Composition for reducing methane emission from ruminant animals

A composition of methanotrophic bacteria derived from ruminant rumens effectively reduces methane emissions by metabolizing methane, while enhancing feed and fermentation efficiencies, addressing the limitations of existing methane reduction methods.

WO2025116670A1PCT designated stage expired Publication Date: 2025-06-05INDUSTRYACADEMIC COOPERATION FOUNDATION GYEONGSANG NATIONAL UNIVERSITY +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/019504
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-11-29
Filing Date
2024-12-02
Publication Date
2025-06-05

AI Technical Summary

Technical Problem

Current methods to reduce methane emissions from ruminants, such as inhibiting methanogenic microorganisms, negatively impact rumen fermentation efficiency and feed efficiency.

Method used

A composition comprising methanotrophic bacteria, specifically derived from the rumen of ruminants, which can metabolize methane, thereby reducing methane emissions. This composition may include bacteria from the genera Methylocystis, Methylomonas, Methylococcus, Methylosinus, or Methylomicrobium, and can be supplemented with methylotrophic bacteria like Methylobacterium.

Benefits of technology

The use of methanotrophic bacteria effectively reduces methane emissions from ruminants while improving feed efficiency and fermentation efficiency, without negatively impacting rumen health.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024019504_05062025_PF_FP_ABST
    Figure KR2024019504_05062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to: a composition which, by comprising methanotrophic bacteria, can effectively reduce methane emission from ruminant animals and can improve the feed efficiency, fermentation efficiency and the like of ruminant animals; and a method for reducing methane emission from ruminant animals and, in particular, to a composition for reducing methane emission from ruminant animals, the composition comprising methanotrophic bacteria, a feed composition for ruminant animals, and a feed additive composition for ruminant animals.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for reducing methane emissions from ruminants The present invention relates to a composition for reducing methane emissions from ruminants. Methane is a gas with a greenhouse gas effect about 80 times that of carbon dioxide and is a major cause of global warming. However, since the lifespan of methane molecules is more than 10 times shorter than that of carbon dioxide, reducing methane emissions is reported to be more immediate and effective in responding to global warming than reducing carbon dioxide. Accordingly, the world declared through the 2021 Global Methane Pledge to reduce methane emissions by 30% by 2030 compared to 2018. Therefore, reducing methane emissions is very important for sustainable industries worldwide. The main source of methane emissions is ruminants such as cattle, which account for more than 37% of global methane emissions. For eco-friendly livestock farming, it is important to develop a composition that can reduce methane generated from these industries. The existing method of reducing methane in ruminants is to add compounds that inhibit the growth of methanogenic microorganisms. This is undesirable because it inhibits the growth of methanogens, which are important constituent microorganisms of rumen fermentation, thereby reducing rumen fermentation efficiency and feed efficiency. The present invention aims to provide a composition and method capable of effectively reducing methane emissions in ruminants. 1. A composition for reducing methane emissions from ruminants, comprising methanotrophic bacteria. 2. In the above 1, the methanotrophic bacteria is a composition for reducing methane emission from ruminants derived from the rumen of ruminants. 3. A composition for reducing methane emission from ruminants, wherein the methanotrophic bacteria in the above 1 are bacteria belonging to the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium. 4. A composition for reducing methane emissions from ruminants, further comprising methylotrophic bacteria in the above 1. 5. In the above 4, the methylotrophic bacteria is a composition for reducing methane emission from ruminants derived from the rumen of ruminants. 6. In the above 4, the composition for reducing methane emission in ruminants is a methylotrophic bacteria of the genus Methylobacterium. 7. A composition for reducing methane emission in ruminants, wherein the methylotrophic bacteria in the above 4 is Methylobacterium organophyllum. 8. A composition for reducing methane emissions from ruminants, wherein the ruminant in 1 above is a cow, a giraffe, a deer, a sheep or a camel. 9. A method for reducing methane emissions from ruminants, comprising the step of feeding a composition of any one of claims 1 to 8 above to the ruminant. 10. A feed composition for ruminants containing methanotrophic bacteria. 11. In the above 10, the methanotrophic bacteria are derived from the rumen of ruminants, a feed composition for ruminants. 12. A feed composition for ruminants according to the above 10, wherein the methanotrophic bacteria are bacteria belonging to the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium. 13. A feed composition for ruminants further comprising methylotrophic bacteria in the above 10. 14. In the above 13, the methylotrophic bacteria are a feed composition for ruminants derived from the rumen of ruminants. 15. A feed composition for ruminants, wherein in the above 13, the methylotrophic bacteria are bacteria of the genus Methylobacterium. 16. A feed composition for ruminants, wherein in the above 13, the methylotrophic bacteria is Methylobacterium organophyllum. 17. A composition of feed additive for ruminants containing methanotrophic bacteria. 18. In the above 17, the methanotrophic bacteria are a composition of feed additives for ruminants derived from the rumen of ruminants. 19. A composition for feed additives for ruminants, wherein the methanotrophic bacteria in the above 17 is a bacterium of the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium. 20. A composition of feed additive for ruminants further comprising methylotrophic bacteria in the above 17. 21. In the above 20, the methylotrophic bacteria are a composition of feed additives for ruminants derived from the rumen of ruminants. 22. A composition of feed additive for ruminants, wherein the methylotrophic bacteria in the above 20 is a bacterium of the genus Methylobacterium. 23. A composition of feed additive for ruminants, wherein the methylotrophic bacteria in the above 20 is Methylobacterium organophyllum. The present invention has an excellent effect in reducing methane emissions from ruminants. The present invention can improve feed efficiency of ruminants. The present invention can improve the fermentation efficiency of ruminants. Figure 1. Growth test of three isolates NC52PC, NC75PC, and NC77PC. Growth curves (OD600) of the three isolates from 0 to 36 hours at 30°C (A) and 39°C (B). Figure 2. SEM images of NC52PC cells showing two morphologically distinct cell types. Figure 3. A) Circular chromosome map including the complete genome of Methylocystis species and two plasmids, and comparison of the genomes with closely related species. The innermost ring indicates GC skew (green -, purple +) and GC content (black). Rings and colors in the legend indicate closely related strains used for comparison with Methylocystis species in NC52PC. B) Circular chromosome map comparing the complete genome of Methylocystis species in NC52PC with closely related species. Figure 4. pH and headspace gas volume of control and NC52PC inoculated samples after 0 h, 12 h, and 24 h (A and B). Digestibility and methane production between control and NC52PC inoculated samples after 12 h and 24 h (C and D). ''ns'' indicates not significant (p-value > 0.05), and asterisk indicates significant difference (p-value < 0.05). Figure 5. Taxonomic analysis of in vitro rumen fermentation samples. Relative abundance at the phylum level for bacteria (A), archaea (B), and fungi (C). Relative abundance at the genus level for bacteria (D) and archaea (E). pmoA copy numbers for methanotrophic communities between control and NC52PC samples (F). Figure 6. Alpha diversity of test tube rumen fermentation samples. A) Shannon indices for bacteria, archaea, and fungi. B) Chao 1 indices for bacteria, archaea, and fungi. Figure 7. Animal performance such as total body weight gain (A) and feed conversion ratio (B) between the three animal groups: normal, low, and high. ''ns'' indicates not significant (p-value > 0.05). Fig. 8. Effect of low and high concentrations of methanotrophic bacteria-based probiotics (NC52PC) on methane emissions (A), methane yield (B), and methane intensity (C) during repeated in vivo tests. The present invention is described in detail below. The present invention relates to a composition for reducing methane emissions from ruminants, comprising methanotrophic bacteria. The composition of the present invention can be fed to ruminants, metabolizing methane generated in the stomach of the ruminant, thereby reducing methane production. The ruminant may be, for example, a cow, a giraffe, a deer, a sheep, a camel, etc. The ruminant may be a cow. The ruminant may be the same species as the ruminant to which the composition is to be treated. Methanotrophic bacteria may be capable of growing and functioning in the rumen. For example, it may show active growth even at 39℃. This means that the growth inhibition is not great compared to 30℃, and the growth inhibition degree may be 80% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less. For example, it may indicate active growth in rumen fluid. This means that the growth inhibition is not significant compared to the basic growth medium, NMS medium, and the growth inhibition degree may be 80% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less. For example, it may be capable of growing under anaerobic or partially aerobic conditions. This may be, for example, by having the ability to utilize oxygen-alternative electron acceptors under anaerobic conditions. Methanotrophs may originate from the rumen of ruminants. Methanotrophic bacteria can be aerobic or anaerobic strains. The methanotrophic bacteria can be, for example, strains of the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium. Examples thereof include Methylocystis fabus, Methylocystis rosea, Methylocystis ecosinbiosis or Methylocystis econoides. The composition of the present invention may further comprise methylotrophic bacteria. Methylotrophic bacteria can promote the growth of methanotrophic bacteria, further increasing the effect of reducing methane emissions. Methylotrophic bacteria may be derived from the rumen of a ruminant. In such a case, the ruminant from which they are derived may be of the same species as the animal from which the methanotrophic bacteria are derived. Methylotrophic bacteria can be, for example, members of the genus Methylobacterium, for example, Methylobacterium organophyllum. The bacteria used in the composition of the present invention may be, for example, a consortium of methanotrophic bacteria and methylotrophic bacteria. These may be, for example, bacteria of the genus Methylocystis and bacteria of the genus Methylobacterium. The composition of the present invention can be used in various forms such as feed, feed additive, food, health functional food, etc. In such cases, it may further include additional components suitable for use in that form. In addition, the present invention relates to a method for reducing methane emissions from ruminants. The method of the present invention comprises the step of feeding the composition for reducing methane emissions described above to a ruminant. The composition may be fed, for example, by mixing the composition into feed or fed separately from feed. The ruminant being fed may be, for example, the same species of ruminant from which the methanotrophic or methylotrophic bacteria originated. Furthermore, the present invention relates to a feed composition for ruminants comprising methanotrophic bacteria. Methanotrophic bacteria may be an example of this. The feed composition of the present invention may further comprise methylotrophic bacteria. These may be those exemplified above. The ruminant being fed may be, for example, the same species of ruminant from which the methanotrophic or methylotrophic bacteria originated. The bacteria used in the composition of the present invention may be, for example, a consortium of methanotrophic bacteria and methylotrophic bacteria. These may be, for example, bacteria of the genus Methylocystis and bacteria of the genus Methylobacterium. The feed composition of the present invention can improve fermentation efficiency by removing methane, a by-product of the rumen fermentation process. In addition, methanotrophs can improve feed efficiency by providing additional energy sources (volatile fatty acids) and proteins (methanotrophic bacteria) to ruminants by metabolizing methane. In addition, ruminants can be supplied with beneficial functional substances such as vitamins and carotenoids produced by methanotrophs, so that they can also enjoy the known efficacy / effects of these ingredients. The feed composition of the present invention may further contain conventional ingredients included in feed for ruminants. Furthermore, the present invention relates to a feed additive composition for ruminants comprising methanotrophic bacteria. Methanotrophic bacteria may be an example of this. The feed composition of the present invention may further comprise methylotrophic bacteria. These may be those exemplified above. The ruminant being fed may be, for example, the same species of ruminant from which the methanotrophic or methylotrophic bacteria originated. The bacteria used in the composition of the present invention may be, for example, a consortium of methanotrophic bacteria and methylotrophic bacteria. These may be, for example, bacteria of the genus Methylocystis and bacteria of the genus Methylobacterium. The feed additive composition of the present invention can be added to conventional ruminant feed. The amount of addition is not particularly limited, and may be, for example, 0.1 to 50 parts by weight, 0.1 to 30 parts by weight, 0.1 to 10 parts by weight, etc., relative to 100 parts by weight of the feed. The feed additive composition of the present invention can improve fermentation efficiency by removing methane, a by-product of the rumen fermentation process. In addition, methanotrophs can improve feed efficiency by providing ruminants with additional energy sources (volatile fatty acids) and proteins (methanotrophic bacteria) by metabolizing methane. In addition, ruminants can be supplied with beneficial functional substances such as vitamins and carotenoids produced by methanotrophs, so that they can also enjoy the known efficacy / effects of these ingredients. The present invention will be described more specifically with reference to the following examples. Example method Enrichment and separation of methanotrophic consortia After collecting samples from the rumen of Korean cattle, 10 mM CuCl was added immediately 2 (NMS-Cu) was added to sterile nitrate mineral salt medium (ATCC medium: 1306) and cultured in serum bottles filled with a mixture of methane and air (20:80) at 30°C for 1 week. After 1 week, the concentrate was diluted 1:10 into fresh NMS-Cu medium and cultured for another week under the same conditions mentioned above. This procedure was repeated for 8 weeks to ensure enrichment of methanotrophs while reducing the possibility of heterotrophic growth. To monitor the presence of methanotrophs, DNA was extracted from the liquid cultures weekly during the entire period of the enrichment process and screened using pmoA and methanotroph 16S rRNA specific primers (Table 1). Primers used to monitor the growth of methanotrophs during the enrichment process Primer NameTargetSequence서열번호MethT1dFMethylomonasMethylobacterMethylomicribiumMethylococcusCCTTCGGGMGCYGACGAGT1MethT1bRGATTCYMTGSATGTCAAGG227FMethylocystisMethylosinusAGAGTTTGATCMTGGCTCAG3MethT2RCATCTCTGRCSAYCATACCGG4Tlmob117FMethylococcaceae(family)GTAAYGCRTAGGAATCTGCC5Tlmob1144fCGGCAGTCTCCYTAGAGTTC6Tllmob445FMethylocystaceaeBeijerinckaceae(family)GGGAMGATAATGACGGTACCWGG7Tllmob1416FGCCTTCGGGTARARCCAACTCC8A189bpmoA(not clear)GGKGACTGGGACTTCTSG9mb661CCGGMGCAACGTCYTTACC10mmox r1403sMMOTGGCACTCGTAGCGCTCCGGCTC11mmox f901TSAARACSTGGAACCGCTGGGT12 After 8 weeks, the liquid culture was plated on NMS-Cu agar plates. Several colonies were selected and repeatedly passaged to isolate methanotrophs. Finally, the colonies were plated and transferred onto a 76 mm polycarbonate membrane filter with a pore size of 0.2 μm (Sterlitech PCT027630). During the plating, the membrane was placed on the NMS-Cu agar plate, which served as a support. The polycarbonate membrane filter was then immediately transferred to a petri dish containing 30 mL of fresh NMS-Cu medium, so that the polycarbonate membrane floated on the medium. The dish was then placed in a sealed chamber containing a mixture of methane and air (50:50) at 30°C. The membrane was observed regularly, and the chamber was replaced with a methane-air mixture every 2 days. Pinkish colonies were observed after 2 weeks of incubation. The colonies were then directly transferred to fresh liquid NMS medium and cultured in serum bottles at 30°C with shaking at 180 rpm for 1 week. The isolated colonies were designated NC75PC, NC77PC, and NC52PC. Growth characteristics analysis Methanotrophic growth experiments were performed in 120-ml serum bottles containing 30 ml of NMS-Cu medium. The bottles were sealed with butyl rubber stoppers and filled with a mixture of 20% (v / v) CH4 and 80% (v / v) air. The same methane:air mixture was used for all growth experiments. Three methanotrophic isolates (NC52PC, NC75PC, and NC77PC) were cultured in a shaking incubator at rumen temperature of 39°C and a shaking speed of 180 rpm, and the growth rates were measured. The growth was monitored by absorbance (OD600) in an Ultrospec 10 cell density meter (Amersham Biosciences). Methane consumption during the cultivation was analyzed using a gas chromatography-flame ionization detector (GC-FID). All experiments were performed in triplicate. Morphological characterization Living cells of the methanogenic strain NC52PC were observed under a phase-contrast microscope (Nikon 80i, a Japanese microscope equipped with a camera) at 400x magnification using oil emulsion. To view the exact morphology of the strain by electron microscopy, the samples were pretreated and observed under a scanning electron microscope (SEM) (Zeiss model EVO-MA-15 SEM). Genome feature analysis High molecular weight genomic DNA was extracted from NC52PC using the Wizard® HMW DNA extraction kit from Promega according to the manufacturer's instructions. Bacterial genome sequencing was performed using a combination of Oxford Nanopore Technologies long reads (ONT) and Illumina short reads sequencing technology (NovaSeq6000) to increase accuracy and completeness. The assembled genomes were annotated using Prokka version 1.14.6. Circular chromosome maps of the two complete genomes and two circular plasmids were generated using the Proksee tool. In silico DNA-DNA hybridization (isDDH) and average nucleotide identity (ANI), average amino acid identity (AAI) were calculated to further confirm taxonomic position. isDDH, ANI, and AAI values ​​were calculated even for closely related species using Type (Strain) Genome Server, OrthoANIu algorithm, and EzAAI tool from EZBioCloud. Test tube rumen fermentation Rumen fluid for in vitro ruminal fermentation was collected from two Holstein-Friesian dairy cows (874±69 kg, 8 years old) that had undergone rumen cannulation. The cows were fed 60% concentrate and 40% bluegrass (Poa pratensis) twice daily with free access to clean drinking water and mineral blocks. Rumen contents were collected in a thermos flask before the morning feeding and immediately transported to the laboratory. They were then squeezed through four layers of surgical gauze and filtered into amber bottles. The bottles were then purged with nitrogen for 30 min, capped, and stored at 39°C. The filtered rumen fluid was then mixed with buffer in a ratio of 1:3 (v / v) while maintaining an anaerobic environment. Thirty ml of the buffered rumen fluid mixture was dispensed into 160-ml serum bottles under a pure nitrogen gas flow. Each serum vial contained 0.3 g of substrate consisting of 80% bluegrass and 20% concentrate, finely ground to pass through a 1 mm sieve, in a heat-sealed nylon bag. This test tube fermentation consisted of two experimental sets, one set containing 5x10 7 CFU / mL NC52PC was inoculated into the control set, and the control set was not inoculated with NC52PC. Each set consisted of three replicates at each time point at 0, 12, and 24 h of incubation. The buffered rumen fluid, substrate, and NC52PC inoculum (no inoculum in the control set) were mixed in a serum bottle, and the internal gas was further replaced with nitrogen for 15 min. The bottle was then covered with a butyl rubber lid and sealed and incubated in a shaking incubator at 100 rpm and 39°C. Total gas production from each bottle during incubation at 0, 12 and 24 h was recorded using a pressure transducer technique (Tagliapietra). Headspace gas (10 mL) was collected from each bottle using a syringe equipped with a two-way stopcock and transferred to a gas vial from which air was vented. Methane concentrations were measured using gas chromatography and a flame ionization detector. After incubation at 0, 12 and 24 h, 10 mL liquid samples were collected and immediately frozen at -80°C for DNA extraction and microbial community analysis. pH was measured using a pH meter (LaquaTwin, Horiba, UK). After the incubation period, the nylon bags containing the residual feed were rinsed with cold tap water and dried in an oven at 80°C for 48 h. Once the nylon bags were dried, they were cooled to room temperature and weighed. Dry matter digestibility was calculated by subtracting the weight of the nylon bags after drying from the initial weight. Animal Experiment Design This study was conducted at the Soonchunhyang National University Animal Farm, and all animal experiments were approved by the university's Animal Experiment Ethics Committee. Twelve Korean cattle steers (Bos taurus, 15 months old, initial body weight 448±43 kg) were tested in a 3X3 Latin square design with three replicates of 28 days each for a total experimental period of 84 days. The experimental design followed a cyclical pattern consisting of four phases: a 17-day feeding period, a 3-day data collection and analysis period, a 1-day sample collection and weighing period, and an 11-day rest period. During the washout period, the cattle were fed the same diet without feed supplements to completely remove residual microorganisms from the previous cycle. The animals were initially grouped by body weight and then randomly assigned to one of three treatments with different feed supplements: control (CON), a mixture of 20 g of wheat bran and 20 ml of NMS-Cu medium without NC52PC; Low concentration NC52PC (LOW), 20g of wheat bran and 3x10 720ml of NMS-Cu medium containing NC52PC suspended at CFUs / ml; high concentration NC52PC (HIGH), 20g of wheat bran and 3x10 8 CFUs / ml of NC52PC suspended in 20 ml of NMS-Cu medium. The experimental animals were fed a standard diet consisting of 8.5 kg of concentrate and 3.5 kg of forage (bluegrass) in a ratio of 70.8:29.2. Detailed nutritional information is shown in Table 2. All treatment mixtures were prepared weekly, refrigerated, and thoroughly mixed into the daily feed amount. Feeding was conducted four times a day, and supplements were provided at 09:00. Nutritional composition of feed used in animal testing CH 4 Emissions measurement Enteric methane (CH 4 ) Emissions were assessed using the Hristov method with slight modifications to suit the experimental environment using the GreenFeed (GF) device (C-Lock, Rapid City, SD, USA). Before starting the experiment, all experimental animals were trained to adapt to the GF device to minimize potential psychological stress. CH 4 Emissions were monitored at eight different intervals for three consecutive days during each measurement period. Measurements were performed at 0, 3, 6, 9, 12, 15, 18 and 21 h intervals for three consecutive days based on feeding time. The GF apparatus was placed in one corner of the large cage, and the experimental animals were sequentially moved from their individual stalls into this experimental pen at each measurement interval. During the measurements, molasses-coated concentrate pellets (250-300 g / feed) were provided to encourage the animals to approach the GF apparatus and assume the correct head-down posture within the hood. The amount of pellets consumed during this time was not included in the calculation of dry matter intake (DMI). Information on the time of animals entering and exiting the GF apparatus, standard gas calibration details, CO 2All relevant data, including recovery timing and gas release measurements, were transmitted to C-Lock. CH 4 Production (g / d) data were calculated using a web-based data management system. Also, CH 4 Production rate (g / kg DMI) and CH 4 The productivity (g / d / kg BW 0.75) was also calculated. Collection of rumen fluid samples and rectal temperature measurement On the 16th day of the animal experiment, rumen fluid was collected from each cow using an oral tube before the morning feeding time. The first 300 mL of rumen fluid was discarded to prevent contamination by saliva. Immediately after collection, rumen pH was measured using a pH meter (SevenCompactTM pH / Ion meter S220, Mettler Toledo, Greifensee, Switzerland). Each rumen fluid sample was then divided into three individual samples and transported to the laboratory on dry ice. Subsequently, ammonia nitrogen (NH 3 -N), volatile fatty acids (VFA), and rumen microorganisms were stored at -80°C for later analysis. In addition, the rectal temperature (RT) of the cows was measured using a digital thermometer (WPT-1, CAS, Yangju, Korea) at approximately 12:00 PM on the day of rumen fluid sampling. Ruminant NH 3 -N and volatile fatty acid concentration analysis NH 3-N concentrations were measured using a Libra S22 spectrophotometer (CB40FJ, Biochrom, Cambourne, UK) according to the protocol developed by Chaney and Marbach. VFA concentrations were measured using high-performance liquid chromatography (HPLC; Agilent Technologies 1200 series, Agilent Technologies, Waldbronn, Germany). HPLC was performed using a UV detector (set to 210 nm and 220 nm), a METACARB87H column (Varian, Palo Alto, CA, USA), and a buffer solvent (0.0085 NH 2 SO 4 ; flow rate 0.6 mL / min) was used. Computational and statistical analysis All data on DMI, CH4 emissions, rumen fermentation, and rumen microbiota were analyzed using the mixed procedure of SAS, where breed and trace minerals were considered as factors. The general linear model and Duncan's multiple range test were then used to test for differences among breeds. All analyses were performed using SAS (version 9.4, SAS Institute, Cary, NC, USA). Statistical significance was set at p-value <0.05. result Isolation and characterization of NC52PC Since methanotrophs are mainly isolated and cultured in an aerobic environment, they have never been isolated from the rumen, which is known as an anaerobic environment, or cultured under rumen environmental conditions. In this invention, aerobic methanotrophs were successfully isolated and cultured from rumen samples. This is because aerobic methanotrophs are likely to exist in the rumen due to oxygen flowing into the rumen through the rumen epithelium. Colonies were isolated through a series of subcultures and repeated smears on agar plates, and then transferred to a polycarbonate membrane to minimize contamination with heterotrophs that may be found on the agar plates. Three promising isolates (NC75PC, NC77PC, NC52PC) obtained from polycarbonate membranes were tested for growth at rumen temperatures of 30°C and 39°C. Isolates NC75PC, NC77PC, and NC52PC showed growth rates of 0.1164 h at 30°C and 36 h, respectively. -1 , 0.1172 h -1 , 0.0915 h -1 The isolates NC75PC and NC77PC grew to an OD600 value of 2 or higher at a specific growth rate of 1.5 (Fig. 1). However, when cultured at 39°C, the growth rates of the isolates NC75PC and NC77PC were 0.0308 h each. -1 Wow 0.0275 h -1 In contrast, NC52PC grew robustly even at 39°C, with a specific growth rate of 0.1075 h, similar to that at 30°C. -1 , which was used in future test tube and in vivo rumen fermentation experiments. Growth rates of three ruminant isolates SEM: Scanning electron microscopy examination of NC52PC revealed two morphologically distinct cell types (Fig. 2). One type of cell appeared as a smooth-surfaced rod-shaped bacilli measuring approximately 2.4–2.9 × 0.8–1 μm in size. The second type appeared as a rough-surfaced, curved cocci measuring approximately 1.3–1.5 × 0.8–1 μm in size. In addition, genome sequencing revealed two genomic DNAs, one of which was closely related to the methanotroph Methylocystis echinoides and the other to the methylotroph Methylobacterium organophilum. Therefore, the smooth-surfaced rod-shaped bacilli were identified as Methylocystis species, and the rough-surfaced, curved cocci were identified as Methylocystis species. Genome analysis: The genome of isolate NC52PC was analyzed using hybrid long-read and short-read sequencing. Sequencing analysis yielded a total of four contigs consisting of two circular chromosomes and two circular plasmids. The large chromosome of 5.1 Mbp in size showed similarity to Methylobacterium genus according to BlastX analysis. The other chromosome of 3.95 Mbp in size and two plasmids belonged to Methylocystis genus. The sizes of the two plasmids were 167 kb and 165 kb. Genome features such as GC content, tRNAs, rRNAs, gene and protein numbers were calculated using Prokka (Table 4). The results of visualizing the genomes of each strain of NC52PC and the closely related species are shown in Fig. 3. Characteristics of the two circular chromosomes of NC52PC Traits Methylobacteriumsp.Methylocystissp.Genome size5.07 Mbp3.9 MbpContigs13CircularYesYesGC%69.9864.46tRNA150150rRNA2412CDS4683388416S42pmoAs-2Integrated plasmids-2Genbank Accession NoCP168955CP170127 Genome-based comparisons of the Methylocystis and Methylobacterium species present in NC52PC with those of closely related species were performed, and the average nucleotide identity (ANI), in silico DNA-DNA hybridization (DDH), and average amino-acid identity (AAI) were calculated. The ANI, AAI, and DDH values ​​between the Methylocystis isolate and its closest relative, Methylocystis echinoides LMG27198, were 81.1%, 81.4%, and 25.8%, respectively, which were lower than the threshold values ​​(ANI or AAI 95%, DDH 70%) (Table 5). Therefore, we proposed that the Methylocystis isolate from NC52PC represents a new species of the genus Methylocystis in the family Methylocystidae. Similarly, when the genomes of the Methylobacterium species in NC52PC were compared with those of the closely related Methylobacterium species, they showed the highest similarity to Methylobacterium organophilum WPA_B with ANI, AAI, and DDH values ​​of 98.6%, 98.8%, and 88.5%, respectively (Table 5). Therefore, the Methylobacterium species in the NC52PC consortium is most likely Methylobacterium organophilum. It was very difficult to further isolate only methanotrophs from NC52PC, a consortium of methanotrophs and methylotrophs, and the growth rate of the isolated methanotrophs was seriously inhibited. To maximize methane reduction, it is ideal to use methanotrophs with a high growth rate that can rapidly metabolize methane. Therefore, for methane reduction in rumen fermentation, it may be best to utilize a consortium of methanotrophs and methylotrophs rather than pure methanotrophs. Methylotrophs can metabolize excess methanol produced during methane oxidation, thereby reducing methanol toxicity and promoting the growth of methanotrophs.Additionally, essential nutrient exchange between Methylocystis and Methylobacterium organophilum may promote the overall growth performance of this consortium. Comparison of the genomes of NC52PC and other closely related species of Methylocystis genus and Methylobacterium genus. isDDH: in silico DNA-DNA hybridization; ANI: average nucleotide identity; AAI: average amino acid identity. SUBIDBioProjectBioSampleLocalidAccessionOrganismSUB14691566PRJNA1155250SAMN43453749Contig3CCP170125(plasmid 1)Methylocystis sp. NC52PCSUB14691566PRJNA1155250SAMN43453749Contig4CP170126(plasmid 2)Methylocystis sp. NC52PCSUB14691566PRJNA1155250SAMN43453749Contig2CCP170127(Genome)Methylocystis sp. NC52PCSUB14700942PRJNA1155264SAMN43454258-CP168955(genome)Methylobacterium organophilum NC52PC Test tube rumen fermentation parameters During in vitro rumen fermentation, no significant differences were observed in pH, total gas production, or digestibility between the control and NC52PC-inoculated samples at any sampling point except for methane production (p-value > 0.05). After 24 h, the total headspace volume of the serum bottle increased from 130 to more than 160 ml. Dry matter degradation continued to increase from 25% at 12 h to more than 32% at 24 h, indicating that rumen fermentation was active throughout the experimental period. In addition, various organic acids were synthesized during the rumen fermentation, and the pH values ​​of both samples dropped from 6.5 to 5.8. When NC52PC was inoculated, methane production was significantly reduced by 41.7% and 53.6% at 12 and 24 h, respectively (p-value <0.01) (Fig. 4). And the slow increase in methane production from 12 to 24 hours in the NC52PC inoculation group shows continuous methanotrophic activity. Since the population of Methylocystis remained relatively stable for 24 hours, methane consumption may have continued. Although NC52PC basically requires oxygen for growth and methane oxidation, to confirm whether NC52PC has the ability to oxidize methane and grow under anoxic conditions, methane consumption was tested using 20% ​​methane under anoxic conditions in NMS-Cu medium supplemented with 0.60 g / L cysteine. As a result, the methane concentration decreased from 180,000 ppm to 168,000 ppm and 160,000 ppm after 24 and 48 hours, respectively. In other words, NC52PC could consume approximately 20,000 ppm of methane for 48 hours without oxygen. This highlights the versatility of aerobic methanotroph NC52PC and its ability to stably oxidize methane despite lack of oxygen supply. Methane oxidation by aerobic methanotrophs in anaerobic environments is possible by utilizing other alternative electron acceptors available in the rumen contents.Microorganisms belonging to the Methylomonadiaceae and Methylocystaceae have been reported to be capable of nitrate / nitrite or mineral oxide-dependent methane oxidation under oxygen limitation. NC52PC may have evolved to utilize denitrification or mineral reduction processes in anoxic environments such as the rumen. Effect of NC52PC on the composition of the rumen microbiota in vitro Total genomic DNA was extracted from both control and NC52PC samples from three technical replicates of the 24-h samples and one replicate of the 0-h sample. 16S rRNA (V3-V4) gene sequence analysis was performed to determine differences in the composition, abundance, and diversity of the rumen microbiota between the control and NC52PC samples after 24-h in vitro fermentation. In total, 18 bacterial phyla and 276 bacterial genera were detected in the pooled experimental samples. Bacteroidetes, Firmicutes, Proteobacteria, and Actinobacteria were the dominant phyla, accounting for up to 80% of the total bacterial ASV (Fig. 5). In the control group, Prevotella was the most dominant genus (16.56%), followed by Intestinimonas (4.21%), Aristeella (4.20%), Succiniclastum (2.51%), Rumminococcus (2.41%), Sodaliphilus (2.17%), Lentimicrobium (1.63%), Bifidobacterium (1.41%), Gehongia (1.39%), and Paludibacteria (1.32%). Meanwhile, the most dominant genus in the NC52PC inoculated samples was Methylocystis (28.7%), followed by Prevotella (9.5%), Aristeella (3.2%), Sodaliphilus (3.2%), Intestinimonas (3.16%), Methylobacterium (2.2%), Ruminococcus (1.74%), Segatella (1.61%), Succiniclastium (1.16%), and Bifidobacterium (1.1%). Since Methylocystis was the dominant genus in the NC52PC samples, the relative abundances of other dominant bacterial genera, including Prevotella, Aristeella, Intestinimonas, Ruminococcus, and Lentimicrobium, were significantly lower (p-value<0.05). In both the control and NC52PC 24-h samples, the archaeal community was dominated by the genus Metanobrevibacter (control 78%, NC52PC 86%), followed by Metanomasilicocus and Metanospira. In the case of Metanobrevibacter, the predominant methanogenic archaea in the rumen, its abundance increased relatively after 24 h, suggesting that the addition of NC52PC did not negatively affect the methanogenic community. In the fungal community, three phyla, Neocalymastigomycota, Ascomycota, and Basidimycota, were dominant, accounting for more than 80% of the total fungal ASV in both the control and NC52PC samples (Fig. 5). In particular, Neocalymastigomycota, which expresses various enzymes involved in lignocellulose degradation,

[0043] There was a slight increase in the amount of fat, which may promote feed digestion. Analysis of alpha diversity showed that bacterial species diversity (Shannon index) in 24-h samples was significantly higher in control samples than in NC52PC (p-value < 0.05), but species richness (Chao 1 index) was not significantly affected. In addition, although archaeal diversity was not affected, Chao 1 index was significantly lower in NC52PC than in control samples (p-value < 0.05), indicating a significant effect on archaeal species richness. In addition, the differences in fungal species diversity and richness were not significant (p-value > 0.05). In vivo rumen fermentation Overall, DMI (kg / d), total body weight gain (kg), and feed conversion ratio (FCR) did not differ significantly among the treatments (p > 0.05) (Fig. 7). Ruminal fermentation characteristics of CON, LOW, and HIGH are shown in Table 7. Butyrate and total volatile fatty acid (VFA) production of CON were significantly lower than those of LOW and HIGH treatments. This may have resulted in lower ruminal pH of NC52PC treatments LOW (6.30) and HIGH (6.29) than CON (6.55). Neither LOW nor HIGH significantly affected other fermentation characteristics, including ammonia content, acetate, propionate, and A:P ratio. Most importantly, CH 4 Emissions (g / d), CH 4 Yield (g / kg DMI), CH 4 The intensity (g / kg BW0.75) was significantly higher in the control group than in the LOW and HIGH NC52PC treated cows (p < 0.05) (Fig. 8), but total CO 2 Levels remained similar across all treatment groups (data not shown). Effects of Methanotrophic Probiotics on pH, Ammonia-Nitrogen and Volatile Fatty Acid Production Data are presented as mean ± standard deviation (SD). 1 Treatment: CON, basal diet (0.2% wheat bran); LOW, basal diet + 0.2% methanotrophs (3Х10 7 CFUs / ml); HIGH, basal diet + 0.2% methanotrophs (3Х10 8 CFUs / ml). 2 SEM, standard error of the mean. 3 A:P, acetic acid to propionic acid ratio. conclusion The study results showed that 12 Korean cattle were fed 3Х10 for 17 days. 8When administered with a probiotic based on methanotrophs at a concentration of CFU / mL, methane emissions were successfully reduced by more than 14% without adversely affecting overall animal health. Methanotroph-based probiotics have tremendous potential to mitigate methane emissions in ruminants and can be used as a promising feed additive to combat climate change.

Claims

1. A composition for reducing methane emissions from ruminants, comprising methanotrophic bacteria.

2. In claim 1, the methanotrophic bacteria is a composition for reducing methane emissions from ruminants derived from the rumen of ruminants.

3. A composition for reducing methane emission from ruminants according to claim 1, wherein the methanotrophic bacteria is a bacterium of the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium.

4. A composition for reducing methane emissions from ruminants, further comprising methylotrophic bacteria according to claim 1.

5. In claim 4, the methylotrophic bacteria is a composition for reducing methane emission from ruminants derived from the rumen of ruminants.

6. A composition for reducing methane emission from ruminants, wherein the methylotrophic bacteria according to claim 4 is a bacterium of the genus Methylobacterium.

7. A composition for reducing methane emission from ruminants, wherein the methylotrophic bacteria according to claim 4 is Methylobacterium organophyllum.

8. A composition for reducing methane emissions from ruminants according to claim 1, wherein the ruminant is a cow, a giraffe, a deer, a sheep or a camel.

9. A method for reducing methane emissions from ruminants, comprising the step of feeding the composition of any one of claims 1 to 8 to the ruminant.

10. A feed composition for ruminants containing methanotrophic bacteria.

11. A feed composition for ruminants according to claim 10, wherein the methanotrophic bacteria are derived from the rumen of ruminants.

12. A feed composition for ruminants according to claim 10, wherein the methanotrophic bacteria are bacteria belonging to the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium.

13. A feed composition for ruminants further comprising methylotrophic bacteria according to claim 10.

14. A ruminant feed composition according to claim 13, wherein the methylotrophic bacteria are derived from the rumen of a ruminant.

15. A feed composition for ruminants according to claim 13, wherein the methylotrophic bacteria are bacteria of the genus Methylobacterium.

16. A feed composition for ruminants according to claim 13, wherein the methylotrophic bacteria is Methylobacterium organophyllum.

17. A composition of feed additive for ruminants containing methanotrophic bacteria.

18. A composition of feed additive for ruminants according to claim 17, wherein the methanotrophic bacteria are derived from the rumen of ruminants.

19. A composition for a feed additive for ruminants according to claim 17, wherein the methanotrophic bacteria is a bacterium of the genus Methylocystis, Methylomonas, Methylococcus, Methylosinus or Methylomicrobium.

20. A feed additive composition for ruminants further comprising methylotrophic bacteria according to claim 17.

21. A composition of feed additives for ruminants according to claim 20, wherein the methylotrophic bacteria are derived from the rumen of ruminants.

22. A composition of a feed additive for ruminants according to claim 20, wherein the methylotrophic bacteria is a bacterium of the genus Methylobacterium.

23. A composition of a feed additive for ruminants according to claim 20, wherein the methylotrophic bacteria is Methylobacterium organophyllum.

Citation Information

Patent Citations

  • Methylotrophs for aquaculture and animal feed

    US10920230B2

  • A process for the production of a bacterially enriched animal feed composition

    US20190082717A1

  • Methylobacterium strains for mitigating methane and methods related thereto

    WO2023039481A1

  • Ruminant feed

    WO2024008734A1