Gene amplification method for producing IVT template
The novel PCR method streamlines the production of IVT templates with a poly A tail, addressing the complexity and inefficiency of existing neoantigen screening methods, and enhances the accuracy of identifying immunogenic neoantigens for targeted therapies.
Patent Information
- Application Number
- PCT/KR2024/096518
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-20
- Filing Date
- 2024-11-13
- Publication Date
- 2025-06-05
AI Technical Summary
Existing neoantigen screening methods are complex, time-consuming, and require expensive peptide synthesis, limiting their efficiency and accuracy in identifying immunogenic neoantigens for targeted therapy.
A novel PCR method that produces an IVT template with a poly A tail in a single step, using forward and reverse primers specific to barcode sequences, allowing for efficient production of mRNA-based templates for antigen or neoantigen screening.
The method simplifies the production of IVT templates, reduces the complexity and time required for neoantigen screening, and enhances the accuracy of identifying immunogenic neoantigens, thereby facilitating the development of targeted therapies.
Smart Images

Figure KR2024096518_05062025_PF_FP_ABST
Abstract
Description
Gene amplification method for producing IVT templates
[0001] The present invention relates to a novel PCR method used to produce a template for performing IVT in an mRNA-based antigen or neoantigen screening method.
[0002]
[0003] Antigens, particularly "neoantigens," refer to new proteins or peptides formed in cancer cells when mutations occur in their DNA. These neoantigens are mutant proteins not found in normal cells, are cancer-specific antigens, and can therefore be used as targets for targeted therapies. To implement targeted therapies utilizing neoantigens, immunogenic neoantigens must first be identified. Furthermore, current neoantigen prediction algorithms have limitations in suggesting immunogenicity, requiring a large amount of biologically immunogenic neoantigen sequence data.
[0004] Specifically, the existing neoantigen screening method requires expensive peptide synthesis, which can lead to problems such as exclusion of candidate neoantigens from screening due to peptide synthesis failure, and requires a complex three-step PCR process for the production of mRNA-based minigenes. Furthermore, when screening in a tandem minigene format where 10 minigenes are arranged per barcode, the 10 epitopes contained in the positive samples must be individually screened using peptides, etc. Therefore, the existing neoantigen screening process is complex and time-consuming. Therefore, the development of new technologies that can perform the neoantigen screening process more accurately and efficiently is necessary. Such screening is necessary for screening a large number of epitopes by sliding the entire gene sequence to select precise antigenic epitopes within genes related to autoimmune diseases, not just predicted neoantigens.
[0005] Meanwhile, to perform in vitro transcription (IVT), which synthesizes mRNA from DNA during the screening process, a template for the IVT reaction must first be prepared. Conventional methods, such as sewing PCR or assembly PCR, require attaching a poly A tail to the template for mRNA synthesis. However, these PCR methods require two or three steps, which are time-consuming and necessitate an optimization process to ensure accuracy.
[0006] In addition, existing DNA template-based IVT template production technology has limitations in the number of IVT templates that can be produced at one time, and is cumbersome because it sometimes requires a special process to remove pathogenic substances such as bacteria and viruses using bacteria or animal-derived materials. Therefore, a new IVT template production technology is needed.
[0007] Accordingly, the inventors of the present invention have completed the present invention by devising a method for producing an IVT template including a poly A tail through a single PCR.
[0008]
[0009] The present invention aims to provide a novel PCR method used to produce a template for performing IVT in an antigen or neoantigen screening method.
[0010]
[0011] A PCR method comprising: an amplification step of a plurality of DNA templates, each of which includes a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence; a step of cloning the plurality of DNA templates with a first forward primer specific to the first barcode sequence; and a step of amplifying the effective DNA templates, the step of cloning an effective DNA template selected from the plurality of DNA templates with a second forward primer specific to the second barcode sequence.
[0012] 2. A PCR method in which the reverse primer used in the amplification step in the above 1 contains a poly A tail at the 5' end.
[0013] 3. A PCR method in the above 1, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer greater than or equal to 2).
[0014] 4. A PCR method according to 1 above, wherein the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer greater than or equal to 2).
[0015] 5. A PCR method according to 1 above, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.
[0016] 6. In the above 1, the PCR method wherein the plurality of DNA templates have the second barcode sequence linked to the 3' end of the first barcode sequence, and the new antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.
[0017] 7. In the above 1, each of the amplification steps is a PCR method in which only the forward primer binds to the plurality of DNA templates or the valid DNA template in the first cycle, and from the subsequent cycles, the forward primer binds to the plurality of DNA templates or the valid DNA template, and the reverse primer binds to the complementary strand of the plurality of DNA templates or the complementary strand of the valid DNA template.
[0018]
[0019] The present invention can provide a novel PCR method used for producing a template for performing IVT in antigen or neoantigen screening and vaccine production using mRNA.
[0020] The PCR method of the present invention can efficiently produce a template for an IVT reaction by using a forward primer binding to a barcode sequence and a reverse primer including a poly A tail.
[0021] The PCR method of the present invention can effectively overcome the limitation of the number of antigens generated from an IVT template based on a basic DNA template, for example, by using a multiple oligo library.
[0022] The novel PCR method of the present invention is efficient in quality control during the new drug development stage because it does not require a master cell bank for IVT template DNA quality control.
[0023] The novel PCR method of the present invention is easy to approach in drug safety evaluation and quality control at the new drug development stage because it can be produced without a special process (a process for removing pathogenic substances such as bacteria or viruses using bacteria or animal-derived materials).
[0024]
[0025] Figures 1a and 1b schematically illustrate the new antigen screening process.
[0026] Figure 2 schematically illustrates a DNA template design consisting of two barcode sequences, a T7 promoter, a 5' untranslated region (UTR), a Kozak sequence, an open reading frame (ORF) containing one neoantigen coding sequence, and a 3' UTR, sequentially.
[0027] Figures 3a and 3b are schematic diagrams illustrating a PCR method of the present invention used to produce an IVT template.
[0028] Figure 4 shows the results of agarose gel electrophoresis after PCR products were produced in the order of one first barcode sequence and four second barcode sequences for the purpose of verifying the size of the reaction product for each barcode.
[0029] Figure 5 is the result of verifying whether immunogenicity is induced through an IVT composite based on a barcode A-specific minigene pool having the same composition as the CEF peptide pool produced in Figure 4.
[0030] Figures 6a to 6c illustrate the results of PCR based on minigene pools designed and constructed with a common barcode and 10 random barcodes in that order to verify the accuracy of the reaction products. After construction of a common barcode sequence-specific minigene pool, the resulting PCR products were subjected to nested PCR using barcodes 1 to 10, and the results were confirmed by agarose gel electrophoresis.
[0031] Figures 7a and 7b show the results of the primary screening, in which HLA-A*02:01-overexpressing K562 cell lines or autologous CD40 act B cells were co-cultured on ELISpots coated with INF-gamma to confirm the immunogenicity against HLA-A*02:01-specific antigens targeting activated T cells.
[0032] Figures 8a to 8e are examples of the use of minigene for screening, showing the final results of confirming immunogenicity for HLA-A*02:01-specific antigens by co-culturing a K562 cell line overexpressing HLA-A*02:01 on an ELISpot coated with INF-gamma for the purpose of selecting positive neoantigens.
[0033]
[0034] The present invention provides a novel PCR method used to produce a template for performing in vitro transcription (IVT) in a method for screening a new antigen and a method for producing a vaccine using mRNA.
[0035] The present invention relates to a PCR method for producing a template for performing IVT more simply by including an amplification step of a plurality of DNA templates, the step including cloning a plurality of DNA templates each including a first barcode sequence, a second barcode sequence, and a neoantigen coding sequence with a first forward primer specific to the first barcode sequence; and an amplification step of an effective DNA template, the step including cloning an effective DNA template selected from among the plurality of DNA templates with a second forward primer specific to the second barcode sequence.
[0036] The PCR method of the present invention can be performed using a DNA template as a template, which includes two barcode sequences for each candidate neoantigen, with the candidate neoantigen as the center.
[0037] The PCR method of the present invention can be used to produce a template for an IVT reaction performed to produce an mRNA pool from a DNA pool.
[0038] The PCR method of the present invention can be used to produce an IVT template in a new antigen screening method.
[0039] The PCR method of the present invention can be used in the production of a vaccine using mRNA.
[0040] In the PCR method of the present invention, the “amplification step of multiple DNA templates” is a step of producing a DNA pool by replicating multiple DNA templates using a first forward primer specific to a first barcode sequence.
[0041] After amplifying multiple DNA templates using the PCR method of the present invention, the produced DNA pool is transcribed by performing IVT, and then expressed to select a group of effective DNA templates that exhibit immunogenicity.
[0042] In the PCR method of the present invention, the “amplification step of a valid DNA template” is a step of producing a DNA pool by replicating a valid DNA template using a second forward primer specific to a second barcode sequence.
[0043] The first forward primer and the second forward primer used in the above amplification step are capable of binding complementarily to the first barcode and the second barcode, respectively, and correspond to primers that specifically bind to each minigene pool.
[0044] The reverse primer used in the above amplification step is a primer that contains a poly A tail at the 5' end and can complementarily bind to all DNA templates, regardless of the sequence of the first barcode or the second barcode.
[0045] The product obtained by the PCR method of the present invention is a double-stranded IVT template containing a poly A tail.
[0046] The PCR method of the present invention can be performed by appropriately adjusting conventional PCR reaction conditions as needed. For example, the denaturation step can be performed at 80°C to 97°C, 85°C to 96°C, or 90°C to 95°C. For example, the primer annealing step can be performed at 45°C to 70°C, 47°C to 67°C, or 50°C to 65°C. For example, the elongation step can be performed at 65°C to 80°C, 67°C to 77°C, or 70°C to 75°C.
[0047] The PCR method of the present invention can be performed by appropriately adjusting the conventional cycle number as needed. For example, it can be performed with 20 to 50 cycles, 21 to 45 cycles, 22 to 40 cycles, 23 to 35 cycles, or 25 to 35 cycles.
[0048] The neoantigen screening method using the PCR method of the present invention is largely divided into two parts (see Figures 1a and 1b). Part 1 includes the steps of designing a DNA template centered on a candidate neoantigen to include two barcode sequences for each candidate neoantigen, amplifying the DNA template using the PCR method of the present invention to produce a DNA pool, and producing an mRNA pool from the DNA pool. Part 2 includes the steps of isolating T cells and B cells from donated blood to confirm the actual immunogenicity of the candidate neoantigen, injecting mRNA and co-stimulatory factors into the B cells after a 5-day maturation process to produce antigen-presenting cells, co-culturing the antigen-presenting cells and T cells, and then determining the level of interferon-gamma detection by the T cells. This screening method includes Part 1 performing screening using the first and second barcodes, respectively, and Part 2 performing screening using each barcode once to select a single neoantigen.
[0049] A "neoantigen" is a new peptide formed in cancer cells when a mutation occurs in tumor DNA. It is a mutant protein not found in normal cells and can become a cancer-specific antigen. Neoantigen peptides are presented on the surface of antigen-presenting cells in a form bound to MHC molecules (pMHC), and T cells recognize them, inducing immunogenicity. To discover neoantigens that can serve as therapeutic targets, it is necessary to predict the peptide sequence (epitope) that will be presented on the surface of antigen-presenting cells upon binding to MHC, and to verify whether the predicted epitope is immunogenic.
[0050] In the present invention, “new antigen coding sequence” means a base sequence encoding a new antigen.
[0051] A "minigene" is a small gene that contains the coding region and control region essential for gene expression in the same manner as a wild-type gene. In one embodiment, a minigene may be a sequence encoding a neoantigen.
[0052] In the present invention, “DNA template” means a single-stranded antisense DNA each including a first barcode sequence, a second barcode sequence, and a new antigen coding sequence, and is used as a template when producing a DNA pool through PCR.
[0053] Antigen-presenting cells (APCs) are a type of immune cell that enhances the immune response by presenting antigens on their surface. Representative examples of APCs include dendritic cells, macrophages, and B cells. APCs can present antigenic peptides via major histocompatibility complex (MHC) molecules, and T cells recognize these presented peptides and become activated, initiating an adaptive immune response.
[0054] Cytotoxic T lymphocytes (CTLs) are a type of lymphocyte and an important component of the adaptive immune system, and are CD8 + Also referred to as T cells, cytotoxic T lymphocytes play a crucial role in the immune response by killing intracellular pathogens such as viruses or bacteria, as well as cancer cells. CTL induction refers to the activation and proliferation of CTLs by recognizing peptides presented by MHC molecules.
[0055] "Immunogenicity" refers to the property of causing an immune response when a foreign substance, such as an antigen, is introduced into the body of a human or animal. Methods for measuring immunogenicity include the Enzyme-Linked ImmunoSpot (ELISpot) Assay, Intracellular Cytokine Staining (ICS) Assay, and Cytokine Bead Array (CBA). In one example, immunogenicity was confirmed by performing ELISpot, but is not limited thereto.
[0056] "ELISpot" is a test method for assessing cellular immunogenicity. It is a highly sensitive immunoassay that can measure cytokine-secreting immune cells in response to a specific antigen at the cellular level. ELISpot is used in research on immune responses in cancer, allergies, and autoimmune diseases, as well as in the discovery of new vaccine candidates. In particular, CD8 + When trying to confirm the cytotoxicity of T cells, ELISpot measurement using a type of cytokine, interferon-γ (IFNγ) or tumor necrosis factor (TNF-a), or both cytokines simultaneously can be used.
[0057] The term "barcode" refers to an oligonucleotide having a nucleotide sequence to which a primer can complementarily bind, which identifies a candidate neoantigen, and is used to distinguish DNA templates from each other in a neoantigen screening method.
[0058] The barcode can be produced using known techniques, and the specific base sequence and length of the barcode of the present invention are not particularly limited.
[0059] In one embodiment, the sequence of the barcode was selected from among the barcodes generated using a barcode generator, which had a Tm (melting temperature) value of 54°C or higher and 56°C or lower, did not have three consecutive nucleotides in the barcode sequence, and did not have a predicted hairpin structure in the barcode. Finally, a barcode set was formed using multiple barcodes having the same length and Tm value, but the present invention is not limited thereto.
[0060] The term "barcode set" refers to a group of multiple barcodes. In one embodiment, two barcode sets, each containing ten barcodes, were used, but this is not limiting.
[0061] In one embodiment, the two types of barcode sets may be composed of different oligonucleotides.
[0062] In one embodiment, the two types of barcode sets may be named alphabetic naming barcodes and numeric naming barcodes, respectively.
[0063] In one embodiment, the two types of barcode sets may be named a first barcode sequence and a second barcode sequence, respectively.
[0064] In one embodiment, a barcode set having the sequence shown in Table 1 below is constructed, but is not limited thereto.
[0065] No. Classification Barcode Name Sequence Tm Value Length 1 Alphabet Naming Barcode Barcode-AGAGAAGCGCACGTACCACTA (SEQ ID NO: 1) 55℃20 mer2 Barcode-BAGGACCAACAAGCGCGTAAC (SEQ ID NO: 2) 55℃20 mer3 Barcode-CTGGCACGAATGGTTAGGCAG (SEQ ID NO: 3) 55℃20 mer4 Barcode-DGTCCTGACGAACGCATGACC (SEQ ID NO: 4) 55℃20 mer5 Barcode-ETGTCCTGCAGCCTCGATCTT (SEQ ID NO: 5) 55℃20 mer6 Barcode-FCGAACTGGACGCCTCGGATA (SEQ ID NO: 6) 55℃20 mer7 Barcode-GGCCGAGTAGCCAGCATTCTT (SEQ ID NO: 7) 55℃20 mer8 Barcode-HCCACCTCGTTCCAGACTTCG (SEQ ID NO: 8) 55℃20 mer9 Barcode-IGTGATGCGGCGACACTAAGT (SEQ ID NO: 9) 55℃20 mer10 Barcode-JATAACCGGCGCATTACCACG (SEQ ID NO: 10) 55℃20 mer11 Number naming barcode Barcode-1TCGAGTCTGCCAGGTTACGA (SEQ ID NO: 11) 55℃20 mer12 Barcode-2ACGAGAGATCCTGCGGCTTA (SEQ ID NO: 12) 55℃20 mer13 Barcode-3TGTGGCTTGTACCGTGTTCA (SEQ ID NO: 13) 55℃20 mer14 Barcode-4CATAGACTGCAGACTCCGCG (SEQ ID NO: 14) 55℃20 mer15 Barcode-5GTACCGCCAGCCATCTAACG (SEQ ID NO: 15) 55℃20 mer16 Barcode-6TCAGGAGAAGGCGCTAACCA (SEQ ID NO: 16)55℃20 mer17Barcode-7GCCATCGGACTTGCCTAGAA (SEQ ID NO: 17)55℃20 mer18Barcode-8CGTCTGAGCAAGGCACGTAG (SEQ ID NO: 18)55℃20 mer19Barcode-9GCCGGCAATGTGAGCTCTAT (SEQ ID NO: 19)55℃20mer20Barcode-10GTGTCTATTGGTGCGTGGCC (SEQ ID NO: 20)55℃20 mer
[0066]
[0067] The present invention provides a PCR method in which the reverse primer used in the amplification step includes a poly A tail at the 5' end.
[0068] The PCR method of the present invention can obtain a PCR product that can be subsequently subjected to IVT by using a common reverse primer containing a poly A tail.
[0069] The present invention provides a PCR method in which a first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that each specifically bind to n different primers (n is an integer greater than or equal to 2).
[0070] The present invention provides a PCR method in which the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer of 2 or more).
[0071] “The second barcode sequence is different from the first barcode sequence” means that the n oligonucleotides included in the first barcode sequence and the m oligonucleotides included in the second barcode sequence are different from each other.
[0072] The numbers n and m may vary depending on the number of candidate neoantigens being screened.
[0073] The length of the barcode sequence may vary depending on several factors, including the number of neoantigen candidates to be screened, the length of the DNA that serves as a template for amplification, and PCR conditions.
[0074] For example, the barcode of the present invention may have 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more, 31 or more, 32 or more, 33 or more, 34 or more, 35 or more, 36 or more, 37 or more, 38 or more, 39 or more, 40 or more, 41 It may be composed of 42 or more, 43 or more, 44 or more, or 45 or more nucleotides.
[0075] For example, the barcode of the present invention may have 50 or less, 49 or less, 48 or less, 47 or less, 46 or less, 45 or less, 44 or less, 43 or less, 42 or less, 41 or less, 40 or less, 39 or less, 38 or less, 37 or less, 36 or less, 35 or less, 34 or less, 33 or less, 32 or less, 31 or less, 30 or less, 29 or less, 28 or less, 27 or less, 26 or less, 25 or less, 24 or less, 23 or less, 22 or less, 21 or less, 20 or less, 19 or less, 18 or less, 17 or less, 16 or less, 15 or less, 14 or less, 13 or less, 12 or less, It may consist of 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, or 5 or fewer nucleotides.
[0076] The present invention provides a PCR method wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.
[0077] In one embodiment, the barcode is comprised of, but is not limited to, 10 to 20 nucleotides.
[0078] The present invention provides a PCR method in which the plurality of DNA templates are linked to the 3' end of the first barcode sequence, and the new antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.
[0079] "Amplifiable linkage" means that the neoantigen coding sequence is functionally linked so that it can be replicated during amplification of the DNA template. Specifically, the first barcode sequence or the second barcode sequence and the neoantigen coding sequence are linked such that a strand complementary to the neoantigen coding sequence can be synthesized starting from a primer that complementarily binds to the barcode sequence, and any additional sequence may be included to achieve this purpose.
[0080] For example, the plurality of DNA templates of the present invention may be a plurality of DNA templates to which a T7 promoter and a Kozak sequence are operably linked for subsequent transcription and expression.
[0081] The present invention provides a PCR method in which each of the above amplification steps binds only the forward primer to the plurality of DNA templates or the valid DNA template in the first cycle, and from the subsequent cycles, the forward primer binds to the plurality of DNA templates or the valid DNA template and the reverse primer binds to the complementary strand of the plurality of DNA templates or the complementary strand of the valid DNA template.
[0082] Since the DNA template used in the PCR method of the present invention is a single strand and an antisense strand, only the forward primer can complementarily bind in the first cycle.
[0083] In the first cycle, the forward primer binds to the DNA template and synthesizes a complementary strand, forming a double strand. Consequently, in subsequent cycles, the double strand separates into single strands, allowing both the forward and reverse primers to bind complementarily to the template.
[0084]
[0085] Hereinafter, the present invention will be described in detail by way of examples to specifically explain the present invention.
[0086]
[0087] Example
[0088] Example 1. Design of DNA template
[0089] The DNA template was designed to be a structure capable of in vitro transcription (IVT), sequentially consisting of two barcode sequences, a T7 promoter, a 5' untranslated region (UTR), an open reading frame (ORF) containing a Kozak sequence and an initiation codon, a neoantigen candidate, a stop codon, and a 3' UTR (Fig. 2).
[0090] The two barcode sequences used in the experiment are shown in Table 1, and the specific T7 promoter, 5' UTR, Kozak sequence and start codon, stop codon and 3' UTR used in the experiment are shown in Table 2 below.
[0091] T7 promoter (including capping binding (AG) sequence)GCGAGGTAATACGACTCACTATAAG (SEQ ID NO: 21) 5' UTRGGCCAGTCACCATGGGG (SEQ ID NO: 22) Kozak + start codonGCCACCATGStop 3' UTRTAAgctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgc (SEQ ID NO: 23)
[0092]
[0093] The fabricated DNA template is single-stranded and corresponds to the antisense strand. The barcode is a site where the forward primer can bind during PCR, and refers to a primer binding site arbitrarily synthesized in the present invention for the purpose of selecting a new antigen.
[0094]
[0095] Example 2. PCR method using multiple oligonucleotides
[0096] To produce templates for performing in vitro transcription (IVT), an efficient PCR method was devised using multiple DNA templates having the design of Example 1 described above as templates. The forward primer used in the PCR of the present invention is a pool-specific primer that can specifically bind to each minigene pool and is a primer that binds to one of two barcode sequences. The reverse primer is a common primer that can bind to all sense strands regardless of the minigene pool. The sequences of the common reverse primers used in the experiments are shown in Table 3 below.
[0097] Common primer (5'->3')tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt tttttttttttttttttttttttttttttttttttttttttttttttttttttgcaatgaaaataaatgttttttattaggcag (SEQ ID NO: 24)
[0098]
[0099] Since the DNA template produced in Example 1 is in an antisense form, only the forward primer can bind to the DNA template in the first cycle, and through the first cycle, the complementary strand of the single-stranded DNA template is synthesized, generating a double-stranded PCR product (Fig. 3a). From the subsequent cycles, the double-stranded PCR product is separated into single strands in a high-temperature denaturation step, the forward primer binds to the antisense strand, and the reverse primer containing a poly A tail binds to the sense strand. When the reverse primer binds to the sense strand and the complementary strand is synthesized, a part complementary to the poly A tail is also synthesized according to the principle of assembly PCR. Therefore, the final obtained PCR product becomes a double-stranded IVT-capable template containing a poly A tail (Fig. 3b).
[0100] This PCR method is simpler than conventional sewing PCR and assembly PCR, and is therefore highly useful in producing IVT templates containing poly A tails.
[0101]
[0102] Example 3. Design of 100 candidate neoantigens using DNA template design.
[0103] In the embodiment of the present invention, the method of assigning barcodes was such that when screening a total of 100 antigens, 10 types of barcodes were used as one set, and a total of two sets of barcodes were randomly synthesized and used for screening.
[0104] The barcode sequence was generated using the existing publicly available barcode generator (https: / github.com / audy / barcode-generator) Python program to generate barcodes of 10 to 20 bp in length. Among the generated barcodes, those with a Tm (melting temperature) value of 54 ° C. or higher and 56 ° C. or lower, without three consecutive nucleotides, and without the predicted hairpin structure in the barcode were selected. Finally, a barcode set was constructed with sequences with the same barcode length and Tm value.
[0105] Individual barcodes included in one set were named with the letters A to J (alphabet-named barcode sequence), and individual barcodes included in another set were named with the numbers 1 to 10 (numeric-named barcode sequence). The specific sequences of each barcode are shown in Table 1.
[0106] According to the aforementioned Example 1, a total of 100 DNA templates were produced by including a combination of one alphabetic naming barcode sequence, one numeric naming barcode sequence, and one neoantigen sequence in each DNA template. The 100 produced DNA templates are shown in Table 4 below. N represents any nucleotide among A, U, T, and G.
[0107]
[0108]
[0109] Each of the 100 assigned minigenes was custom-made as a library, and the DNA templates were designed to amplify and produce a minigene pool of a defined combination through PCR.
[0110]
[0111] Example 4. Production of a barcode-linked minigene pool to confirm the production of an IVT template and verify whether it induces immunogenicity.
[0112] To confirm that the IVT template is successfully produced through the PCR method of the present invention, experiments were performed with 32 minigenes containing ORFs corresponding to the same peptide sequence as the CEF peptide cocktail.
[0113] The CEF peptide pool used as a positive control for HLA Class I is a virus-based mixture of 32 HLA Class I-restricted T-cell epitopes. A minigene was created with the same epitope composition to verify whether it induced immunogenicity.
[0114] First, a minigene pool was created using barcode A corresponding to the first barcode sequence and barcodes 1, 2, 3, and 4 corresponding to the second barcode sequence, and then the band size was confirmed by agarose gel electrophoresis (Fig. 4).
[0115] Among these, a DNA pool containing 32 CEF species was created using barcode A, which is an alphabetic naming barcode sequence commonly assigned to each Minigene.
[0116] The DNA template used in the production of the DNA pool is sequentially composed of two barcode sequences, a T7 promoter, a 5' untranslated region (UTR), a Kozak sequence and an initiation codon, an open reading frame (ORF) containing each DNA sequence corresponding to 32 CEF species, a stop codon, and a 3' UTR, similar to Example 1.
[0117] The barcode sequences shown in Table 1 are combined in Table 5 below, and the T7 promoter, 5' UTR, Kozak sequence, start codon, stop codon, and 3' UTR sequences are shown in Table 3. Table 5 below shows the epitope sequences corresponding to each of the 32 CEF species used for each barcode combination.
[0118] No. 1 Barcode Sequence 2 Barcode Sequence Classification Amino Acid Sequence DNA Sequence (Codon Optimization) 1 Barcode-A Barcode-B Influenza AFMYSDFHFI (SEQ ID NO: 25) TTCATGTACAGCGACTTCCACTTCATC (SEQ ID NO: 26) 2 Barcode-A Barcode-BEBV RTADYCNVLNKEF (SEQ ID NO: 27) GACTACTGCAACGTGCTGAACAAGGAGTTC (SEQ ID NO: 28) 3 Barcode-A Barcode-C Influenza MGILGFVFTL (SEQ ID NO: 29) GGCATCCTGGGCTTTGTGTTCACCCTG (SEQ ID NO: 30) 4 Barcode-A Barcode-CEBV LMP2 ACLGGLLTMV (SEQ ID NO: 31) TGTCTGGGAGGCCTGCTGACAATGGTG (SEQ ID NO: 32) 5 Barcode-A Barcode-CEBV BMLF1GLCTLVAML(SEQ ID NO: 33)GGACTGTGTACACTGGTGGCCATGCTG(SEQ ID NO: 34)6Barcode-ABarcode-CHCMV pp65NLVPMVATV(SEQ ID NO: 35)AATCTGGTGCCTATGGTGGCCACCGTG(SEQ ID NO: 36)7Barcode-ABarcode-CInfluenza NPELRSRYWAI(SEQ ID NO: 37)GAGCTGAGAAGCAGATACTGGGCCATC(SEQ ID NO: 38)8Barcode-ABarcode-CEBV EBNA 3QAKWRLQTL(SEQ ID NO: 39)CAGGCCAAGTGGAGACTGCAGACACTG(SEQ ID NO: 40)9Barcode-ABarcode-CHCMVTPRVTGGGAM(SEQ ID NO: 41)ACACCTAGAGTGACAGGAGGCGGCGCTATG(SEQ ID NO: 42)10Barcode-ABarcode-DInfluenza NPRVLSFIKGTK(SEQ ID NO: 43)AGAGTGCTGAGCTTCATCAAGGGCACCAAG(SEQ ID NO: 44)11Barcode-ABarcode-DEBVRVRAYTYSK(SEQ ID NO: 45)AGAGTGAGAGCCTACACCTACAGCAAG(SEQ ID NO: 46)12Barcode-ABarcode-DInfluenzaMSIIPSGPLK(SEQ ID NO: 47)AGCATCATCCCTAGCGGCCCACTGAAG(SEQ ID NO: 48)13Barcode-ABarcode-DEBV EBNA 4NPAVFDRKSDAK(SEQ ID NO: 49)GCCGTGTTCGACAGAAAGAGCGACGCCAAG(SEQ ID NO: 50)14Barcode-ABarcode-DEBVIVTDFSVIK(SEQ ID NO: 51)ATCGTGACCGACTTCAGCGTGATCAAG(SEQ ID NO: 52)15Barcode-ABarcode-DEBVATIGTAMYK(SEQ ID NO: 53)GCCACAATCGGCACCGCCATGTACAAG(SEQ ID NO: 54)16Barcode-ABarcode-DEBV BZLF-1RAKFKQLL(SEQ ID NO: 55)AGAGCCAAGTTCAAGCAGCTGCTG(SEQ ID NO: 56)17Barcode-ABarcode-DEBVEENLLDFVRF(SEQ ID NO: 57)GAGGAGAACCTGCTGGACTTCGTGAGATTC(SEQ ID NO: 58)18Barcode-ABarcode-EInfluenza AVSDGGPNLY(SEQ ID NO: 59)GTGAGCGATGGCGGCCCTAATCTGTAC(SEQ ID NO: 60)19Barcode-ABarcode-EInfluenza ACTELKLSDY(SEQ ID NO: 61)TGCACCGAGCTGAAGCTGAGCGACTAC(SEQ ID NO: 62)20Barcode-ABarcode-FInfluenza AILRGSVAHK(SEQ ID NO: 63)ATCCTGAGAGGCTCTGTGGCCCACAAG(SEQ ID NO: 64)21Barcode-ABarcode-FEBVRLRAEAQVK(SEQ ID NO: 65)AGACTGAGAGCCGAGGCCCAGGTGAAA(SEQ ID NO: 66)22Barcode-ABarcode-GInfluenza NPSRYWAIRTR(SEQ ID NO: 67)AGCAGATACTGGGCCATCAGAACCAGA(SEQ ID NO: 68)23Barcode-ABarcode-HEBVRPPIFIRRL(SEQ ID NO: 69)AGACCCCCCATCTTCATCAGAAGACTG(SEQ ID NO: 70)24Barcode-ABarcode-IInfluenzaNPKTGGPIYKR(SEQ ID NO: 71)AAGACCGGCGGCCCCATCTACAAGAGA(SEQ ID NO: 72)25Barcode-ABarcode-JEBV EBNA 3AFLRGRAYGL(SEQ ID NO: 73)TTTCTGAGAGGCAGAGCCTACGGCCTG(SEQ ID NO: 74)26Barcode-ABarcode-1Influenza NPLPFDKTTVM(SEQ ID NO: 75)CTGCCCTTCGACAAGACCACCGTGATG(SEQ ID NO: 76)27Barcode-ABarcode-1EBV EBNA3AYPLHEQHGM(SEQ ID NO: 77)TATCCTCTGCACGAGCAGCACGGCATG(SEQ ID NO: 78)28Barcode-ABarcode-2HCMVSDEEEAIVAYTL(SEQ ID NO: 79)AGCGATGAGGAGGAGGCCATCGTGGCCTACACACTG(SEQ ID NO: 80)29Barcode-ABarcode-3EBV EBNA 3CRRIYDLIEL(SEQ ID NO: 81)AGAAGAATCTACGACCTGATCGAGCTG(SEQ ID NO: 82)30Barcode-ABarcode-4Influenza MASCMGLIY(SEQ ID NO: 83)GCCAGCTGCATGGGCCTGATCTAC(SEQ ID NO: 84)31Barcode-ABarcode-5CMV pp65IPSINVHHY(SEQ ID NO: 85)ATCCCCAGCATCAACGTGCACCACTAC(SEQ ID NO: 86)32Barcode-ABarcode-6HCMVEFFWDANDIY(SEQ ID NO: 87)GAGTTCTTCTGGGACGCCAACGACATCTAC(SEQ ID NO: 88)
[0119]
[0120] An RNA pool was prepared by performing IVT from a DNA pool produced by the PCR method of the present invention, electroporated into a K562 cell line overexpressing HLA-A*02:01, and co-cultured with PBMCs on an ELISpot coated with INF-gamma. As a result, it was confirmed that immunogenicity was induced at a level similar to that of the existing peptide-based induction method (Fig. 5).
[0121]
[0122] Example 5. Confirmation of a DNA pool created through PCR targeting a new antigen sequence linked to a barcode.
[0123] Example 5-1. PCR amplification
[0124] Minigenes containing actual barcode sequences were amplified for each barcode combination from the 100 DNA template composites produced in Example 3. As previously described, the DNA templates consist of an antisense strand, allowing the forward primer to bind complementarily to each barcode sequence, while the reverse primer can bind only to the sense strand of the newly synthesized DNA.
[0125] PCR was performed using a PCR reaction solution containing a single-stranded DNA template in antisense form, a forward primer complementary to the barcode sequence, and a common reverse primer capable of binding to all sense strands regardless of the minigene pool and containing a poly A tail.
[0126] The final PCR product obtained by performing PCR consists of two barcode sequences, a T7 promoter, a 5' UTR, an open reading frame (ORF) containing a neoantigen epitope sequence, a 3' UTR, and a poly A tail, and has a size of approximately 380 bp, although the size may vary depending on the length of the epitope sequence (Fig. 6a).
[0127] Example 5-2. Confirmation of barcode sequence-specific minigene pool production
[0128] To confirm whether the barcode sequence-specific minigene pool was successfully produced, PCR was performed using the method of Example 2 using a forward primer binding to the sequence corresponding to Barcode-A among the alphabet-named barcode sequences and the common reverse primer (Fig. 6b).
[0129] Nested PCR was performed on the amplified PCR products using forward primers and a common reverse primer that bind to the numerical naming barcodes Barcode-1 to 10. The final PCR products were subjected to agarose gel electrophoresis to confirm each single type of minigene amplicon, thereby confirming the presence of 10 types of minigenes that share Barcode-A and each include Barcode-1 to 10 (Fig. 6c).
[0130]
[0131] Example 6. Confirmation of immunogenicity of pooled minigenes through primary screening and primary selection of positive neoantigens.
[0132] Example 6-1. CTL induction
[0133] MACS isolation of donated blood corresponding to HLA-A*02:01 and CD8 + T cells and CD19 + Cells were secured. The secured CD19 + CD40-CD40L activated B cells (hereinafter referred to as CD40 act B cells) were produced through a culture period of approximately one week under culture conditions in which CD40L recombinant protein, IL-4, and IL-21 were added to the cells.
[0134] The minigene in mRNA form, produced through IVT, and the co-stimulatory factors OX40L-T2A-41BBL and IL12A-T2A-IL12B were co-transfected (electroporated) into the produced CD40 act B cells. When mRNA and co-stimulatory factors are injected into CD40 act B cells, the mRNA is expressed within the cells, and the expressed peptide or protein is presented on the surface through the antigen presentation pathway, enabling the production of antigen-presenting cells.
[0135] Secured CD8 + T cells and manufactured antigen-presenting cells were co-cultured to obtain cell lines for neoantigen detection by targeting minigenes with each alphabetically designated barcode sequence for neoantigen-specific activation and expansion. Co-culture was performed twice at 10-day intervals.
[0136] Example 6-2. Confirmation of immunogenicity of pooled minigenes through primary screening and primary selection
[0137] The activated T cells obtained through the process of Example 6-1 were co-cultured with K562 cell lines overexpressing HLA-A*02:01 or autologous CD40 act B cells on ELISpots coated with INF-gamma. The immunogenicity against HLA-A*02:01-specific antigens was confirmed through the detection level of INF-gamma, thereby selecting a group of effective DNA templates to be the target of secondary screening (Figs. 7a and 7b).
[0138]
[0139] Example 7. Selection of a single antigen with immunogenicity through secondary screening
[0140] The second screening was conducted on a group of valid DNA templates selected in the first screening.
[0141] CD8 immunogenicity confirmed through the primary screening performed in Example 6 + After secondary screening using minigenes containing a combination of numerically named barcodes that each shared one antigen, targeting T cells, single antigen results were generated.
[0142] The second screening was performed in the same manner as the first screening of Example 6, but using a K562 cell line overexpressing HLA-A*02:01 or autologous CD40 act B cells, co-cultured on an ELISpot coated with INF-gamma.
[0143] As a result of confirming the immunogenicity for the HLA-A*02:01-specific antigen through the detection level of INF-gamma, the result of Barcode-7 confirmed in the secondary screening was finally derived as a single antigen with immunogenicity, "A7" (Figs. 8a to 8e). When a minigene indicated by the barcode sequence of the combination of Barcode-A and Barcode-7 is presented on the surface of an antigen-presenting cell, it becomes a neoantigen that can be targeted as it has immunogenicity.
Claims
1. An amplification step of the plurality of DNA templates, comprising the step of cloning the plurality of DNA templates, each of which includes a first barcode sequence, a second barcode sequence, and a new antigen coding sequence, with a first forward primer specific to the first barcode sequence; and A PCR method comprising an amplification step of the valid DNA template, the step including cloning the selected valid DNA template from among the plurality of DNA templates with a second forward primer specific to the second barcode sequence.
2. A PCR method according to claim 1, wherein the reverse primer used in the amplification step includes a poly A tail at the 5' end.
3. A PCR method according to claim 1, wherein the first barcode sequence is any one sequence selected from a group consisting of n oligonucleotides that specifically bind to n different primers (n is an integer greater than or equal to 2).
4. A PCR method according to claim 1, wherein the second barcode sequence is different from the first barcode sequence and is any one sequence selected from a group consisting of m oligonucleotides that specifically bind to m different primers (m is an integer of 2 or more).
5. A PCR method according to claim 1, wherein the first barcode sequence or the second barcode sequence comprises 5 to 50 nucleotides.
6. A PCR method according to claim 1, wherein the plurality of DNA templates have the second barcode sequence linked to the 3' end of the first barcode sequence, and the new antigen coding sequence is linked so as to be amplifiable by a primer linked to the first barcode sequence or the second barcode sequence.
7. A PCR method according to claim 1, wherein in each of the amplification steps, in the first cycle, only the forward primer binds to the plurality of DNA templates or the valid DNA template, and from the subsequent cycles, the forward primer binds to the plurality of DNA templates or the valid DNA template, and the reverse primer binds to the complementary strands of the plurality of DNA templates or the complementary strand of the valid DNA template.
Citation Information
Patent Citations
DNA-barcoded antigen multimers and methods of use thereof
WO2019199945A1