Detection method for pathogenic leptospira, identification method for leptospira, gene marker, and detection kit

By detecting the filG gene in leptospirosis samples and using PCR technology, the problem of low diagnosis rate in the existing technology is solved, early diagnosis and high sensitivity detection effects are achieved, and the patient's mortality rate is reduced.

WO2025118500A1PCT designated stage expired Publication Date: 2025-06-12CHANG GUNG MEMORIAL HOSPITAL +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/095840
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-04
Filing Date
2024-05-28
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the diagnosis rate of leptospirosis, which leads to difficulties in early treatment of the disease and increases the mortality rate of patients.

Method used

By detecting whether the nucleic acid sample in the sample contains the filG gene of the pathogenic Leptospira, the polymerase chain reaction (PCR) technology is used for amplification and detection, which improves the sensitivity of diagnosis.

Benefits of technology

The early diagnosis of leptospirosis was achieved, which reduced the patient's mortality rate and improved the ability to identify pathogenic bacteria.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024095840_12062025_PF_FP_ABST
    Figure CN2024095840_12062025_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a detection method for pathogenic Leptospira, an identification method of Leptospira, a gene marker, and a detection kit. The detection method for Leptospira comprises: detecting whether a nucleic acid sample of a test specimen has a filG gene of pathogenic Leptospira, and if the nucleic acid sample of the test specimen has the filG gene of the pathogenic Leptospira, indicating the presence of the pathogenic Leptospira in the test specimen. By detecting a flagellar gene filG of pathogenic Leptospira, the detection rate of Leptospira can be effectively increased, which is conducive to the diagnosis of leptospirosis in humans and pets as well as environmental management and control and microbial monitoring. Leptospirosis in humans and pets is diagnosed and treated in a timely manner, and high infectivity and mortality caused by this zoonotic disease is avoided.
Need to check novelty before this filing date? Find Prior Art

Description

Detection method of pathogenic Leptospira bacteria, identification method of Leptospira bacteria, gene marker and detection kit Technical Field

[0001] The present invention relates to an identification and detection method, in particular to a method for detecting pathogenic Leptospira bacteria, and also relates to a gene marker and a detection kit for diagnosing Leptospirosis. Background Art

[0002] Leptospirosis is a re-emergent infectious disease that occurs frequently in tropical and subtropical regions and is one of the most common zoonotic infections worldwide. It has a diverse natural reservoir in the environment, with pigs, rats, cattle, cats, dogs, and other rodents serving as primary sources of infection. Animals infected with the pathogenic Leptospira bacteria develop chronic kidney infections, which are excreted in urine and contaminate the environment, such as soil or water. Humans exposed to these contaminated environments can then enter the body through damaged skin or mucous membranes, causing disease. In Taiwan, patients have presented with fever, jaundice, acute renal failure, and multiple organ failure, often followed by rapid death, since 1790. Symptoms of leptospirosis mimic septic shock, but all bacterial and viral tests are negative, and advanced antibiotics are ineffective, leaving internal medicine residents perplexed. Due to a lack of diagnostic tools, leptospirosis has been largely overlooked in Taiwan.

[0003] In 1996, the first case of acute kidney injury due to Leptospira infection in Taiwan attracted the attention of the Taiwanese medical community. Since then, the number of confirmed cases of leptospirosis in Taiwan has rapidly increased. In 2000, the Centers for Disease Control (CDC) of the Ministry of Health and Welfare established a leptospirosis surveillance system, and in 2004, leptospirosis was listed as a Category IV notifiable infectious disease in Taiwan.

[0004] Leptospirosis may lead to acute renal failure or chronic kidney disease. Therefore, there is a need for a detection method for trace pathogenic Leptospira bacteria that can effectively improve the diagnosis rate, so as to diagnose and treat it early and reduce the mortality rate of patients.

[0005] Furthermore, leptospirosis is a potentially fatal disease for dogs and cats. If the diagnosis is missed, it can lead to kidney failure, which can extend the pet's life while placing a heavy financial burden on the owner. Therefore, timely diagnosis of Leptospira infection in pets and prompt treatment can help protect sick pets, as well as staff and pet owners, from this serious disease. Environmental pollution can contribute to the spread of this infection. Therefore, developing a simple method for identifying trace amounts of Leptospira would facilitate environmental monitoring and control of areas contaminated by Leptospira species, thereby preventing the spread of infectious diseases.

[0006] Summary of the Invention

[0007] In view of the defects of the existing technology, the purpose of the present invention is to provide a detection method that can effectively improve the diagnosis rate of leptospirosis, so as to provide early treatment for patients and reduce the high mortality rate caused by leptospirosis.

[0008] To achieve the aforementioned objectives, the present invention provides a use of the filG gene of pathogenic Leptospira bacteria for preparing a detection product for detecting leptospirosis. In one embodiment, the detection product can be, for example, a detection reagent composition or a detection kit.

[0009] The detection reagent composition may comprise a detection reagent.

[0010] To achieve the aforementioned objectives, the present invention further provides a method for detecting pathogenic Leptospira bacteria, comprising:

[0011] Step (a): providing a nucleic acid sample for testing; and

[0012] Step (b) detects whether the nucleic acid sample of the test sample has the filG gene of the pathogenic Leptospira interrogans. If the nucleic acid sample of the test sample has the filG gene of the pathogenic Leptospira interrogans, it indicates that the test sample contains pathogenic Leptospira, or indicates that the test sample is contaminated by pathogenic Leptospira.

[0013] The present invention determines whether a nucleic acid sample is infected or contaminated by pathogenic Leptospira by detecting the presence of the flagellar gene filG in the nucleic acid sample. If the test sample comes from a living organism, it indicates that the living organism has a high risk of contracting leptospirosis. The detection method of the present invention has higher detection sensitivity than the traditional method using the lipL32 gene.

[0014] According to the present invention, if the nucleic acid sample of the test sample contains the filG gene of the pathogenic Leptospira bacteria, it indicates a high probability that the test sample contains or is contaminated with the pathogenic Leptospira bacteria. Furthermore, if the test sample originates from a human or animal, the individual is at high risk of contracting leptospirosis.

[0015] Preferably, the nucleic acid sample of the test sample in step (a) is amplified. For example, amplification can be performed using polymerase chain reaction (PCR). Preferably, the PCR method is real-time quantitative PCR (RT-PCR) or microfluidic digital quantitative PCR (DPCR). Preferably, the detection of whether the nucleic acid sample of the test sample in step (b) contains the filG gene of pathogenic Leptospira bacteria is performed using nucleic acid sequencing or probe analysis.

[0016] More preferably, the detection in step (b) is performed using real-time quantitative PCR or microfluidics quantitative PCR for amplification and detection. The flagellar gene filG of pathogenic Leptospira (1,014 bp in length) shares 79% sequence identity with the flagellar gene filG2 of Leptospira biflexa (1,014 bp in length). Sequence identification using reciprocal best-hit BLASTx analysis confirmed that the flagellar gene filG of pathogenic Leptospira and the flagellar gene filG2 of Leptospira biflexa are homologous genes. Real-time quantitative PCR or microfluidics quantitative PCR can directly utilize the different probes of the present invention to identify and detect differences in the flagellar genes between pathogenic Leptospira and Leptospira hyperbolicus, thereby distinguishing Leptospira spp. present in the nucleic acid sample as either pathogenic Leptospira or Leptospira hyperbolicus. Even more preferably, microfluidics quantitative PCR is used for detection. Compared to conventional methods that target the lipL32 gene of pathogenic Leptospira, which is an outer membrane protein gene, microfluidics quantitative PCR results show higher sensitivity for the flagellar gene filG of pathogenic Leptospira. Furthermore, the use of the primer pairs and probes of the present invention results in even more sensitive detection results.

[0017] The genus Leptospira (Leptospira spp.) encompasses various species. Certain species possess virulence factors, such as the Lip132 mantle protein, which is the primary pathogenicity factor. These species are known as interrogans, a homologous pathogenic species. Other species lack virulence factors and are environmentally active, known as biflexa, a saprophytic species. However, these two species are morphologically indistinguishable. According to the present invention, the flagellar gene filG of the interrogans is identified as LIC10023 according to the NCBI database, while the flagellar gene filG2 of the biflexa is identified as LEPBI_I3423 according to the NCBI database.

[0018] Preferably, step (b) is (b') detecting whether the nucleic acid sample of the test sample has the sequence of 466bp to 689bp of the filG gene of the pathogenic Leptospira bacteria. If the nucleic acid sample of the test sample has the sequence of 466bp to 689bp of the filG gene of the pathogenic Leptospira bacteria, it indicates that the test sample contains pathogenic Leptospira bacteria. Preferably, if the nucleic acid sample of the test sample has a nucleotide sequence with at least 70% sequence identity with SEQ ID NO: 1, it indicates that the test sample contains pathogenic Leptospira bacteria, for example, a nucleotide sequence with at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO: 1. Preferably, the nucleotide sequence of 466bp to 689bp of the filG gene of the pathogenic Leptospira bacteria is as shown in SEQ ID NO: 1.

[0019] Preferably, the step (b) is (b") detecting whether the nucleic acid sample in the test sample has the sequence of 581bp to 689bp of the filG gene of the pathogenic Leptospira bacteria. If the nucleic acid sample in the test sample has the sequence of 581bp to 689bp of the filG gene of the pathogenic Leptospira bacteria, it indicates that the test sample contains pathogenic Leptospira bacteria. Preferably, if the nucleic acid sample in the test sample has a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 2, it indicates that the test sample contains pathogenic Leptospira bacteria, for example, a nucleotide sequence having at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO: 2. Preferably, the nucleotide sequence of 581bp to 689bp of the filG gene of the pathogenic Leptospira bacteria is as shown in SEQ ID NO: 2.

[0020] Preferably, step (b) is (b') detecting whether the nucleic acid sample of the test sample has the sequence of 466bp to 580bp of the filG gene of the pathogenic Leptospira as shown in SEQ ID NO: 3. If the nucleic acid sample of the test sample has the sequence of 466bp to 580bp of the filG gene of the pathogenic Leptospira, it indicates that the test sample contains pathogenic Leptospira. Preferably, if the nucleic acid sample of the test sample has a nucleotide sequence having at least 70% sequence identity with SEQ ID NO: 3, it indicates that the test sample contains pathogenic Leptospira, for example, a nucleotide sequence having at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO: 3. Preferably, the nucleotide sequence of 466bp to 580bp of the filG gene of the pathogenic Leptospira is as shown in SEQ ID NO: 3.

[0021] According to the present invention, the test sample in step (a) is derived from a human tissue rinsate, a human tissue homogenate, a human body fluid, an animal tissue rinsate, an animal tissue homogenate, an animal body fluid, or environmental water. Preferably, the human or animal body fluid comprises blood, urine, or cerebrospinal fluid. The human or animal tissue homogenate comprises kidney homogenate.

[0022] Preferably, the nucleic acid sample of the test sample in step (a) comprises DNA or RNA.

[0023] Preferably, the amplification is performed using a primer pair capable of amplifying a fragment of the filG gene of the pathogenic Leptospira bacteria that is distinguishable from the filG2 gene of Leptospira hyperbolicus. Preferably, the amplification is performed using a primer pair having a sequence identity of 70% or greater to SEQ ID NO:4 and SEQ ID NO:5; or a primer pair having a sequence identity of 70% or greater to SEQ ID NO:11 and SEQ ID NO:12; or a primer pair having a sequence identity of 70% or greater to SEQ ID NO:15 and SEQ ID NO:16; or a primer pair having a sequence identity of 70% or greater to SEQ ID NO:19 and SEQ ID NO:20.

[0024] Preferably, the present invention can also be used in conjunction with detection of the lipL32 gene of pathogenic Leptospira bacteria to increase the diagnosis rate.

[0025] In one embodiment of the present invention, a primer pair having at least 70% sequence identity to SEQ ID NO:4 or SEQ ID NO:5 is used to amplify the sequence from bp 581 to 689 of the filG gene of a pathogenic Leptospira or the filG2 gene of a hyperbolic Leptospira. A probe for a pathogenic Leptospira having at least 70% sequence identity to SEQ ID NO:6 or a probe for a pathogenic Leptospira such as SEQ ID NO:13 having at least 70% sequence identity is used to further confirm whether the amplified fragment is the sequence from bp 581 to 689 of the filG gene of a pathogenic Leptospira. Preferably, after amplifying the 581 to 689 bp of the filG gene of the pathogenic Leptospira or the filG2 gene of Leptospira hyperbolicus, a Leptospira hyperbolicus probe having a sequence identity of 70% or greater to SEQ ID NO: 7 or SEQ ID NO: 14 can be used to further confirm whether the amplified fragment is the sequence of 581 to 689 bp of the filG2 gene of Leptospira hyperbolicus.

[0026] In one embodiment, a primer pair having a sequence identity of 70% or greater to SEQ ID NO: 11 or SEQ ID NO: 12 is used to amplify the sequence from bp 581 to 689 of the filG gene of a pathogenic Leptospira or the filG2 gene of a hyperbolic Leptospira. A probe having a sequence identity of 70% or greater to SEQ ID NO: 6 or 70% or greater to SEQ ID NO: 13 is then used to further confirm whether the amplified fragment is the sequence from bp 581 to 689 of the filG gene of a pathogenic Leptospira. Preferably, after amplifying the 581 to 689 bp of the filG gene of the pathogenic Leptospira or the filG2 gene of Leptospira hyperbolicus, a Leptospira hyperbolicus probe having a sequence identity of 70% or greater to SEQ ID NO: 7 or SEQ ID NO: 14 can be further used to determine whether the amplified fragment is the sequence of 581 to 689 bp of the filG2 gene of Leptospira hyperbolicus.

[0027] In one embodiment, after amplifying bp 466 to 580 of the filG gene of a pathogenic Leptospira or the filG2 gene of a hyperbolic Leptospira using a primer pair having 70% or greater sequence identity to SEQ ID NO: 15 or SEQ ID NO: 16, or a primer pair having 70% or greater sequence identity to SEQ ID NO: 19 or SEQ ID NO: 20, a pathogenic Leptospira probe having 70% or greater sequence identity to SEQ ID NO: 17, or a pathogenic Leptospira probe having 70% or greater sequence identity to SEQ ID NO: 21, is used to further confirm whether the amplified fragment is the 466 to 580 bp of the filG gene of a pathogenic Leptospira. In another embodiment, after amplifying the filG gene of the pathogenic Leptospira or the filG2 gene of Leptospira hyperbolicus, a Leptospira hyperbolicus probe having a sequence identity of 70% or greater to SEQ ID NO: 18 or SEQ ID NO: 22 can be used to determine whether the amplified fragment is the filG2 gene of Leptospira hyperbolicus.

[0028] Preferably, the pathogenic Leptospira probe or the hyperbolic Leptospira probe has a reporter dye at the 5' end and a quencher dye at the 3' end. Preferably, the reporter dye is a fluorescent reporter dye, such as FAM, EvaGreen, VIC, HEX, TAMRA, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Yakima yellow, Attorney 550, Texas Red, Quasar 670, ROX, Cy3, or Cy5 fluorescent reporter dyes. Preferably, the quencher dye is BHQ1, BHQ2, BHQ3, Dabcyl, or NFQ.

[0029] To achieve the aforementioned objectives, the present invention further provides a method for identifying Leptospira spp. bacteria, comprising:

[0030] Step (i) providing a nucleic acid sample containing Leptospira bacteria;

[0031] Step (ii) detecting the flagellar gene of the nucleic acid sample containing Leptospira bacteria. If the flagellar gene of the nucleic acid sample containing Leptospira bacteria contains filG, it means that the Leptospira bacteria contain pathogenic Leptospira bacteria; if the flagellar gene of the nucleic acid sample containing Leptospira bacteria contains filG2, it means that the Leptospira bacteria contain hyperbolic Leptospira bacteria.

[0032] To achieve the aforementioned objectives, the present invention further provides a reagent composition for identifying Leptospira spp. bacteria, comprising a reagent for detecting the filG gene of pathogenic Leptospira spp. and / or detecting the filG2 gene of Leptospira hyperbolicus.

[0033] Preferably, the reagent for detecting the filG gene of pathogenic Leptospira bacteria and / or the filG2 gene of Leptospira hyperbolicus comprises a molecule for detecting the filG gene of pathogenic Leptospira bacteria and / or the filG2 gene of Leptospira hyperbolicus. Preferably, the molecule for detecting the filG gene of pathogenic Leptospira bacteria and / or the filG2 gene of Leptospira hyperbolicus comprises a nucleic acid molecule, such as the primer pair or probe described above.

[0034] To achieve the aforementioned objectives, the present invention further provides a genetic marker for detecting leptospirosis, comprising bp 466 to 689 of the filG gene of the pathogenic Leptospira bacterium. Preferably, the marker comprises a nucleotide sequence having at least 70% sequence identity with SEQ ID NO:1. For example, the marker may comprise a nucleotide sequence having at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO:1. Preferably, the marker comprises bp 466 to 689 of the filG gene of the pathogenic Leptospira bacterium as set forth in SEQ ID NO:1.

[0035] To achieve the aforementioned objectives, the present invention further provides a genetic marker for detecting leptospirosis, comprising bp 581 to 689 of the filG gene of the pathogenic Leptospira bacterium. Preferably, the marker comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO:2. For example, the marker may comprise a nucleotide sequence having at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:2. Preferably, the marker comprises bp 581 to 689 of the filG gene of the pathogenic Leptospira bacterium as set forth in SEQ ID NO:2.

[0036] To achieve the aforementioned objectives, the present invention further provides a genetic marker for detecting leptospirosis, comprising bp 466 to 580 of the filG gene of the pathogenic Leptospira bacterium. Preferably, the marker comprises a nucleotide sequence having at least 70% sequence identity to SEQ ID NO:3. For example, the marker may comprise a nucleotide sequence having at least 75%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO:3. Preferably, the marker comprises bp 466 to 580 of the filG gene of the pathogenic Leptospira bacterium as set forth in SEQ ID NO:3.

[0037] To achieve the aforementioned objectives, the present invention further provides a use of the filG gene of pathogenic Leptospira bacteria for detecting leptospirosis.

[0038] To achieve the aforementioned objectives, the present invention further provides a detection kit for detecting pathogenic Leptospira bacteria, comprising a primer pair for detecting pathogenic Leptospira bacteria; wherein the primer pair for detecting pathogenic Leptospira bacteria comprises a forward primer for detecting pathogenic Leptospira bacteria and a reverse primer for detecting pathogenic Leptospira bacteria; the forward primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of 70% or greater with SEQ ID NO: 4 or SEQ ID NO: 11, for example, a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or greater with SEQ ID NO: 4 or SEQ ID NO: 11; and the reverse primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of 70% or greater with SEQ ID NO: 5 or SEQ ID NO: 12. For example, it can be a nucleotide sequence that has at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity with SEQ ID NO: 5 or SEQ ID NO: 12.

[0039] Preferably, the aforementioned detection kit for detecting pathogenic Leptospira further comprises a probe for pathogenic Leptospira having a sequence identity of 70% or greater to SEQ ID NO: 6 and / or SEQ ID NO: 13. For example, the probe may be a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or greater to SEQ ID NO: 6 or SEQ ID NO: 13.

[0040] Preferably, the aforementioned detection kit for detecting leptospirosis further comprises a probe for Leptospira hyperbolicus having a sequence identity of at least 70% with SEQ ID NO: 7 and / or SEQ ID NO: 14. For example, the probe may be a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or more with SEQ ID NO: 7 or SEQ ID NO: 14.

[0041] To achieve the aforementioned objectives, the present invention further provides a detection kit for detecting pathogenic Leptospira bacteria, comprising a primer pair for detecting pathogenic Leptospira bacteria; wherein the primer pair for detecting pathogenic Leptospira bacteria comprises a forward primer for detecting pathogenic Leptospira bacteria and a reverse primer for detecting pathogenic Leptospira bacteria; the forward primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of 70% or more to SEQ ID NO: 15 or SEQ ID NO: 19, for example, a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or more to SEQ ID NO: 15 or SEQ ID NO: 19; the reverse primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of 70% or more to the sequence shown in SEQ ID NO: 16 or SEQ ID NO: 20, for example, a nucleotide sequence having a sequence identity of 70% or more to the sequence shown in SEQ ID NO: 17 or SEQ ID NO: 21. NO: 16 or a nucleotide sequence having at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 20.

[0042] Preferably, the aforementioned detection kit for detecting pathogenic Leptospira further comprises a probe for pathogenic Leptospira having a sequence identity of 70% or greater to SEQ ID NO: 17 or SEQ ID NO: 21. For example, the probe may be a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or greater to SEQ ID NO: 17 or SEQ ID NO: 21.

[0043] Preferably, the aforementioned detection kit for detecting pathogenic Leptospira further comprises a probe for Leptospira hyperbolicus having a sequence identity of 70% or greater to SEQ ID NO: 18 or SEQ ID NO: 22. For example, the probe may be a nucleotide sequence having a sequence identity of at least 73%, 75%, 76%, 78%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 99.5% or greater to SEQ ID NO: 18 or SEQ ID NO: 22.

[0044] By detecting the filG gene of pathogenic Leptospira, the present invention can effectively confirm whether the source of the test sample is infected or contaminated by pathogenic Leptospira. Compared with the traditional detection of the lipL32 gene, the present invention has higher sensitivity, allowing for early treatment and avoiding the high mortality rate caused by leptospirosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIG1 shows the results of PCR and gel electrophoresis using the first to fourth sets of primer pairs and probes for detecting flagellar genes in Example 2. DETAILED DESCRIPTION

[0046] The following is a detailed description of the technical means used by the present invention to achieve the intended purpose with reference to the accompanying drawings and embodiments of the present invention.

[0047] Preparation Example 1 Strain Culture

[0048] Pathogenic Leptospira interrogans serovar Copenhageni Fiocruz L1-130 (ATCC number BAA-1198) (hereinafter referred to as LIC) and Leptospira biflexa (hereinafter referred to as LBP) (hereinafter referred to as L. biflexa serovar Patoc (ATCC number 23582)) were cultured in bacterial culture medium containing 10% Leptospira enrichment Elinghausen-McCullough-Johnson-Harris (EMJH) medium (BD Diagnostics) and 90% Leptospira medium base EMJM medium (Difco, Sparks, MD) for subsequent bacterial nucleic acid extraction and infection experiments.

[0049] Example 1

[0050] (1) Complete the first set of DNA primer pairs and probes for detecting the flagellar gene of Leptospira (hereinafter referred to as the first set of primer pairs and probes)

[0051] The first set of primers is a primer pair that is expected to amplify the filG gene of the pathogenic Leptospira or the filG2 gene of the hyperbolic Leptospira from 581 bp to 689 bp.

[0052] Forward primer 1: ATACTTCTGCGGGTGGTATTG, i.e., SEQ ID NO: 4.

[0053] Reverse primer 1: GCAAGTTCGGGATCTTCTTCT, i.e., SEQ ID NO: 5.

[0054] Pathogenic Leptospira probe (hereinafter referred to as LIC probe) 1: AGTTGAGATTCTAAACTTAGTCGATCGGGGAACG, SEQ ID NO: 6. LIC probe 1 has a FAM fluorescent reporter dye (6-carboxyfluorescein) at its 5' end and a BHQ1 quencher dye (Black Hole Quencher 1) at its 3' end.

[0055] Leptospira hyperbolicus probe (hereinafter referred to as LBP probe) 1: ACGGAGAAGACCATCATCGAAGCT, ie, SEQ ID NO: 7. The 5' end of LBP probe 1 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye.

[0056] (2) DNA extraction

[0057] The bacterial solution prepared in Preparation Example 1 was used to extract genomic DNA (gDNA) of pathogenic Leptospira and Leptospira hyperbolicus using a QIAamp DNA extraction kit (Cat. No. 51306; Qiagen, Hilden, Germany) according to the manufacturer's instructions.

[0058] (3) PCR combined with gel electrophoresis

[0059] PCR was performed on the extracted LIC and LBP gDNA using forward primer 1 and reverse primer 1 using the SuperRed PCR Master Mix (BIOTOOLS CO., LTD., Taiwan) PCR kit on a PCT instrument (PTC-100 Programmable Thermal Controller (MJ Research Inc., Waltham, Massachusetts, USA). 10 μL of the PCR product was analyzed by electrophoresis on a 2% agarose gel. Specifically, the PCR reaction was performed by preparing a PCR mixture in a reaction tube. Sterile water, 2.5 μL of 10 μM forward primer, 2.5 μL of 10 μM reverse primer, 25 ng (5 μL, 5 ng / μL) of the extracted LIC or LBP gDNA, and 2x SuperRed PCR Master Mix were added to the reaction tube in this order, bringing the total volume to 25 μL. After mixing, the reaction tube was microcentrifuged to pool the PCR reaction mixture at the bottom of the tube. PCR was performed using a PCT machine (PTC-100 Programmable Thermal Controller (MJ Research Inc., Waltham, Massachusetts, USA) according to the conditions in Table 1 below.

[0060] Table 1: Example 1 PCR reaction conditions

[0061] The gel electrophoresis results confirmed that forward primer 1 and reverse primer 1 were able to amplify approximately 110 bp, meaning that forward primer 1 and reverse primer 1 were indeed able to amplify 581 bp to 689 bp of the filG gene of the pathogenic Leptospira or the filG2 gene of the hyperbolic Leptospira.

[0062] (IV) Detection using real-time quantitative PCR (qPCR)

[0063] The gDNA of the pathogenic Leptospira and Leptospira hyperbolicus obtained by extraction in step (2) of this example were respectively PCR-PCR-equipped using forward primer 1, reverse primer 1, LIC probe 1 and LBP probe 1 in a real-time quantitative PCR instrument (ABI ViiA7 TMTaqMan real-time PCR system (Applied Biosystems) was used to detect gene expression. Each reaction was repeated three times. Specifically, the real-time quantitative PCR reaction was performed by first adding sterile water, 2.5 μL forward primer (10 μM), 2.5 μL reverse primer (10 μM), 2.5 μL LIC probe 1 or LBP probe 1 (10 μM), 25 ng (5 μL, 5 ng / μL) LIC or LBP gDNA, and 2x TaqMan TM Fast Universal PCR Master Mix was added to make the final total volume 50 μL. After mixing evenly, the reaction tube was microcentrifuged to make the reaction mixture accumulate at the bottom of the reaction tube. TM The reaction was performed in the comparative Cт (ΔΔCт) mode of a real-time PCR system (Applied Biosystems) with the following cycle temperatures: stage 1: 50°C for 2 minutes; stage 2: 95°C for 10 minutes; stage 3: 95°C for 15 seconds and 60°C for 1 minute, for 40 cycles.

[0064] The obtained results are shown in Tables 2 and 3 below, respectively. The qPCR results of each group are expressed as the threshold cycle number (CT value).

[0065] Table 2: Taqman real-time quantitative PCR results of LIC probe 1

[0066] Table 3: Taqman real-time quantitative PCR results of LBP probe 1

[0067] As shown in Tables 2 and 3 above, the approximately 110 bp fragment amplified by primer pair 1 in the filG gene of LIC can indeed be detected using LIC probe 1. In contrast, the approximately 110 bp fragment amplified by primer pair 1 in the filG2 gene of LBP cannot be detected using LBP probe 1.

[0068] Similarly, the approximately 110 bp fragment amplified by primer pair 1 in the filG gene of LIC did not produce an amplification product when used with LBP probe 1. In contrast, the approximately 110 bp fragment amplified by primer pair 1 in the filG2 gene of LBP did produce an amplification product when used with LBP probe 1. Therefore, the present invention can utilize the 581 to 689 bp region of the flagellar gene to detect Leptospira infection and distinguish between pathogenic and hyperbolic Leptospira species.

[0069] (V) Digital microfluidic quantitative PCR

[0070] Digital microfluidics quantitative PCR was performed using the QIAcuity Probe PCR Kit. 40 μL of the reaction mixture, containing Probe PCR Master Mix (Qiagen), forward primer 1, reverse primer 1, LIC probe 1, LBP probe 1, nuclease-free water, and gDNA extracted in step (2), was added to each well. The reaction mixture was then added to QIAcuity 26k 24-well Nanoplates (Qiagen), and nucleic acid partitioning was performed using the Standard Priming Profile (Qiagen). For comparison, a lipL32 primer pair and lipL32 probe commonly used in the prior art for detecting pathogenic Leptospira bacteria (Matsui, M., et al. (2017). High level of IL-10 expression in the blood of animal models possibly relates to resistance against leptospirosis. Cytokine, 96, 144-151) were used: lipL32 forward primer: AAGCATTACCGCTTGTGGTG, SEQ ID NO: 8; lipL32 reverse primer: GAACTCCCATTTCAGCGATT, SEQ ID NO: 9; and LIC lipL32 probe: AAAGCCAGGACAAGCGCCG, SEQ ID NO: 10. The LIC lipL32 probe has a FAM fluorescent reporter dye at its 5' end and a BHQ1 quencher dye at its 3' end. Digital microfluidic quantitative PCR was performed according to the conditions in Table 4 below:

[0071] Table 4: Conditions for digital microfluidics PCR in Example 1

[0072] Thermal cycling, nucleic acid separation, and data analysis were all performed using a digital microfluidics PCR instrument, coupled with QIAcuity software (Qiagen, version 2.1.7) to determine sample thresholds according to the user manual. The results are shown in Table 5 below.

[0073] Table 5: Results of digital microfluidics quantitative PCR in Example 1

[0074] As shown in Table 5, at a gDNA concentration of 0.000001 ng / μL for the filG gene, Leptospira bacteria can be distinguished as LIC or LBP. However, the conventionally used lipL32 gene cannot detect Leptospira at this concentration. Therefore, the filG gene detection method used in the present invention is superior to the conventional lipL32 gene detection method and has higher sensitivity.

[0075] (VI) Digital microfluidic quantitative PCR of mouse kidneys infected with Leptospira bacteria

[0076] 1. Experimental Animals

[0077] C57BL / 6 mice aged 7 to 8 weeks (purchased from the National Laboratory Animal Center, National Institute of Laboratory Science, Taiwan, China) were randomly divided into LIC group, LBP group and control group. In the LIC group, 1×10 9 The number of pathogenic Leptospira bacteria was 24 in total; the LBP group was intraperitoneally injected with 1×10 9 The control group consisted of 6 mice injected intraperitoneally with sterile basic culture medium (Leptospira medium base EMJM medium (Difco, Sparks, MD)). The mice were killed on the 7th and 28th days after infection, and the kidneys were collected for total RNA extraction. All animal experiments complied with the Animal Biosafety Level 2 (ABSL-2) standards and strictly adhered to the relevant guidelines for the use and handling of infected animals. This study was approved by the Institutional Animal Care and Use Committee of the Chang Gung Memorial Hospital in Taiwan, China (Approval No.: 2021062203).

[0078] 2. Total RNA Extraction and Reverse Transcription

[0079] Total RNA was extracted using RNA-Bee TM RNAzol reagent and DNase I digestion were performed according to the manufacturer's instructions. The extracted total RNA was reverse transcribed into cDNA using the Transcriptor cDNA synthesis kit (Cat. No. 04897030001; Roche Diagnostics, Germany), and the cDNA samples were stored at -20°C for subsequent use.

[0080] 3.1 Digital microfluidics quantitative PCR

[0081] The experimental method here is similar to that described in point (4), except that the nucleic acid sample used is from the kidney tissue of mice infected with Leptospira.

[0082] 3.2 Quantitative PCR using lipL32 digital microfluidics

[0083] The experimental method here is similar to that described in point 3.1, except that the forward primer (SEQ ID NO: 8), reverse primer (SEQ ID NO: 9) and probe (SEQ ID NO: 10) for the lipL32 gene described in point (5) are used.

[0084] The experimental results of 3.1 and 3.2 are shown in Tables 6 and 7 below respectively according to the number of days after infection.

[0085] Table 6: Results of digital microfluidics quantitative PCR on samples taken 7 days after infection

[0086] As shown in Table 6, on day 7 of infection, Leptospira were detected in 58% and 83% of the kidneys of mice infected with pathogenic Leptospira using primer pairs and probes targeting the lipL32 gene and the flagella gene, respectively. Furthermore, on day 7, the lipL32 primer pair and probe detected 4.2 to 34.4 total Leptospira nucleic acid copies per μg of kidney tissue RNA in the kidneys of mice; while the filG primer pair and probe detected 2.2 to 12.9 total Leptospira nucleic acid copies per μg of kidney tissue RNA. However, 41% (5 of 12) of mice infected with pathogenic Leptospira were not detected using the lipL32 primer pair and probe. However, in mice not detected by the lipL32 primer pair and probe, a small number of total nucleic acid copies were detected using the filG primer pair and probe. Therefore, it was confirmed that the detection method for the filG gene was more sensitive.

[0087] Table 7: Results of digital microfluidics quantitative PCR on samples taken 28 days after infection

[0088] As shown in Table 7, on day 28 of infection, the primer pair and probe targeting the lipL32 gene and the flagella gene detected Leptospira in 58% and 83% of the kidneys of mice infected with pathogenic Leptospira, respectively. Furthermore, on day 28, the primer pair and probe targeting the filG gene detected 2.1 to 6.5 copies of Leptospira total nucleic acid per μg of kidney tissue RNA in the kidneys of mice infected with pathogenic Leptospira. When the primer pair and probe targeting the lipL32 gene were used, 13.3 to 1680.4 copies of Leptospira total nucleic acid per μg of kidney tissue RNA were detected in the kidneys of mice infected with pathogenic Leptospira. However, in 25% (3 / 12) of mice infected with pathogenic Leptospira, the primer pair and probe targeting the lipL32 gene failed to detect Leptospira total nucleic acid, whereas the primer pair and probe targeting the filG gene detected a small number of copies of nucleic acid in these mice. This further demonstrates the sensitivity of the present invention's detection method for the filG gene. Furthermore, in two mice (2 / 12, or 16.7%) infected with pathogenic Leptospira, no primers or probes targeting either the lipL32 or filG genes were detected, suggesting that the Leptospira were eliminated by the immune system and were not present in the kidneys.

[0089] The results of Example 1 show that the method for detecting the filG gene of the present invention can still detect pathogenic Leptospira even when the bacterial concentration is low, and is superior to the detection method for the lipL32 gene used in the prior art and can better detect pathogenic Leptospira.

[0090] Example 2

[0091] In Example 2, primer pairs 2 to 4 and probes were designed for detection of the filG gene. PCR, gel electrophoresis analysis, and real-time quantitative PCR were performed to determine whether pathogenic Leptospira and Leptospira hyperbolicus could be distinguished. The primer pairs 2 to 4 and probes used in this example are as follows:

[0092] (1) Complete the second set of DNA primer pairs and probes for detecting the flagellar gene of Leptospira (hereinafter referred to as the second set of primer pairs and probes)

[0093] The second set of primers is a primer pair that is expected to amplify the 581 bp to 689 bp of the filG gene of the pathogenic Leptospira or the filG2 gene of the hyperbolic Leptospira.

[0094] Forward primer 2: ACTTCTGCGGGTGGTATTGATTC, i.e., SEQ ID NO: 11. This sequence has 82.6% sequence identity with forward primer 1 of SEQ ID NO: 4.

[0095] Reverse primer 2: AGTTCGGGATCTTCTTCTTCC, i.e., SEQ ID NO: 12. This sequence has 85.7% sequence identity with reverse primer 1 of SEQ ID NO: 5.

[0096] LIC probe 2: CGTAGTTGAGATTCTAAACTTAGTCGATCGGG, i.e., SEQ ID NO: 13. The 5' end of LIC probe 2 has a FAM fluorescent reporter dye and the 3' end has a BHQ1 quencher dye. This sequence has 85% sequence identity with LIC probe 1 of SEQ ID NO: 6.

[0097] LBP probe 2: GGGAACGGAGAAGACCATCATCGA, i.e., SEQ ID NO: 14. The 5' end of LBP probe 2 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye. This sequence has 83.3% sequence identity with LBP probe 1 of SEQ ID NO: 7.

[0098] (2) Complete the third set of DNA primer pairs and probes for detecting the flagellar gene of Leptospira (hereinafter referred to as the third set of primer pairs and probes)

[0099] The third set of primers is a primer pair that is expected to amplify the filG gene of pathogenic Leptospira or the filG2 gene of Leptospira hyperbolicus from 466 bp to 580 bp.

[0100] Forward primer 3: AAACGAATTGCAACGATGGAC, i.e., SEQ ID NO: 15.

[0101] Reverse primer 3: ACCACCCGCAGAAGTATAATC, i.e., SEQ ID NO: 16.

[0102] LIC probe 3: CGGACGTACTTCGGGAAGTGGAAA, i.e., SEQ ID NO: 17. The 5' end of the LIC probe 3 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye.

[0103] LBP probe 3: AGTGGAACGCGTGTTAGAGCGTAA, i.e., SEQ ID NO: 18. The 5' end of the LBP probe 3 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye.

[0104] (3) Complete the fourth set of DNA primer pairs and probes for detecting the flagellar gene of Leptospira (hereinafter referred to as the fourth set of primer pairs and probes).

[0105] The fourth primer pair is a primer pair that is expected to amplify the filG gene of pathogenic Leptospira or the filG2 gene of Leptospira hyperbolicus from 466 bp to 580 bp.

[0106] Forward primer 4: TTGCAAAACGAATTGCAACGATGG, i.e., SEQ ID NO: 19. This sequence has 79% sequence identity with forward primer 3 of SEQ ID NO: 15.

[0107] Reverse primer 4: CCCGCAGAAGTATAATCTTC, i.e., SEQ ID NO: 20. This sequence has 80.9% sequence identity with forward primer 3 of SEQ ID NO: 16.

[0108] LIC probe 4: CAGTCCGGACGTACTTCGGGAAGTGG, i.e., SEQ ID NO: 21. The 5' end of LIC probe 4 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye. This sequence has 80.7% sequence identity with LIC probe 3 of SEQ ID NO: 17.

[0109] LBP probe 4: CGTGAAGTGGAACGCGTGTTAGAGCG, i.e., SEQ ID NO: 22. The 5' end of LBP probe 4 has a FAM fluorescent reporter dye, and the 3' end has a BHQ1 quencher dye. This sequence has 80.7% sequence identity with LBP probe 3 of SEQ ID NO: 18.

[0110] (IV) PCR combined with gel electrophoresis analysis

[0111] The experimental method is similar to that of Example 1 (2) and (3), except that primer pairs 1 to 4 were used for PCR, combined with gel electrophoresis. The results are shown in Figure 1. As can be seen from Figure 1, primer pairs 1 to 4 can all amplify the target fragment of approximately 110 bp.

[0112] (V) Detection using real-time quantitative PCR

[0113] This experimental method was similar to that described in Example 1 (4), except that primer pairs 1 to 4 were used, respectively, and a no-template control (NTC) was also performed, replacing the LIC or LBP gDNA with sterile water. The results are shown in Table 8 below, where each qPCR result is expressed as the threshold cycle number (CT value).

[0114] Table 8: Real-time quantitative PCR results using primer pairs and probes from groups 1 to 4

[0115] According to the results in Table 7, it can be seen that the primer pairs and probes of groups 2 to 4 can effectively identify pathogenic Leptospira and Leptospira hyperbolicus, just like the primer pairs and probes of group 1.

[0116] Therefore, the detection of flagellar genes can effectively distinguish LIC and LBP, and the results are more sensitive than the lipL32 gene used in existing technologies.

Claims

1. A use of the filG gene of a pathogenic Leptospira bacterium for preparing a detection product for detecting leptospirosis.

2. A method for detecting pathogenic Leptospira bacteria, comprising: Step (a) provides a nucleic acid sample for testing; and Step (b) detects whether the nucleic acid sample of the test sample has the filG gene of the pathogenic Leptospira interrogans. If the nucleic acid sample of the test sample has the filG gene of the pathogenic Leptospira interrogans, it means that the test sample contains the pathogenic Leptospira interrogans.

3. The method for detecting pathogenic Leptospira bacteria according to claim 2, wherein: The step (b) is (b') detecting whether the nucleic acid sample of the test sample has the sequence of 466bp to 689bp of the filG gene of the pathogenic Leptospira bacteria. If the nucleic acid sample of the test sample has the sequence of 466bp to 689bp of the filG gene of the pathogenic Leptospira bacteria, it means that the test sample contains pathogenic Leptospira bacteria.

4. The method for detecting pathogenic Leptospira bacteria according to claim 2, wherein: The step (b) is (b") detecting whether the nucleic acid sample of the test sample has the sequence of 581bp to 689bp of the filG gene of the pathogenic Leptospira bacteria. If the nucleic acid sample in the test sample has the sequence of 581bp to 689bp of the filG gene of the pathogenic Leptospira bacteria, it means that the test sample contains pathogenic Leptospira bacteria.

5. The method for detecting pathogenic Leptospira bacteria according to claim 2, wherein: The step (b) is (b'") detecting whether the nucleic acid sample of the test sample has the sequence of 466bp to 580bp of the filG gene of the pathogenic Leptospira bacteria. If the nucleic acid sample of the test sample has the sequence of 466bp to 580bp of the filG gene of the pathogenic Leptospira bacteria, it means that the test sample contains pathogenic Leptospira bacteria.

6. The method for detecting pathogenic Leptospira according to any one of claims 2 to 5, wherein: The test sample in step (a) is from human tissue flushing fluid, human tissue homogenate fluid, human body fluid, animal tissue flushing fluid, animal tissue homogenate fluid, animal body fluid or environmental water source.

7. The method for detecting Leptospira according to any one of claims 2 to 5, wherein: The nucleic acid sample of the test sample in step (a) comprises DNA or RNA.

8. The method for detecting pathogenic Leptospira according to any one of claims 2 to 5, wherein: The nucleic acid sample of the test sample in step (a) is amplified.

9. The method for detecting pathogenic Leptospira bacteria according to claim 2, wherein: In the step (b), the detection of whether the nucleic acid sample of the test sample has the filG gene of the pathogenic Leptospira bacteria is performed by nucleic acid sequencing or by probe analysis.

10. A method for identifying Leptospira spp. bacteria, comprising: Step (i) providing a nucleic acid sample containing Leptospira bacteria; Step (ii) detects the flagella gene of the nucleic acid sample containing Leptospira bacteria. If the flagella gene of the nucleic acid sample containing Leptospira bacteria contains filG, it means that the Leptospira bacteria contain pathogenic Leptospira bacteria; if the flagella gene of the nucleic acid sample containing Leptospira bacteria contains filG2, it means that the Leptospira bacteria contain hyperbolic Leptospira bacteria.

11. A reagent composition for identifying Leptospira spp. bacteria, comprising reagents for detecting the filG gene of pathogenic Leptospira bacteria and the filG2 gene of hyperbolic Leptospira bacteria.

12. A gene marker for detecting leptospirosis, comprising the sequence of 466 bp to 689 bp of the filG gene of pathogenic Leptospira bacteria.

13. A gene marker for detecting leptospirosis, comprising the sequence of 581 bp to 689 bp of the filG gene of pathogenic Leptospira.

14. A gene marker for detecting leptospirosis, comprising the sequence of 466 bp to 580 bp of the filG gene of pathogenic Leptospira.

15. A detection kit for detecting pathogenic Leptospira bacteria, comprising a primer pair for detecting pathogenic Leptospira bacteria; in, The primer pair for detecting pathogenic Leptospira bacteria comprises a forward primer for detecting pathogenic Leptospira bacteria and a reverse primer for detecting pathogenic Leptospira bacteria; The forward primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of more than 70% with SEQ ID NO: 4 or SEQ ID NO: 11, and the reverse primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of more than 70% with SEQ ID NO: 5 or SEQ ID NO:

12.

16. The detection kit for detecting pathogenic Leptospira according to claim 15, further comprising a probe of pathogenic Leptospira having a sequence identity of more than 70% with SEQ ID NO: 6 and / or SEQ ID NO:

13.

17. The detection kit for detecting Leptospira hyperbolica according to claim 15 or 16, further comprising a probe for Leptospira hyperbolica having a sequence identity of more than 70% with SEQ ID NO: 7 and / or SEQ ID NO:

14.

18. A detection kit for detecting pathogenic Leptospira bacteria, comprising a primer pair for detecting pathogenic Leptospira bacteria; in, The primer pair for detecting pathogenic Leptospira bacteria comprises a forward primer for detecting pathogenic Leptospira bacteria and a reverse primer for detecting pathogenic Leptospira bacteria; The forward primer for detecting pathogenic Leptospira bacteria comprises the same primer as SEQ ID NO: 15 or SEQ ID NO:

19. A nucleotide sequence having a sequence identity of more than 70%, wherein the reverse primer for detecting pathogenic Leptospira bacteria comprises a nucleotide sequence having a sequence identity of more than 70% with SEQ ID NO: 16 or SEQ ID NO:

20.

19. The detection kit for detecting pathogenic Leptospira according to claim 18, further comprising a probe of pathogenic Leptospira having a sequence identity of more than 70% with SEQ ID NO: 17 and / or SEQ ID NO:

21.

20. The detection kit for detecting Leptospira hyperbolica according to claim 18 or 19, further comprising a probe for Leptospira hyperbolica having a sequence identity of more than 70% with SEQ ID NO: 18 and / or SEQ ID NO: 22.

Citation Information

Patent Citations

  • Pseudomonas mutans fliG gene silencing strain and application thereof

    CN113151134A

  • Compositions And Methods For Conversion Of Aldehydes To Alkanes

    US20100251428A1

  • Compositions and methods of preparing leptospira

    US20170014500A1