation medium after strain cultivation, or a supernatant of the fermentation medium (e.g., obtained by centrifugation or the like), or a concentrated product of the fermentation medium or its supernatant (e.g., concentrated by at least one of evaporation, freeze-drying, dialysis, extraction, membrane separation, etc.), or an extract of the fermentation medium or its supernatant (e.g., an extract obtained by at least one of extraction, extraction with a solvent such as water or an organic solvent, etc.), or a dried product obtained by drying any of the fermentation medium or its supernatant, concentrated product, or extract. In addition, in some specific embodiments, the extract can be an extraction for one or more specific components, such as components with a specific molecular weight range, specific solubility, specific isoelectric point, etc.; or it can be an extraction that is not directed at one or more types of components. Specific extraction methods include extraction using at least one solvent such as methanol, ethanol, chloroform, water, acid, or alkali in a specific process sequence under certain temperature conditions, such as extraction in 75 v / v% ethanol at 60-80° C. for 1-10 minutes, or extraction in methanol at -30--10° C. for 1-10 minutes, or extraction in methanol / chloroform / water solution at -40--20° C. for 30-60 minutes, or extraction in deionized water at 95° C. for 1-10 minutes, or extraction in perchloric acid, trichloroacetic acid, hydrochloric acid, or sodium hydroxide solution at 0-4° C., etc., thereby extracting corresponding metabolites, such as short-chain fatty acids or short-chain fatty acid salts, such as at least one of acetic acid, butyric acid, valeric acid, acetate, propionate, and valerate.

[0175] In some embodiments, the culture is a culture obtained under anaerobic culture conditions using a liquid culture medium. For example, the liquid culture medium is MM01 liquid culture medium (comprising about 5 g / L of peptone, about 5 g / L of trypticase, about 10 g / L of yeast powder, about 5 g / L of beef extract, about 5 g / L of glucose, about 2 g / L of K2HPO4, about 2 g / L of sodium acetate, about 1 mL / L of Tween 80, about 5 mg / L of heme, about 0.5 g / L of L-cysteine ​​hydrochloride, about 1 μL / L of vitamin K1, and about 8 mL / L of inorganic salt solution (about 0.25 g / L of calcium chloride, about 1 g / L of dipotassium hydrogen phosphate, about 1 g / L of potassium dihydrogen phosphate, about 0.5 g / L of magnesium sulfate, about 10 g / L of sodium bicarbonate, and about 2 g / L of sodium chloride). In some embodiments, during anaerobic culture, the culture temperature is 35 to 42° C., for example, 37° C. In some embodiments, during anaerobic culture, the culture time is 24 to 72 hours, such as 36 to 60 hours, and optionally 48 hours. In some embodiments, during anaerobic culture, the pH of the culture medium is 6 to 10, and optionally pH 7.

[0176] It is understood that in the above-mentioned culture, the compound and / or cell debris comprising bacterial strain, and / or the metabolites secreted by bacterial strain. Wherein, metabolites include small molecules (such as amino acids, nucleosides, nucleotides) and macromolecules (such as polypeptides, carbohydrates, nucleic acids, proteoglycans, lipids). These metabolites can be the primary metabolites that directly participate in normal cell function, or the secondary metabolites that are usually not needed by basic cell function, and the metabolic intermediates produced in the primary or secondary metabolite building-up process. Thus, biological functions similar to bacterial strains can be achieved by the different types of cultures containing the compound and / or metabolites of bacterial strain.

[0177] A third aspect of the embodiments of the present application relates to a bacterial agent comprising one or more of the aforementioned strains or metabolites of the strains or the aforementioned cultures, for example, the strain with a deposit number of GDMCC No: 62664 or its metabolites or the culture of the strain, and / or the strain with a deposit number of GDMCC No: 62665 or its metabolites or the culture of the strain.

[0178] The fourth aspect of the embodiments of the present application relates to a composition, which includes the aforementioned strain or its metabolites or the aforementioned culture or the aforementioned bacterial agent, or the raw materials for preparing the composition include the aforementioned strain or its metabolites or the aforementioned culture or the aforementioned bacterial agent.

[0179] The fifth aspect of the embodiments of the present application relates to a pharmaceutical composition, which includes C1) the aforementioned Parabacteroides strain or its metabolite, or the aforementioned culture, or the aforementioned bacterial agent; and C2) a combination drug. By combining drugs, the efficacy of the drug is improved. In some embodiments, the combination drug includes at least one of an oncology drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug. In some embodiments, the oncology drug may include at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug.

[0180] Immunotherapy drugs include at least one of immune cell therapy drugs and immune checkpoint inhibitors. Among them, immune cell therapy drugs include at least one of T cell therapy drugs (such as CAR-T, TCR-T), tumor infiltrating lymphocyte therapy drugs, and NK cell therapy drugs. Immune checkpoint inhibitors include inhibitors targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA.

[0181] The term "immune checkpoint inhibitor" refers to an antagonist that targets an immune checkpoint protein. The immune checkpoint inhibitor can enhance proteins that stimulate the immune response or block proteins that inhibit the immune response, thereby exhibiting an anti-cancer effect through the immune response. In some embodiments, the immune checkpoint inhibitor can be a protein or peptide, such as a soluble fusion protein; it can be an antibody or antigen-binding fragment thereof that binds to the immune checkpoint protein to be inhibited; it can be an inhibitory nucleic acid (such as an siRNA molecule, shRNA molecule, antisense RNA) that specifically binds to the mRNA encoding the immune checkpoint protein.

[0182] In some specific embodiments, the inhibitor is an antibody, such as anti-PD-1 antibodies (such as Camrelizumab, Cemiplimab (cemiplimab-rwlc), Dostarlimab, Enlonstobart, Nivolumab, Pembrolizumab, Penpulimab, Prolgolimab, Pucotenlimab, Retifanlimab, Serplulimab, Sintilimab, Tislelizumab, Toripalimab, Zimberelimab), anti-PD-L1 antibodies (such as Adebrelimab, Atezolizumab, Avelumab, Cosibelimab, Durvalumab, Envafolimab, Socazolimab, Sugemalimab, Tagitanlimab), anti-CTLA-4 antibodies (such as Ipilimumab, Tremelimumab), etc.

[0183] In some embodiments, metabolic disease drugs include drugs used to treat amino acid metabolism disorders (such as phenylketonuria, glycine metabolism disorders, tyrosine metabolism disorders), organic acid metabolism disorders (methylmalonic acidemia, propionic acidemia), glucose metabolism disorders (such as glycogen storage disease, galactosemia, diabetes), fat metabolism disorders (such as hypercholesterolemia, hyperlipidemia), purine metabolism disorders (such as gout, lipomatous dysplasia), pigment metabolism disorders (such as porphyria), blood ammonia metabolism disorders (such as hyperammonemia, citrin deficiency), and metal ion metabolism disorders (such as Wilson's disease).

[0184] Taking diabetes as an example, diabetes drugs include at least one of insulin, metformin, pramide, sulfonylureas (such as glyburide, glipizide, glimepiride), methylcobalamin (such as repaglinide, nateglinide), thiazolidinediones (such as rosiglitazone, pioglitazone), DPP-4 inhibitors (such as sitagliptin, saxagliptin, linagliptin), GLP-1 receptor agonists (such as exenatide, liraglutide, semaglutide), SGLT2 inhibitors (such as canagliflozin, dapagliflozin, empagliflozin), entecavir, tenofovir, lamivudine, adefovir, telbivudine, simeprexa, sofosbuvir, interferon, ribavirin, etc.

[0185] In some embodiments, the pharmaceutical composition further includes product instructions.

[0186] In some embodiments, the pharmaceutical composition is in an infant-suitable dosage form, a pediatric-suitable dosage form, or an adult-suitable dosage form, is a gastrointestinal dosage form or a parenteral dosage form, and is an oral dosage form or an injectable dosage form. The strain in the pharmaceutical composition is capable of at least partially proliferating in the intestine of the subject, and the Parabacteroides strain can be a live bacterium, an attenuated bacterium, a killed bacterium, a freeze-dried bacterium, or an irradiated bacterium.

[0187] In some embodiments, the pharmaceutical composition comprises 1×10 3 CFU / g~1×10 13 CFU / g of Parabacteroides strain, that is, each gram of the pharmaceutical composition contains 1×10 3 to 1×10 13 Colony forming units (CFU) of the Parabacteroides strain, in other embodiments, the pharmaceutical composition comprises 1×10 3 CFU / mL~1×10 13 CFU / mL of Parabacteroides strains, that is, each mL of the pharmaceutical composition contains 1×10 3 to 1×10 13 colony forming units (CFU) of the Parabacteroides strain, for example, at least 1×10 3 , 2×10 3 , 5×10 3 , 1×10 4 , 2×10 4 , 5×10 4 , 1×10 5 , 2×10 5 , 5×10 5 , 1×10 6 , 2×10 6 , 5×10 6 , 1×10 7 , 2×107 , 5×10 7 , 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , 1×10 10 , 2×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 5×10 11 , 1×10 12 , 2×10 12 , 5×10 12 , 1×10 13 colony-forming units (CFU) of the Parabacteroides spp.

[0188] In some embodiments, the pharmaceutical composition or the raw materials of the pharmaceutical composition include C1) at a mass percentage of 1% or more. In some embodiments, the pharmaceutical composition or the raw materials of the pharmaceutical composition include C1) at a mass percentage of 1-80%, 2-70%, 5-60%, 10-50%, 20-40%, or 40-60%.

[0189] In some embodiments, the Parabacteroides strains contained in the above-mentioned pharmaceutical composition are capable of at least partially proliferating in the intestine of the subject, for example, at least 1% to 80%, 2 to 70%, 5 to 60%, 10 to 50%, 20 to 40%, or 40 to 60% of the Parabacteroides strains are capable of proliferating in the intestine of the subject.

[0190] In some embodiments, the bacterial strain in the pharmaceutical composition is lyophilized. In some embodiments, the bacterial strain in the pharmaceutical composition is spray-dried. In some embodiments, the bacterial strain in the pharmaceutical composition is lyophilized or spray-dried and is viable. In some embodiments, the bacterial strain in the pharmaceutical composition is lyophilized or spray-dried and is capable of partially or completely colonizing the intestine. In some embodiments, the lyophilized bacterial strain is reconstituted prior to administration. In some cases, reconstitution is performed using a diluent.

[0191] In some embodiments, the pharmaceutical composition is administered orally. Oral administration may involve swallowing, whereby the compound enters the gastrointestinal tract, and / or oral, lingual, or sublingual administration, whereby the compound enters the bloodstream directly from the oral cavity. Pharmaceutical dosage forms suitable for oral administration include solid suppositories, solid particulates, semisolids, and liquids (including multiphase or dispersed systems) such as tablets; soft or hard capsules containing multi- or nanoparticles, liquids (e.g., aqueous solutions), emulsions, or powders; lozenges (including liquid fillers); chewable gels; rapidly dispersing dosage forms; ovules; sprays; and buccal / mucosal adhesive patches.

[0192] In some embodiments, the pharmaceutical formulation is an enteric formulation, i.e., a gastro-resistant formulation (e.g., resistant to gastric pH) suitable for delivery of the pharmaceutical composition to the intestine by oral administration. Enteric formulations may be particularly useful when the Parabacteroides strain or another component of the pharmaceutical composition is acid-sensitive, e.g., susceptible to degradation under gastric conditions.

[0193] In some embodiments, the enteric formulation comprises an enteric coating. In some embodiments, the formulation is an enteric-coated dosage form. For example, the formulation can be an enteric-coated tablet or an enteric-coated capsule, etc. The enteric coating can be a conventional enteric coating, such as a conventional coating for tablets, capsules, etc. for oral delivery. The formulation can comprise a film coating, such as a film layer of an enteric polymer, such as an acid-insoluble polymer. In some embodiments, the enteric formulation is enteric in nature, such as gastrointestinal and does not require an enteric coating. In some embodiments, the formulation is an intrinsic enteric capsule (e.g., from Capsugel).

[0194] In some embodiments, the pharmaceutical composition is in the form of a powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral liquids, ointments, emulsions, or lavages. By formulating the strain or strain culture into any of the above pharmaceutical compositions, the effective active ingredient can be released as desired, such as rapidly or slowly.

[0195] A sixth aspect of the embodiments of the present application relates to a pharmaceutical combination product comprising independently:

[0196] A first product comprising the aforementioned Parabacteroides strain, or a metabolite of the aforementioned Parabacteroides strain, or the aforementioned culture, or the aforementioned bacterial agent;

[0197] Second product, including combination drugs.

[0198] It is understood that the first product contains an effective amount of the aforementioned strain or culture. The first product and the second product can be administered at different time points, and / or using different administration methods, and / or at different administration intervals, in respective dosages.

[0199] In some embodiments, the combination drug in the second product includes at least one of an oncology drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug. In some embodiments, the oncology drug may include at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug.

[0200] Among them, chemotherapy drugs include alkylating agents (such as cyclophosphamide, ifosfamide, thiotepa, melphalan, carmustine, lomustine, semustine, nimustine, fotemustine, estramustine, nitrogen methyl, nitrogen mustard, nitrocarb, phthalate nitrogen mustard, chlorambucil, hexamethylmelamine, busulfan, temozolomide), platinums (such as cisplatin, carboplatin, oxaliplatin, suplatin, lobaplatin, nedaplatin, dicycloplatin), podophyllums (such as podophyllotoxin, etoposide, teniposide, etoposide phosphate), camptothecin, At least one of alkaloids (such as camptothecin, hydroxycamptothecin, irinotecan, topotecan), taxanes (such as paclitaxel, docetaxel), anthracyclines (such as daunorubicin, doxorubicin, epirubicin, pirarubicin, idarubicin, mitoxantrone, aclarubicin), fluoropyrimidines (such as gemcitabine, capecitabine, 5-fluorouracil, fufurantoin, deoxyfluridine, tegafur, carmofur, trifluridine), antibiotics (such as mitomycin, bleomycin, bleomycin), etc.

[0201] The photosensitizer includes at least one of porphyrins (such as dihydrochlorin, phthalocyanine, bacteriochlorin), boron dipyrroles (such as fluoroboron dipyrrole, azafluoroboron dipyrrole), and rose bengal.

[0202] The photothermal agent includes at least one of precious metal nanoparticles (such as nanodots, nanorods, nanowires, nanosheets, etc. of precious metals such as gold, silver, platinum, and palladium), organic polymers (such as polypyrrole, polyaniline, polyethylenedioxythiophene, polystyrene sulfonate, indocyanine green, porphyrin), carbon-based nanomaterials (such as graphene, carbon nanotubes, and cellulose carbonization products), magnetic nanomaterials (such as Fe3O4), and semiconductor nanomaterials (such as copper sulfide, molybdenum sulfide, bismuth sulfide, antimony sulfide, gold sulfide, copper selenide, molybdenum selenide, bismuth selenide, antimony selenide, and gold selenide).

[0203] Immunotherapy drugs include at least one of immune cell therapy drugs and immune checkpoint inhibitors. Among them, immune cell therapy drugs include at least one of T cell therapy drugs (such as CAR-T, TCR-T), tumor infiltrating lymphocyte therapy drugs, and NK cell therapy drugs. Immune checkpoint inhibitors include inhibitors targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA.

[0204] In some embodiments, the central nervous system disease comprises at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder, and depression.

[0205] In some embodiments, the aforementioned strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, and the aforementioned pharmaceutical combination product include preventing and / or treating tumors by at least one of the following (a) to (l): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of acetic acid or acetate, propionic acid or propionate, butyric acid or butyrate, valeric acid or valerate in SCFA; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue.

[0206] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancers, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases) by inhibiting HDAC activity and / or promoting IFNβ transcriptional activity.

[0207] Existing research results show that HDAC inhibitors exhibit good anti-tumor effects on a variety of tumor cells, including those in the bladder, bone, breast, uterus, central nervous system, esophagus, lung, ovary, pancreas, bile duct cancer, and prostate. They can cause these tumor cells to show significant apoptosis, proliferation inhibition, and cell cycle arrest. As oncogenes that regulate the onset of cancer, reducing or inhibiting the activity of HDAC expression has been shown to have multiple anti-cancer effects. In addition, TSA can also inhibit tumor angiogenesis by downregulating the expression of genes related to tumor angiogenesis caused by hypoxia and directly inhibiting the migration and proliferation of endothelial cells. Moreover, HDAC inhibitors can treat diabetes through various mechanisms, including inhibition of Pdxl (Park et al., 2008, J Clin Invest, 118, 2316-24) and enhancing the expression of the transcription factor Ngn3 to increase the endocrine reservoir. Progenitor cells (Haumaitre et al., 2008, Mol Cell Biol, 28, 6373-83) and enhanced insulin expression (Molsey et al., 2003, J Biol Chem, 278, 19660-6), etc. HDAC inhibition is also a promising treatment method for late diabetic complications such as diabetic nephropathy and retinal ischemia (Christensen et al., 2011, Mol Med, 17 (5-6), 370-390). Therefore, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product achieves treatment or prevention of diseases (such as tumors or cancers, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases) by inhibiting HDAC activity.

[0208] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancer, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases, and central nervous system diseases) by upregulating proinflammatory factors and chemokines to stimulate immunity and / or by downregulating anti-inflammatory factors for immunomodulation. In some embodiments, the proinflammatory factor is selected from at least one of IFNγ, IFNβ, IL-1β, IL-6, IL-1β, MCP-1, MIG, RANTES, and TNFα.

[0209] An eighth aspect of the embodiments of the present application relates to the use of the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product for preventing and / or treating a disease. In some embodiments, the disease includes at least one of a tumor or cancer, a metabolic disease, an inflammatory or autoimmune disease, an infectious disease, and a central nervous system disease.

[0210] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product includes preventing and / or treating tumors by at least one of the following (a) to (l): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of acetic acid or acetate, propionic acid or propionate, butyric acid or butyrate, valeric acid or valerate in SCFA; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue.

[0211] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancers, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases) by inhibiting HDAC activity and / or promoting IFNβ transcriptional activity.

[0212] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancer, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases, and central nervous system diseases) by upregulating proinflammatory factors and chemokines to stimulate immunity and / or by downregulating anti-inflammatory factors for immunomodulation. In some embodiments, the proinflammatory factor is selected from at least one of IFNγ, IFNβ, IL-1β, IL-6, IL-1β, MCP-1, MIG, RANTES, and TNFα.

[0213] A ninth aspect of the embodiments of the present application relates to a method for treating a disease, comprising administering to a subject an effective dose of the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product.

[0214] In some embodiments, the disease comprises at least one of a tumor or cancer, a metabolic disease, an inflammatory or autoimmune disease, an infectious disease, and a central nervous system disease. The tumor or cancer comprises at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor. In some embodiments, the prevention and / or treatment of tumors is achieved by at least one of the following (a) to (o): (a) inhibiting tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) improving tumor treatment response rate; (e) improving the efficacy of immune checkpoint inhibitory drug treatment, such as improving the efficacy of anti-PD-1 antibody treatment; (f) preventing and / or inhibiting tumor cell spread or metastasis; (g) reducing anti-tumor drug resistance; (h) inhibiting HDAC activity through at least one of SCFA or short-chain fatty acid salts; (i) inhibiting HDAC activity and / or promoting IFNβ transcriptional activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue, (m) enhancing the action of cytotoxic tumor immune cells, (n) local tumor immunotherapy, and (o) relieving tumor microenvironment immunosuppression.

[0215] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancers, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases and central nervous system diseases) by inhibiting HDAC activity and / or promoting IFNβ transcriptional activity.

[0216] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product treats or prevents diseases (such as tumors or cancer, metabolic diseases, inflammatory or autoimmune diseases, infectious diseases, and central nervous system diseases) by upregulating proinflammatory factors and chemokines to stimulate immunity and / or by downregulating anti-inflammatory factors for immunomodulation. In some embodiments, the proinflammatory factor is selected from at least one of IFNγ, IFNβ, IL-1β, IL-6, IL-1β, MCP-1, MIG, RANTES, and TNFα.

[0217] In some embodiments, the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product is administered at least once a day. In some embodiments, when the administration frequency is twice or more per day, the same dose is administered each time. In some embodiments, when the administration frequency is twice or more per day, a different dose is administered each time. In some embodiments, the route of administration comprises at least one of oral administration, sublingual administration, nasal administration, rectal administration, inhalation administration, transdermal administration, intraperitoneal injection, subcutaneous injection, intradermal injection, intramuscular injection, and intravenous injection.

[0218] The term "subject", or patient, refers to any mammal. A subject or patient described as "in need thereof" refers to a mammal in need of treatment (or prevention) of a disease. The term "treating" a disease in a subject or "treating" a subject having or suspected of having a disease refers to administering drug therapy to the subject, such as administering one or more agents (e.g., including the aforementioned Parabacteroides strain, the aforementioned culture, the aforementioned bacterial agent, the aforementioned composition, the aforementioned pharmaceutical composition, or the aforementioned pharmaceutical combination product) to reduce or prevent the worsening of at least one symptom of the disease. Therefore, in one embodiment, "treating" refers in particular to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies, or reducing resistance to alternative therapies, or a combination thereof.

[0219] The term "prevent" is art-recognized and, when used in connection with a condition such as local recurrence, is well known in the art and includes administration of a composition that reduces the occurrence of or delays the onset of symptoms of a medical condition in a subject relative to a subject that has not received the composition. Thus, prevention of cancer includes, for example, reducing the number of detectable tumors in a population of patients receiving prophylactic treatment relative to an untreated control population, and / or delaying the appearance of detectable tumors in a treated population relative to an untreated control population, e.g., by a statistically and / or clinically significant amount.

[0220] The tenth aspect of the present application also relates to a method for preparing the aforementioned culture, which comprises the following steps: taking the aforementioned strain, inoculating it into a fermentation medium, and obtaining a culture.

[0221] In some embodiments, the method further includes centrifuging the culture and collecting the fermentation medium supernatant. In some embodiments, the method further includes concentrating the fermentation medium or the fermentation medium supernatant by at least one of evaporation, freeze-drying, dialysis, extraction, and membrane separation to obtain a concentrated product. In some embodiments, the method further includes subjecting the fermentation medium or the fermentation medium supernatant to at least one of extraction and solvent extraction to obtain an extract. In some embodiments, the method further includes drying any of the fermentation medium, the fermentation medium supernatant, the concentrated product, and the extract to obtain a dried product.

[0222] The meanings of some abbreviations involved in the following examples are shown in Table 1 below.

[0223] Table 1. Meaning of some abbreviations

[0224] Some of the culture media involved in the following examples are as follows:

[0225] MM01 liquid culture medium, components: peptone 5 g / L, trypticase 5 g / L, yeast powder 10 g / L, beef extract 5 g / L, glucose 5 g / L, K2HPO4 2 g / L, sodium acetate 2 g / L, Tween 80 1 mL / L, hemoglobin 5 mg / L, L-cysteine ​​hydrochloride 0.5 g / L, vitamin K1 1 μL / L, inorganic salt solution 8 mL / L (each 1 L includes calcium chloride 0.25 g, dipotassium hydrogen phosphate 1 g, potassium dihydrogen phosphate 1 g, magnesium sulfate 0.5 g, sodium bicarbonate 10 g, sodium chloride 2 g).

[0226] Solid MM01 medium, composed of: peptone 5 g / L, trypticase 5 g / L, yeast powder 10 g / L, beef extract 5 g / L, glucose 5 g / L, K2HPO4 2 g / L, sodium acetate 2 g / L, Tween 80 1 mL / L, hemoglobin 5 mg / L, L-cysteine ​​hydrochloride 0.5 g / L, vitamin K1 1 μL / L, inorganic salt solution 8 mL / L (each 1 L includes calcium chloride 0.25 g, dipotassium hydrogen phosphate 1 g, potassium dihydrogen phosphate 1 g, magnesium sulfate 0.5 g, sodium bicarbonate 10 g, sodium chloride 2 g), agar 15 g / L.

[0227] AC liquid culture medium, composition: peptone 20 g / L, glucose 5 g / L, yeast extract 3 g / L, beef extract powder 3 g / L, vitamin C 0.2 g / L, pH 7.0.

[0228] Anaerobic blood agar plates (purchased from Huankai Microorganisms) were prepared with the following composition: 10 g / L casein pancreatic digest, 3 g / L cardiac pancreatic digest, 1 g / L corn starch, 5 g / L meat peptic digest, 5 g / L yeast extract powder, 5 g / L sodium chloride, 15 g / L agar, and 50-100 mL / L sterile defibrinated sheep blood, pH 7.3 ± 0.2.

[0229] Columbia blood agar plates (purchased from Huankai Microbiology) were composed of: trypticase peptone 12 g / L, animal tissue protein digest 5 g / L, corn starch 1 g / L, beef extract 3 g / L, yeast extract 3 g / L, sodium chloride 5 g / L, agar 13.5 g / L, polymyxin B 0.01 g / L, nalidixic acid 0.01 g / L, or 50-100 mL / L of sterile defibrinated sheep blood, pH 7.3 ± 0.2.

[0230] Chocolate agar plates (purchased from Huankai Microorganisms) were prepared with the following composition: polyvalent peptone 18 g / L, starch 1 g / L, sodium chloride 5 g / L, agar 15 g / L, and defibrinated sheep blood 40 g / L, pH 7.4 ± 0.2.

[0231] TSB liquid medium, composition: trypticase 17g / L, soybean papain hydrolysate 3g / L, dipotassium hydrogen phosphate 2.5g / L, sodium chloride 5g / L, glucose 2.5g / L, pH 7.3±0.2.

[0232] MYPG solid plate medium, composition: peptone 5g / L, malt extract powder 3g / L, yeast extract powder 3g / L, glucose 10g / L, agar 20g / L, pH 6.2±0.2.

[0233] The above culture medium can be prepared by conventional preparation methods and sterilization methods.

[0234] The above implementation manner is described below with reference to specific examples.

[0235] Example 1: Isolation and identification of strains MNH 26621 and MNH 20645

[0236] 1. Isolation of strains

[0237] Strain MNH 26621 was isolated from a stool sample of a healthy volunteer in Dali, Yunnan Province, and strain MNH 20645 was isolated from a stool sample of a healthy male volunteer in Guangzhou, Guangdong Province. The specific process is as follows:

[0238] (1) Volunteers collected 2 to 5 grams of fresh feces and placed them in a sample collection and storage tube. After shaking and homogenization, the processed fecal sample was placed in an ice box and sent to the laboratory for strain isolation within 24 hours.

[0239] (2) In the biosafety cabinet, saline solution was dispensed into 9 mL tubes. The culture medium for strain isolation was prepared and transferred to an anaerobic workstation (Don Whitley Scientific H35) 24 h in advance. Sample information, culture medium type, isolation date, etc. were labeled.

[0240] (3) Take a fresh stool sample and place it in an anaerobic operating station. Use a vortex shaker to shake for 1 min, mix it, and then draw 1 mL of the sample into 9 mL of normal saline and mix it for 10 min. -1 dilution, and then serially diluted to 10 -6 Dilution solution, set aside.

[0241] (4) Take 10 respectively -6 Drop the diluted solution into the separation medium (anaerobic blood agar plate, Columbia blood agar plate and chocolate agar plate) at a drop volume of 100 μL / dish. Spread evenly. After the surface of the plate is dry, turn the plate upside down and culture at 37°C for 3 to 5 days.

[0242] (5) Observe the growth of the strain in the isolation culture medium and pick a single colony with a sterilized toothpick to purify the strain. The purified strain is placed at 37°C for anaerobically culture.

[0243] (6) Prepare pure culture strains into 20% glycerol / water-bacteria solution and store at -86°C.

[0244] 2. Identification of strains

[0245] 2.1 Morphological characteristics

[0246] Strain MNH 26621 was inoculated onto MYPG solid plate medium and incubated anaerobically at 37°C for 48 hours. The results are shown in Figure 1A. Visible colonies formed on the plate. These were round, with regular, smooth edges, approximately 2 mm in diameter, and opaque. No secretions were formed around the colonies. Also referring to Figures 2A and 3A, microscopic observation revealed that the strain was non-spore-forming, flagella-free, nonmotile, and short rod-shaped, approximately 3-5 μm in diameter by 8-15 μm in diameter. Gram staining was negative.

[0247] Strain MNH 20645 was inoculated onto MYPG solid plate medium and incubated anaerobically at 37°C for 48 hours. The results are shown in Figure 1B. Visible colonies formed on the plate medium. These were round, with regular, smooth, and opaque edges, and no secretions were formed around the colonies. Furthermore, referring to Figures 2B and 3B, microscopic observation revealed that the strain was non-spore-forming, non-flagellated, non-motile, and rod-shaped, with a diameter of approximately 5 μm × 10–20 μm. Gram staining was negative.

[0248] 2.2 Physiological and biochemical characteristics

[0249] Strain MNH 26621 has a growth temperature range of 30-42°C, with an optimal growth temperature of 37°C. Referring to Figures 4-6A, this strain can grow in a pH range of 7.0-10.0, with an optimal growth pH of 7.0-9.0. It can tolerate up to 2% NaCl and can survive and grow in bile salt concentrations ranging from 0-0.10%, but cannot grow at bile salt concentrations of 0.15% or greater. Furthermore, this strain cannot grow under aerobic conditions but grows well under anaerobic conditions, indicating that it is an obligate anaerobe.

[0250] Strain MNH 20645 grows at temperatures ranging from 30°C to 42°C, with an optimal growth temperature of 37°C. Referring to Figures 4-6, B, this strain is pH-sensitive, with an optimal growth pH of approximately 7.2 (the medium used for 0% NaCl in Figures 5-6 is approximately 7.2). It can tolerate up to 2% NaCl but is intolerant to bile salts, failing to grow at bile salt concentrations of 0.1% or greater. Furthermore, this strain can survive aerobic conditions for 4 hours with a survival rate of approximately 80%, and grows well under anaerobic conditions.

[0251] API 20A test

[0252] The test was performed using API 20A reagent strips (BioMerieux) according to the manufacturer's instructions. The strain was cultured at 37°C under anaerobic conditions. The results are shown in Table 2.

[0253] Table 2. API 20A test results for strains MNH 26621 and MNH 20645

[0254] As can be seen from the table, strains MNH 26621 and MNH 20645 can both utilize glucose, lactose, sucrose, xylose, arabinose, mannose, raffinose, and rhamnose as substrates to metabolize and produce acid, while other types of substrates cannot be used.

[0255] Antibiotic susceptibility testing

[0256] The antibiotic susceptibility test of strain MNH 26621 was performed using the disk diffusion method. The test results are shown in Table 3.

[0257] Table 3. Antibiotic susceptibility test results of strains MNH 26621 and MNH 20645

[0258] As shown in Table 3, strain MNH 26621 was sensitive to ampicillin, erythromycin, ciprofloxacin, lincomycin, chloramphenicol, penicillin, gentamicin, tetracycline, and ceftriaxone, but was resistant to trimethoprim-sulfamethoxazole. Strain MNH 20645 was sensitive to erythromycin, chloramphenicol, tetracycline, penicillin, ampicillin, lincomycin, and ceftriaxone, but was resistant to trimethoprim-sulfamethoxazole, ciprofloxacin, and gentamicin.

[0259] 2.3 16S rRNA

[0260] Fresh cultures of strains MNH 26621 and MNH 20645 were collected, and genomic DNA was extracted using the SDS method. The purity and integrity of the DNA were then tested by agarose gel electrophoresis and quantified using Qubit.

[0261] The extracted genomic DNA template was used to amplify 16S rRNA, and the amplification primers were:

[0262] 1492R: AGAGTTTGATCATGGCTCAG (SEQ ID NO: 3)

[0263] 27F: TAGGGTTACCTTGTTACGACTT (SEQ ID NO: 4).

[0264] The amplified PCR product was purified and then sequenced using ABI3730XL. The 1422 bp 16S rRNA sequence of strain MNH 26621 was obtained as follows:

[0265] This sequence was compared with the NCBI Nucleotide collection (nr / nt) database, and the closest species was Parabacteroides merdae with a similarity of 96.34%. The species classification information of this strain was preliminarily determined, that is, MNH 26621 was preliminarily determined to belong to the genus Parabacteroides and was a new species.

[0266] The 1406 bp 16S rRNA sequence of strain MNH 20645 was obtained as follows:

[0267] This sequence was compared with the NCBI Nucleotide collection (nr / nt) database, and the closest species was Parabacteroides hominis with a similarity of 99.85%. It was preliminarily determined that strain MNH 20645 was Parabacteroides hominis.

[0268] The identity of the 16S rRNA of strain MNH 26621 (SEQ ID NO: 1) and the 16S rRNA of MNH 20645 (SEQ ID NO: 2) was 96.74%.

[0269] The 16S rRNA sequences of MNH 26621 and MNH 20645 measured above, along with those of related genera, were aligned using the MUSCLE method. Finally, the maximum likelihood method was used, with 1000 similarity recalculations, and a phylogenetic tree was constructed using MEGA X. Based on the phylogenetic trees shown in Figures 7, 8, and 9, MNH 20645 and Parabacteroides hominis NSJ 79 are on the same branch and have a relatively close evolutionary distance from each other, whereas MNH 26621 forms a separate clade and is relatively distant from other species.

[0270] To further determine the average nucleotide identity of the genomes of strains MNH 26621, MNH 20645, and other members of the genus Parabacteroides, genomes of the original strains of MNH 26621 and MNH 20645 were prepared, sequenced, assembled, and analyzed. Genomic DNA samples from the original strains of MNH 26621 and MNH 20645, which had passed electrophoresis, were fragmented by ultrasonication to approximately 350-bp fragments. Illumina sequencing libraries were then constructed using a standard DNA library preparation kit (NEB Ultra™). Paired-end 150-bp sequencing was performed on the Illumina NovaSeq. Sequencing of MNH 26621 yielded 1.27 Gbp of data, of which Q20 accounted for 97.17%. Sequencing of MNH 20645 yielded 1.30 Gbp of data, of which Q20 accounted for 97.04%.

[0271] The raw sequencing data were filtered using fastp (version 0.20.0) with the filtering parameters: "--poly_g_min_len 10--poly_x_min_len 10--q 15--u 40--n 5--l 50". The filtered raw data were assembled using SPAdes (version v3.14.0) with the assembly parameters "--isolate--cov-cutoff 10". The MNH 26621 genome assembly yielded a total gene length of 5.06 Mbp, an N50 length of 145.2 kbp, and a GC content of 46.17%. The MNH 20645 genome assembly yielded a total gene length of 5.19 Mbp, an N50 length of 105.3 kbp, and a GC content of 46.27%.

[0272] The prokaryotic analysis software Genome Annotation Pipeline prokka (version 1.14.5) was used for genomic gene prediction analysis with the parameters "--gcode 11 --evalue 1e-09". A total of 1833 CDS sequences were predicted for MNH 26621, with an average CDS sequence length of 1055 bp. A total of 4192 CDS sequences were predicted for MNH 20645, with an average CDS sequence length of 1103 bp. The genome information of all model strains of the genus Parabacteroides was downloaded from NCBI. The degree of genomic relatedness was determined by evaluating the average nucleotide identity (ANI) and alignment score (AF) of the full genome sequences of MNH 26621 and MNH 20645 with these reference organisms. The alignment results are shown in Table 4 below:

[0273] Table 4. Complete genome sequence alignment of strains MNH 26621 and MNH 20645 with other strains of the genus Parabacteroides

[0274] The model strain with the highest average nucleotide identity to the genome of strain MNH 26621 was Parabacteroides hominis, with an average nucleotide identity (ANI) of 88.87% and an alignment fraction (AF) of 75.27%. A full-genomic alignment of MNH 26621 with known species revealed that strain MNH 26621 can be clearly distinguished from known species based on genotypic characteristics: Parabacteroides johnsonii, Parabacteroides merdae, Parabacteroides massiliensis, Parabacteroides acidifaciens, Parabacteroides gordonii, Parabacteroides faecis, Parabacteroides bouchesdurhonensis, Parabacteroides goldsteinii, Parabacteroides timonensis, Parabacteroides provencensis, Parabacteroides chinchillae, and Parabacteroides distasonis.

[0275] The model strain with the highest average nucleotide identity to the genome of strain MNH 20645 was Parabacteroides hominis, with an average nucleotide identity (ANI) of 99.92% and an alignment score (AF) of 97.14%. Therefore, MNH 20645 was identified as Parabacteroides hominis.

[0276] The average nucleotide identity between the MNH 26621 genome and the MNH 20645 genome was 88.89%, and the alignment score was 74.55% (with the MNH 20645 genome as the reference sequence).

[0277] The average nucleotide identity between the MNH 20645 genome and the MNH 26621 genome was 88.81%, and the alignment score was 73.54% (using the MNH 26621 genome as the reference sequence).

[0278] 2.4 Genomic analysis

[0279] Based on the previously assembled genomic data, potential antibiotic resistance genes were analyzed using the RGI pipeline (version 4.2.2), using the CARD (version 3.0.0, https: / / card.mcmaster.ca / analyze / rgi) database. The alignment results are shown in Table 5.

[0280] Table 5. Drug-resistant gene information of strains MNH 26621 and MNH 20645

[0281] The potential virulence factors and related genes in the genome were analyzed using NCBI blastp (version 2.7.1+) and compared with the virulence factor database VFDB (virulence factor database, http: / / www.mgc.ac.cn / cgi-bin / VFs / v5 / main.cgi, updated on September 19, 2019). The comparison results are shown in Table 6.

[0282] Table 6. Potential toxicity genes of strains MNH 26621 and MNH 20645

[0283] gutSMASH5 (version 1.0.0) was used to analyze the potential primary metabolic gene clusters in the genome, and the alignment results are shown in Table 7.

[0284] Table 7. Potential primary metabolic gene clusters of strains MNH 26621 and MNH 20645

[0285] 2.5 Short-chain fatty acids (SCFA) determination

[0286] (1) Preparation of bacterial cells

[0287] The strain MNH 26621 was inoculated into a liquid culture medium and cultured anaerobically at 37° C. for 48 hours. The bacterial cells were collected by centrifugation and stored at -86° C. for later use.

[0288] (2) Preparation of standard products

[0289] Acetic acid, propionic acid, butyric acid, isobutyric acid, valeric acid, isovaleric acid, and hexanoic acid standards were weighed and prepared with ethyl acetate into eight mixed standard concentration gradients of 0.1 μg / mL, 0.5 μg / mL, 1 μg / mL, 5 μg / mL, 10 μg / mL, 20 μg / mL, 50 μg / mL, and 100 μg / mL.

[0290] Take 600 μL of standard, add 25 μL of 4-methylvaleric acid with a final concentration of 500 μM as internal standard, mix well and add to the injection vial, enter GC-MS detection, injection volume 1 μL, split ratio 10:1, split injection.

[0291] (3) Metabolite extraction

[0292] The collected bacterial samples were thawed on ice, 80 mg of sample was taken into a 2 mL glass centrifuge tube, 900 μL of 0.5% phosphoric acid was added to resuspend, shaken and mixed for 2 min, centrifuged at 14000 g for 10 min, 800 μL of supernatant was taken, an equal amount of ethyl acetate was added for extraction, shaken and mixed for 2 min, centrifuged at 14000 g for 10 min, 600 μL of the upper organic phase was taken, 4-methylvaleric acid with a final concentration of 500 μM was added as an internal standard, mixed and added to the injection vial, and entered into GC-MS detection, the injection volume was 1 μL, the split ratio was 10:1, and split injection was performed.

[0293] (4) Sample testing and analysis

[0294] The samples were separated using an Agilent DB-WAX capillary column (30 m × 0.25 mm ID × 0.25 μm) gas chromatography system. The temperature program was as follows: initial temperature 90°C, then increased at 10°C / min to 120°C, then at 5°C / min to 150°C, and finally at 25°C / min to 250°C, where it was maintained for 2 minutes. Helium carrier gas was used at a flow rate of 1.0 mL / min.

[0295] Mass spectrometry analysis was performed using an Agilent 7890A / 5975C gas chromatography-mass spectrometer (GC-MS). The inlet temperature was 250°C, the ion source temperature was 230°C, the transfer line temperature was 250°C, and the quadrupole temperature was 150°C. Electron impact ionization (EI) was used in full scan and SIM scanning modes, with an electron energy of 70 eV.

[0296] MSD ChemStation software was used to extract chromatographic peak areas and retention times. Calibration curves were drawn and the content of short-chain fatty acids in the samples was calculated. The results are shown in Table 8.

[0297] Table 8. Short-chain fatty acid (SCFA) production results of strain MNH 26621

[0298] As can be seen from the results in the table, the strain MNH 26621 provided in this example produces high amounts of acetic acid and propionic acid.

[0299] The above method was used to detect the short-chain fatty acid (SCFA) production of strain MNH 20645. The results are shown in Table 9.

[0300] Table 9. Short-chain fatty acid (SCFA) production results of strain MNH 20645

[0301] As can be seen from the results in the table, the strain MNH 20645 provided in this example produces high amounts of acetic acid and propionic acid.

[0302] Combining the morphological, physiological, biochemical, 16S and whole genome identification results, strain MNH 26621 has significant differences from other existing strains of the genus Parabacteroides and can be identified as a new species of the genus Parabacteroides.

[0303] Strain MNH 26621 was deposited with the Guangdong Microbial Culture Collection Center (GDMCC) under the name Parabacteroides sp. MNH 26621 and the GDMCC number 62664 on July 28, 2022. The deposit address is: Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 5th Floor, 100 Xianlie Middle Road, Guangzhou, China. The proposed taxonomic name is Parabacteroides sp. The deposited strain was identified as viable by the GDMCC.

[0304] Combining the morphological, physiological, biochemical, 16S and whole genome identification results, strain MNH 20645 can be identified as Parabacteroides hominis.

[0305] Strain MNH 20645 was deposited with the Guangdong Microbial Culture Collection Center (GDMCC) under the name Parabacteroides sp. MNH 20645 and the GDMCC number 62665 on July 28, 2022. The deposit address is: Institute of Microbiology, Guangdong Academy of Sciences, Building 59, 5th Floor, 100 Xianlie Middle Road, Guangzhou, China. The proposed taxonomic name is Parabacteroides sp. The deposited strain was identified as viable by the GDMCC.

[0306] Example 2: Regulation of the immune activity of macrophages by strains

[0307] THP-1 cells (Wuhan Punosai Life Science Co., Ltd.) were treated with PMA at a final concentration of 5 ng / mL for 48 hours to differentiate into M0 macrophages. M0 macrophages were co-incubated with strains (MNH 26621 or MNH 20645) for 24 hours. The strains were added at an MOI (viable count: cell number) of 10:1. An M1 macrophage control group (M0 macrophages induced with 20 ng / mL IFNγ and 10 pg / mL LPS for 24 hours) was also established. After anaerobic culture for 1 hour, a cocktail of antibiotics (1 mg / mL Ampicillin, 5 mg / mL Streptomycin, and 1 mg / mL Colistin) was added to kill the bacteria. Culture was continued for 23 hours, and the supernatant was collected.

[0308] Using BD TM The Cytometric Bead Array (CBA) Human Soluble Protein Master Buffer Kit was used to react the supernatant sample with the test protein according to the instructions. The concentrations of cytokines such as IL-10, IL-6, IL-8, IL-1β, IL-12 / IL-13P40, MCP-1, and RANTES in the supernatant were then measured by flow cytometry.

[0309] The results for strain MNH 26621 are shown in Figure 10. After co-culture with strain MNH 26621, macrophages clearly showed characteristics of differentiation into M1 macrophages. Specifically, the level of the anti-inflammatory factor IL-10 was significantly downregulated, while the level of the pro-inflammatory factor IL-1β was significantly upregulated. The levels of the chemokines RANTES and MCP-1 were also significantly upregulated.

[0310] The results for strain MNH 20645 are shown in Figure 11. After co-culture with strain MNH 20645, macrophages also clearly showed characteristics of differentiation into M1 macrophages. Specifically, the levels of chemokines MCP-1 and RANTES were significantly upregulated, as were the levels of proinflammatory cytokines IL-1β, IL-6, IL-12 / IL-13P40, and IL-8.

[0311] Example 3: Regulation of Primary PBMC Immune Activity by Strain

[0312] After incubating the strain (MNH 26621 or MNH 20645) with primary PBMC cells for 24 h, the supernatant was collected and a control group was set up in which the strain MNH 26621 was replaced with PBS. TMThe Cytometric Bead Array (CBA) Human Soluble Protein Master Buffer Kit was used to react the supernatant sample with the detection protein according to the instructions. The concentrations of cytokines IL-1β, RANTES (CCL5), IL-6, MCP-1 (CCL2), and IL-8 in the supernatant were then measured by flow cytometry.

[0313] The results are shown in FIG12 , and strain MNH 26621 can significantly induce a significant increase in inflammatory factors IL-1β, IL-6, IL-8 and chemokines MCP-1 (CCL2), RANTES (CCL5).

[0314] In addition, the results of strain MNH 20645 showed that the expression of inflammatory factors IL-1β and IL-6 tended to increase.

[0315] Example 4: Effect of strains on IFNβ expression

[0316] Interferon (IFN) receptor proteins are a type of cytokine secreted by host cells that regulate immune responses. Viruses, bacterial endotoxins, and synthetic double-stranded RNA can stimulate interferon production. IFNβ, a type I interferon, promotes the activity of NK cells, macrophages, and T lymphocytes, thereby exerting antiviral, anti-tumor, and immunomodulatory effects. To verify whether the strain can promote IFNβ expression, this study used THP-1 cells (a cell line developed by Muen) that carry a constructed IFNβ gene promoter reporter gene (i.e., IFNβ-promoter reporter) to evaluate the strain's effect on IFNβ transcriptional activity.

[0317] Preparation of strain culture supernatant: The strain (MNH 26621 or MNH 20645) was inoculated into MM01 liquid medium and cultured anaerobically at 37°C for 48 hours. The bacteria were removed by centrifugation, and the culture supernatant was filtered through a 0.22 μm filter, aliquoted, and stored at -80°C until use.

[0318] Control group: DMEM complete medium (10% FBS) containing 10% volume of MM01 medium.

[0319] MSA-2 group: CAS No. 129425-81-6, IFNβ activation positive control (40 μM).

[0320] Strain group: containing 10% volume of strain culture supernatant.

[0321] THP-1-IFNβ-promoter reporter cells were seeded in 96-well plates at 1×10 cells per well.5 Cells were treated according to the designated groups. After 24 hours of culture, the cells were centrifuged at 300g for 5 minutes, the supernatant was removed, and 50 μL of 1× luciferase detection reagent was added. The reaction was allowed to proceed for 1 minute, and the luminescence values ​​were measured using a microplate reader. The relative fluorescence values ​​(Relative Luminescence) were normalized to those of the control group to evaluate the effect of the strain on IFNβ transcriptional activity.

[0322] The results are shown in Figure 13, which show that the culture supernatants of strains MNH 26621 and MNH 20645 can significantly promote IFNβ transcription activity. These results indicate that the strains provided in the examples of this application have potential functional effects in immunomodulation, antiviral, and anti-tumor activities.

[0323] Example 5: Animal experiment on the use of strains for the treatment of liver cancer

[0324] To verify the potential of strains MNH 26621 or MNH 20645 for tumor prevention and treatment, we performed a liver cancer growth inhibition experiment using a mouse syngeneic tumor model. This experimental protocol has been ethically reviewed by the Laboratory Animal Care and Use Committee of Muen Biotechnology.

[0325] Test strains: The glycerol cryopreserved tubes of the strains in Example 1 were thawed at 37°C and inoculated onto anaerobic blood plates in an anaerobic workstation for activation. The activated strains were inoculated into MM01 liquid medium and cultured anaerobically to obtain a sufficient amount of culture. The cultured liquid was concentrated by centrifugation and resuspended in a solvent (PBS-Cys: phosphate buffer containing 0.05% cysteine ​​hydrochloride) to obtain the purity and viable count (3.5×10 8 CFU / mL) of the test substances that meet the requirements of animal experiments.

[0326] Tumor cells: H22 mouse hepatoma cells, CBP69230.

[0327] Experimental animals: BALB / C mice, aged 5-6 weeks, were purchased from Guangdong Sijiajingda Biotechnology Co., Ltd.

[0328] Animal experiment: The mice were raised normally. After the quarantine period, H22 mouse liver cancer cells were injected intradermally to establish a mouse liver cancer model. The cell inoculation volume was 2×10 6 / mL, 0.1mL / mouse. The day of inoculation was recorded as D1. At D7, mice with abnormal tumor growth were eliminated and randomly stratified and grouped according to tumor volume, with 12 mice / group. The negative control group A (Control) was given culture medium, and the experimental group G was given strain MNH 20645. The endpoint of this experiment was: 12 gavage administrations were completed. During the experiment, animal characteristics, tumor changes, tumor size, and mouse weight were regularly monitored. At the end of the experiment, weight changes, tumor volume changes, response rate, and tumor inhibition rate were analyzed. At the end of the experiment, all mice were euthanized by cervical dislocation. The results are shown in Tables 10 to 11 below, and reference can be made to Figure 14.

[0329] Table 10. Overall statistics of mice at the end of the experiment with strain MNH 20645

[0330] Table 11. Tumor tissue weight after autopsy of experimental mice of strain MNH 20645

[0331] The results in the figure show that the weight of the mice increased steadily during the administration period, and there was no significant difference between the experimental group (Group G) and the control group (Group A) of the strain, indicating that oral administration of the strain did not affect the normal growth of the mice; compared with the tumors of the mice in the control group, the tumors of the mice in the experimental group were significantly smaller, and the TGI increased significantly, showing a significant effect of inhibiting tumor growth. Compared with the low response rate of the control group, the response rate of the experimental group was significantly improved. The experimental group of strain MNH 20645 had a response rate of up to 45.45%, while the response rate of the control group was only 8.33%. In summary, the strain MNH 20645 of the embodiment showed good efficacy in anti-liver cancer and could significantly reduce the growth rate of liver cancer in mice.

[0332] At the same time, the experimental results also showed that strain MNH 26621 exhibited certain efficacy in anti-liver cancer and could reduce the growth rate of liver cancer in mice.

[0333] Example 6: Animal experiment on the use of strains for the treatment of lung cancer

[0334] To verify the strain's potential for lung cancer prevention and treatment, a mouse syngeneic tumor model was used to investigate its potential for inhibiting lung cancer growth. This experimental protocol has been ethically reviewed by the Muen Biotech Laboratory Animal Care and Use Committee.

[0335] Test strains: The glycerol cryopreserved tubes of the strains in Example 1 were thawed at 37°C and inoculated on anaerobic blood plates in an anaerobic workstation for activation. The activated strains were inoculated into MM01 liquid medium and cultured anaerobically to obtain a sufficient amount of culture. The cultured liquid was concentrated by centrifugation and resuspended in a solvent (PBS-Cys) to obtain the purity and viable count (3.5×10 8CFU / mL) of the test substances that meet the requirements of animal experiments.

[0336] Tumor cells: LLC1 mouse lung cancer cells, CL-0140.

[0337] Experimental animals: The experimental mice were C57BL / 6J mice, 5 weeks old, purchased from Guangdong Yaokang Biotechnology Co., Ltd.

[0338] Animal experiments:

[0339] After the quarantine period, the mice were raised normally and the mouse lung cancer model was established by intradermal injection of LLC1 mouse lung cancer cells. The cell inoculation volume was 2×10 7 / mL, 0.1mL / mouse. The day of inoculation was recorded as D1. At D7, mice with abnormal tumor growth were eliminated and randomly stratified and grouped according to tumor volume, with 12 mice / group. The negative control group (Control) was given culture medium, and the experimental group was given the corresponding strain. Dosing began on the day of grouping, with an oral volume of 0.2mL / mouse / time and an administration frequency of 1 day / time. The endpoint of this experiment was D21: 14 oral administrations were completed. During the experiment, animal characteristics, tumor changes, tumor size, and mouse weight were regularly monitored. At the end of the experiment, weight changes, tumor volume changes, response rate, and tumor inhibition rate were analyzed. At the end of the experiment, all mice were euthanized by cervical dislocation. The results are shown in the table below and Figures 15 to 16.

[0340] Table 12. Overall statistics of mice at the end of the experiment

[0341] Table 13. Tumor tissue weight after mouse autopsy

[0342] The results showed that the weight of the mice increased steadily during the administration period, and there was no significant difference between the experimental groups and their respective control groups before dissection. Compared with the tumors of the mice in the respective control groups, the tumor volume and tumor weight of the mice in the experimental groups were significantly reduced, and the TGI was significantly increased, showing a significant inhibitory effect on tumor growth. Compared with the low response rates of the respective control groups, the response rates of the experimental groups were significantly improved. For example, the experimental group of strain MNH 26621 had a response rate of up to 72.73%, while the control group had only 36.36%; the implementation group of strain MNH 20645 had a response rate of up to 50%, while the control group had only 16.67%. In summary, the strains in the examples show good efficacy in anti-lung cancer and can significantly reduce the growth rate of lung cancer in mice.

[0343] Example 7: Experimental verification of the effect of strains on the treatment of PD-1 combined with lung cancer

[0344] To validate the therapeutic efficacy of the strain combined with PD-1 antibodies, a mouse syngeneic tumor model was used to investigate the inhibition of lung cancer growth. This experimental protocol has been ethically reviewed by the Muen Biopharmaceuticals Laboratory Animal Care and Use Committee.

[0345] Test strains: The glycerol cryopreserved tubes of the strains in Example 1 were thawed at 37°C and inoculated on anaerobic blood plates in an anaerobic workstation for activation. The activated strains were inoculated into MM01 liquid medium and cultured anaerobically to obtain a sufficient amount of culture. The cultured liquid was concentrated by centrifugation and resuspended in a solvent (PBS-Cys) to obtain the purity and viable count (1.0×10 8 CFU / mL) of the test substances that meet the requirements of animal experiments.

[0346] Tumor cells: LLC1 mouse lung cancer cells, CL-0140.

[0347] Experimental animals: The experimental mice were C57BL / 6J mice, 5 weeks old, purchased from Guangdong Yaokang Biotechnology Co., Ltd.

[0348] PD-1 antibody: anti-mPD-1 antibody (RMP1-14), prepared in normal saline at 2 mg / mL, sourced from BioXcell.

[0349] Animal experiments:

[0350] After the quarantine period, the mice were raised normally and the mouse lung cancer model was established by intradermal injection of LLC1 mouse lung cancer cells. The cell inoculation volume was 2×10 7 / mL, 0.1mL / mouse. The day of inoculation was designated as D1. On D5, mice with abnormal tumor growth were removed and randomly divided into groups based on tumor volume, 8 mice per group, and the grouping was as follows:

[0351] Table 14. Grouping of combined experiments

[0352] The PBS-Cys (glycerol) is prepared by uniformly mixing PBS-Cys (phosphate buffer containing 0.05% cysteine ​​hydrochloride) and 100% glycerol in a ratio of 3:1.

[0353] Negative control group A (Negative Control) received the negative control PBS-Cys(Gly) (ig) and the negative control saline (ip). Positive control group B (PD-1) received the negative control PBS-Cys(Gly) and the positive control anti-PD-1 antibody (ip). Groups F and G received the test strains (MNH 26621(ig) and MNH 20645(ig)) and anti-PD-1 antibodies, respectively. Dosing began on the day of grouping. The oral gavage volume for PBS-Cys(Gly) and each test strain was 0.2 mL / animal, the injection volume for saline was 5 mL / kg, and the injection volume for anti-PD-1 antibodies was 10 mg / kg. PBS-Cys(Gly) and each test strain were administered once daily until the end of the study (a total of 20 doses). Saline and anti-PD-1 antibodies were administered every three days for a total of six doses.

[0354] After reaching the endpoint of the experiment, all surviving mice were dissected and samples were collected to measure tumor weight and calculate tumor volume. Finally, statistical analysis and comparison of tumor volume curve changes (Tumor volume), endpoint tumor volume (Tumor volume at endpoint), endpoint tumor weight (Tumor weight at endpoint) and endpoint tumor growth inhibition rate (Tumor Growth Inhibition Rate at endpoint, TGI) were performed.

[0355] The results showed that the combination of strains and PD-1 antibodies has a certain effect on the treatment of lung cancer. The endpoint tumor volume results, the negative control is: 1279.80mm 3 , positive control group (PD-1 antibody): 710.29mm 3 , MNH 20645 combined with PD-1 antibody: 627.71mm 3 , MNH 26621 combined with PD-1 antibody: 675.53mm 3 Compared with the positive control group, tumor volumes in both the MNH 20645 and MNH 26621 combination groups showed a downward trend. The tumor growth inhibition rate (TGI) was 47.3% for the positive control group (PD-1), 53.9% for the MNH 20645 and PD-1 antibody combination, and 50.0% for the MNH 26621 and PD-1 antibody combination. Compared with the positive control group, the TGIs for both the MNH 20645 and MNH 26621 combination groups increased to a certain extent. Therefore, both the MNH 20645 and PD-1 antibody combination groups and the MNH 26621 and PD-1 antibody combination groups have a certain inhibitory effect on tumor growth.

[0356] Example 8: Experimental results of the combination of strain MNH20645 and Gemcitabine for the treatment of pancreatic cancer

[0357] To validate the therapeutic efficacy of strain MNH20645 combined with gemcitabine, a mouse syngeneic tumor model was used to investigate the inhibition of lung cancer growth. This experimental protocol has been ethically reviewed by the Muen Biotech Laboratory Animal Care and Use Committee.

[0358] Test strains: After thawing the glycerol cryopreserved tube of MNH20645 strain at 37°C, inoculate it on an anaerobic blood plate in an anaerobic workstation for activation. The activated strain was inoculated into MM01 liquid medium and cultured anaerobically to obtain a sufficient number of viable bacteria. The cultured bacterial solution was centrifuged and concentrated, and then the bacteria were resuspended in a solvent to obtain the purity and viable count (1.30×10 10 CFU / mL) of the test substances that meet the requirements of animal experiments.

[0359] Tumor cells: KPC mouse pancreatic cancer cells.

[0360] Experimental animals: The experimental mice were C57BL / 6J female mice, 7-8 weeks old, purchased from Guangdong Yaokang Biotechnology Co., Ltd.

[0361] Animal experiment: After the quarantine period, KPC mice were subcutaneously inoculated with pancreatic cancer cells to form an ectopic homologous tumor model. The inoculation volume was 3×10 6 cells / mouse, 0.1mL / mouse. When the average tumor volume reaches 60-100mm 3 The patients were randomly divided into 10 groups according to tumor volume. The grouping is as follows:

[0362] Table 15. Grouping of combined experiments

[0363] The PBS-Cys (glycerol) is prepared by uniformly mixing PBS-Cys (phosphate buffer containing 0.05% cysteine ​​hydrochloride) and 100% glycerol in a ratio of 3:1.

[0364] On the day of grouping, oral administration was started. Groups A and B were given PBS-Cys (glycine), and group G was given MNH20645. The oral administration volume was 0.2 mL per mouse. When the average tumor volume of the negative control group A grew to 120 mm 3 ~150mm 3At 14:00, groups A, B, and G began to receive drugs by intraperitoneal injection. Group A received normal saline at a dose of 5 mg / kg, and groups B and G received Gemcitabine at a dose of 50 mg / kg. The frequency of administration was once every 3 days, for a total of 6 times. The animals were weighed upon receipt and at the end of the quarantine period; the animals were weighed twice a week after tumor inoculation, and the animals were weighed on the day of intraperitoneal injection; the day of tumor cell inoculation was D1. From Day 7 to grouping, the tumor diameter was measured once a day; after grouping, the tumor diameter was measured once every 3 days; when the average tumor volume of any group reached or exceeded 600 mm 3 The tumor diameter was measured every 2 days and the tumor growth was recorded. The experiment was terminated on D35. 3 ) measurements. After reaching the experimental endpoint, all surviving mice were dissected and samples were collected to measure tumor weight and calculate tumor volume. Finally, statistical analysis and comparison of tumor volume curve changes (Tumor volume), endpoint tumor volume (Tumor volume at endpoint), endpoint tumor weight (Tumor weight at endpoint) and endpoint tumor inhibition rate (Tumor inhibition rate at endpoint, TGI) were performed.

[0365] Tumor inhibition rate: (average volume of control group minus volume of experimental group) / average volume of control group × 100%. All data are expressed as mean ± SD and analyzed using GraphPad Prism 8.0.2 software. For comparisons of three or more groups, one-way ANOVA with Dunnett's multiple comparisons test was used. For two-way comparisons, two-way ANOVA with Sidak's multiple comparisons test was used. Significant differences are indicated by *, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0366] The results are shown in the following table and Figure 17.

[0367] Table 16 Statistics of overall status of mice at the end of the experiment

[0368] Table 17 Tumor tissue weight after mouse autopsy

[0369] The results showed that the average endpoint volume of the tumor in the negative control group was 961.75 mm3 The average endpoint volume of tumor in the positive control group (Gemcitabine) was 605.41 mm 3 The mean tumor volume at the endpoint of MNH20645 combined with Gemcitabine treatment was significantly reduced to 429.52 mm 3 ; On D35, the average weight of tumor tissue in the negative control group mice was about 0.92g, the average weight of tumor tissue in the positive control group mice was about 0.68g, and the average weight of tumor tissue in the experimental group was about 0.48g on the 35th day. MNH20645 combined with Gemcitabine treatment can inhibit tumor growth.

[0370] Figure 17A shows the tumor volume change curves of each group of mice at different intervention time points; Figure 17B shows the tumor volume graph of each group of mice at the end point. Figures 17A and B show the mean ± standard deviation of mouse tumor volume (mm 3 ) presents data. Figure 17A was statistically analyzed using a two-way ANOVA analysis and showed that the tumor volumes of the positive control group and the MNH20645 combined with Gemcitabine experimental group were significantly reduced compared to the negative control group. The tumor volumes of the MNH20645 combined with Gemcitabine experimental group were significantly reduced compared to the positive control group. Figure 17B was statistically analyzed using a one-way ANOVA method with Dunnett's multiple comparison analysis and showed that at the endpoint, the tumor volumes of the positive control group and the MNH20645 combined with Gemcitabine experimental group were significantly reduced compared to the negative control group. Figure 17C was statistically analyzed using a one-way ANOVA method with Dunnett's multiple comparison analysis and showed that at the endpoint, the tumor volumes of the positive control group showed a decreasing trend compared to the negative control group, but did not reach significance, while the tumor volumes of the MNH20645 combined with Gemcitabine experimental group were significantly reduced. Figure 17D shows the endpoint TGI of mice. One-way ANOVA analysis shows that at the endpoint, the TGI of mice in the positive control group and the MNH20645 combined with Gemcitabine experimental group was significantly greater than that in the negative control group. Figure 17E shows the weight of mice during the dosing period. The results show that the weight of mice increased during the dosing period. Two-way ANOVA showed no significant difference between the MNH20645 combined with the negative control and the positive control groups. As shown in Figures 17A to D, the combination of MNH20645 and Gemcitabine significantly inhibited pancreatic cancer tumor growth.

[0371] Figures 17F-H show the changes in tumor volume in individual mice, presented as tumor volume values. The dotted line represents the tumor volume at 40% inhibition relative to the negative control group. A mouse with a tumor volume greater than the negative control group's tumor volume at 40% inhibition indicates a tumor inhibition rate of <40%, indicating no antitumor drug response. A mouse with a tumor volume less than the negative control group's tumor volume at 40% inhibition indicates a tumor inhibition rate of ≥40%, indicating a response. Compared to the negative control group's 0% response rate, the positive control group had a 50% response rate. The MNH20645 combined with Gemcitabine treatment significantly increased the response rate, reaching 62.5%.

[0372] In summary, MNH20645 combined with Gemcitabine can inhibit pancreatic cancer tumor growth and significantly reduce the growth rate of pancreatic cancer in mice.

[0373] Example 9: Immunoanalysis of MNH26621-activated lung cancer tumor mice

[0374] This example is based on the following principle: After preparing a single-cell suspension from tumor-bearing mouse tissue, specific molecules are labeled with fluorescent markers. The proportion of cells expressing the specific molecules can be detected using a flow cytometer. The distribution of immune cells can, to some extent, reflect the immune status of the mouse.

[0375] Take an appropriate amount of tumor tissue from the experimental endpoint mice (tumor-bearing mice) in Example 6, rinse the surface with PBS, cut into small pieces and crushed, and place the crushed tumor tissue in 5mL collagenase IV digestion solution system (1mg / mL collagenase IV, 0.1mg / mL DNA enzyme, 10% FBS) at 37°C for digestion for 30min; the digested tissue fluid is filtered through a 70μm filter membrane to prepare a mouse tumor single cell suspension, which is tested on the machine to count the total number of cells in the tissue. Take the mouse tumor single cell suspension, add dyes (corresponding antibody combinations) T-Live-Tumor / NK-Live-Tumor, T-Tumor / NK-Tumor to stain the surface of tumor cells with T cells / NK cells, resuspend the stained cells with PBS, and detect on the machine. Take the mouse tumor single cell suspension, add dyes (corresponding antibody combinations) MDSC-Live-Tumor, MDSC-Tumor to stain tumor cells with MDSC cells, resuspend the stained cells with PBS, and detect on the machine. Single-cell suspensions of mouse tumors were prepared and stained with the dyes (corresponding antibody combinations) TAM-Live-Tumor and TAM-Tumor-Surface, respectively. The stained cells were resuspended in PBS and analyzed. Single-cell suspensions of mouse tumors were stimulated with stimulants for 4 hours. The cells were stained with the dyes (corresponding antibody combinations) Live-Tumor and Tumor-IFN-Surface, respectively. The stained cells were resuspended in PBS. The cells were then fixed with fixative and permeabilization buffer according to the assay kit instructions, stained with T-IFN / TNF, and resuspended in PBS for analysis. Single-cell suspensions of mouse tumors were prepared and stained with the dyes (corresponding antibody combinations) Treg-Live-Tumor and Treg-Surface-Tumor, respectively. The stained cells were resuspended in PBS. The cells were then fixed with fixative and permeabilization buffer according to the assay kit instructions, stained with Treg-Foxp3-Tumor nuclear stain, and resuspended in PBS for analysis.

[0376] Flow cytometry data were processed using CyExpert and statistical analysis was performed using Graphpad Prism V9. Statistical analysis was performed using one-way ANOVA with Dunnet's multiple comparison, ns not significant*p<0.05,**p<0.01,***p<0.001.

[0377] Compared with the control group, the proportions of cytotoxic cells CD4+IFNγ+ cells (Figure 18A) and CD45+CD3+ cells (Figure 18B) in mouse tumor tissues were significantly increased; the proportion of immunosuppressive Treg cells (Figure 18C) was significantly decreased.

[0378] Analysis of the correlation between immune cells in tumor tissue and tumor endpoint volume (see A to D in Figure 19) showed that tumor endpoint volume was significantly positively correlated with the proportion of immunosuppressive Treg cells and M2 macrophages in tumor tissue, and significantly negatively correlated with the proportion of tumor-killing cells CD8+IFNγ+ cells and CD8+TNFα+ cells in tumor tissue.

[0379] Analysis of the correlation between M2 macrophages, cytotoxic CD8+IFNγ+ cells and tumor weight in tumor tissue (see A and B in Figure 20) showed that tumor weight was significantly positively correlated with M2 macrophages in tumor tissue, and significantly negatively correlated with the proportion of tumor-killing CD8+IFNγ+ cells in tumor tissue.

[0380] It can be seen from this that the strain provided in the examples of the present application can activate the local immunity of mouse tumors by inhibiting the proportion of immunosuppressive Treg cells in mouse tumors, increasing the proportion of tumor CD45+CD3+ cells and killer cells CD4+IFNγ+ cells, and exerting an anti-tumor effect.

[0381] Therefore, the strain MNH26621 provided in the examples of the present application can exert anti-tumor activity by stimulating the activation of the mouse immune system.

[0382] Example 10: Evaluation of the effects of strains MNH26621 and MNH20645 on differentiation and maturation of mouse bone marrow-derived DC cells

[0383] This example is based on the principle that dendritic cells (DCs) play an important role in immune activation. It has been confirmed that DCs are the only antigen-presenting cells (APCs) that can significantly stimulate the proliferation of naive T cells, while other types of APCs (such as monocytes, macrophages, B cells, etc.) can only stimulate activated or memory T cells. Therefore, DCs are the initiators of the body's adaptive T cell immune response and play an extremely important role in tumor immunity. For mice, the most common method is to induce DCs from bone marrow cells, namely bone marrow-derived DCs (BMDCs). Therefore, this study used this model and used flow cytometry to detect biomarkers related to differentiation and maturation of DC cell surfaces (such as CD11c, MHCII, CD80, CD86, etc.) to evaluate the effects of strains on DC differentiation and maturation phenotypes.

[0384] Experimental preparation: The DMEM complete medium of this example is: DMEM medium containing 10% fetal bovine serum (FBS), 1% penicillin-streptomycin, 1% L-glutamine, and 1% HEPES (N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid buffer, pH buffer range 6.8-8.2).

[0385] BMDC induction medium: DMEM complete medium containing 25 ng / mL GM-CSF (granulocyte-macrophage colony-stimulating factor) and 10 ng / mL IL-4 (interleukin-4).

[0386] Preparation of MNH26621 culture supernatant: strain MNH26621 was inoculated into MM01 liquid culture medium, cultured anaerobically at 37°C for 48 hours, and the cells were removed by centrifugation. The culture supernatant was filtered through a 0.22 μm filter, aliquoted, and the collected material was stored at -80°C until use.

[0387] Preparation of MNH20645 culture supernatant: strain MNH20645 was inoculated into MM01 liquid culture medium and cultured anaerobically at 37°C for 48 hours. The bacteria were removed by centrifugation, and the culture supernatant was filtered through a 0.22 μm filter, aliquoted, and stored at -80°C until use.

[0388] Control group: DMEM complete medium;

[0389] MM01 group: BMDC induction medium containing 10% MM01 bacterial culture medium.

[0390] MNH26621 group: BMDC induction medium containing 10% MNH26621 bacterial culture supernatant.

[0391] MNH20645 group: BMDC induction medium containing 10% MNH20645 bacterial culture supernatant.

[0392] BMDC surface marker staining solution: CD45-AF700, CD11C-PC5.5, MHC-II-APC, CD86-PE-Cy7, and CD80-FITC are prepared at a ratio of 1:100, and each reaction system is 100 μL.

[0393] Experimental Procedure: Mouse Bone Marrow Cell Extraction: Femurs and tibias from healthy wild-type mice (C57BL / 6) were cut at both ends. Bone marrow cells were extracted from the femurs and tibias using a 1 mL syringe filled with pre-chilled PBS and dispersed by pipetting. After grinding, the cells were centrifuged at 1000 rpm for 5 minutes. The cells were lysed and resuspended in PBS to prepare a single-cell suspension.

[0394] Induction and culture of BMDCs: Pellet bone marrow cells by centrifugation, resuspend in 10 mL of BMDC induction medium, transfer to a 10 cm dish, and culture in a 37°C incubator for 6 days for differentiation. Change half of the BMDC induction medium every two days. After 6 days of culture, relatively mature BMDCs should be obtained.

[0395] Treat BMDC cells with the supernatant of the strain: centrifuge the BMDC cells, resuspend them, count them, and calculate the number of cells to be treated with 1×10 6 Cells were seeded / well in a 12-well plate. The cells were treated according to the conditions of the control, MM01, MNH26621, and MNH20645 groups. After 24 hours of culture, the cells were harvested by centrifugation, washed with PBS, and stained with BMDC surface marker staining solution for 30 minutes. BMDCs were then analyzed by flow cytometry for expression of MHC II, CD80, CD86, and other molecules associated with differentiation and maturation.

[0396] Experimental Results: Figure 21 shows flow cytometric analysis of MHC II, CD80, and CD86 surface molecules on DCs in the MNH26621 group. The results show that compared with the MM01 group, MNH26621 significantly upregulated MHC II expression on DCs and promoted significant upregulation of CD80 and CD86. These results suggest that MNH26621 promotes DC differentiation and maturation, potentially facilitating the activation of anti-tumor immunity.

[0397] Figure 22 shows flow cytometric analysis of MHC II and CD86 surface molecules in DCs treated with MNH20645. The results show that compared with the MM01 group, MNH20645 significantly upregulated MHC II expression in DCs and CD86 expression. These results suggest that MNH20645 promotes DC differentiation and maturation, potentially facilitating the activation of anti-tumor immunity.

[0398] In Figures 21 and 22, the data are presented as mean ± standard deviation (Mean ± SD). The statistical analysis was performed using one-way ANOVA and Tukey's multiple comparisons test. Significant differences are indicated by *. For significant significance analysis, the following are: not significantly different (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001.

[0399] Example 11 Evaluation of the inhibitory effect of strains MNH26621 and MNH20645 on the M2 TAM phenotype

[0400] This embodiment is based on the principle that tumor-associated macrophages (TAM) play an important role in the malignant progression of tumors. TAM can be roughly divided into M1 and M2 types. M1 plays a pro-inflammatory role and inhibits tumor growth, while M2 plays an anti-inflammatory role, inhibits anti-tumor immune activation, and promotes the malignant progression of tumors. Therefore, for M2 macrophages, this study established an in vitro method of inducing mouse mononuclear macrophage leukemia cells (RAW264.7) with IL-4 (interleukin-4) in vitro to construct an M2 TAM model, and detected the changes in the expression levels of M2 macrophage biomarkers CD206 and Arg1 by real-time fluorescence quantitative PCR technology to evaluate the effect of the strain on the phenotype of M2 macrophages.

[0401] Experimental preparation: Preparation of MNH26621 culture supernatant: strain MNH26621 was inoculated into MM01 liquid medium and cultured anaerobically at 37°C for 48 hours. The bacteria were removed by centrifugation, and the culture supernatant was filtered through a 0.22 μm filter, aliquoted, and stored at -80°C until use.

[0402] Preparation of MNH20645 culture supernatant: strain MNH20645 was inoculated into MM01 liquid culture medium and cultured anaerobically at 37°C for 48 hours. The bacteria were removed by centrifugation, and the culture supernatant was filtered through a 0.22 μm filter, aliquoted, and stored at -80°C until use.

[0403] The DMEM complete medium in this embodiment is: DMEM medium: fetal bovine serum (FBS): P / S (Penicillin-Streptomycin) = 9:1:0.1; for example, 45 mL DMEM medium + 5 mL fetal bovine serum (FBS) + 500 μL P / S

[0404] Control group: DMEM complete medium containing 5% volume of MM01 bacterial culture medium;

[0405] TAM group: DMEM complete medium containing 20 ng / mL IL4 and 5% MM01 bacterial culture medium

[0406] MNH26621 group: DMEM complete medium containing 20 ng / mL IL4 and 5% MNH26621 bacterial culture supernatant.

[0407] MNH20645 group: DMEM complete medium containing 20 ng / mL IL4 and 5% MNH20645 bacterial culture supernatant.

[0408] After the RAW264.7 cells were counted, they were plated in a 6-well plate, with 5*10 cells per well.5 / 2mL, cultured in a 5% CO2 incubator at 37°C, and the cells adhered for 24 hours. The next day, the old culture medium was aspirated with a pipette, and 2mL of culture medium corresponding to Control, TAM, MNH26621, and MNH20645 were added, mixed gently, and placed in a 5% CO2, 37°C incubator for 2 days. After the culture, the cells were washed with PBS and subjected to RNA extraction (TAKARA MiniBEST Universal RNA Extraction Kit, TAKARA), reverse transcription (PrimeScriptTM RT reagent Kit with gDNA Eraser, TAKARA), qPCR detection of CD206 and Arg1, and internal reference GAPDH expression (TB Premix Ex Taq TM II, TAKARA). All operations were performed according to the kit instructions.

[0409] CD206 primers: F-CTCTGTTCAGCTATTGGACGC (SEQ ID NO: 5); R-CGGAATTTCTGGGATTCAGCTTC (SEQ ID NO: 6); Arg1 primer: F-CATTGGCTTGCGAGACGTAGAC (SEQ ID NO: 7); R-GCTGAAGGTCTCTTCCATCACC (SEQ ID NO: 8); GAPDH primers: F-GTGTTCCTACCCCCAATGTGT (SEQ ID NO: 9); R-ATTGTCATACCAGGAAATGAGCTT (SEQ ID NO: 10).

[0410] Experimental results: Figure 23 shows the expression of M2 markers CD206 and Arg1 in RAW264.7 cells detected by QPCR in the MNH26621 group. The results showed that IL-4 significantly promoted the significant upregulation of the expression of macrophage M2 biomarkers CD206 and Arg1, indicating that IL-4 can successfully induce the M2 type transformation of RAW265.7 cells. The culture supernatant of strain MNH26621 significantly inhibited the significant expression of CD206 and Arg1 caused by IL-4, indicating that MNH26621 has the ability to inhibit the IL-4-induced M2 type transformation of RAW264.7 cells. These results suggest that MNH26621 has the ability to relieve the immunosuppression of M2 macrophages in the tumor microenvironment, thereby promoting the activation of anti-tumor immunity.

[0411] Figure 24 shows the expression of M2 markers CD206 and Arg1 in RAW264.7 cells detected by QPCR in the MNH20645 group. The results showed that IL-4 significantly promoted the significant upregulation of the expression of macrophage M2 biomarkers CD206 and Arg1, indicating that IL-4 can successfully induce the M2 type transformation of RAW265.7 cells. The culture supernatant of strain MNH20645 significantly inhibited the significant expression of CD206 and Arg1 caused by IL-4, indicating that MNH20645 has the ability to inhibit the M2 type transformation of RAW264.7 cells induced by IL-4. These results suggest that MNH20645 has the ability to relieve the immunosuppression of M2 macrophages in the tumor microenvironment, thereby promoting the activation of anti-tumor immunity.

[0412] In Figures 23-24, the data are shown as mean ± standard deviation (Mean ± SD). Statistical analysis was performed using one-way ANOVA and Tukey's multiple comparisons test. Significant differences are indicated by *. For significant significance analysis, the following are: not significantly different (ns), p value ≥ 0.05; *, p value < 0.05; **, p value < 0.01; ***, p value < 0.001; ****, p value < 0.0001.

[0413] The present application has been described in detail above with reference to the embodiments. However, the present application is not limited to the above embodiments. Various modifications can be made within the scope of knowledge possessed by a person of ordinary skill in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features of the embodiments can be combined with each other unless there is a conflict.

Claims

1. A strain of the genus Parabacteroides, characterized in that Any one of the following A1) to A5): A1) strains having 16S rRNA that is at least 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, 100% identical to the sequence shown in SEQ ID NO:1; A2) strains with a deposit number of GDMCC No: 62664 or GDMCC No: 62665; A3) strains having at least 96.74%, 97%, 98%, 98.5%, 98.65%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, 100% identity to the 16S rRNA of the strain described in A2); A4) strains whose 16S rRNA is at least 97%, 98%, 98.65%, 99%, 99.5%, 99.9%, 100% identical to the sequence shown in SEQ ID NO: 2; Preferably, the strain is selected from at least one of the following: Parabacteroides hominis, Parabacteroides merdae, Parabacteroides johnsonii, Parabacteroides massiliensis, Parabacteroides acidifaciens, Parabacteroides faecis, Parabacteroides bouchesdurhonensis, Parabacteroides provencensis, Parabacteroides goldsteinii, Parabacteroides gordonii, Parabacteroides timonensis, Parabacteroides chinchillae, Parabacteroides distasonis, Parabacteroides hominis; A5) a strain whose genome has an average nucleotide identity of at least 87%, 88%, 88.81%, 88.89%, 89%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.99%, or 100% with the genome of any of the strains A1) to A4); and / or a strain whose genome has an alignment score of at least 70%, 73.54%, 74.55%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% with the genome of any of the strains A1) to A4); Preferably, A2) the sequence of 16S rRNA of the strain with the deposit number of GDMCC No: 62664 is shown as SEQ ID NO: 1, and the sequence of 16S rRNA of the strain with the deposit number of GDMCC No: 62665 is shown as SEQ ID NO: 2; Preferably, the strain is derived from the human intestine; Preferably, the strain is capable of high production of short-chain fatty acids; Preferably, the strain can produce high amounts of acetic acid and / or propionic acid.

2. A culture of the Parabacteroides strain according to claim 1; Preferably, the culture comprises any one of the following B1) to B5): B1) fermentation medium of the strain; B2) the supernatant of the fermentation medium of the strain; B3) the concentrated product of B1) or B2); B4) an extract of B1) or B2); B5) a dried product of any one of B1) to B4); Preferably, the fermentation medium is a liquid medium; Preferably, the culture is obtained using a liquid culture medium under anaerobic culture conditions; Preferably, the fermentation medium is MM01 liquid medium, and / or the culture temperature is 35-42° C., and / or the culture time is 24-72 hours, and / or the pH of the culture medium is 6-10.

3. A bacterial agent, characterized in that The bacterial agent comprises the Parabacteroides strain according to claim 1, or a metabolite of the Parabacteroides strain according to claim 1, or the culture according to claim 2.

4. A composition, characterized in that The composition or the raw material of the composition comprises the Parabacteroides strain of claim 1, or a metabolite of the Parabacteroides strain of claim 1, or the culture of claim 2, or the bacterial agent of claim 3; Preferably, the composition further comprises at least one of an excipient, a diluent, a carrier, and an auxiliary material; Preferably, the composition further comprises at least one probiotic, wherein the at least one probiotic is selected from at least one of the following: Bifidobacterium spp., Lactobacillus spp., Lactococcus spp., Lactaseibacillus spp., Pediococcus acidilactici, Akkermansia, Pediococcus pentosaceus and / or Saccharomyces boulardii; Preferably, the probiotic is selected from the group consisting of Bifidobacterium adolescentis, Bifidobacterium animalis subsp. animalis, Bifidobacterium animalis subsp. lactis, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium longum subsp. longum, Bifidobacterium longum subsp. infantis, Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii subsp. Bulgaricus, Lactobacillus delbrueckii subsp. subsp. Lactis), Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus johnsonii, Lactobacillus kefiranofaciens subsp.Kefiranofaciens, Lacticaseibacillus casei, Lacticaseibacillus paracasei, Lacticaseibacillus rhamnosus, Limosilactobacillus fermentum, Limosilactobacillus reuteri, Lactiplantibacillus plantarum, Ligilactobacillus salivarius, Latilactobacillus curvatus, Latilactobacillus sakei, Streptococcus salivarius subsp.thermophilus, Lactococcus lactis subsp.lactis, Lactococcus lactis subsp.lactis biovardiacetylactis), Lactococcus cremoris, Akkermansia muciniphila;. Preferably, the auxiliary material also includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring agent; Preferably, the composition comprises at least one of a drug, a nutritional supplement, a dietary supplement, a food, and a food additive; Preferably, the composition is a solid preparation or a liquid preparation; Preferably, the dosage form of the composition is any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral liquids, ointments, emulsions, and lavage agents; Preferably, the composition further comprises a product instruction sheet.

5. A pharmaceutical composition, characterized in that Includes the following C1) and C2): C1) the Parabacteroides strain of claim 1, or a metabolite of the Parabacteroides strain of claim 1, or the culture of claim 2, or the bacterial agent of claim 3; C2) combined medications; Preferably, the combination drug includes at least one of a tumor drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug; Preferably, the tumor drug includes at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug; Preferably, the chemotherapy drug includes at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, epirubicin, and gemcitabine; Preferably, the photosensitizer includes at least one of boron dipyrrole, dihydrochlorin, and red bengal; Preferably, the photothermal agent includes at least one of noble metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials; Preferably, the immunotherapy drug includes at least one of an immune cell therapy drug and an immune checkpoint inhibitor; Preferably, the immune cell therapy drug includes at least one of a T cell therapy drug, a tumor infiltrating lymphocyte therapy drug, and a NK cell therapy drug; Preferably, the immune checkpoint inhibitor includes an inhibitor targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA; Preferably, the pharmaceutical composition comprises 1×10 3 CFU / g~1×10 13 CFU / g or 1×10 3 CFU / mL~1×10 13 CFU / mL of said Parabacteroides strain; Preferably, each gram or each mL of the pharmaceutical composition comprises at least 1×10 3 , 2×10 3 , 5×10 3 , 1×10 4 , 2×10 4 , 5×10 4 , 1×10 5 , 2×10 5 , 5×10 5 , 1×10 6 , 2×10 6 , 5×10 6 , 1×10 7 , 2×10 7 , 5×10 7 , 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , 1×10 10 , 2×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 5×10 11 , 1×10 12 , 2×10 12 , 5×10 12 , 1×10 13 colony forming units (CFU) of the Parabacteroides strain; Preferably, the Parabacteroides strain in the pharmaceutical composition is a live bacterium, an attenuated bacterium, a killed bacterium, a freeze-dried bacterium or an irradiated bacterium; Preferably, the pharmaceutical composition or the raw material of the pharmaceutical composition comprises about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, %, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% of C1); Preferably, the pharmaceutical composition or the raw material of the pharmaceutical composition comprises C1) in a mass percentage of 1-80%, 2-70%, 5-60%, 10-50%, 20-40%, 40-60%; Preferably, the pharmaceutical composition further comprises at least one of an excipient, a diluent, and a carrier; Preferably, the pharmaceutical composition further comprises an excipient; Preferably, the auxiliary material includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring agent; Preferably, the pharmaceutical composition is in a dosage form suitable for infants, children or adults; Preferably, the pharmaceutical composition is a dosage form for gastrointestinal administration or parenteral administration; Preferably, the pharmaceutical composition is an oral preparation or an injection; Preferably, the dosage form of the pharmaceutical composition is any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral liquids, ointments, emulsions, and lavage agents; Preferably, the strain is capable of at least partially proliferating in the intestinal tract of the subject; Preferably, the pharmaceutical composition further comprises a product instruction sheet.

6. A pharmaceutical combination product, characterized in that Includes standalone: a first product, wherein the first product comprises the Parabacteroides strain of claim 1, or comprises a metabolite of the Parabacteroides strain of claim 1, or comprises the culture of claim 2, or comprises the bacterial agent of claim 3; a second product, wherein the second product comprises a combination drug; Preferably, the combination drug includes at least one of a tumor drug, a metabolic disease drug, an inflammatory or autoimmune disease drug, an infectious disease drug, and a central nervous system disease drug; Preferably, the tumor drug includes at least one of a chemotherapy drug, a photosensitizer, a photothermal agent, and an immunotherapy drug; Preferably, the chemotherapy drug includes at least one of paclitaxel, camptothecin, 5-fluorouracil, cisplatin, doxorubicin, mitomycin, epirubicin, and gemcitabine; Preferably, the photosensitizer includes at least one of boron dipyrrole, dihydrochlorin, and red bengal; Preferably, the photothermal agent includes at least one of noble metal nanoparticles, organic polymers, carbon-based nanomaterials, magnetic nanomaterials, and semiconductor nanomaterials; Preferably, the immunotherapy drug includes at least one of an immune cell therapy drug and an immune checkpoint inhibitor; Preferably, the immune cell therapy drug includes at least one of a T cell therapy drug, a tumor infiltrating lymphocyte therapy drug, and a NK cell therapy drug; Preferably, the immune checkpoint inhibitor includes an inhibitor targeting at least one of PD-1, PD-L1, PD-L2, CTLA-4, TIM-3, LAG-3, TIGIT, VISTA, BTLA, CD27, CD28, CD70, CD80, CD86, CD137, CD276, KIRs, TNFRSF4, GITR, GITRL, 4-1BBL, A2aR, VTCN1, IDO, and KLRA; Preferably, the first product comprises 1×10 3 CFU / g~10 13 CFU / g or 1×10 3 CFU / mL~10 13 CFU / mL of said Parabacteroides strain; Preferably, each gram or each mL of the first product comprises at least 1×10 3 , 2×10 3 , 5×10 3 , 1×10 4 , 2×10 4 , 5×10 4 , 1×10 5 , 2×10 5 , 5×10 5 , 1×10 6 , 2×10 6 , 5×10 6 , 1×10 7 , 2×10 7 , 5×10 7 , 1×10 8 , 2×10 8 , 5×10 8 , 1×10 9 , 2×10 9 , 5×10 9 , 1×10 10 , 2×10 10 , 5×10 10 , 1×10 11 , 2×10 11 , 5×10 11 , 1×10 12 , 2×10 12 , 5×10 12 , 1×10 13 colony forming units (CFU) of the Parabacteroides strain; Preferably, the Parabacteroides strain in the first product is a live bacterium, an attenuated bacterium, a killed bacterium, a freeze-dried bacterium or an irradiated bacterium; Preferably, the first product and / or the second product further comprises at least one of an excipient, a diluent, and a carrier; Preferably, the first product and the second product independently further comprise at least one auxiliary material; Preferably, the auxiliary material includes at least one of a lubricant, a wetting agent, a binder, an emulsifier, a suspension stabilizer, a solubilizer, a preservative, a sweetener, and a flavoring agent; Preferably, the pharmaceutical combination product is a dosage form suitable for infants, children or adults; Preferably, the first product and the second product are independently in the form of a dosage form for gastrointestinal administration or a dosage form for parenteral administration; Preferably, the first product and the second product are independently oral preparations or injections; Preferably, the first product and the second product are independently any one of powder, granules, tablets, capsules, gels, suspensions, drops, pills, injections, suppositories, aerosols, oral liquids, ointments, emulsions, and lavage agents; Preferably, the Parabacteroides strain is capable of at least partially proliferating in the intestine of the subject; Preferably, the pharmaceutical combination product further comprises a product instruction sheet.

7. Use of the Parabacteroides strain according to claim 1, the culture according to claim 2, the bacterial agent according to claim 3, the composition according to claim 4, the pharmaceutical composition according to claim 5 or the pharmaceutical combination product according to claim 6 in the preparation of a medicament for preventing and / or treating at least one of the following diseases (1) to (6); (1) The disease includes at least one of tumor or cancer, metabolic disease, inflammatory or autoimmune disease, infectious disease and central nervous system disease; (2) The disease includes at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor; Preferably, the solid tumor comprises at least one of head and neck cancer, upper digestive tract cancer, lower digestive tract cancer, hepatobiliary system cancer, neuroendocrine tumor, chest cancer, bone tumor, soft tissue sarcoma, skin cancer, breast cancer, female reproductive system cancer, male reproductive system cancer, urinary system cancer, eye cancer, central nervous system cancer and endocrine system cancer; Preferably, the hematopoietic tumor includes at least one tumor of the blood, lymph and bone marrow; Preferably, the tumor or cancer comprises oral cancer, salivary gland cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, nasal cancer, paranasal sinus cancer, laryngeal cancer, esophageal cancer, esophageal-gastric junction cancer, gastric cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, anal canal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, hilar bile duct cancer, distal bile duct cancer, hepatopancreatic ampullary cancer, pancreatic cancer, gastric neuroendocrine tumor, duodenal and ampullary neuroendocrine tumor, jejunal-ileal neuroendocrine tumor, appendix neuroendocrine tumor, colorectal neuroendocrine tumor, pancreatic neuroendocrine tumor, thymic cancer, lung cancer, malignant pleural mesothelioma, angiosarcoma, desmoid tumor, Ewing sarcoma, fibrosarcoma, gastrointestinal stromal tumor, Kaposi sarcoma, leiomyosarcoma, liposarcoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, rhabdomyosarcoma , synovial sarcoma, undifferentiated pleomorphic sarcoma, cutaneous fibrosarcoma protuberans, Merkel cell carcinoma, malignant melanoma of the skin, vulvar cancer, vaginal cancer, cervical cancer, uterine corpus cancer, uterine carcinosarcoma, uterine corpus sarcoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gestational trophoblastic tumor, penile cancer, prostate cancer, testicular cancer, kidney cancer, renal pelvis cancer, ureter cancer, bladder cancer, urethral cancer, eyelid cancer, conjunctival cancer, conjunctival melanoma, uveal melanoma, retinoblastoma, lacrimal gland cancer, orbital sarcoma, lymphoma of ocular adnexa, brain cancer, spinal cord tumor, differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, parathyroid cancer, adrenocortical carcinoma, Hodgkin lymphoma, non-Hodgkin lymphoma, cutaneous lymphoma, plasma cell myeloma and leukemia; Preferably, the tumor or cancer includes a tumor or cancer caused by bacteria or viruses; Preferably, the bacteria or virus includes at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori and Fusobacterium nucleatum; (3) The disease includes metabolic diseases, such as diseases of abnormal metabolism of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia and metal ions; (4) the disease comprises an inflammatory or autoimmune disease, such as at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behcet's disease, asthma, allergic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis and Sjögren's syndrome; (5) The disease includes infectious diseases, such as diseases caused by at least one of bacteria, viruses and fungi; (6) The disease includes a central nervous system disease, such as at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder and depression; Preferably, the prevention and / or treatment of tumors comprises at least one of the following (a) to (l): (a) Inhibit tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) Improve the response rate of tumor treatment; (e) improving the efficacy of immune checkpoint inhibitors or chemotherapeutic drugs, such as improving the efficacy of anti-PD-1 antibodies or gemcitabine; (f) preventing and / or inhibiting the spread or metastasis of tumor cells; (g) reduce tumor drug resistance; (h) inhibiting HDAC activity by at least one of acetate or acetate, propionate or propionate, butyrate or butyrate, valeric acid or valerate among SCFAs; (i) inhibiting HDAC activity and / or promoting IFNβ transcription activity; (j) regulating or activating the subject's immune system; (k) Promote tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue; (m) enhancing the effect of tumor-killing immune cells; (n) Local tumor immunotherapy; (o) Relieve the immunosuppression of the tumor microenvironment.

8. Use of the Parabacteroides strain according to claim 1, the culture according to claim 2, the bacterial agent according to claim 3, the composition according to claim 4, the pharmaceutical composition according to claim 5 or the pharmaceutical combination product according to claim 6 in preventing and / or treating at least one of the following diseases (1) to (6); (1) The disease includes at least one of tumor or cancer, metabolic disease, inflammatory or autoimmune disease, infectious disease and central nervous system disease; (2) The disease includes at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor; Preferably, the solid tumor comprises at least one of head and neck cancer, upper digestive tract cancer, lower digestive tract cancer, hepatobiliary system cancer, neuroendocrine tumor, chest cancer, bone tumor, soft tissue sarcoma, skin cancer, breast cancer, female reproductive system cancer, male reproductive system cancer, urinary system cancer, eye cancer, central nervous system cancer and endocrine system cancer; Preferably, the hematopoietic tumor includes at least one tumor of the blood, lymph and bone marrow; Preferably, the tumor or cancer comprises oral cancer, salivary gland cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, nasal cancer, paranasal sinus cancer, laryngeal cancer, esophageal cancer, esophageal-gastric junction cancer, gastric cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, anal canal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, hilar bile duct cancer, distal bile duct cancer, hepatopancreatic ampullary cancer, pancreatic cancer, gastric neuroendocrine tumor, duodenal and ampullary neuroendocrine tumor, jejunal-ileal neuroendocrine tumor, appendix neuroendocrine tumor, colorectal neuroendocrine tumor, pancreatic neuroendocrine tumor, thymic cancer, lung cancer, malignant pleural mesothelioma, angiosarcoma, desmoid tumor, Ewing sarcoma, fibrosarcoma, gastrointestinal stromal tumor, Kaposi sarcoma, leiomyosarcoma, liposarcoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, rhabdomyosarcoma , synovial sarcoma, undifferentiated pleomorphic sarcoma, cutaneous fibrosarcoma protuberans, Merkel cell carcinoma, malignant melanoma of the skin, vulvar cancer, vaginal cancer, cervical cancer, uterine corpus cancer, uterine carcinosarcoma, uterine corpus sarcoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gestational trophoblastic tumor, penile cancer, prostate cancer, testicular cancer, kidney cancer, renal pelvis cancer, ureter cancer, bladder cancer, urethral cancer, eyelid cancer, conjunctival cancer, conjunctival melanoma, uveal melanoma, retinoblastoma, lacrimal gland cancer, orbital sarcoma, lymphoma of ocular adnexa, brain cancer, spinal cord tumor, differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, parathyroid cancer, adrenocortical carcinoma, Hodgkin lymphoma, non-Hodgkin lymphoma, cutaneous lymphoma, plasma cell myeloma and leukemia; Preferably, the tumor or cancer includes a tumor or cancer caused by bacteria or viruses; Preferably, the bacteria or virus includes at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori and Fusobacterium nucleatum; (3) The disease includes metabolic diseases, such as diseases of abnormal metabolism of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia and metal ions; (4) the disease comprises an inflammatory or autoimmune disease, such as at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behcet's disease, asthma, allergic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis and Sjögren's syndrome; (5) The disease includes infectious diseases, such as diseases caused by at least one of bacteria, viruses and fungi; (6) The disease includes a central nervous system disease, such as at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety disorder and depression; Preferably, the prevention and / or treatment of tumors comprises at least one of the following (a) to (o): (a) Inhibit tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) Improve the response rate of tumor treatment; (e) improving the efficacy of immune checkpoint inhibitors or chemotherapeutic drugs, such as improving the efficacy of anti-PD-1 antibodies or gemcitabine; (f) preventing and / or inhibiting the spread or metastasis of tumor cells; (g) reduce anti-tumor drug resistance; (h) inhibiting HDAC activity by at least one of acetate or acetate, propionate or propionate, butyrate or butyrate, valeric acid or valerate among SCFAs; (i) inhibiting HDAC activity and / or promoting IFNβ transcription activity; (j) regulating or activating the subject's immune system; (k) promoting tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue; (m) enhancing the effect of tumor-killing immune cells; (n) Local tumor immunotherapy; (o) Relieve the immunosuppression of the tumor microenvironment.

9. A method for treating a disease, comprising administering to a subject an effective dose of the Parabacteroides strain of claim 1, the culture of claim 2, the bacterial agent of claim 3, the composition of claim 4, the pharmaceutical composition of claim 5, or the pharmaceutical combination product of claim 6; Preferably, the disease includes at least one of tumor or cancer, metabolic disease, inflammatory or autoimmune disease, infectious disease and central nervous system disease; Preferably, the tumor or cancer comprises at least one of a solid tumor, a soft tissue tumor, a hematopoietic tumor, a glandular tumor, and a metastatic tumor; Preferably, the solid tumor comprises at least one of head and neck cancer, upper digestive tract cancer, lower digestive tract cancer, hepatobiliary system cancer, neuroendocrine tumor, chest cancer, bone tumor, soft tissue sarcoma, skin cancer, breast cancer, female reproductive system cancer, male reproductive system cancer, urinary system cancer, eye cancer, central nervous system cancer and endocrine system cancer; Preferably, the hematopoietic tumor includes at least one tumor of the blood, lymph and bone marrow; Preferably, the tumor or cancer comprises oral cancer, salivary gland cancer, nasopharyngeal cancer, oropharyngeal cancer, hypopharyngeal cancer, nasal cancer, paranasal sinus cancer, laryngeal cancer, esophageal cancer, esophageal-gastric junction cancer, gastric cancer, small intestine cancer, appendix cancer, colon cancer, rectal cancer, anal canal cancer, liver cancer, intrahepatic bile duct cancer, gallbladder cancer, hilar bile duct cancer, distal bile duct cancer, hepatopancreatic ampullary cancer, pancreatic cancer, gastric neuroendocrine tumor, duodenal and ampullary neuroendocrine tumor, jejunal-ileal neuroendocrine tumor, appendix neuroendocrine tumor, colorectal neuroendocrine tumor, pancreatic neuroendocrine tumor, thymic cancer, lung cancer, malignant pleural mesothelioma, angiosarcoma, desmoid tumor, Ewing sarcoma, fibrosarcoma, gastrointestinal stromal tumor, Kaposi sarcoma, leiomyosarcoma, liposarcoma, myxofibrosarcoma, malignant peripheral nerve sheath tumor, rhabdomyosarcoma , synovial sarcoma, undifferentiated pleomorphic sarcoma, cutaneous fibrosarcoma protuberans, Merkel cell carcinoma, malignant melanoma of the skin, vulvar cancer, vaginal cancer, cervical cancer, uterine corpus cancer, uterine carcinosarcoma, uterine corpus sarcoma, ovarian cancer, fallopian tube cancer, primary peritoneal cancer, gestational trophoblastic tumor, penile cancer, prostate cancer, testicular cancer, kidney cancer, renal pelvis cancer, ureter cancer, bladder cancer, urethral cancer, eyelid cancer, conjunctival cancer, conjunctival melanoma, uveal melanoma, retinoblastoma, lacrimal gland cancer, orbital sarcoma, lymphoma of ocular adnexa, brain cancer, spinal cord tumor, differentiated thyroid cancer, anaplastic thyroid cancer, medullary thyroid cancer, parathyroid cancer, adrenocortical carcinoma, Hodgkin lymphoma, non-Hodgkin lymphoma, cutaneous lymphoma, plasma cell myeloma and leukemia; Preferably, the tumor or cancer includes a tumor or cancer caused by bacteria or viruses; Preferably, the bacteria or virus includes at least one of hepatitis B virus, hepatitis C virus, human papillomavirus, Epstein-Barr virus, Helicobacter pylori and Fusobacterium nucleatum; Preferably, the metabolic disease includes a metabolic abnormality of at least one of amino acids, organic acids, sugars, fats, purines, pigments, blood ammonia and metal ions; Preferably, the inflammatory or autoimmune disease comprises at least one of psoriasis, psoriatic arthritis, multiple sclerosis, inflammatory bowel disease, ankylosing spondylitis, chronic obstructive pulmonary disease, glomerulonephritis, myocarditis, dry eye, uveitis, Behcet's disease, asthma, allergic dermatitis, acne, Crohn's disease, ulcerative colitis, bronchitis, allergic rhinitis, Graves' disease, Hashimoto's thyroiditis, rheumatoid arthritis, type 1 diabetes, systemic lupus erythematosus, scleroderma, glomerulonephritis, systemic vasculitis, Addison's disease, autoimmune myositis and Sjögren's syndrome; Preferably, the infectious disease includes a disease caused by at least one of bacteria, viruses and fungi; Preferably, the central nervous system disease includes at least one of stroke, schizophrenia, drug addiction, Alzheimer's disease, Parkinson's disease, anxiety and depression; Preferably, the prevention and / or treatment of tumors comprises at least one of the following (a) to (o): (a) Inhibit tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) Improve the response rate of tumor treatment; (e) improving the efficacy of immune checkpoint inhibitors or chemotherapeutic drugs, such as improving the efficacy of anti-PD-1 antibodies or gemcitabine; (f) preventing and / or inhibiting the spread or metastasis of tumor cells; (g) reduce anti-tumor drug resistance; (h) inhibiting HDAC activity by at least one of acetate or acetate, propionate or propionate, butyrate or butyrate, valeric acid or valerate among SCFAs; (i) inhibiting HDAC activity and / or promoting IFNβ transcription activity; (j) regulating or activating the subject's immune system; (k) Promote tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue; (m) enhancing the effect of tumor-killing immune cells; (n) Local tumor immunotherapy; (o) Relieve the immunosuppression of the tumor microenvironment; Preferably, the Parabacteroides strain, the culture, the bacterial agent, the composition, the pharmaceutical composition or the pharmaceutical combination product is administered at least once a day; Preferably, when the administration frequency is twice or more per day, the same dose is administered each time; Preferably, when the administration frequency is twice or more per day, each administration is at a different dose; Preferably, the administration route includes at least one of oral administration, sublingual administration, nasal administration, rectal administration, inhalation administration, transdermal administration, intraperitoneal injection, subcutaneous injection, intradermal injection, intramuscular injection, and intravenous injection.

10. A method for preparing the culture according to claim 2, characterized in that The following steps are involved: The Parabacteroides strain of claim 1 is inoculated into a fermentation medium to obtain a culture; The method further comprises at least one of the following steps: (1) centrifuging the culture to collect the fermentation medium supernatant; (2) concentrating the fermentation medium or the supernatant of the fermentation medium by at least one of evaporation, freeze-drying, dialysis, extraction, and membrane separation to obtain a concentrated product; (3) extracting the fermentation medium or the supernatant of the fermentation medium by at least one of extraction and solvent extraction; (4) Drying any one of the fermentation medium, the fermentation medium supernatant, the concentrated product, and the extract to obtain a dried product.

11. A therapeutic composition comprising any one of the following strains: Parabacteroides hominis, Parabacteroides merdae, Parabacteroides johnsonii, Parabacteroides massiliensis, Parabacteroides acidifaciens, Parabacteroides faecis, Parabacteroides bouchesdurhonensis, Parabacteroides provencensis, Parabacteroides goldsteinii, Parabacteroides gordonii, Parabacteroides timonensis, Parabacteroides chinchillae, Parabacteroides distasonis, Parabacteroides hominis; and / or pharmaceutical carrier; The composition prevents and / or treats tumors by at least one of the following (a) to (o): (a) Inhibit tumor volume growth; (b) inhibiting tumor weight increase; (c) inhibiting tumor cell growth; (d) Improve the response rate of tumor treatment; (e) improving the efficacy of immune checkpoint inhibitors or chemotherapeutic drugs, such as improving the efficacy of anti-PD-1 antibodies or gemcitabine; (f) preventing and / or inhibiting the spread or metastasis of tumor cells; (g) reduce anti-tumor drug resistance; (h) inhibiting HDAC activity by at least one of acetate or acetate, propionate or propionate, butyrate or butyrate, valeric acid or valerate among SCFAs; (i) inhibiting HDAC activity and / or promoting IFNβ transcription activity; (j) regulating or activating the subject's immune system; (k) Promote tumor cell senescence or apoptosis; (l) inhibiting angiogenesis in tumor tissue; (m) enhancing the effect of tumor-killing immune cells; (n) Local tumor immunotherapy; (o) Relieve the immunosuppression of the tumor microenvironment.

Citation Information

Patent Citations

  • Compositions and methods for inducing CD8 + T cells

    CN111886333A

  • Compositions comprising co-selected microbiota and methods for use thereof

    CN112087998A

  • Compositions comprising bacterial strains

    CN112370468A

  • Compositions comprising parabacteroides bacterial strains for treating cancer

    CN113207282A

Cited By

  • Lactobacillus casei C7-2 and application thereof in preparation of composition for conditioning / improving thyroiditis and brain function activity and protecting neurons

    CN120758430A