DNA methylation biomarker for diagnosing liver fibrosis and use thereof

Abstract

The present application relates to a DNA methylation biomarker for diagnosing liver fibrosis and a use thereof. By using a composition and a method of the present invention, liver fibrosis can be diagnosed, data can be obtained from a small amount of blood with very stable values based on DNA methylation, and diagnosis costs can be reduced.

Description

DNA methylation biomarkers for diagnosing liver fibrosis and their uses

[0001] The present invention relates to a DNA methylation biomarker for diagnosing liver fibrosis and its use.

[0002] The liver is a major metabolic organ in our body and has a greater regenerative capacity than other organs. However, as we age, the risk of developing chronic liver diseases such as non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), liver fibrosis, and hepatocellular carcinoma (HCC) increases due to various stress factors. Meanwhile, in 2024, the Korean Association for the Study of the Liver changed the official name of non-alcoholic fatty liver disease (NAFLD) to metabolic dysfunction-associated steatotic liver disease (MASLD). In addition, non-alcoholic steatohepatitis (NASH) was also changed to metabolic dysfunction-associated steatohepatitis (MASH).

[0003] Early detection of liver fibrosis is crucial, but existing blood tests measuring liver damage markers like ALT and AST are not very accurate. Furthermore, while imaging techniques like abdominal ultrasound can be used to measure the degree of liver fibrosis, there is a significant risk of variation depending on the measurement method.

[0004] Recently, research results have been reported that liver elasticity testing using FibroScan, a liver fibrosis scan test, can noninvasively predict liver fibrosis; however, liver elasticity test values ​​tend to differ depending on the location of the test.

[0005] In addition, magnetic resonance elastography (MRE) using magnetic resonance imaging and real-time elastography, which tests liver elasticity in real time while performing ultrasound by adding a transducer for liver elasticity testing to ultrasound, are being attempted, but improvements are needed in terms of cost and effectiveness.

[0006] Accordingly, the present inventors have developed a liver fibrosis diagnostic technology that can diagnose liver fibrosis more accurately than Fibroscan, obtain data with very stable values ​​based on DNA methylation from a small amount of blood, and reduce diagnostic costs.

[0007] [Prior Art Literature]

[0008] [Patent Document]

[0009] (Patent Document 1) Korean Patent Publication No. 10-2017-0074034

[0010] One object of the present invention is to provide a composition for diagnosing liver fibrosis.

[0011] Specifically, the present invention provides a composition for diagnosing liver fibrosis, comprising a preparation for measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0012] Another object of the present invention is to provide a kit for diagnosing liver fibrosis comprising the composition.

[0013] Another object of the present invention is to provide a method for providing information for diagnosing liver fibrosis.

[0014] Specifically, the present invention provides a method for providing information for diagnosing liver fibrosis, comprising: (a) measuring a methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 in a sample isolated from a subject; and (b) comparing the methylation level measured in step (a) with a methylation level of a CpG site of the same gene in a control sample.

[0015] Another object of the present invention is to provide a preparation for use in diagnosing liver fibrosis, which measures the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0016] Another object of the present invention is to provide a use of a preparation for measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101, for the manufacture of a composition or kit for diagnosing liver fibrosis.

[0017] One aspect of the present invention is a composition for diagnosing liver fibrosis, comprising a formulation for measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0018] Liver fibrosis stages are divided into no fibrosis (F0), mild fibrosis (F1), significant fibrosis (F2 or higher), advanced fibrosis (F3 or higher), and cirrhosis (F4) according to the NASH CRN fibrosis staging system.

[0019] As used herein, “liver fibrosis” may include cirrhosis.

[0020] In one embodiment, the liver fibrosis of the present invention may be, but is not limited to, advanced liver fibrosis of F≥3.

[0021] In one embodiment, the liver fibrosis of the present invention may be, but is not limited to, liver fibrosis accompanied by non-alcoholic steatohepatitis, specifically, liver fibrosis of F≥3 accompanied by non-alcoholic steatohepatitis.

[0022] In this study, non-alcoholic fatty liver disease (NAFLD) and metabolic fatty liver disease (MASLD) can be used interchangeably, and non-alcoholic steatohepatitis (NASH) and metabolic steatohepatitis (MASH) can also be used interchangeably.

[0023] In one embodiment, the formulation may be a formulation that measures the methylation level of a CpG site of one or more (e.g., 1, 2, 3 or 4) genes selected from the group consisting of CLEC11A, LTBP4, TMC1 and NPTX2.

[0024] In one embodiment, the formulation may be a formulation that measures the methylation level of CpG sites of the genes CLEC11A, LTBP4, TMC1 and NPTX2.

[0025] In the present specification, the methylation level of CpG sites of one or more (e.g., 1, 2, 3, 4, 5, 6 or 7) genes selected from the group consisting of ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 may be associated with liver aging.

[0026] In one embodiment, the formulation may be a formulation that measures the methylation level of CpG sites of the genes ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0027] As used herein, "methylation" refers to the attachment of a methyl group to a base constituting DNA. Specifically, in the present invention, methylation refers to methylation that occurs at a cytosine at a specific CpG site of a specific gene. When methylation occurs, the binding of transcription factors is hindered, thereby suppressing the expression of a specific gene. Conversely, when unmethylation or hypomethylation occurs, the expression of a specific gene is increased. DNA methylation is the most well-known epigenetic change that occurs when a methyl group is added to the 5'-position of a cytosine at a CpG site. Because DNA methylation changes exist in DNA, they are easy to detect, are more stable than protein or RNA markers, and occur at a specific location in a gene, making analysis easy.

[0028] In this specification, any CpG site within each gene can be used as the site for measuring methylation levels without limitation. For example, methylation of CpGs located in one or more of the promoter, 5' UTR, 3' UTR, intron, and exon of each gene can be measured, but is not limited thereto.

[0029] In one implementation, the methylation level of each gene can be measured using fragments containing the CpG sites of each gene. The fragment containing the CpG site can refer to a fragment that has selectivity and specificity for the gene, such that it can represent the gene among fragments containing the CpG site of the gene. Therefore, by measuring the methylation level of a fragment containing the CpG site of any gene, the methylation level of the gene can be compared, thereby diagnosing the target disease.

[0030] Furthermore, since the locations of CpG sites in any gene are known in the art, those skilled in the art can appropriately select fragments containing CpG sites within a gene to achieve the desired effects of the present invention, or utilize fragments containing CpG sites known to represent any gene in the art. Furthermore, agents that measure the methylation level of these fragments can be purchased and compared to the methylation level of the desired gene.

[0031] In one embodiment, the CLEC11A gene may comprise a base sequence of SEQ ID NO: 1, the LTBP4 gene may comprise a base sequence of SEQ ID NO: 2, the TMC1 gene may comprise a base sequence of SEQ ID NO: 3, the NPTX2 gene may comprise a base sequence of SEQ ID NO: 4, the ELOVL2 gene may comprise a base sequence of SEQ ID NO: 5, the FHL2 gene may comprise a base sequence of SEQ ID NO: 6, the SH2B2 gene may comprise a base sequence of SEQ ID NO: 7, the LOC107984784 gene may comprise a base sequence of SEQ ID NO: 8, the LINC00672 gene may comprise a base sequence of SEQ ID NO: 9, or the LINC02101 gene may comprise a base sequence of SEQ ID NO: 10. That is, liver fibrosis can be diagnosed by measuring the methylation level of CpG sites within one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) base sequences of sequence numbers 1 to 10.

[0032] The term “measuring methylation level” in this specification refers to measuring the degree of methylation of a nucleic acid sequence, and specifically, may mean measuring the amount of methylation present in a DNA base sequence of a target DNA methylation gene within the entire genomic region or some non-genomic region.

[0033] In one implementation, the methylation level of CpG sites of a gene can be measured at the genome level.

[0034] In one embodiment, the agent for measuring the methylation level of a CpG site of a gene may include, but is not limited to, bisulfite or a salt thereof, a methylation-sensitive restriction enzyme, a primer that specifically binds to a sequence comprising a CpG site of the gene, a probe that can hybridize to a sequence comprising a methylated CpG site of the gene, a methylated CpG binding domain, or an antibody or aptamer that specifically binds to methylcytosine.

[0035] In this specification, a methylation-sensitive restriction enzyme is a restriction enzyme that can specifically detect methylation of a CpG site, and may contain CG as a recognition site of the restriction enzyme. Examples thereof include, but are not limited to, SmaI, SacII, EagI, HpaII, MspI, BssHII, BstUI, NotI, etc. Depending on methylation or unmethylation at C of the restriction enzyme recognition site, whether or not the restriction enzyme cuts is different, and this can be detected through PCR or Southern blot analysis. Other methylation-sensitive restriction enzymes other than the above restriction enzymes are well known in the art.

[0036] In this specification, primers can be preferably designed according to the sequence of a specific CpG site to be analyzed for methylation, and can be a primer pair that can specifically amplify cytosine that is methylated and not modified by bisulfite, and a primer pair that can specifically amplify cytosine that is not methylated and modified by bisulfite.

[0037] In one embodiment, when an antibody or aptamer that specifically binds to a methylated CpG binding domain or methylcytosine is used as a preparation for measuring the methylation level, the methylated DNA can be immunoprecipitated using these, and then the methylation of a specific CpG site can be confirmed through Southern blot, PCR, microarray, or sequencing. In addition, a substrate, an appropriate buffer solution, a chromogenic enzyme or fluorescent substance label, a secondary antibody labeled with a chromogenic enzyme or fluorescent substance, and a chromogenic substrate can be used for immunological detection or quantification of the antibody. In the above, the substrate may be a nitrocellulose membrane, a plate synthesized with polyvinyl resin, a plate synthesized with polystyrene resin, a glass slide glass, etc., the chromogenic enzyme may be peroxidase, alkaline phosphatase, etc., the fluorescent substance may be FITC, RITC, etc., the chromogenic substrate may be ABTS (2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid)), OPD (o-phenylenediamine), or TMB (tetramethyl benzidine), and other labeling methods may be used, but are not limited thereto.

[0038] The term “diagnosis” as used herein includes determining a subject’s susceptibility to a particular disease or condition, determining whether a subject has a particular disease or condition, determining a prognosis for a subject having a particular disease or condition, or monitoring the same.

[0039]

[0040] Another aspect of the present invention is a kit for diagnosing liver fibrosis, comprising the composition for diagnosing liver fibrosis.

[0041] In one embodiment, the kit of the present invention comprises:

[0042] (i) a preparation for measuring the methylation level of a CpG site of a target gene (e.g., a plurality of primers, probes, or antisense nucleotides capable of hybridizing to the target gene or a fragment thereof; a methylated CpG binding domain; and / or an antibody or aptamer that specifically binds to methylcytosine);

[0043] (ii) a container suitable for containing a preparation for measuring the methylation level of a CpG site of the above gene and a biological sample (e.g., nucleic acid isolated from the biological sample);

[0044] (iii) means for detecting hybridization or binding of (ii); and / or

[0045] Optionally (iv) may include instructions for use and interpretation of kit results.

[0046] The kit of the present invention may also contain other components, including a hybridization solution packaged in a separate container, in which the nucleic acid of the target gene can be hybridized with a plurality of primers, probes, or antisense nucleotides.

[0047] Specifically, the kit of the present invention may be comprised of one or more different component compositions, solutions, or devices suitable for the analytical method. For example, the kit of the present invention may be an RT-PCR (Reverse Transcription Polymerase Chain Reaction) kit or a DNA chip kit. In addition to the above formulations, the kit of the present invention may additionally include a polymerase, agarose, or a buffer solution required for electrophoresis.

[0048] In one embodiment, the kit of the present invention may comprise a nucleic acid chip (CHIP) or gene panel having immobilized probes capable of hybridizing or binding to a gene having a CpG site or a fragment thereof having a CpG site.

[0049] In one embodiment, the kit of the present invention may include a computer having a built-in agent, device, and algorithm for measuring the methylation level of a CpG site of a target gene or a fragment thereof, and the algorithm may be used to correlate the result of measuring the level of the target gene with the diagnosis of the target disease.

[0050]

[0051] Another aspect of the present invention is a method for providing information for diagnosing liver fibrosis.

[0052] Specifically, the method is a method for providing information for diagnosing liver fibrosis, comprising the steps of: (a) measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 in a sample isolated from a subject; and (b) comparing the methylation level measured in step (a) with the methylation level of a CpG site of the same gene in a control sample. The liver fibrosis, methylation, the site for measuring the methylation level, the measurement of the methylation level of the CpG site, the diagnosis, etc. are as described above.

[0053] In one embodiment, the genes measuring the methylation level of a CpG site may be one or more (e.g., 1, 2, 3 or 4) genes selected from the group consisting of CLEC11A, LTBP4, TMC1 and NPTX2.

[0054] As an example, the genes measuring the methylation level of CpG sites may be CLEC11A, LTBP4, TMC1 and NPTX2.

[0055] In the present specification, the methylation level of CpG sites of one or more (e.g., 1, 2, 3, 4, 5, 6 or 7) genes selected from the group consisting of ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 may be associated with liver aging.

[0056] As an example, the genes measuring the methylation level of a CpG site may be genes of ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0057] In one embodiment, the CpG site for diagnosing liver fibrosis may include, but is not limited to, a CpG site within any one of the base sequences of SEQ ID NOs: 1 to 10.

[0058] In one embodiment, the step of measuring the methylation level can be performed by at least one selected from the group consisting of PCR, methylation-specific PCR (methylation-specific polymerase chain reaction), real-time methylation-specific PCR (real-time methylation-specific polymerase chain reaction), MethyLight PCR, MehtyLight digital PCR, EpiTYPER, PCR using methylated DNA-specific binding protein, methyl PNA-PCR, quantitative PCR, DNA chip, pyrosequencing, bisulfite sequencing, Southern blot, RLGS (Restriction landmark genomic scanning), MS-SnuPE (Methylation-sensitive single-nucleotide primer extension), CpG microarray, COBRA (Combined bisulfite-restriction analysis), MIRA (methylated-CpG island recovery assay), mass spectrometry, and immunoprecipitation using a methylated CpG binding domain or an anti-methylcytosine antibody.

[0059] In one embodiment, the method of the present invention may further include a step of determining liver fibrosis when the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, ELOVL2, FHL2, SH2B2, and LINC00672 increases compared to a control group, or when the methylation level of a CpG site of one or more genes selected from the group consisting of TMC1, NPTX2, LOC107984784, and LINC02101 decreases compared to a control group.

[0060] In one embodiment, the method of the present invention may further include a step of determining liver fibrosis and liver aging when the methylation level of the CpG site of one or more (e.g., 1, 2, 3, or 4) genes selected from the group consisting of ELOVL2, FHL2, SH2B2, and LINC00672 increases compared to a control group, or when the methylation level of the CpG site of one or more (e.g., 1 or 2) genes selected from the group consisting of LOC107984784 and LINC02101 decreases compared to a control group.

[0061] As used herein, the term “increased methylation level of a gene” or “increased methylation level of a CpG site of a gene” means that the methylation level in a sample of a subject is measurably and significantly increased compared to a control group, and may mean, for example, an increase of about 1.1 times or more, for example, 1.1 to 2.5 times, 1.1 times, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times, 1.7 times, 1.8 times, 1.9 times, or 2 times or more.

[0062] As used herein, the term “decreased methylation level of a gene” or “decreased methylation level of a CpG site of a gene” means that the methylation level in a sample of a subject is measurably and significantly reduced compared to a control group, for example, by about 0.9 times or less, for example, by 0.1 times to 0.9 times, 0.9 times, 0.8 times, 0.7 times, 0.6 times, 0.5 times, 0.4 times, 0.3 times, 0.2 times, or 0.1 times or less.

[0063] In one embodiment, the method of the present invention can be performed using a plurality of panels.

[0064] In one embodiment, the control group when diagnosing liver fibrosis may be, but is not limited to, a normal subject, a patient with non-alcoholic fatty liver disease, a subject with FO to F2, or a patient with non-alcoholic steatohepatitis with FO to F2.

[0065] As used herein, the term "subject" includes, without limitation, any subject capable of suffering from liver fibrosis, but may be a mammal, including, for example, a human.

[0066] As used herein, "sample" may refer to a sample obtained from a subject. Depending on the type of analysis being performed, the sample may encompass a wide range of samples obtained from individuals, body fluids, cell lines, tissue cultures, DNA isolation, and the like, including, for example, blood, serum, plasma, saliva, stool, urine, cells, tissues, biopsies, paraffin-embedded tissues, and fine needle aspiration specimens. In one embodiment, the sample may be derived from, but is not limited to, blood, plasma, serum, and / or liver.

[0067]

[0068] Another aspect of the present invention is a use of a preparation for diagnosing liver fibrosis, which measures the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0069] The above liver fibrosis, methylation, CpG site, methylation level measurement, preparation, diagnosis, etc. are as described above.

[0070]

[0071] Another aspect of the present invention is the use of a formulation for measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 for the manufacture of a composition or kit for diagnosing liver fibrosis.

[0072] The above liver fibrosis, methylation, CpG site, methylation level measurement, preparation, diagnosis, kit, etc. are as described above.

[0073] The composition and method of the present invention can diagnose liver fibrosis, obtain data with very stable values ​​based on DNA methylation from a small amount of blood, and have the effect of reducing diagnostic costs.

[0074] Figure 1 is a diagram showing the process of searching for blood DNA methylation markers for detection of liver fibrosis.

[0075] Figure 2 is a diagram showing the correlation between CLEC11A and liver fibrosis.

[0076] - A and B are diagrams analyzing the degree of methylation of CLEC11A using the Infinium 850K methylation array in blood samples and liver samples, respectively.

[0077] - C is a diagram analyzing the degree of methylation of CLEC11A using pyrosequencing in blood samples.

[0078] - D is a diagram showing the ROC (Receiver Operating Characteristics) curve for CLEC11A.

[0079] Figure 3 is a diagram showing the correlation between LTBP4 and liver fibrosis.

[0080] - A and B are diagrams analyzing the degree of methylation of LTBP4 using the Infinium 850K methylation array in blood samples and liver samples, respectively.

[0081] - C is a diagram analyzing the degree of methylation of LTBP4 using pyrosequencing in blood samples.

[0082] - D is a diagram showing the ROC curve for LTBP4.

[0083] Figure 4 is a diagram showing the correlation between TMC1 and liver fibrosis.

[0084] - A and B are diagrams analyzing the methylation level of TMC1 using the Infinium 850K methylation array in blood samples and liver samples, respectively.

[0085] - C is a diagram analyzing the degree of methylation of TMC1 using pyrosequencing in blood samples.

[0086] - D is a diagram showing the ROC curve for TMC1.

[0087] Figure 5 is a diagram showing the correlation between NPTX2 and liver fibrosis.

[0088] - A and B are diagrams analyzing the degree of methylation of NPTX2 using the Infinium 850K methylation array in blood samples and liver samples, respectively.

[0089] - C is a diagram analyzing the degree of methylation of NPTX2 using pyrosequencing in blood samples.

[0090] - D is a diagram showing the ROC curve for NPTX2.

[0091] Figure 6 is a diagram showing ROC curves for CLEC11A, LTBP4, TMC1, and NPTX2.

[0092] Figure 7 is a diagram showing the correlation between ELOVL2 and fibrosis (A and B) and liver aging (C).

[0093] Figure 8 is a diagram showing the correlation between FHL2 and fibrosis (A and B) and liver aging (C).

[0094] Figure 9 is a diagram showing the correlation between SH2B2 and fibrosis (A and B) and liver aging (C).

[0095] Figure 10 is a diagram showing the correlation between LOC107984784 and fibrosis (A and B) and liver aging (C).

[0096] Figure 11 is a diagram showing the correlation between LINC00672 and fibrosis (A and B) and liver aging (C).

[0097] Figure 12 is a diagram showing the correlation between LINC02101 and fibrosis (A and B) and liver aging (C).

[0098] Figure 13 is a diagram showing ROC curves for ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

[0099] Hereinafter, the present invention will be described in more detail through experimental examples and examples. These experimental examples and examples are intended solely to illustrate the present invention, and the scope of the present invention is not to be construed as being limited by these experimental examples and examples.

[0100]

[0101] Experimental Example 1. DNA Methylation Microarray Experiment and Data Analysis Method

[0102]

[0103] The EPIC BeadChip (Illumina) was used for methylation analysis experiments according to the manufacturer's instructions. Specifically, 1 μg of genomic DNA collected from whole blood was treated with 20 μL of sodium bisulfite solution included in the EZ DNA Methylation-Gold Kit (Zymo Research, Orange, CA). The bisulfite-modified DNA (4 μL) was amplified using the Infinium Methylation Assay kit (Illumina). The amplified DNA was hybridized to the EPIC BeadChip and scanned with the Illumina iSCAN system. CpG methylation values ​​were calculated as mean-β values ​​using the minfipackage (version 1.26.2) in R software, and functional normalization was used to eliminate technical variations. Measurements with a detection p-value less than 0.05 were considered to have a signal significantly higher than background.

[0104]

[0105] Experimental Example 2. DNA methylation analysis using pyrosequencing

[0106]

[0107] Pyrosequencing technology was used to verify the selected DNA methylation markers. Specifically, 1 μg of total DNA collected from whole blood was subjected to bisulfite conversion using the EZ DNA Methylation-Gold Kit (Zymo Research, California, USA). Each sample was eluted with 20 μL of the kit's elution buffer. Next, 2 μL of the bisulfite-modified DNA was added to 15 μL of a PCR mixture containing the primer set and a 2x master mix (Thermo Scientific, Massachusetts, USA) and amplified using a SimpliAmp Thermal Cycler (AppliedBiosystems, MA, USA).

[0108] For pyrosequencing, forward, reverse, and sequencing primers were designed using PyroMark Assay Design 2.0 (Qiagen, Hilden, Germany). Standard pyrosequencing was then performed. Specifically, 10 μL of PCR product was immobilized on 3 μL of PyroMark Q48 Magnetic Beads (Qiagen, Hilden, Germany) and annealed with sequencing primers at 80°C for 10 min. Sequence analysis was performed on a PyroMark Q48 Autoprep instrument using the PyroMark Q48 Advanced CpG Reagent Kit according to the manufacturer's instructions (Qiagen, Hilden, Germany). Finally, the generated pyrograms were analyzed using the PyroMark Q48 Autoprep.

[0109]

[0110] Example 1: Exploration of DNA methylation markers in blood for detection of liver fibrosis.

[0111]

[0112] DNA methylation was analyzed in blood derived from normal controls (n=50), NAFL patients (n=55), NASH_F0-F2 patients (n=79), and NASH_F3-F4 patients (n=16) of the non-alcoholic fatty liver disease (NAFLD) cohort (Table 1) according to Experimental Example 1 (Fig. 1).

[0113]

[0114]

[0115] Based on the integrated analysis of the generated DNA methylation data, transcriptome data, and clinical data (NAS, Fibrosis, etc.), DNA methylation markers with significantly increased or decreased methylation of CpG sites in DNA specific to NASH with fibrosis stage (F; NASH CRN fibrosis staging system) ≥3 were selected (Tables 2 and 3).

[0116] DNA Methylation MarkerBiological RolecgIDGenomicCoordinates*RefGene_GroupCLEC11AGrowth factorcg07809484chr19:512319683' CpG IslandLTBP4TGFβ binding proteincg06399029chr19:41102791TSS1500TMC1Transmembrane channel-like proteincg22154765chr9:752006815'UTRNPTX2Neuronal petraxin, synaptic proteincg05705168chr7:98198475OpenSea

[0117] *Human GRCh37 / hg19 assembly.

[0118]

[0119] DNA methylation marker cgID forward direction SEQ ID NO: CLEC11Acg07809484CGAGGTACTCTGGAAAATGTAGTCCTGTCACGCGCCCACGGGTAGGAAAACCCCAAGTCG[CG]AAGCCTTAACATTCAACTCACGTTTGGATCTCTCAGACGAGAGTTTTTCAAAAC AGGTGC1LTBP4cg06399029GGAGCAGAGAGCTGAGGACTGCCAGATGGAGTCCAGCTTAGGGGACCCTGCCCCCAACCC[CG]CTCCCGTATCCCTCCCATTTTTAAGCACCCCTACGCCTGGGACCTCTGTTCCACGA GAAG2TMC1cg22154765GTGGAGAAGTTATTGGGTCATATAGTGATGGTGTGCAGATAGGACCTGGTGTGTGAGTTGA[CG]AGGAGCCATTGCCATTCAGCCATCAAGAATCATGATGTGTGTTGTGTAGGAATGGAGAG G3NPTX2cg05705168TGAAGCTGAGTCTCTGGTCTCTGATCATGGCTTACTCCTCCCAGATGACGGCAGCATTGA[CG]GTGAGTGTGTGTGCCCCTCAGCTCACAGCCAGGACGAGCCTATTAAAAATGCCCCTGCAG4

[0120]

[0121] Example 2: Correlation Analysis between Selected Markers and Liver Fibrosis

[0122]

[0123] For CLEC11A, LTBP4, TMC1, and NPTX2 selected in Example 1, the degree of methylation was analyzed using the Infinium 850K methylation array in blood and liver samples. As a result, CLEC11A and LTBP4 showed increased methylation in NASH of F3 or higher compared to normal controls, NAFL, and NASH of FO to F2 (Figs. 2 and 3), and TMC1 and NPTX2 showed decreased methylation in NASH of F3 or higher compared to normal controls, NAFL, and NASH of FO to F2 (Figs. 4 and 5).

[0124] The results of pyrosequencing using blood were also confirmed to be identical to the results of the Infinium 850K methylation array (Figs. 2 to 5).

[0125] The AUROCs of CLEC11A, LTBP4, TMC1, and NPTX2 were 0.7985, 0.6996, 0.7792, and 0.7863, respectively (Figs. 2 to 5), and the AUROC for the combination of the four markers was 0.8279, confirming excellent diagnostic ability (Fig. 6).

[0126]

[0127] Example 3: Exploration of DNA methylation markers in blood for the diagnosis of liver fibrosis and aging.

[0128]

[0129] To explore markers for diagnosing liver fibrosis and aging in blood, DNA methylation was analyzed in blood derived from normal controls (n=50), non-alcoholic fatty liver disease (NAFL) patients (n=55), NASH_F0-F2 patients (n=79), and NASH_F3-F4 patients (n=16) of the NAFLD cohort (Table 1) according to Experimental Example 1 (Fig. 1).

[0130]

[0131] Based on the integrated analysis of the generated DNA methylation data, transcriptome data, and clinical data (such as fibrosis), DNA methylation markers with significantly increased or decreased methylation of CpG sites in DNA were selected according to liver fibrosis of F≥3 and aging (Tables 4 and 5).

[0132] DNA MethylationMarkerBiological FunctioncgIDGenomicCoordinates*RefGene_GroupELOVL2ELOVL Fatty Acid Elongasecg16867657chr6:11044877TSS200FHL2Four And A Half LIM Domainscg17268658chr2:1060157455'UTRSH2B2SH2B Adaptor Proteincg12315284chr7:1019363185'UTRLOC107984784Uncharacterizedcg09083519chr15:62496764OpenSeaLINC00672Long Intergenic Non-Protein Coding RNAcg08388455chr17:370818755'UTRLINC02101Long Intergenic Non-Protein Coding RNAcg25116600chr5:57368421OpenSea

[0133] *Human GRCh37 / hg19 assembly.

[0134]

[0135] DNA methylation marker cgID forward direction SEQ ID NO:ELOVL2cg16867657CCGCGGCGTCCCCTGCCGGCCGGGCGGCGATTTGCAGGTCCAGCCGGCGCCGGTTTCGCG[CG]GCGGCTCAACGTCCACGGAGC CCCAGGAATACCCACCCGCTGCCCAGATCGGCAGCCGCT5FHL2cg17268658TTTGCCAGGGCTCCTTTCTTCGTGCCCTCCGGGTCTTGGGAGCACAGTAGTTAT CGGGAG[CG]TCGCCTCCGGCGTGGGCTCTCGGGGCCGAGTTTCGGACGAGGCCTGGGCGCGGTGGCAGG6SH2B2cg12315284TGGTGCTGGGGAGGAGGTGGGGGGTGCCAGCTGGAGGTGGGCGGGGCTCCTGCCTCTCCC[CG]CCCCCAGGGCCACCGCCCACTGTGCCGCGCATCGATTGGTCGCGGGCCCATTAGCTGGGG7LOC10 7984784cg09083519AAATGGTGGATGGTAAACACACATATATTTCAGTCAGGAAGGAAACCTCACCCAACACTTG[CG]ATTTTTTGACTTTATTATAGCCATTC TGACTGGTGTAAGGGTGATATCTCATTGTGGTTTT8LINC00672cg08388455AGGGGGAGGGGGAAAGAACCAGGGCTGAGCTGTGGAGTGAAGGGGAGCCATTTCT CTCCAC[CG]ACTGCAACCTCCGTGCTCACAGCTCACGGTTCACCAGAATCCAGGGGGCTTGGTCGGCCTA9LINC02101cg25116600CATGCTGTTTAATATCCAGAGTTCCTTTCATGAACTGTCACATGCTTAGGTTGACACAGA[CG]CTAACTTAATTAAAGCCTCAGGGAGCACATGTATTATCCACTATAACTGGCCCTTCATTG10

[0136]

[0137] Example 4: Correlation Analysis of Selected Markers with Liver Fibrosis and Aging

[0138]

[0139] For ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 selected in Example 3, the degree of methylation was analyzed in blood samples using the Infinium 850K methylation array. As a result, it was confirmed that ELOVL2, FHL2, SH2B2, and LINC00672 showed increased methylation in liver fibrosis grade F3 or higher compared to liver fibrosis grades FO to F2, and that methylation increased in NASH grade F3 or higher compared to normal controls, NAFL, and NASH grades FO to F2, and that methylation increased with increasing age (Figs. 7 to 9 and 11). LOC107984784 and LINC02101 were confirmed to have reduced methylation in liver fibrosis grade F3 or higher compared to liver fibrosis grades FO to F2, and to have reduced methylation in NASH grade F3 or higher compared to normal controls, NAFL, and NASH grades FO to F2, and to have reduced methylation with increasing age (Figs. 10 and 12). The AUROC for the combination of six markers, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101, was 0.96, confirming excellent diagnostic ability (Fig. 13).

[0140]

[0141] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical concept or essential characteristics. In this regard, it should be understood that the experimental examples and embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

A composition for diagnosing liver fibrosis, comprising a preparation for measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101.

2. In paragraph 1, The CLEC11A gene contains the base sequence of sequence number 1, or The LTBP4 gene contains the base sequence of sequence number 2, or The TMC1 gene contains the base sequence of sequence number 3, or The NPTX2 gene contains the base sequence of sequence number 4, or The ELOVL2 gene contains the base sequence of sequence number 5, or The FHL2 gene contains the base sequence of sequence number 6, or The SH2B2 gene contains the base sequence of sequence number 7, or The LOC107984784 gene contains the base sequence of sequence number 8, or The LINC00672 gene contains the base sequence of sequence number 9, or A composition comprising the LINC02101 gene having a base sequence of sequence number 10.

3. A composition according to claim 1, wherein the methylation level of a CpG site of one or more genes selected from the group consisting of ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 is associated with liver aging.

4. In the first paragraph, a composition comprising a preparation for measuring the methylation level of the CpG site of the gene, bisulfite or a salt thereof, a methylation-sensitive restriction enzyme, a primer that specifically binds to a sequence including the CpG site of the gene, a probe that can hybridize to a sequence including the methylated CpG site of the gene, a methylated CpG binding domain, or an antibody or aptamer that specifically binds to methylcytosine.

5. A composition according to claim 1, wherein the liver fibrosis is liver fibrosis of F≥3.

6. A composition according to claim 1, wherein liver fibrosis is accompanied by non-alcoholic steatohepatitis.

7. A kit for diagnosing liver fibrosis, comprising a composition according to any one of claims 1 to 6. 8.(a) a step of measuring the methylation level of a CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, TMC1, NPTX2, ELOVL2, FHL2, SH2B2, LOC107984784, LINC00672, and LINC02101 in a sample isolated from a subject; and (b) a method for providing information for diagnosing liver fibrosis, comprising a step of comparing the methylation level measured in step (a) with the methylation level of a CpG site of the same gene in a control sample.

9. A method for determining liver fibrosis in claim 8, wherein the methylation level of the CpG site of one or more genes selected from the group consisting of CLEC11A, LTBP4, ELOVL2, FHL2, SH2B2, and LINC00672 increases compared to the control group, or the methylation level of the CpG site of one or more genes selected from the group consisting of TMC1, NPTX2, LOC107984784, and LINC02101 decreases compared to the control group.

10. In the 8th paragraph, the step of measuring the methylation level is performed by at least one selected from the group consisting of PCR, methylation-specific PCR, real time methylation-specific PCR, MethyLight PCR, MehtyLight digital PCR, EpiTYPER, PCR using methylated DNA-specific binding protein, methyl PNA-PCR, quantitative PCR, DNA chip, pyrosequencing, bisulfite sequencing, Southern blot, RLGS (Restriction landmark genomic scanning), MS-SnuPE (Methylation-sensitive single-nucleotide primer extension), CpG microarray, COBRA (Combined bisulfite-restriction analysis), MIRA (methylated-CpG island recovery assay), mass spectrometry, and immunoprecipitation using a methylated CpG binding domain or an anti-methylcytosine antibody.

11. A method according to any one of claims 8 to 10, wherein the sample is derived from blood, plasma, serum or liver of the subject.

Images