Target gene for controlling fusarium ear blight and dsrna for controlling fusarium ear blight targeting same

Abstract

The present invention is premised on the genes FGSG_10360, FGSG_13150, and FGSG_06123 being essential genes for the growth of Fusarium graminearum. In the present invention, dsRNA for the essential genes are provided together with the genes to contribute to the inhibition of the expression of the genes FGSG_10360, FGSG_13150, and FGSG_06123. According to the present invention, it is possible to develop a Fusarium graminearum-targeting antifungal agent that targets FGSG_10360, FGSG_13150, and FGSG_06123. The dsRNA according to the present invention can be effectively used in the development of an RNAi-based therapeutic agent for Fusarium ear blight.

Description

Target gene for controlling red mold disease and DSRNA targeting the same for controlling red mold disease

[0001] The present invention provides an essential gene sequence that plays a vital role in the survival of Fusarium graminearum, and provides a dsRNA that targets this gene and inhibits its expression. Using the dsRNA of the present invention, the expression of the target gene can be effectively inhibited, thereby controlling Fusarium graminearum disease.

[0002] This invention was carried out with the support of the individual basic research project "Study on the oxidative stress response mechanism of plant pathogenic fungi" (Project ID: 1711181045, Project No.: 2021R1C1C1004200) supported by the Ministry of Science and ICT.

[0003] Among the ascomycetes of the genus Fusarium, the group commonly referred to as "red molds" includes Fusarium graminearum, F. culmorum, F. avenacium, Fusarium asiaticum, and Fusarium boothii. Of these, F. graminearum is no longer classified as a single biological species based on traditional morphological classification. Instead, it is classified as a species complex consisting of at least 16 phylogenetically distinct species worldwide. This red mold belonging to the Fusarium graminearum species complex is a representative plant pathogenic fungus distributed around the world, and it causes red mold disease symptoms (Fusarium Head Blight) in cereals such as barley and wheat, as well as rice, as well as ear rot and root rot in corn.

[0004] In addition, this fungus is important in agriculture, feed, and food industries because it produces a large amount of secondary metabolites that are harmful to humans and animals, such as trichothecenes, zearalenone, and aurofusarin. However, the continuous occurrence of rice head blight caused by red mold and the resulting yield reduction are causing significant economic damage. However, research on plant diseases caused by Fusarium graminearum species complex worldwide has been limited to cereals (barley, wheat) and corn, and research on head blight in rice, including basic plant pathology, is almost non-existent. Control of red mold disease mostly relies on DMI (Demethylation Inhibiting) fungicides that damage the cell wall components of the fungus. However, with the recent emergence of resistance to chemical agents and increasing interest in biological control or green bio businesses based on RNAi, red mold disease also requires new disease control targets and new control methods.

[0005] RNA interference (RNAi), a recently emerging technology, is a gene silencing phenomenon that occurs when double-stranded RNA (dsRNA) enters cells. Once dsRNA is delivered into the cell, it is recognized by the enzyme Dicer, which cleaves it into short nucleotides of approximately 20 nucleotides. The cleaved dsRNA, called siRNA (short interfering RNA), forms the RNA-induced silencing complex (RISC) with various nucleotide-degrading enzymes. The antisense strand (guide strand) of the siRNA loaded into RISC then cleaves the complementary sequence of the target mRNA, leading to rapid mRNA degradation and suppression of the protein encoded by the target mRNA. RNA interference is gene-specific and has a strong influence, so it has the advantage of being able to suppress the expression of a desired gene by synthesizing dsRNA targeting a specific gene, and is being used in various fields such as agricultural pest control, suppression of cancer cell expression, and transgenic plants.

[0006] Herein, the present inventors suggest a new disease control target based on RNAi by identifying essential genes essential for the survival of red mold.

[0007] The present invention aims to provide an essential gene sequence essential for the survival of red mold. When the expression of the essential gene according to the present invention is suppressed, the growth of red mold is inhibited, resulting in a control effect against red mold disease.

[0008] The present invention also aims to control red mold disease in an environmentally friendly manner by inhibiting the essential genes of the red mold using an RNAi-based dsRNA treatment method.

[0009] However, the technical problems to be solved by the present invention are not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.

[0010] Hereinafter, the present invention will be described in detail. The advantages and features of the present invention, as well as the embodiments that achieve them, will be apparent with reference to the embodiments described below. However, the present invention is not limited to the embodiments disclosed below and may be implemented in various different forms. These embodiments are provided solely to ensure the complete disclosure of the present invention and to fully inform those skilled in the art of the scope of the invention. The present invention is defined solely by the scope of the claims. Like reference numerals designate like elements throughout the specification.

[0011] Unless otherwise defined, all terms (including technical and scientific terms) used herein may be used in a sense commonly understood by those of ordinary skill in the art to which the present invention pertains. Furthermore, terms defined in commonly used dictionaries are not to be interpreted ideally or excessively unless explicitly and specifically defined otherwise. The terminology used herein is for the purpose of describing embodiments and is not intended to limit the present invention. In this specification, singular forms also include plural forms, unless specifically stated otherwise.

[0012] The present invention identifies FGSG_10360, FGSG_13150, and FGSG_06123 as essential genes essential for the growth of red mold, and provides their sequences. In the present invention, the 'target gene' refers to 'FGSG_10360, FGSG_13150, or FGSG_06123', which are essential genes of the red mold.

[0013] In the present invention, the sequence of FGSG_10360 is represented by SEQ ID NO: 1, the sequence of FGSG_13150 is represented by SEQ ID NO: 2, and the sequence of FGSG_06123 is represented by SEQ ID NO: 3. The target gene for controlling red mold disease of the present invention may include any one of the gene sequences of SEQ ID NOs: 1 to 3 or a portion thereof.

[0014] The present invention also provides a composition for controlling red mold disease, comprising as an active ingredient a dsRNA that suppresses the expression of any one of the gene sequences of SEQ ID NOs: 1 to 3 or a vector expressing the dsRNA.

[0015] In another embodiment of the present invention, a use and method for controlling red mold disease using a composition comprising, as an active ingredient, a dsRNA that suppresses the expression of any one of the gene sequences of SEQ ID NOs. 1 to 3 or a vector expressing the dsRNA are provided.

[0016] The dsRNA for the gene sequence of the above sequence number 1 may include the sequence represented by the sequence number 4, the dsRNA for the gene sequence of the above sequence number 2 may include the sequence represented by the sequence number 5, and the dsRNA for the gene sequence of the above sequence number 3 may include the sequence represented by the sequence number 6.

[0017] The present invention also provides a method for controlling red mold disease using the composition. The method for controlling red mold disease of the present invention comprises the steps of: i) preparing a composition comprising dsRNA targeting any one of the gene sequences of SEQ ID NOs: 1 to 3 or a vector expressing the dsRNA; and ii) treating a plant with the composition.

[0018] In the present invention, the plants to be controlled include, but are not limited to, cereals (preferably rice, barley, wheat, rye, oats, and corn, etc.).

[0019] The present invention identifies essential genes of red mold and targets them to suppress their expression. According to the present invention, red mold disease can be controlled in an environmentally friendly manner.

[0020] The present invention also provides a specific dsRNA that inhibits the expression of the target gene. The dsRNA of the present invention can effectively inhibit the expression of the target gene, thereby significantly reducing the incidence of red mold disease.

[0021] The dsRNA gene of the present invention can be utilized as a new target for the development of an antifungal agent for controlling red mold disease, and the dsRNA sequence can be usefully used for the development of RNAi-based drugs.

[0022] Figure 1A shows the promoters of FGSG_10360 and FGSG_13150. ZEAR This is the result when replaced with . In Fig. 1A, Z-3639 is a red mold wild type strain, P ZEAR -Fg10360 is the promoter of FGSG_10360 ZEAR strains substituted with P ZEAR -Fg13150 is the promoter of FGSG_13150 ZEAR It is a strain that has been replaced with . The results of mycelial growth when each strain was cultured under gene expression inhibition conditions (CM) and gene expression induction conditions (CM + 30 μM b-estradiol) are shown. Figure 1B shows the results when the promoter of FGSG_06123 was replaced with PFCR1. Z-3639 is a red mold wild type strain, P FCR1 -Fg06123 is a strain in which the promoter of FGSG_06123 is replaced with PFCR1. This is the result of mycelial growth when each strain was cultured under gene expression inhibition conditions (copper sulfate 50 μM) and gene expression induction conditions (BCS 25 μM).

[0023] Figure 2 shows the results of an experiment analyzing the effect of dsRNA treatment on controlling red mold disease. In Figure 2, 'H2O only' is an experimental group treated with water instead of dsRNA, GFP-dsRNA is a dsRNA that acts on GFP, CYP51-dsRNA is a dsRNA that acts on CYP51A, CYP51B, and CYP51C simultaneously, Fg10360-dsRNA is a dsRNA that acts on FGSG_10360, Fg13150-dsRNA is a dsRNA that acts on FGSG_13150, and Fg06123-dsRNA is an experimental group treated with dsRNA that acts on FGSG_06123. This is the result of checking whether red mold disease occurred 5 days after treating 500 ng of the dsRNA above to barley leaves and then inoculating them with red mold spores.

[0024] Hereinafter, to aid understanding of the present invention, examples will be given in detail. However, the following examples are intended only to illustrate the scope of the present invention and are not intended to limit its scope. These examples are provided to more fully explain the present invention to those of average skill in the art.

[0025] In the present invention, the "red mold pathogen" is a strain that causes red mold disease, and may be one or more strains selected from the group consisting of Fusarium asiaticum, Fusarium graminearum, and Fusarium boothii.

[0026] The term "red mold disease" of the present invention refers to a disease induced by red mold, a fungus of the genus Fusarium, as described above.

[0027] In the present invention, the term "target gene" refers to an essential gene essential for the growth of red mold, and refers to a target gene whose expression is to be suppressed in the present invention. The target genes of the present invention include the FGSG_10360 (SEQ ID NO: 1), FGSG_13150 (SEQ ID NO: 2), and FGSG_06123 (SEQ ID NO: 3) genes.

[0028] In the present invention, "dsRNA" means double-stranded RNA, and can induce RNA interference (RNAi), a gene silencing phenomenon that occurs when double-stranded RNA (dsRNA) enters a cell.

[0029] The dsRNA of the present invention includes genes having sequences of SEQ ID NOs: 4 to 6, genes having base sequences substantially identical to each sequence, and fragments of the genes. The dsRNA of SEQ ID NO: 4 can inhibit the expression of the FGSG_10360 (SEQ ID NO: 1) gene, the dsRNA of SEQ ID NO: 5 can inhibit the expression of the FGSG_13150 (SEQ ID NO: 2) gene, and the dsRNA of SEQ ID NO: 6 can inhibit the expression of the FGSG_06123 (SEQ ID NO: 3) gene.

[0030] The above-mentioned genes consisting of substantially identical base sequences refer to those having sequence homology of 80% or more, preferably 90% or more, and most preferably 95% or more, but are not limited thereto, and if they have sequence homology of 80% or more and have the same activity, they are included in the present invention. As described above, the dsRNA for controlling red mold disease of the present invention may have one or more nucleic acid bases mutated by substitution, deletion, insertion, or a combination thereof, as long as it has an activity equivalent thereto, and these are also included in the scope of the present invention.

[0031] The term "primer" of the present invention refers to a short nucleic acid sequence having a short free 3' hydroxyl group, which can form base pairs with a complementary template and serves as a starting point for copying the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. PCR conditions and the lengths of the sense and antisense primers can be modified based on those known in the art.

[0032] The composition for controlling red mold disease according to the present invention may be prepared in the form of, for example, a directly sprayable solution, powder, and suspension, or a highly concentrated aqueous, oily, or other suspension, dispersion, emulsion, oily dispersion, paste, dust, dustable material, or granule, but is not limited thereto.

[0033] The composition for controlling red mold disease of the present invention can be formulated in various forms. These formulations can be prepared, for example, by adding a solvent and / or carrier. Often, inert additives and surface-active substances, such as emulsifiers or dispersants, are mixed into the formulation. Suitable surface-active substances are aromatic sulfonic acids (e.g. lignosulfonic acid, phenolsulfonic acid, naphthalene- and dibutylnaphthalenesulfonic acid), fatty acids, alkyl- and alkylarylsulfonates, alkyl lauryl ethers, alkali metal, alkaline earth metal and ammonium salts of fatty alcohol sulfates, sulfated hexa-, hepta- and octadecanol, salts of fatty alcohol glycol ethers, sulfonated naphthalene and derivatives thereof, condensates with formaldehyde, condensates of naphthalene or naphthalenesulfonic acid, phenol and formaldehyde, polyoxyethyleneoctyl phenol ethers, ethoxylated isooctyl-, octyl- or nonylphenols, alkylphenyl or tributylphenyl polyglycol ethers, alkylarylpolyether alcohols, isotridecyl alcohol, fatty alcohol / ethylene oxide condensates, ethoxylated castor oil, It may be, but is not limited to, polyoxyethylene alkyl ether or polyoxypropylene, lauryl alcohol polyglycol ether acetate, sorbitol ester, lignin-sulfite waste liquor or methylcellulose.

[0034] Suitable solid carrier materials are, in principle, all porous, agriculturally acceptable carriers, such as, but not limited to, mineral earths (e.g., silica, silica gel, silicates, talc, kaolin, limestone, lime, chalk, boll, loess, clays, dolomite, diatomaceous earth, calcium sulfate, magnesium sulfate, magnesium oxide, ground synthetic materials), fertilizers (e.g., ammonium sulfate, ammonium phosphate, ammonium nitrate, urea), plant products (e.g., cereal flour, bark flour, wood meal and nut shell flour) or cellulose powder. Furthermore, the solid carriers may be used alone or in combination of two or more.

[0035] The present invention also provides a method for controlling red mold disease, comprising the step of treating a plant with the composition for controlling red mold disease. The composition for controlling red mold disease of the present invention comprises, as an active ingredient, dsRNA targeting any one of the genes of SEQ ID NOS: 1 to 3, wherein the dsRNA is as described above. The method for controlling red mold disease may be to treat a normal plant with the composition to prevent red mold disease or to treat a plant suspected of having red mold disease.

[0036] In the control method of the present invention, the treatment includes, but is not limited to, uniformly diluting a control composition with water to control red mold disease and then spraying it on the plant using an appropriate spraying device such as a power sprayer. The "effective amount" of the present invention means an amount sufficient to produce beneficial or desired results.

[0037]

[0038] Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are merely illustrative of the present invention, and the content of the present invention is not limited to the following examples.

[0039]

[0040] [Example 1]

[0041] 1-1. dsRNA synthesis

[0042] For the dsRNA synthesis of the present invention, approximately 200-250 bp was amplified from the exon portion of the target gene of red mold (SEQ ID NO: 1 to 3, respectively), and MEGAscript was used based on the amplified PCR product. TM dsRNA (SEQ ID NOs: 4 to 6, respectively) was synthesized using RNAi Kit (Thermo Fisher Scientific).

[0043]

[0044] 1-2. Experiments to identify essential genes using zearalenone-inducible promoters and copper-responsive promoters.

[0045] In the present invention, FGSG_10360 (SEQ ID NO: 1), FGSG_13150 (SEQ ID NO: 2), and FGSG_06123 (SEQ ID NO: 3) genes were selected as essential gene candidates for red mold. Strains in which the promoters of FGSG_10360 and FGSG_13150 were replaced with PZEAR (P ZEAR -Fg_10360 (SEQ ID NO: 7), P ZEAR -Fg13150 (SEQ ID NO: 8)) and strains in which the promoters of FGSG_06123 were replaced with PFCR1 (P FCR1 -Fg06123, sequence number 9) was produced and the mycelial growth was observed under gene expression inhibition and gene expression induction conditions (Fig. 1). P ZEAR -Fg10360 and P ZEAR -Fg13150 strain showed significantly reduced mycelial growth under gene expression inhibition conditions (CM) and increased mycelial growth under gene expression induction conditions (30 μM b-estradiol). P FCR1 - The Fg06123 strain showed reduced mycelial growth under gene expression inhibition conditions (copper sulfate 50 μM), but recovered mycelial growth to the level of the wild-type strain under gene expression induction conditions (copper chelator (bathocuproinedisulfonic acid, BCS, 25 μM)). These results confirmed that the FGSG_10360, FGSG_13150, and FGSG_06123 genes are essential genes essential for the growth of red mold (target genes for controlling red mold disease in the present invention).

[0046]

[0047] [Example 2]

[0048] Experimental analysis of disease control effects when treated with dsRNA

[0049] To determine whether dsRNA specifically targeting the essential genes FGSG_10360, FGSG_13150, and FGSG_06123 identified in Example 1 exhibited a disease-controlling effect, barley leaves were treated with the dsRNA produced in Example 1-1 and then subjected to a pathogenicity test (Fig. 2). Water and GFP-dsRNA served as negative controls, while CYP51-dsRNA, which had been reported to be effective in previous studies, served as a positive control. 500 ng of the above dsRNA was sprayed on the third leaf of barley grown for three weeks, and 1 hour later, red mold spores were inoculated. As a result of observation after 5 days, it was confirmed that the lesions were reduced to the same extent in barley leaves treated with Fg10360-dsRNA (SEQ ID NO: 4), Fg13150-dsRNA (SEQ ID NO: 5), and Fg06123-dsRNA (SEQ ID NO: 6) as in barley leaves treated with CYP51-dsRNA (bottom image of Fig. 2). Therefore, it was proven that the dsRNA disclosed in the present invention can be successfully used to control red mold disease.

[0050]

[0051] The foregoing description of the present invention is provided for illustrative purposes only. Those skilled in the art will readily appreciate that the present invention can be readily modified into other specific forms without altering the technical spirit or essential characteristics of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

[0052]

[0053] Sequence number 1

[0054] FGSG_10360 gene

[0055] ATCATGCTCTGGGAGCTCCCACAGCGCAGATGATTTAG

[0056]

[0057] Sequence number 2

[0058] FGSG_13150 gene

[0059] TCTCCACCTTGGCAGGTGGAGACCAGGAAAAGATTAACTCATTACTCAAGGAAGCCATTGATACTTTGACACAGCAGAGAATCATTTGCAAAAGCAAACGGCTTCCGCTTTCTGGGAGGCCCTTCAGACTCAACGAAGCATTTGGACATGTACTCGGGAAGCTTGCGCAACGGACCAAATACAAGGACGCTGCCGATTTCAAAACGCAACTGGATGCTATTTTCCGCCGCGGCGAGGCCTATCGAATCCCTTTCACACTCAATGATGGGTCGGTAATGGCGTTGATAAATCTCAATGCGAGTGAAAGGATCAAACTGGTTCCAGTCAACGTGCCTCACATTCCCTTGGGTTTCAAGCCTGGCCAGTACGAGATGCGTAAGCTGAAGAAATCGCTCTACTCTCATGACCTTGAAGCGGTCCCCACGGACTTGTACAAGTATGACGAGGAGATCGACGTCCTCCGCAGGAGTGTCTTTGAAGGACCTCCAGCCGCAGGTAAAGGCAAAACCAGCGTGCTCCCACAATGGGTTGACTTCTTTGGACGTCGGGAAGCGGAACGGTGGATGGATGTGCTGGGTGCTTTCTGCTTCGTGTACGCGAACAGAGGTCTTCTGACGATCGAAGGAGTGTGCAATGCTCTCAAGCCGGTGCTCGAGGAGTTCGAGGCTAAGCTCATCATGGATTGGGGTGTGAAGACAGGCGTGCTTAAGCACTCGGAAGAAGGTCTAGGGCTCATGGTAGGAGAGTGGTGGTGGCTTGCTGTCCCTTGGCAATGGGGGCGACAGTTCAAGCCCACAGGTTATAATGAAGGCATGGATTAA

[0060]

[0061] 서열번호 3

[0062] FGSG_06123 gene

[0063] AAAAGTATTTCACTTTATGATGGTTGGGATGTTTCTGCCCGCAACGTTTGTGGACCCTACGTACGCAGCTCTGGCTCTCTCCTTAATTCTGGCGGTCTTCCTGATCTTGGATCTCCTCAGAGCGAGCCAGCTTCCCCCATTATCGAAGCCTATTGCCTCATTCCTGGCGCCATATGTTGACGGCAGGGATTTCCGCGGCCCTGTCGTCATCTCACACATCTTTCTTCTCATTGGATGTGCGATTCCTCTTTGGCTAGGCCTCGCTTCTCTACCACGCACTGGGTCTGACTACCTGTCTGGCTGGGAAGTATCAGGTCGAGATGTCAGTCTTGTCGCTGGCGTTACTTGCGTGGGACTTGGAGATGCAGCAGCCTCACTTATAGGACGTCGGTATGGACGTCGCAAGTGGTTCTGGGGCGGTGGCAAGAGTCTCGAGGGCAGTTTTGCATTTGCAGTGGCAGTTGTCCTGGGCCTTGGTGCTGCCAGTATGTGGTTGCGAGTTGGCGGCTGGCCAGTTGCGGGCGACCAACCCGGGCCCGTTGCTGCTACTCGAAATGCTGTTATGTGCGCCTCGATGGCGAGTCTAACCGAAGCGGTTCTGACCGGCGGAAATGACAATGTCATTGTGCCCGTGGTACTGTGGACTTGTGTGAAAAGCCTGGGTGTCTAA

[0064]

[0065] 서열번호 4

[0066] FGSG_10360 dsRNA

[0067] GACACGAGCGCGAGGTTCACAACAAACACGGAGGTCCCAAGAAGACAGTCAACTGTCCTCATTTGAATTGCAAGCGACATACAGGGAAGGGGTTCTCAAGATTGGAGAACTTGAACGAGCATCTTCGCCGTGTTCACACAAACCCTGACGGAGCTGGAAACACTCCTCCCCCCGATATGGTCTTGTCCGATGAGAACGACAGCGAGCAGACAGGTGTGAAGCGCAAGCGTCGTGCGAGCGATACGGCCAACGCGGAGATAATCGAACTCAAAGAGGAGGTCAAGCGGCTGC

[0068]

[0069] 서열번호 5

[0070] FGSG_13150 dsRNA

[0071] TCACCAACGCCACGGAAGACTTAGTTCGTATCAATCTTTTGTTGCGCGGACATATATCTGTTCCGACCTTGAACGCGCATGGTCAGACTCATTCATTCAGGCACCACCGGGAGCGGCGGGCCCTCATAACATCTTCGTCTCATTCTTCAGCGAGGCCGGTGGCGAGATCATCGAGACTTCCGCGCTTTCCTGGCCGTCAGAATGGCAGCTTACGCCCAAGTCATTCCCCGAAAGTGTTCCGGATCGTGCTTTGCTTGTGGACTCCCCCTCTGAAGAGGAAGAGGACGAAGACGA

[0072]

[0073] 서열번호 6

[0074] FGSG_06123 dsRNA

[0075] GGCTGTGTTGTTGTACCCTCTTCACCAAAGTTTATGCGTGGTATTGCACTATCTTACCACCACAAGTCTGTTGACGGCTGAGCTTCAGCTACTATCAATTGCACTTATCAACGTTCTACTTCTCGCTTCTTCGCCCCA AATTCTCATTCTCAAGGCTCTTCTTTGGGGCGTGGTTTTGTCACTTCTTGTATTTTGTGGTCCTGTCATTCGTTGGGGAATTACGTTGGCCAGAGTGCCAAAGTGGCGGTTCCGCAGGGCATCATTCGCCCAGCAGCCA

[0076]

[0077] *Each of the above sequence numbers 4 to 6 is a dsRNA sequence, and T (thymine) can be interpreted as U (uracil).

[0078]

[0079] Sequence number 7

[0080] PZEAR-Fg_10360

[0081] TGGAGACGACCGAGGGATGATGCAAGATGATACTTCTGTTGTGCACGATGCGACTCGACTCGACTTGGGGCACCCCGCATTCCCCTCGCCCATCGACGCTGCTATGCCAGCACCACAAATCGACGGTATTCCTGACGACAAAGACCTTTCGCCCAGCATCGACTCGCCACCTCCCCCTCGGGTAAGGCCCATCGCCAAGCCAGAGAGAGAGGCTGTAAAGGGCGTAGATGGCAAGTTCCACTGCACGCAAGAAGATTGCCAAGAGGAGATTCGAGTATTTTCGCGAAAGTGCGAATGGAAGTAAGTTCTACCCAATGCCTAAATTTGAGAGCCATGCTAACTGTTTTGCAGCAAGCACATGGACAAGCACGAACGACCCTATCGATGCCCTGCCGTAGGATGCGAGAACCTCCCCGGTTTTACCTATTCAGGTGGTCTACTTCGACACGAGCGCGAGGTTCACAACAAACACGGAGGTCCCAAGAAGACAGTCAACTGTCCTCATTTGAATTGCAAGCGACATACAGGGAAGGGGTTCTCAAGATTGGAGAACTTGAACGAGCATCTTCGCCGTGTTCACACAAACCCTGACGGAGCTGGAAACACTCCTCCCCCCGATATGGTCTTGTCCGATGAGAACGACAGCGAGCAGACAGGTGTGAAGCGCAAGCGTCGTGCGAGCGATACGGCCAACGCGGAGATAATCGAACTCAAAGAGGAGGTCAAGCGGCTGCGGGAGGAGAACGAAAAGCTCACGGCTGACGTGGCGCAGCAGTCGCAGCACTCTTTGGCCATGATGGCCCAGATTGCTGAGTTGCAGGACGCTCTGCGAAATGGCGTTTCGCATCATGCTCTGGGAGCTCCCACAGCGCAGATGATTTAG

[0082]

[0083] 서열번호 8

[0084] PZEAR-Fg13150

[0085] TACAAGGACGCTGCCGATTTCAAAACGCAACTGGATGCTATTTTCCGCCGCGGCGAGGCCTATCGAATCCCTTTCACACTCAATGATGGGTCGGTAATGGCGTTGATAAATCTCAATGCGAGTGAAAGGATCAAACTGGTTCCAGTCAACGTGCCTCACATTCCCTTGGGTTTCAAGCCTGGCCAGTACGAGATGCGTAAGCTGAAGAAATCGCTCTACTCTCATGACCTTGAAGCGGTCCCCACGGACTTGTACAAGTATGACGAGGAGATCGACGTCCTCCGCAGGAGTGTCTTTGAAGGACCTCCAGCCGCAGGTAAAGGCAAAACCAGCGTGCTCCCACAATGGGTTGACTTCTTTGGACGTCGGGAAGCGGAACGGTGGATGGATGTGCTGGGTGCTTTCTGCTTCGTGTACGCGAACAGAGGTCTTCTGACGATCGAAGGAGTGTGCAATGCTCTCAAGCCGGTGCTCGAGGAGTTCGAGGCTAAGCTCATCATGGATTGGGGTGTGAAGACAGGCGTGCTTAAGCACTCGGAAGAAGGTCTAGGGCTCATGGTAGGAGAGTGGTGGTGGCTTGCTGTCCCTTGGCAATGGGGGCGACAGTTCAAGCCCACAGGTTATAATGAAGGCATGGATTAA

[0086]

[0087] 서열번호 9

[0088] PFCR1-Fg06123 CGAAAAGTATTTCACTTTATGATGGTTGGGATGTTTCTGCCCGCAACGTTTGTGGACCCTACGTACGCAGCTCTGGCTCTCTCCTTAATTCTGGCGGTCTTCCTGATCTTGGATCTCCTCAGAGCGAGCCAGCTTCCCCCATTATCGAAGCCTATTGCCTCATTCCTGGCGCCATATGTTGACGGCAGGGATTTCCGCGGCCCTGTCGTCATCTCACACATCTTTCTTCTCATTGGATGTGCGATTCCTCTTTGGCTAGGCCTCGCTTCTCTACCACGCACTGGGTCTGACTACCTGTCTGGCTGGGAAGTATCAGGTCGAGATGTCAGTCTTGTCGCTGGCGTTACTTGCGTGGGACTTGGAGATGCAGCAGCCTCACTTATAGGACGTCGGTATGGACGTCGCAAGTGGTTCTGGGGCGGTGGCAAGAGTCTCGAGGGCAGTTTTGCATTTGCAGTGGCAGTTGTCCTGGGCCTTGGTGCTGCCAGTATGTGGTTGCGAGTTGGCGGCTGGCCAGTTGCGGGCGACCAACCCGGGCCCGTTGCTGCTACTCGAAATGCTGTTATGTGCGCCTCGATGGCGAGTCTAACCGAAGCGGTTCTGACCGGCGGAAATGACAATGTCATTGTGCCCGTGGTACTGTGGACTTGTGTGAAAAGCCTGGGTGTCTAA

Claims

1. A target gene for controlling red mold disease, comprising any one of the gene sequences of sequence numbers 1 to 3.

2. In paragraph 1, A target gene for controlling red mold disease, wherein the growth of red mold is inhibited when the expression of the above target gene is suppressed.

3. A composition for controlling red mold disease, comprising as an active ingredient a dsRNA that suppresses the expression of any one of the gene sequences of sequence numbers 1 to 3 or a vector expressing the dsRNA.

4. In paragraph 3, A composition for controlling red mold disease, wherein the dsRNA for the gene sequence of the above sequence number 1 comprises a sequence represented by sequence number 4.

5. In paragraph 3, A composition for controlling red mold disease, wherein the dsRNA for the gene sequence of the above sequence number 2 comprises a sequence represented by sequence number 5.

6. In paragraph 3, A composition for controlling red mold disease, wherein the dsRNA for the gene sequence of the above sequence number 3 comprises a sequence represented by sequence number 6.

7. In the method of controlling red mold disease, i) a step of producing a composition comprising a dsRNA targeting any one of the gene sequences of sequence numbers 1 to 3 or a vector expressing the dsRNA; and ii) A method for controlling red mold disease, comprising the step of treating a plant with the composition.

8. In paragraph 7, A method for controlling red mold disease, wherein the dsRNA comprises any one of the sequences of SEQ ID NOs: 4 to 6.

9. In paragraph 7, A method for controlling pests, wherein the plant is at least one selected from the group consisting of rice, barley, wheat, rye, oats and corn.

Images