Composition for detecting rothia kristinae YM-6 strain, and use thereof
The use of a WGS-based molecular marker and specific primer sets for PCR enables rapid, accurate, and cost-effective detection of the Rothia kristinae YM-6 strain, addressing the limitations of existing NGS methods.
Patent Information
- Application Number
- PCT/KR2024/014864
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-01
- Filing Date
- 2024-09-30
- Publication Date
- 2025-06-05
AI Technical Summary
Current methods for detecting specific strains of microorganisms, such as the Lotia christinae YM-6 strain, using 16S rRNA gene-based next-generation sequencing (NGS) are time-consuming, expensive, and lack specificity in identifying specific strains.
A composition and method utilizing a molecular marker based on Whole Genome Sequence (WGS) data, specifically a polynucleotide sequence (sequence number 1 or its complementary sequence), to identify the Rothia kristinae YM-6 strain through nucleic acid amplification reactions like PCR, using a primer set consisting of a forward and reverse primer.
This approach allows for rapid and accurate detection of the Rothia kristinae YM-6 strain with high specificity, reducing detection time and costs compared to traditional NGS methods, and enabling differentiation from related strains or species.
Smart Images

Figure KR2024014864_05062025_PF_FP_ABST
Abstract
Description
Composition for detecting Lotia christinae YM-6 strain and use thereof
[0001] The present invention relates to a composition for identifying microorganisms at a specific strain level and to a use thereof.
[0002] The skin is the largest organ in the human body, directly exposed to the external environment. Its key function is to protect the body from external irritants and prevent moisture loss. Along with other bodily organs such as the intestines, the skin is home to a diverse array of microorganisms, including bacteria, fungi, small larvae, and viruses, all of which maintain specialized functions. These microorganisms and their entire genetic information (genome) are collectively referred to as the skin microbiome.
[0003] Skin microbiome research has become possible with the development of next-generation sequencing (NGS) analysis methods. Specifically, utilizing 16S rRNA gene primers allows for cataloging and processing the bacterial composition of the microbiome.
[0004] While these 16S rRNA gene-based NGS assays offer the advantage of detecting all microorganisms in a given environment, they currently require at least a week of analysis and have limitations in that the 16S rRNA gene alone cannot detect specific strains. Furthermore, using NGS to detect specific strains is expensive.
[0005] (Patent Document 1) KR 10-2286080 B1
[0006] The present specification relates to a molecular marker based on Whole Genome Sequence (WGS) data that can identify the Rothia kristinae YM-6 strain at the strain or species level. Using the molecular marker, the Rothia kristinae YM-6 strain can be identified relatively quickly and accurately through a nucleic acid amplification reaction such as polymerase chain reaction (PCR).
[0007] One aspect provides a composition for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P, comprising an agent capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.
[0008] Another aspect is to provide a primer set for the detection of Rothia kristinae YM-6 strain, deposited under accession number KCCM12685P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.
[0009] Another aspect is to provide a kit for detecting Rothia kristinae YM-6 strain, deposited under accession number KCCM12685P, comprising a composition according to one aspect.
[0010] Another aspect provides a method for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P using a composition, primer set, or kit according to one aspect.
[0011] One aspect provides a composition for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P, comprising an agent capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.
[0012] The Rothia kristinae YM-6 strain deposited under the above accession number KCCM12685P is known in Korean Patent Registration No. 10-2286080. The strain deposited under the above accession number KCCM12685P may be the Rothia kristinae YM-6 strain.
[0013] The polynucleotide comprising the above sequence number 1 or a complementary polynucleotide thereof may be a partial sequence of the whole genome sequence of the Lotia christinae YM-6 strain deposited under accession number KCCM12685P. The whole genome includes all genetic information of the microorganism, such as chromosomal DNA and plasmid DNA. The above sequence number 1 may be a sequence from position 5311 to position 5623 of the complete sequence of the chromosomal DNA of the YM-6 strain.
[0014] The polynucleotide comprising the above sequence number 1 or a complementary polynucleotide thereof may be a whole genome sequencing (WGS)-based molecular marker capable of identifying the Lotia christinae YM-6 strain at the strain or species level. The "molecular marker" refers to a molecule having a characteristic that can confirm the presence or state of a certain living organism or substance. For example, a specific DNA base sequence can be used as a molecular marker capable of determining the presence or absence of a specific strain. When the sequence of the above sequence number 1 or a complementary sequence thereof is present in the nucleic acid sequence of the microorganism to be analyzed, the microorganism can be identified as the Lotia christinae YM-6 strain.
[0015] In addition, since the polynucleotide comprising the above sequence number 1 or its complementary polynucleotide is a molecular marker based on whole genome sequencing (WGS), its detection specificity is significantly superior to that of the existing 16S rRNA gene-based NGS analysis method that cannot detect a specific strain. Therefore, by utilizing the above molecular marker, it is possible to distinguish the Lotia cristinae YM-6 strain from microorganisms belonging to closely related strains or closely related species that cannot be distinguished by general physiological or chemical differences.
[0016] In addition, by using a preparation capable of specifically detecting a polynucleotide consisting of the above sequence number 1 or a complementary polynucleotide thereof, a specific strain can be identified only by detecting a molecular marker of a relatively short length (e.g., 313 bp), so that time and cost can be significantly reduced compared to the existing NGS analysis method that identifies a 16S rRNA gene of several hundred to several thousand bp in length.
[0017] Therefore, a formulation capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof may be a formulation capable of detecting or identifying the Rothia kristinae YM-6 strain. The formulation may specifically detect only the Rothia kristinae YM-6 strain, distinguishing it from microorganisms having different detailed strains. Therefore, a composition according to the above aspect may be a composition for identifying the Rothia kristinae YM-6 strain deposited under accession number KCCM12685P.
[0018] The above formulation is not limited in type as long as it is a substance capable of specifically binding to the polynucleotide or its complementary polynucleotide. The formulation may be, but is not limited to, a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.
[0019] The above "primer" is a short single-stranded oligonucleotide that serves as a starting point for the production of another polymer strand complementary to the template during DNA synthesis. The primer used in the nucleic acid amplification reaction may include a primer set consisting of a forward primer and a reverse primer. The length of the primer may be, but is not limited to, 15 to 40 nt, 15 to 30 nt, 15 to 25 nt, 18 to 40 nt, 18 to 30 nt, or 18 to 25 nt.
[0020] When a nucleic acid amplification reaction is performed using a primer that specifically binds to a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof, the YM-6 strain of Lotia cristinae can be specifically identified based on whether or not an amplification product is detected.
[0021] In one specific example, the primer may be a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3.
[0022] The above "probe" refers to a DNA or RNA fragment complementary to a specific base sequence of DNA or RNA, and is labeled with a radioactive element, dye, fluorescent substance, etc., so that the presence or absence of a specific base sequence can be confirmed. The length of the probe is 10 to 1000 bp, 10 to 500 bp, 10 to 300 bp, 10 to 200 bp, 10 to 100 bp, 50 to 1000 bp, 50 to 500 bp, 50 to 300 bp, 50 to 200 bp, 50 to 100 bp, 100 to 1000 bp, 100 to 500 bp, 100 to 300 bp, 100 to 200 bp, 150 to 1000 bp, 150 to 500 bp, 150 to 300 bp, 150 to 200 bp, 200 to 1000 bp, 200 to 500 bp, It may be, but is not limited to, 200 to 300 bp, 250 to 1000 bp, 250 to 500 bp, 250 to 350 bp, or 250 to 300 bp.
[0023] When hybridization is performed using a probe that specifically binds to a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof, the YM-6 strain of Rothia christinae can be specifically identified through hybridization.
[0024] In one specific embodiment, the probe may be an oligonucleotide consisting of a sequence of at least 10, at least 20, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 250, or at least 300 consecutive nucleotides complementary to part or all of a polynucleotide comprising SEQ ID NO: 1 or a complementary polynucleotide thereof.
[0025] In one specific example, the probe may be an oligonucleotide consisting of a nucleotide sequence of 313 nt in length complementary to a polynucleotide consisting of SEQ ID NO: 1 or a complementary polynucleotide thereof.
[0026] The above primer or probe can be chemically synthesized using a known method. The primer or probe may additionally include one or more labels selected from a radioactive element, a chromophore, a chemiluminescent phosphor, a fluorophore, and a magnetic particle linked to the 5'-end or 3'-end.
[0027] The above "label" or "detectable label" may refer to any chemical moiety bound to a nucleotide or a nucleotide polymer, wherein the binding may be a covalent bond or a non-covalent bond. The detectable labels are known in the art. Non-limiting examples of the detectable labels include, 32 P or 35Radioactive elements such as S; linker molecules such as biotin, avidin, streptavidin, horseradish peroxidase (HRP), protein A, protein G, antibodies or fragments thereof, FLAG tags, and myc tags; enzymes such as peroxidase and luciferase; electron donors and acceptors; dyes such as Cy5 and Cy3; and magnetic particles (MPs) such as iron oxide nanoparticles and gold nanoparticles.
[0028] Another aspect provides a primer set for the detection of Rothia kristinae strain YM-6, deposited under accession number KCCM12685P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.
[0029] The forward primer represented by the above sequence number 2 has a length of 20 bp, a Tm (melting temperature) of about 60°C, and a GC% of about 50%.
[0030] The reverse primer represented by the above sequence number 3 is 20 bp in length, has a Tm of about 60°C, and a GC% of about 55%.
[0031] When a nucleic acid amplification reaction is performed using the above primer set, an amplification product of 313 bp in size can be detected only when the Rothia kristinae YM-6 strain is present.
[0032] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR product was synthesized for the strains Kocuria varians YM-3 and Kocuria rhizophila KACC 14744, which belong to the same Micrococcaceae family but are of different genus and species, and that a PCR product was synthesized only for the Rothia kristinae YM-6 strain. This shows that even if strains of other genera are present in the sample, only the Rothia kristinae YM-6 strain can be specifically and clearly detected and identified at the genus level.
[0033] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR product was synthesized for the Rothia koreensis KACC 17049 strain belonging to the same genus, and only the Rothia kristinae YM-6 strain synthesized a PCR product. Through this, it was confirmed that even if strains of the same genus are present in a sample, only the Rothia kristinae YM-6 strain can be specifically and clearly detected and identified at the species level.
[0034] In one embodiment, when PCR was performed using the primer sets of SEQ ID NO: 2 and SEQ ID NO: 3, it was confirmed that under one condition with the same annealing temperature and time, no PCR product was synthesized for the Rothia kristinae KACC 15198 strain belonging to the same species, and only the Rothia kristinae YM-6 strain synthesized a PCR product. Through this, it was confirmed that even if strains of the same species are present in a sample, only the Rothia kristinae YM-6 strain can be specifically and clearly detected and identified at the strain level.
[0035] Another aspect provides a kit for detecting Rothia kristinae YM-6 strain, deposited under accession number KCCM12685P, comprising a composition according to one aspect.
[0036] The above kit may additionally include reagents required for nucleic acid amplification reaction.
[0037] The nucleic acid amplification reaction described above may be performed using any nucleic acid amplification technology known in the art without limitation. The nucleic acid amplification reaction may be, for example, PCR (polymerase chain reaction). The PCR may include, but is not limited to, real-time PCR, RT-PCR (Reverse Transcriptase Polymerase Chain Reaction), qRT-PCR (quantitative Real-Time Polymerase Chain Reaction), etc. Accordingly, the kit described above may be a PCR kit.
[0038] Reagents required for the above nucleic acid amplification reaction may include DNA polymerase, dNTP, buffer solution, etc.
[0039] The above kit may additionally include a user guide describing optimal reaction performance conditions.
[0040] Another aspect provides a method for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P using a composition, primer set, or kit according to one aspect.
[0041] The above detection may be performed by one or more methods selected from, but not limited to, PCR analysis, DNA sequencing, hybridization by microarray, DAF (DNA Amplification Fingerprinting), Northern blot, and Southern blot.
[0042] In one embodiment, the method comprises the steps of isolating nucleic acids from a sample;
[0043] A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and a primer set according to one aspect; and
[0044] It may include a step of detecting an amplification product generated by the above nucleic acid amplification reaction.
[0045] The above sample may be a strain to be analyzed or a material expected to contain the strain.
[0046] The nucleic acid may be DNA or RNA. The nucleic acid may be DNA. The DNA may include genomic DNA (gDNA). The DNA may include chromosomal DNA and plasmid DNA (pDNA). The genomic DNA may refer to chromosomal DNA.
[0047] A method known in the art can be used to isolate nucleic acids from the above sample.
[0048] The nucleic acid amplification reaction described above can be used without limitation as long as it is a nucleic acid amplification technique known in the art. The nucleic acid amplification reaction may be, for example, PCR. The PCR may include, but is not limited to, real-time PCR, RT-PCR, qRT-PCR, etc.
[0049] The annealing temperature of the nucleic acid amplification reaction may be 63 to 70°C, 63 to 69°C, 64 to 70°C, 64 to 69°C, 65 to 70°C, 65 to 69°C, 66 to 70°C, 66 to 69°C, 67 to 70°C, 67 to 69°C, or about 68°C.
[0050] Detection of the above amplification product can be performed through, but is not limited to, DNA chips, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, magnetic field measurement, etc.
[0051] In the above detection step, if an amplification product of 313 bp in length is detected, it may be determined that the sample is the Rothia kristinae YM-6 strain deposited under accession number KCCM12685P, or it may be determined that the strain is present in the sample.
[0052] Therefore, the above method can be a method for identifying the Rothia kristinae YM-6 strain deposited under the accession number KCCM12685P.
[0053] Duplicate content is omitted in consideration of the complexity of this specification, and terms not otherwise defined herein have the meanings commonly used in the technical field to which the present invention belongs.
[0054] The composition according to the aspect utilizes a whole-genome sequencing (WGS)-based molecular marker, so that the Rothia kristinae YM-6 strain can be rapidly and accurately detected or identified with high detection specificity at the strain or species level.
[0055] Figure 1 shows the results of confirming the selected Rothia kristinae YM-6 detection primer pair using NCBI Primer Blast.
[0056] Figure 2 is an electrophoresis result confirming that the primer pair for detecting Rothia kristinae YM-6 can specifically detect only the target microorganism.
[0057] The following examples are provided for more detailed description. However, these examples are provided solely to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.
[0058] Example 1: Preparation of primer
[0059] Primers capable of specifically detecting Rothia kristinae YM-6 strain (accession number: KCCM12685P) were designed.
[0060] First, whole-genome sequences of microorganisms belonging to closely related strains or species that cannot be distinguished by general physiological or chemical differences were collected from the National Center for Biotechnology Information (NCBI). The target strains and comparison strains are shown in Table 1.
[0061] Genus Species Strain Target strain Rothiakristinae YM-6 Comparison strain 1 Rothiakristinae KACC 15198 Comparison strain 2 Kocuriarvarians YM-3 Comparison strain 3 Kocuriarhizophila KACC 14744 Comparison strain 4 Rothiakoreensis KACC 17049
[0062] After fragmenting the whole genome information of the strains in Table 1 into 10-500 bp units, the fragmented sequences were numbered using Linux commands. Furthermore, sequence information was collected for the remaining regions after excluding regions with identical sequences using NCBI's Nucleotide Blast. Subsequently, candidate primers were designed using primer design systems such as NCBI Primer Blast among regions containing rare sequences.
[0063] Example 2: In-silico PCR of candidate primers
[0064] Prior to producing the primers selected as candidates in Example 1, theoretical primer validation was performed through in-silico PCR using a server. The results of confirming the final selected primer pairs using NCBI Primer Blast are shown in Figure 1.
[0065] As a result, as shown in Fig. 1, the final selected primer pair can specifically detect a 313 bp long sequence from position 5311 to position 5623 of the full-length genomic DNA sequence of the YM-6 strain of Lotia christinae. The 313 bp long sequence is shown in SEQ ID NO: 1.
[0066] Example 3: Primer verification PCR performed at optimal temperature
[0067] For the primers finally selected in Example 2, a primer validation experiment was conducted via PCR using the genomic DNA (gDNA) of the target strain and comparison strain as templates at the optimal temperature. The sequences of the primer pairs are shown in Table 2 below.
[0068] Target strain direction sequence (5'->3') sequence number annealing temperature Rothia kristinae YM-6 forward TTGCATGTGTTAAGCACGCC268℃ reverse CGGTGACGTTTTCCGAGAGA3
[0069] Example 4: Confirmation of specific reaction of primers
[0070] Experiments were conducted to confirm that the final selected primers specifically bind only to the target strain.
[0071] Specifically, PCR was performed using the corresponding primer pairs for gDNA of Rothia kristinae YM-6, Rothia kristinae KACC 15198, Kocuria varians YM-3, Kocuria rhizophila KACC 14744, and Rothia koreensis KACC 17049; DNA of environmental samples; and a negative control. Total soil DNA was used as the environmental sample DNA. Sterile distilled water (SDW) was used as the negative control. The electrophoresis results of the PCR products are shown in Fig. 2.
[0072] As a result, as shown in Fig. 2, a DNA band of 313 bp was confirmed only in the PCR product using Rothia kristinae YM-6 as a sample.
[0073] The optimal PCR amplification conditions for detecting Rothia kristinae YM-6 strain are shown in Table 3 below.
[0074] Temperature Time Cycle Pre-denaturation 95℃ 3 minutes 1 cycle Denaturation 95℃ 30 seconds 30 cycles Annealing 68℃ 30 seconds Extension 72℃ 30 seconds Final Extension 72℃ 3 minutes 1 cycle Hold 4℃--
Claims
1. A composition for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P, comprising an agent capable of specifically detecting a polynucleotide consisting of sequence number 1 or a complementary polynucleotide thereof.
2. A composition according to claim 1, wherein the polynucleotide or its complementary polynucleotide is a partial sequence of the whole genome sequence of the Rothia kristinae YM-6 strain.
3. A composition according to claim 1, wherein the agent is a primer or probe that specifically binds to the polynucleotide or its complementary polynucleotide.
4. A composition according to claim 3, wherein the primer is a primer set comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.
5. A primer set for detection of Rothia kristinae YM-6 strain, deposited under accession number KCCM12685P, comprising a forward primer represented by sequence number 2 and a reverse primer represented by sequence number 3.
6. A kit for detecting Rothia kristinae YM-6 strain, deposited under accession number KCCM12685P, comprising the composition of claim 1.
7. A kit according to claim 6, further comprising a reagent necessary for a nucleic acid amplification reaction.
8. Step of isolating nucleic acid from the sample; A step of performing a nucleic acid amplification reaction using the above nucleic acid as a template and the primer set of claim 5; and Comprising a step of detecting an amplification product generated by the above nucleic acid amplification reaction, A method for detecting Rothia kristinae YM-6 strain deposited under accession number KCCM12685P.
9. A method according to claim 8, wherein the nucleic acid is DNA.
10. A method according to claim 8, wherein, when an amplification product having a length of 313 bp is detected, the sample is determined to be the Rothia kristinae YM-6 strain deposited under the accession number KCCM12685P, or the strain is determined to be present in the sample.
Citation Information
Patent Citations
Modulation of microbiota function via microbiome gene therapy to prevent, treat, or cure microbiome-related diseases or disorders
JP2023520729A
Rothia kristinae strain and skin condition improving uses of thereof
KR102286080B1