Hepatitis c virus inhibitor

Abstract

The present invention addresses the problem of providing: a compound having a hepatitis C virus (HCV) inhibition activity and can prevent and / or treat hepatitis C; and a medicine containing the compound. [Solution] The present invention provides: a compound having a structure represented by formula (I) or (IV) and having an HCV inhibition activity; and a composition containing the compound.

Description

Hepatitis C virus inhibitor

[0001] The present invention relates to a compound having inhibitory activity against hepatitis C virus and a pharmaceutical comprising said compound. More specifically, the present invention relates to a compound having inhibitory activity against hepatitis C virus, which is an indole derivative and / or a tetrahydrocarbazole derivative, and a hepatitis C virus inhibitor comprising said compound.

[0002] Hepatitis C is a general term for liver diseases (chronic hepatitis, cirrhosis, and hepatocellular carcinoma) caused by infection with the hepatitis C virus (HCV). HCV was discovered by Choo et al. in the United States in 1989, and it has been revealed that more than 90% of cases previously diagnosed as non-A, non-B hepatitis and more than half of cases previously diagnosed as alcoholic liver disease are actually caused by HCV. Recent estimates suggest that there are 58 million HCV carriers worldwide, and 900,000 to 1.3 million in Japan. Once HCV infection is established, even in healthy adults, only about 30% recover after an acute course, while approximately 70% of infected cases persist and progress to chronic hepatitis. Once chronic, spontaneous clearance of the virus is rare, at only 0.2% per year. Persistent inflammation due to HCV infection induces liver fibrosis, which progresses to cirrhosis and hepatocellular carcinoma (Non-Patent Document 1).

[0003] The goal of hepatitis C treatment is to improve the long-term prognosis of chronic liver disease caused by persistent HCV infection, i.e., to prevent liver cancer and liver disease-related death. To achieve this goal, antiviral therapy is administered with the aim of eliminating HCV. In fact, it has been shown that hepatitis subsides in cases where HCV RNA has been successfully eliminated by interferon (IFN) treatment.

[0004] Until now, chemotherapy using interferon has been the main treatment for hepatitis C, but direct-acting antivirals (DAAs), which directly target viral factors, became available in 2011. In Japan, so-called "interferon-free" treatment, which uses only DAA, a direct-acting antiviral drug, without interferon, began in 2014 and has become the mainstream antiviral treatment for hepatitis C in recent years.

[0005] HCV is a positive-sense single-stranded RNA virus belonging to the Hepacivirus genus of the Flaviviridae family. It is classified into six genotypes, HCV1 to 6, which are further divided into several subtypes. The full-length genome sequences of several HCV genotypes have been determined. The HCV genome is approximately 9,600 nucleotides long and contains a single open reading frame (ORF) encoding a single large polyprotein of approximately 3,000 amino acids. In infected cells, this polyprotein is cleaved at multiple sites by the viral protease to produce structural and nonstructural (NS) proteins. The nonstructural proteins that are not incorporated into viral particles are divided into NS2, NS3, NS4A, NS4B, NS5A, and NS5B. Currently, the NS3 / 4A, NS5A, and NS5B regions are targeted by DAA, and each region has protease activity, viral genome replication complex formation function, and RNA-dependent RNA polymerase activity.

[0006] To date, multiple types of NS3 / 4A protease inhibitors, NS5A inhibitors, and NS5B RNA polymerase inhibitors have been approved. More specifically, as of May 2022, seven NS3 / 4A protease inhibitors (telaprevir, simeprevir, asunaprevir, vaniprevir, paritaprevir, grazoprevir, and glecaprevir) have been approved, six NS5A replication complex inhibitors (daclatasvir, ledipasvir, ombitasvir, elbasvir, pibrentasvir, and velpatasvir) have been approved, and the NS5B polymerase inhibitors sofosbuvir and non-nucleoside beclabuvir have been approved. However, the manufacture and sale of the NS3 / 4A protease inhibitors vaniprevir, telaprevir, simeprevir, paritaprevir, asunaprevir, and grazoprevir have been discontinued, and only glecaprevir is available.

[0007] Currently, treatment with sofosbuvir (NS5B inhibitor) / ledipasvir (NS5A inhibitor) combination tablets (Harvoni), glecaprevir (NS3 / 4A inhibitor) / pibrentasvir (NS5A inhibitor) combination tablets (Maviret), or sofosbuvir / velpatasvir (NS5A inhibitor) combination tablets (Epclusa) is administered based on the viral genotype, hepatitis progression, and previous treatment history. This approach has achieved a reduction in blood viral load below the detection limit in over 95% of patients undergoing initial treatment for chronic hepatitis to compensated cirrhosis. While these treatment results are primarily from developed countries, the prevalent viral genotypes vary by country and region. Recently, it has become clear that there are viruses with low susceptibility to DAA. For example, treatment of HCV genotypes 3 and 4 prevalent in Africa and China has been reported to be only about 50% effective. It is possible that there is greater diversity in DAA susceptibility among HCV genotypes than previously anticipated. Furthermore, even in developed countries, there are certainly patients who are resistant or have low sensitivity to current treatments. There have also been reports of the emergence of drug-resistant strains in patients previously treated with DAA, such as those in whom drug resistance mutations seen in treatment failure cases can lead to multidrug resistance. On the other hand, with the market expected to shrink, pharmaceutical companies have basically stopped developing new anti-HCV drugs, making it difficult to provide new treatment options for treatment failure cases, and the social needs for HCV are not being fully met.

[0008] If inhibitors targeting HCV proteins other than NS3 / 4A, NS5A, and NS5B are developed, they may be combined with existing DAAs to develop new treatment options. Mutational analysis has shown that HCV NS2, one of the potential targets, possesses cysteine ​​protease activity that cleaves the viral precursor polyprotein and is also important in the particle formation process. Drug discovery research using NS2 protease inhibition as an indicator was once undertaken by pharmaceutical companies and others, but was unsuccessful, and no compounds that target NS2 and could serve as the active ingredient of HCV inhibitors have yet been developed.

[0009] Hepatitis C Treatment Guidelines (Version 8.2) Published January 2023 Compiled by the Hepatitis Treatment Guidelines Committee of the Japan Society of Hepatology

[0010] An objective of the present invention is to provide a compound that targets NS2 and has inhibitory activity against HCV, and a composition containing the compound.

[0011] In light of this current situation, the present inventors analyzed the role of NS2 in hepatitis C virus particle formation and found that NS2 association with envelope E2 through binding to the host factor signal peptidase subunit 1 (SPCS1) is important for particle envelopment. Furthermore, the present inventors found that the NS2 region important for interaction with SPCS1 is well conserved among HCV genotypes. Based on these findings, we aimed to discover novel anti-HCV drugs targeting NS2. However, HCV NS2 is a three-transmembrane protein that is difficult to purify, making it difficult to establish an in vitro experimental system, hindering high-throughput screening of inhibitors. Therefore, the present inventors utilized a cell-free protein synthesis system that also enables the preparation of active membrane proteins to establish an in vitro NS2-SPCS1 binding assay system and successfully screened for inhibitors. Then, using the NS2-SPCS1 binding assay system, the inventors conducted screening of a library of small molecule compounds and selected several compounds that inhibit NS2-SPCS1 binding. From among the candidate compounds, the inventors identified Compound A, a tetrahydrocarbazole derivative, as a proof-of-concept compound with HCV particle production inhibitory activity. Furthermore, the inventors were able to confirm that this compound has low cytotoxicity. Furthermore, focusing on the structure of Compound A, the inventors designed and synthesized numerous analogous compounds having a partial structure of Compound A and further screened them. As a result, they were able to obtain indole derivatives and / or tetrahydrocarbazole derivatives with high anti-HCV activity, thereby completing the present invention. The compounds discovered through the present invention are characterized by their inhibitory activity against HCV virus particle formation, unlike existing DAAs.

[0012] That is, the present invention relates to a compound having the structure of formula (I) or (IV), a composition containing the compound, etc. The compound having the structure of formula (I) or (IV) inhibits NS2-SPCS1 binding and exhibits anti-HCV activity of inhibiting HCV virus particle formation, and therefore one aspect of the present invention relates to an HCV inhibitor or a therapeutic agent for hepatitis C containing the compound. More specifically, the present invention relates to the following [1] to

[49] .

[0013] [1] A compound represented by the following formula (I), or a salt thereof, or a solvate thereof:

[0014]

[0015] In formula (I), X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３ is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group or a carboxy group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８ [2] The compound according to [1], or a salt thereof, or a solvate thereof, represented by the following formula (II):

[0016]

[0017] In formula (II), X is S(=O) ２ or C(=O); R ３ , and R ６ ~R ９ are each as defined in formula (I); R １１ In (n), n is an integer from 0 to 8, and R １１are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; wherein X is S(=O) ２ and R ３ , and R ６ ~R ８ are all hydrogen atoms, and R ９ is ethyl and R １１ (n) excluding the case where n = 0. [3] The compound according to [2], or a salt thereof, or a solvate thereof, represented by the following formula (III):

[0018]

[0019] In formula (III), X, R ３ , R ９ and R １１ are each as defined in formula (II); where X is S(=O) ２ and R ３ is a hydrogen atom, and R ９ is ethyl and R １１ (n) except when n=0. [4] X is S(=O) ２ [5] The compound according to [1], or a salt thereof, or a solvate thereof, wherein R １ Is -COOR ９ And here R ９ is a hydrogen atom, methyl, or ethyl. [6] The compound according to [1], or a salt thereof, or a solvate thereof, wherein the compound represented by formula (I) is any of the following:

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049] [7] A compound represented by the following formula (IV), or a salt thereof, or a solvate thereof:

[0050]

[0051] In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, [8] R is a group represented by (C6-C12)aryloxy optionally substituted with one or more substituents, (C6-C12)arylcarbonyl optionally substituted with one or more substituents, a heterocyclyl group optionally substituted with one or more substituents, a (5-12)heteroaryl optionally substituted with one or more substituents, a (C1-C6)alkylcarbonyl optionally substituted with one or more substituents, a (C1-C6)alkoxycarbonyl optionally substituted with one or more substituents, a (C1-C6)alkylaminocarbonyl optionally substituted with one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro. １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted with one or more substituents, a (C1-C6) alkoxy which may be substituted with one or more substituents, a (C6-C12) aryl which may be substituted with one or more substituents, a heterocyclyl which may be substituted with one or more substituents, a (C1-C6) alkoxycarbonyl which may be substituted with one or more substituents, carboxy, or nitro, or a salt thereof, or a solvate thereof. [9] The compound according to [7], represented by the following formula (V), or a salt thereof, or a solvate thereof:

[0052]

[0053] In formula (V), X, Z, and R １２ ~R １６are as defined in formula (IV).

[10] The compound according to [7], or a salt thereof, or a solvate thereof, represented by the following formula (VI):

[0054]

[0055] In formula (VI), Z and R １２ ~R １６

[11] A compound according to [7] or [8], or a salt thereof, or a solvate thereof, represented by the following formula (VII):

[0056]

[0057] In formula (VII), R １２ ~R １６ are as defined in formula (IV).

[12] X is S(=O) ２

[13] The compound according to [7], or a salt thereof, or a solvate thereof, wherein the compound represented by formula (IV) is any one of the following:

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[14] A composition comprising the compound according to any one of [1] to

[13] , or a salt thereof, or a solvate thereof, and a pharmaceutically acceptable carrier.

[15] A hepatitis C virus inhibitor comprising the compound according to any one of [1] to

[13] , or a salt thereof, or a solvate thereof, and a pharmaceutically acceptable carrier.

[16] A prophylactic and / or therapeutic agent for hepatitis C, comprising the compound according to any one of [1] to

[13] , or a salt thereof, or a solvate thereof, and a pharmaceutically acceptable carrier.

[17] The prophylactic and / or therapeutic agent according to

[16] , wherein the hepatitis C is a liver disease caused by infection with hepatitis C virus (HCV) selected from the group consisting of chronic hepatitis, cirrhosis, and hepatocellular carcinoma.

[18] The prophylactic and / or therapeutic agent according to

[17] , which is an orally administered agent.

[19] The prophylactic and / or therapeutic agent according to

[17] , which is a parenterally administered agent.

[20] The preventive and / or therapeutic agent according to

[19] , wherein the parenteral administration agent is an injection.

[0073]

[21] A method for inhibiting hepatitis C virus, comprising a step of administering a compound represented by the following formula (I), or a salt thereof, or a solvate thereof:

[0074]

[0075] In formula (I), X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８

[22] A method for inhibiting hepatitis C virus, comprising the step of administering a compound represented by the following formula (IV), or a salt thereof, or a solvate of the compound or salt:

[0076]

[0077] In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, (C6-C12)aryloxy optionally substituted by one or more substituents, (C6-C12)arylcarbonyl optionally substituted by one or more substituents, heterocyclyl group optionally substituted by one or more substituents, (5-12)heteroaryl optionally substituted by one or more substituents, (C1-C6)alkylcarbonyl optionally substituted by one or more substituents, (C1-C6)alkoxycarbonyl optionally substituted by one or more substituents, (C1-C6)alkylaminocarbonyl optionally substituted by one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro.

[0078]

[23] A method for preventing and / or treating hepatitis C, comprising a step of administering to a subject a compound represented by the following formula (I), or a salt thereof, or a solvate thereof:

[0079]

[0080] In formula (I), X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８

[24] The method for preventing and / or treating hepatitis C according to

[23] , wherein the compound represented by formula (I) is a compound represented by the following formula (II):

[0081]

[0082] In formula (II), X is S(=O) ２ or C(=O); R ３ , and R ６ ~R ９ are each as defined in formula (I); R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; wherein X is S(=O) ２ and R ３ , and R ６ ~R ８ are all hydrogen atoms, and R ９ is ethyl and R １１ (n) except for the case where n = 0.

[25] The method for preventing and / or treating hepatitis C according to

[24] , wherein the compound represented by formula (II) is a compound represented by the following formula (III):

[0083]

[0084] In formula (III), X, R ４ , R ９ and R １１ are each as defined in formula (II); ３ X is S (=O) ２ and R ３ is a hydrogen atom, and R ９ is ethyl and R １１ This excludes the case where n=0 in (n).

[0085]

[26] A method for preventing and / or treating hepatitis C, comprising a step of administering to a subject a compound represented by the following formula (IV), or a salt thereof, or a solvate thereof:

[0086]

[0087] In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents,

[27] The method for preventing and / or treating hepatitis C according to

[26] , wherein the compound represented by formula (IV) is a compound represented by the following formula (V):

[0088]

[0089] In formula (V), X, Z, and R １２ ~R １６ are as defined in formula (IV).

[28] The method for preventing and / or treating hepatitis C according to

[26] , wherein the compound represented by formula (IV) is a compound represented by the following formula (VI):

[0090]

[0091] In formula (VI), Z and R １２ ~R １６are as defined in formula (IV).

[29] The method for preventing and / or treating hepatitis C according to

[26] , wherein the compound represented by formula (IV) is a compound represented by the following formula (VII):

[0092]

[0093] In formula (VII), R １２ ~R １６ are as defined in formula (IV).

[30] The method for prevention and / or treatment according to any one of

[22] to

[29] , wherein the subject is a human infected with hepatitis C virus.

[0094]

[31] Use of a compound represented by the following formula (I) for the manufacture of an agent for the prophylaxis and / or treatment of hepatitis C:

[0095]

[0096] In formula (I), X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３ is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８ are all hydrogen atoms.

[0097]

[32] Use of a compound represented by the following formula (IV) for the manufacture of an agent for the prophylaxis and / or treatment of hepatitis C:

[0098]

[0099] In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, (C6-C12)aryloxy optionally substituted by one or more substituents, (C6-C12)arylcarbonyl optionally substituted by one or more substituents, heterocyclyl group optionally substituted by one or more substituents, (5-12)heteroaryl optionally substituted by one or more substituents, (C1-C6)alkylcarbonyl optionally substituted by one or more substituents, (C1-C6)alkoxycarbonyl optionally substituted by one or more substituents, (C1-C6)alkylaminocarbonyl optionally substituted by one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro.

[0100]

[33] A compound represented by the following formula (I) for use in a method for preventing and / or treating hepatitis C:

[0101]

[0102] In formula (I), X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３ is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １is an ethoxycarbonyl group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８

[34] The compound for use in the method for preventing and / or treating hepatitis C according to

[33] , wherein the compound represented by formula (I) is a compound represented by the following formula (II):

[0103]

[0104] In formula (II), X is S(=O) ２ or C(=O); R ３ , and R ６ ~R ９ are each as defined in formula (I); R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; wherein X is S(=O) ２ and R ３ , and R ６ ~R ８ are all hydrogen atoms, and R ９ is ethyl and R １１ (n) except when n = 0.

[35] The compound for use in the method for preventing and / or treating hepatitis C according to

[34] , wherein the compound represented by formula (II) is a compound represented by the following formula (III):

[0105]

[0106] In formula (III), X, R ３ , R９ and R １１ are each as defined in formula (II); where X is S(=O) ２ and R ３ is a hydrogen atom, and R ９ is ethyl and R １１ (n) (excluding the case where n=0).

[36] A compound represented by the following formula (IV) for use in a method for preventing and / or treating hepatitis C:

[0107]

[0108] In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents,

[37] The compound for use in the method for preventing and / or treating hepatitis C according to

[36] , wherein the compound represented by formula (IV) is a compound represented by the following formula (V):

[0109]

[0110] In formula (V), X, Z, and R １２ ~R １６ are as defined in formula (IV).

[38] The compound for use in the method for preventing and / or treating hepatitis C according to

[36] , wherein the compound represented by formula (IV) is a compound represented by the following formula (VI):

[0111]

[0112] In formula (VI), Z and R １２ ~R １６are as defined in formula (IV).

[39] The compound for use in the method for preventing and / or treating hepatitis C according to

[36] , wherein the compound represented by formula (IV) is a compound represented by the following formula (VII):

[0113]

[0114] In formula (VII), R １２ ~R １６ are each as defined in formula (IV).

[0115]

[40] A kit comprising interferon and the composition according to

[14] .

[41] The kit according to

[40] , further comprising ribavirin.

[42] The kit according to

[40] or

[41] , further comprising DAA.

[43] The kit according to any one of

[40] to

[42] , for simultaneous administration.

[44] The kit according to any one of

[40] to

[42] , for asynchronic administration.

[0116]

[45] A kit comprising a composition containing DAA and the composition according to

[14] .

[46] The kit according to

[45] , further comprising ribavirin.

[47] The kit according to

[45] or

[46] , for simultaneous administration.

[48] The kit according to

[45] or

[46] , for asynchronic administration.

[49] The kit according to any one of

[40] to

[48] , which is intended for the prevention and / or treatment of hepatitis C, and further comprises instructions or a package insert for said use.

[0117] The present invention provides compounds having the structure of formula (I) or (IV) and compositions containing such compounds. Furthermore, the compounds, compositions, hepatitis C virus inhibitors, and prophylactic and / or therapeutic agents, medicaments, treatment methods, uses, or kits of the present invention can reduce hepatitis C virus, providing novel prevention and / or treatment for hepatitis C and diseases caused by hepatitis C. Furthermore, since the compounds of the present invention exhibit significant hepatitis C virus inhibitory activity at low doses on the order of μM or less and / or have low cytotoxicity, the therapeutic agents, medicaments, pharmaceutical compositions, treatment methods, uses, or combinations of the present invention can provide prevention and / or treatment for hepatitis C and diseases caused by hepatitis C in a highly safe manner with minimal side effects.

[0118] FIG. 1 is a schematic diagram showing a complex containing SPSC1 (signal peptidase complex subunit 1) and NS2 protein of hepatitis C virus in the endoplasmic reticulum membrane.

[0119] Figure 2 is a schematic diagram of a screening system for in vitro selection of compounds that inhibit the interaction between NS2 and SPSC1. When the interaction between NS2 and SPSC1 is inhibited in the presence of a test compound, the luminescence at 520-620 nm in response to irradiation with 680 nm excitation light is attenuated (compared to a control in the absence of the test compound). Therefore, compounds that have inhibitory activity against this interaction can be selected using the attenuation of luminescence as an indicator.

[0120] In one embodiment, the present invention provides a compound of formula (I):

[0121]

[0122] wherein X is S(=O) ２ or C(=O); R １ represents a hydrogen atom or -COOR ９ or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents; R２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３ is a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, or a (C6-C10) aryl optionally substituted by one or more substituents; R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl optionally substituted by one or more substituents, a (C3-C8) cycloalkyl optionally substituted by one or more substituents, a (C2-C6) alkenyl optionally substituted by one or more substituents, a (C2-C6) alkynyl optionally substituted by one or more substituents, a (C6-C10) aryl optionally substituted by one or more substituents, a (C1-C6) haloalkyl optionally substituted by one or more substituents, a (C1-C6) alkoxy optionally substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl optionally substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group, and R ２ and R ３ is a hydrogen atom, and R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８and R are substituted or unsubstituted hydrogen atoms, or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising the compound, a salt thereof, or a solvate thereof.

[0123] In another aspect, the present invention relates to a compound of formula (I) having the following formula (II):

[0124]

[0125] wherein X is S(=O) ２ or C(=O); R ３ , and R ６ ~R ９ are each as defined in formula (I); R １１ In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; wherein X is S(=O) ２ and R ３ , and R ６ ~R ８ are all hydrogen atoms, and R ９ is ethyl and R １１ (n) (excluding the case where n = 0) or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising a compound represented by formula (II) above or a salt thereof, or a solvate thereof.

[0126] In another aspect, the present invention relates to a compound of formula (II) having the following formula (III):

[0127]

[0128] [In the formula: X, R ３ , R ９ and R１１ are each as defined in formula (II); where X is S(=O) ２ and R ３ is a hydrogen atom, and R ９ is ethyl and R １１ (n) (excluding the case where n=0) or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising a compound represented by formula (III) above or a salt thereof, or a solvate thereof.

[0129] In another aspect, the present invention relates to a compound represented by any one of formulas (I) to (III), or a salt thereof, or a solvate thereof, wherein X is S(=O) ２ or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising a compound represented by any one of formulas (I) to (III) above, or a salt thereof, or a solvate thereof.

[0130] In another aspect, the present invention provides a compound represented by formula (I), or a salt thereof, or a solvate thereof, wherein R １ Is -COOR ９ And here R ９ In another aspect, the present invention provides a compound represented by formula (I), a salt thereof, or a solvate thereof, wherein R １ Is -COOR ９ And here R ９ is a hepatitis C virus inhibitor containing a compound in which R is a hydrogen atom, methyl, or ethyl, or a salt thereof, or a solvate thereof.

[0131] In another aspect, the present invention provides a compound represented by formula (II) or (III), or a salt thereof, or a solvate thereof, wherein R ９is a hydrogen atom, methyl or ethyl, or a salt thereof, or a solvate thereof. In yet another aspect, the present invention provides a compound represented by formula (II) or (III), or a salt thereof, or a solvate thereof, wherein R ９ is a hepatitis C virus inhibitor containing a compound in which R is a hydrogen atom, methyl, or ethyl, or a salt thereof, or a solvate thereof.

[0132] In another aspect, the present invention is directed to a compound represented by formula (I), or a salt thereof, or a solvate thereof, wherein the compound represented by formula (I) is any of the following compounds, or a salt thereof, or a solvate thereof:

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167] In another aspect, the present invention provides a compound of formula (IV):

[0168]

[0169] [In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom; R １１In (n), n is an integer from 0 to 8, and R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, or a group represented by the formula (I): wherein the aryl group is a (C6-C12)aryloxy optionally substituted with one or more substituents, a (C6-C12)arylcarbonyl optionally substituted with one or more substituents, a heterocyclyl group optionally substituted with one or more substituents, a (5-12)heteroaryl optionally substituted with one or more substituents, a (C1-C6)alkylcarbonyl optionally substituted with one or more substituents, a (C1-C6)alkoxycarbonyl optionally substituted with one or more substituents, a (C1-C6)alkylaminocarbonyl optionally substituted with one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro, or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising the compound, a salt thereof, or a solvate thereof.

[0170] In another aspect, the present invention relates to a compound of formula (IV) having the following formula (V):

[0171]

[0172] [In formula (V), X, Z, and R １２ ~R １６ are each as defined in formula (IV)], or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor containing the compound represented by formula (V) above, or a salt thereof, or a solvate thereof.

[0173] In another aspect, the present invention relates to a compound of formula (IV) having the following formula (VI):

[0174]

[0175] [In formula (VI), Z and R １２ ~R １６ are each as defined in formula (IV)], or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor containing a compound represented by formula (VI) above, or a salt thereof, or a solvate thereof.

[0176] In another aspect, the present invention relates to a compound of formula (IV) having the following formula (VII):

[0177]

[0178] [In formula (VII), Z and R １２ ~R １６ are each as defined in formula (IV)], or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor containing a compound represented by formula (VII) above, or a salt thereof, or a solvate thereof.

[0179] In another aspect, the present invention relates to a compound represented by any one of formulas (IV) to (V), or a salt thereof, or a solvate thereof, wherein X is S(=O) ２ or a salt thereof, or a solvate thereof. Another aspect of the present invention is a hepatitis C virus inhibitor comprising a compound represented by any one of formulas (IV) to (VII) above, or a salt thereof, or a solvate thereof.

[0180] In another aspect, the present invention provides a compound represented by formula (IV), or a salt thereof, or a solvate thereof, wherein R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl optionally substituted with one or more substituents, a (C1-C6) alkoxy optionally substituted with one or more substituents, a (C6-C12) aryl optionally substituted with one or more substituents, a heterocyclyl group optionally substituted with one or more substituents, a (5-12) heteroaryl optionally substituted with one or more substituents, a (C1-C6) alkoxycarbonyl optionally substituted with one or more substituents, carboxy, or nitro, or a salt thereof, or a solvate thereof. In another aspect, the present invention provides a compound represented by formula (IV), a salt thereof, or a solvate thereof, wherein R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted with one or more substituents, a (C1-C6) alkoxy which may be substituted with one or more substituents, a (C6-C12) aryl which may be substituted with one or more substituents, a heterocyclyl group which may be substituted with one or more substituents, a (5-12) heteroaryl which may be substituted with one or more substituents, a (C1-C6) alkoxycarbonyl which may be substituted with one or more substituents, carboxy, or nitro, or a salt thereof, or a solvate thereof.

[0181] In another embodiment, the present invention provides a compound represented by formula (V) or (VI), or a salt thereof, or a solvate thereof, wherein Z is C—R １２ and R １２ ~R １６are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl optionally substituted with one or more substituents, a (C1-C6) alkoxy optionally substituted with one or more substituents, a (C6-C12) aryl optionally substituted with one or more substituents, a heterocyclyl group optionally substituted with one or more substituents, a (5-12) heteroaryl optionally substituted with one or more substituents, a (C1-C6) alkoxycarbonyl optionally substituted with one or more substituents, carboxy, or nitro, or a salt or solvate thereof. In yet another aspect, the present invention provides a compound represented by formula (V) or (VI), a salt or solvate thereof, wherein Z is C-R １２ and R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted with one or more substituents, a (C1-C6) alkoxy which may be substituted with one or more substituents, a (C6-C12) aryl which may be substituted with one or more substituents, a heterocyclyl group which may be substituted with one or more substituents, a (5-12) heteroaryl which may be substituted with one or more substituents, a (C1-C6) alkoxycarbonyl which may be substituted with one or more substituents, carboxy, or nitro, or a salt thereof, or a solvate thereof.

[0182] In another aspect, the present invention is directed to a compound represented by formula (IV), or a salt thereof, or a solvate thereof, wherein the compound represented by formula (IV) is any one of the following, or a salt thereof, or a solvate thereof:

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196]

[0197] Examples of compounds of the present invention include, but are not limited to, the following: 4-((9-(2-ethylhexyl)-2,3,4,9-tetrahydro-1H-carbazole)-6-sulfonamido)benzoic acid; ethyl 4-(1,2,3,4-tetrahydrocyclopenta[b]indole-7-sulfonamido)benzoate; ethyl 4-(5,6,7,8,9,10-hexahydrocyclohepta[b]indole-2-sulfonamido)benzoate; ethyl 4-(6,7,8,9,10,11-hexahydro-5H-cycloocta[b]indole-2-sulfonamido)benzoate; 4-(6,7,8,9,10,11-hexahydro-5H-cycloocta[b]indole-2-sulfonamido)benzoic acid; 4-(5,6,7,8,9,10-hexahydrocyclohepta[b]indole-2-sulfonamido)benzoic acid; 4-(6,7,8,9,10,11-hexahydro-5H-cycloocta[b]indole-2-sulfonamido)benzoic acid; ethyl 4-(3-methyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoate; ethyl 4-(2-methyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoate; ethyl 4-(2,3,4,9-tetrahydrospiro[carbazole-1,1'-cyclopentane]-6-sulfonamido)benzoate; ethyl 4-(3-(N-methyl-carbamoyl)-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoate; ethyl 4-(3-hydroxymethyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoate;4-(3-propyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoic acid; 4-(3-tert-butyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoic acid; 4-(2,2,4-trimethyl-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoic acid;ethyl 4-(2-methyl-1H-indole-5-sulfonamido)benzoate; ethyl 4-(2,3-dimethyl-1H-indole-5-sulfonamido)benzoate; ethyl 4-(3-ethyl-2-propyl-1H-indole-5-sulfonamido)benzoate: 4-(3-ethyl-2-propyl-1H-indole-5-sulfonamido)benzoic acid; ethyl 4-(2-phenyl-1H-indole-5-sulfonamido)benzoate; ethyl 4-(2-phenyl-1H-indole-5-sulfonamido)benzoate; ethyl 4-(3-methyl-2-(4-fluorophenyl)-1H-indole-5-sulfonamido)benzoate; ethyl 4-(3-methyl-2-(4-fluorophenyl)-1H-indole-5-sulfonamido)benzoate; 4-[2-(4-fluorophenyl)-3-methyl-1H-indole-5-sulfonamido]benzoic acid; N-[2-(2-methylphenoxy)phenyl]-2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamide; ethyl 4-[(2,3,4,9-tetrahydro-1H-carbazole-6-carbonyl)amino]benzoate; 4-[(2,3,4,9-tetrahydro-1H-carbazole-6-carbonyl)amino]benzoic acid;N-methyl-4-(2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzamide; and 4-(2,3,4,9-tetrahydro-1H-carbazole-6-sulfonamido)benzoic acid. ;

[0198] The terms used in this specification will be explained below.

[0199] The term "nitro" refers to the substituent "-NO ２ The term "cyano" or "nitrile" refers to the substituent "-CN". The term "hydroxy" refers to the substituent "-OH". The term "carboxy" refers to the substituent "-COOH". The term "carbamoyl" refers to the substituent "-CONH ２ The term "amino" refers to the substituent "-NH ２ " means.

[0200] (Ca-Cb) means that the number of carbon atoms is a to b. For example, the "(C1-C12)" in "(C1-C12) alkyl" means that the alkyl has 1 to 12 carbon atoms, and "(C2-C5)" means that the alkyl has 2 to 5 carbon atoms. "(Ca-Cb)" meaning the number of carbon atoms may be written as "Ca-Cb" without parentheses. Therefore, for example, the "C1-C6" in "C1-C6 alkyl" means that the alkyl has 1 to 6 carbon atoms.

[0201] As used herein, general terms such as "alkyl" are intended to include both straight and branched chains, such as butyl and tert-butyl, while the specific term "butyl," for example, refers to straight chain "normal butyl" and not branched chain "tert-butyl," and branched chain isomers such as "tert-butyl" are specifically referred to when intended.

[0202] Examples of halogen atoms include fluorine atoms, chlorine atoms, bromine atoms, and iodine atoms.

[0203] (C1-C12) alkyl means a straight or branched chain alkyl having 1 to 12 carbon atoms. Examples of (C1-C12) include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, sec-butyl, isobutyl, tert-butyl, pentyl, hexyl, 2-ethylhexyl, etc.

[0204] (C1-C6) alkyl means a straight or branched chain alkyl having 1 to 6 carbon atoms. Examples of (C1-C6) alkyl include appropriate examples of the above-mentioned (C1-C12) alkyl.

[0205] (C3-C8)cycloalkyl means cycloalkyl having 3 to 8 carbon atoms. Examples of (C3-C8)cycloalkyl are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl.

[0206] (C2-C6)alkenyl means a straight or branched chain alkenyl having from 2 to 6 carbon atoms. Examples of (C2-C6)alkenyl include, but are not limited to, vinyl, 1-propenyl, isopropenyl, 2-propenyl, 1-butenyl, 1-methyl-1-propenyl, 2-methyl-1-propenyl, 2-butenyl, 3-butenyl, 1,3-butadienyl, 1-pentenyl, 1-hexenyl, and the like.

[0207] (C2-C6)alkynyl means a straight or branched chain alkynyl having from 2 to 6 carbon atoms. Examples of (C2-C6)alkynyl include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, 1-methyl-2-propynyl, 2-butynyl, 3-butynyl, 1-pentynyl, 1-hexynyl, and the like.

[0208] Unless otherwise specified, (C6-C12)aryl refers to an aromatic hydrocarbon group having 6 to 12 carbon atoms. Examples of (C6-C12)aryl are phenyl, biphenyl, 1-naphthyl, and 2-naphthyl. Here, the carbon atoms on the aromatic ring may be substituted with one or more substituents. Unless otherwise specified, (C6-C10)aryl refers to an aromatic hydrocarbon group having 6 to 10 carbon atoms. Examples of (C6-C10)aryl are phenyl, 1-naphthyl, and 2-naphthyl. Here, the carbon atoms on the aromatic ring may be substituted with one or more substituents.

[0209] Unless otherwise specified, the heterocyclyl group refers to a non-aromatic heterocycle containing, in addition to carbon atoms, one or more atoms selected from oxygen atoms, nitrogen atoms, sulfur atoms, and boron atoms. For example, it is a 3- to 8-membered or 3- to 6-membered non-aromatic heterocycle. Specific examples include aziridinyl, oxiranyl, oxetanyl, thietanyl, tetrahydrofuranyl, tetrahydropyranyl, azetidinyl, pyrrolidinyl, piperidinyl, piperazinyl, dihydroisoxazolyl, dioxaborolanyl, dioxolanyl, dioxanyl, and morpholinyl. Here, atoms on the heterocycle may be substituted with one or more substituents.

[0210] (5-12)Heteroaryl, unless otherwise specified, refers to a 5- to 12-membered monocyclic or fused bicyclic aromatic heterocycle containing, in addition to carbon atoms, one or more heteroatoms selected from nitrogen, oxygen, and sulfur atoms. Examples of monocyclic aromatic heterocycles include pyridyl, pyrimidinyl, pyrazinyl, pyridazinyl, triazinyl, thienyl, furanyl, pyrrolyl, pyrazolyl, thiazolyl, isothiazolyl, oxazolyl, isoxazolyl, imidazolyl, triazolyl, thiadiazolyl, oxadiazolyl, and tetrazolyl. Examples of fused bicyclic heterocycles include those in which one of the monocyclic groups and a phenyl ring, or one of the heteroaromatic monocyclic groups, is connected to a C8- Fused bicyclic moieties formed by condensing to form a C10 bicyclic group include, for example, indolyl, benzimidazolyl, indazolyl, benzotriazolyl, isoquinolinyl, quinolinyl, benzothiazolyl, benzofuranyl, benzothienyl, benzisoxazolyl, pyrazolopyridyl, pyrazolopyrimidinyl, pyrrolopyridyl, triazolopyridyl, triazolopyrimidinyl, quinazolinyl, quinoxalinyl, or cinnolinyl, where atoms on the heterocycle may be optionally substituted with one or more substituents.

[0211] (C1-C6)haloalkyl means a straight or branched alkyl having 1 to 6 carbon atoms substituted with 1 to 13 identical or different halogen atoms (wherein halogen atoms have the same meaning as defined above). Examples of (C1-C6)haloalkyl include, but are not limited to, fluoromethyl, chloromethyl, bromomethyl, difluoromethyl, dichloromethyl, trifluoromethyl, trichloromethyl, etc. The phrase "optionally substituted with one or more substituents" in "(C1-C6)haloalkyl optionally substituted with one or more substituents" means that one or more positions in the (C1-C6)alkyl moiety that are not substituted with halogen atoms may be substituted with a substituent other than a halogen atom.

[0212] (C1-C6)alkoxy means (C1-C6)alkyl-O- (wherein the (C1-C6)alkyl moiety has the same meaning as defined above, and the same applies in the following explanations). Examples of (C1-C6)alkoxy include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, butoxy, sec-butoxy, isobutoxy, tert-butoxy, pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, and the like. "(C1-C6)alkoxy optionally substituted with one or more substituents" means that the (C1-C6)alkyl moiety in the alkoxy group may be substituted with a substituent at one or more positions. The phrase "optionally substituted with one or more substituents" in the following explanations should be understood in the same way.

[0213] (C1-C6)alkoxycarbonyl means (C1-C6)alkyl-O-C(=O)-. Examples of (C1-C6)alkoxycarbonyl include, but are not limited to, methoxycarbonyl and ethoxycarbonyl.

[0214] Unless otherwise specified, the (C1-C6) alkylcarbonyl group refers to a ((C1-C6) alkyl)-C(=O)- group, and examples thereof include acetyl, propionyl, 2-methylpropionyl, 2,2-dimethylpropionyl, butanoyl, pivaloyl, 2-methylbutanoyl, 3-methylbutanoyl, 2-ethylbutanoyl, 2,2-dimethylbutanoyl, 2,3-dimethylbutanoyl, 3,3-dimethylbutanoyl, pentanoyl, 2-methylpentanoyl, 3-methylpentanoyl, 4-methylpentanoyl, and hexanoyl.

[0215] Unless otherwise specified, (C1-C6) alkylaminocarbonyl refers to a ((C1-C6) alkyl)-NH-C(=O)- group, and examples thereof include methylaminocarbonyl, ethylaminocarbonyl, n-propylaminocarbonyl, isopropylaminocarbonyl, n-butylaminocarbonyl, isobutylaminocarbonyl, sec-butylaminocarbonyl, tert-butylaminocarbonyl, n-pentylaminocarbonyl, 1-methylbutylaminocarbonyl, 2-methylbutylaminocarbonyl, 3-methylbutylaminocarbonyl, 1-ethylpropylaminocarbonyl, 1,1-dimethylpropylaminocarbonyl, 1,2-dimethylpropylaminocarbonyl, 2,2-dimethylpropylaminocarbonyl, and n-hexylaminocarbonyl.

[0216] An example of "carbamoyl which may be substituted by one or more substituents" is -CONH ２ In the carbamoyl group represented by the formula: wherein one or two hydrogen atoms on the nitrogen atom are substituted with a substituent. An example of the substituent is (C1-C6) alkyl, and a more specific example is methyl or ethyl.

[0217] Unless otherwise specified, (C6-C12)aryloxy refers to a (C6-C12 aryl)-O- group, and examples thereof include a phenoxy group, a naphthalene-1-yloxy group, and a naphthalene-2-yloxy group.

[0218] Unless otherwise specified, (C6-C12)arylcarbonyl refers to a (C6-C12 aryl)-C(=O)- group, and examples thereof include benzoyl, biphenylcarbonyl, naphthalen-1-ylcarbonyl, and naphthalen-2-ylcarbonyl groups.

[0219] A cyclic hydrocarbon group refers to a cyclic group in which all atoms constituting the ring are carbon atoms. In one embodiment, examples of cyclic hydrocarbon groups include, but are not limited to, aromatic or non-aromatic monocyclic, bicyclic, or tricyclic 3- to 14-membered (preferably 5- to 14-membered, more preferably 5- to 10-membered) cyclic hydrocarbon groups. Examples of cyclic hydrocarbon groups include, but are not limited to, cycloalkyl, aryl, and the like. Examples of cycloalkyl include the above-mentioned examples of (C3-C8)cycloalkyl. Aryl is an aromatic cyclic group among the cyclic hydrocarbon groups defined above. Examples of aryl include the above-mentioned examples of (C6-C12)aryl. The cyclic hydrocarbon groups defined or exemplified above may, if possible, include non-fused cyclic (e.g., monocyclic or spirocyclic) and fused cyclic groups. The cyclic hydrocarbon groups defined or exemplified above may, if possible, be unsaturated, partially saturated, or saturated. The cyclic hydrocarbon group as defined or exemplified above is also called a carbocyclic group. A carbocycle is a ring corresponding to the cyclic hydrocarbon group as defined or exemplified above. Examples of carbocycles (hydrocarbon rings) include, but are not limited to, cyclopropane, cyclobutane, cyclopentane, cyclopentene, cyclohexane, cyclohexene, cycloheptane, cycloheptene, cyclooctane, cyclooctene, adamantane, etc.

[0220] In this specification, the "substituents" in the phrase "optionally substituted with one or more substituents" are not particularly limited as long as they are chemically permissible and exhibit the effects of the present invention.

[0221] In this specification, examples of the "one or more substituents" in the phrase "optionally substituted with one or more substituents" include, but are not limited to, one or more substituents (preferably 1 to 3 substituents) independently selected from the following substituent group (a):

[0222] Substituent group (a) is the group consisting of halogen atoms, nitro, cyano, hydroxy, amino, (C1-C6) alkyl, (C1-C6) haloalkyl, (C3-C8) cycloalkyl, (C2-C6) alkenyl, (C2-C6) alkynyl, (C1-C6) alkoxy, carbamoyl, (C1-C6) haloalkyl, (C1-C6) alkylcarbonyl, (C1-C6) alkoxycarbonyl, (C1-C6) alkylaminocarbonyl, phenyl, phenoxy, benzoyl, heterocyclyl, and hydrocarbon ring groups.

[0223] In addition, one or more substituents (preferably 1 to 3 substituents) independently selected from substituent group (a) may each be independently substituted with one or more substituents (preferably 1 to 3 substituents) independently selected from substituent group (b), where substituent group (b) is the same as substituent group (a).

[0224] Examples of "(C1-C12) alkyl optionally substituted by one or more substituents" include, but are not limited to, (C1-C12) haloalkyl, (C1-C12) hydroxyalkyl, and (C1-C4) alkyl optionally substituted by 1 to 9 fluorine atoms. Any other groups not defined herein are subject to the usual definitions.

[0225] As used herein, substituents (e.g., R １ , R ２ , R ３ , R ４ , R ５ The term "as described herein" and similar terms when referring to substituents (e.g., X, Z, etc.) incorporates by reference all definitions of substituents and all examples, preferred examples, more preferred examples, further preferred examples and particularly preferred examples, if any, herein.

[0226] As used herein, the open-ended terms "comprise(s)" / "comprising" may be optionally replaced with the restrictive phrase "consist(s) of" / "consisting of," respectively.

[0227] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0228] Unless otherwise indicated, numbers expressing quantities, sizes, concentrations, reaction conditions, and the like used herein are understood to be modified by the term "about." In some aspects, disclosed numerical values ​​are to be construed based on the number of reported significant digits and by applying ordinary rounding techniques. In some aspects, disclosed numerical values ​​are to be construed to include errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0229] The compounds of the present invention which are indole derivatives represented by formula (I) and / or tetrahydrocarbazole derivatives represented by formulas (II) to (VII), or salts thereof, or solvates thereof include not only the compounds of the present invention which are indole derivatives represented by formula (I) and / or tetrahydrocarbazole derivatives represented by formulas (II) to (VII), but also salts thereof (preferably pharmaceutically acceptable salts thereof), various hydrates and solvates thereof, substances having crystalline polymorphisms, and substances which serve as prodrugs of these substances. Furthermore, when an asymmetric carbon atom is present, not only racemic modifications but also optically active substances are included.

[0230] Specific examples of acceptable salts of the compounds of the indole derivatives represented by formula (I) and / or tetrahydrocarbazole derivatives represented by formulas (II) to (VII) of the present invention include, when the compounds are treated as basic compounds, acid addition salts with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.) and organic acids (e.g., methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, etc.). On the other hand, when the compounds are treated as acidic compounds, inorganic salts (e.g., sodium salt, potassium salt, lithium salt, barium salt, calcium salt, magnesium salt, etc.) can be used.

[0231] Solvates of the compounds of the present invention, which are the indole derivatives represented by formula (I) and / or the tetrahydrocarbazole derivatives represented by formulas (II) to (VII) of the present invention, and salts thereof, include hydrates and various solvates (for example, solvates with alcohols such as ethanol).

[0232] In the general formulas (I) and (IV), S(=O) in X ２ or C(=O), preferably S(=O) ２ is.

[0233] In general formula (I), R １ In the formula (I), a hydrogen atom or -COOR ９ or -CONHR １０ As the group represented by the formula (I), preferably —COOR ９ or -CONHR １０ and more preferably -COOR ９ is.

[0234] The R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl optionally substituted by one or more substituents, where R ９ Preferred examples of R are hydrogen atom, ethyl or ethyl; １０ Preferred examples are ethyl or methyl.

[0235] In general formula (I), R ２ In the formula (I), the hydrogen atom or the phenoxy group which may be substituted with one or more substituents is preferably a hydrogen atom. A preferred example of the phenoxy group which may be substituted with one or more substituents is a phenoxy group.

[0236] In general formula (I), R ３In the formula (I), the hydrogen atom, the (C1-C12) alkyl optionally substituted by one or more substituents, the (C3-C8) cycloalkyl optionally substituted by one or more substituents, or the (C6-C10) aryl optionally substituted by one or more substituents is preferably a hydrogen atom or a (C1-C12) alkyl optionally substituted by one or more substituents, more preferably a hydrogen atom. A preferred example of the (C1-C12) alkyl optionally substituted by one or more substituents is an unsubstituted (C1-C12) linear or branched alkyl. Specific examples of the (C1-C12) alkyl optionally substituted by one or more substituents include 2-ethylhexyl, methyl, ethyl, propyl, 2-methylbutyl, cyclohexylmethyl, or oxiran-2yl-methyl, and a preferred specific example is 2-ethylhexyl.

[0237] In general formula (I), R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C6-C10) aryl which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, carboxy, or a (C1-C6) alkoxycarbonyl which may be substituted by one or more substituents; ４ and R ５ may bond to each other to form a hydrocarbon ring together with adjacent carbon atoms, and preferably includes (C1-C12) alkyl which may be substituted with one or more substituents, a hydrogen atom, (C6-C10) aryl which may be substituted with one or more substituents, or (C1-C6) haloalkyl which may be substituted with one or more substituents. More preferred examples include R ４ and R ５is (C1-C12) alkyl, each of which may be substituted with one or more substituents, where R ４ and R ５ are bonded to each other to form a hydrocarbon ring together with the adjacent carbon atoms. ４ and R ５ Preferred examples of the hydrocarbon rings which are bonded to each other and form adjacent carbon atoms include cyclopentene which may be substituted with one or more substituents, hexene which may be substituted with one or more substituents, cycloheptene which may be substituted with one or more substituents, and cyclooctene which may be substituted with one or more substituents, a more preferred example being cyclohexene which may be substituted with one or more substituents, and an even more preferred example being cyclohexene which has no substituents. ４ and R ５ do not bond to each other to form a hydrocarbon ring together with adjacent carbon atoms, R ４ and R ５ Preferred examples of are a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, or a (C6-C10) aryl which may be substituted by one or more substituents, more preferably a hydrogen atom, methyl, ethyl, propyl, butyl, pentyl, phenyl, or halo-substituted aryl, and even more preferably a hydrogen atom, methyl, ethyl, propyl, pentyl, phenyl, or fluorophenyl.

[0238] In general formulas (I) and (IV), R ６ ~R ８ In the above, each independently represents a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a hydroxyl or a halogen atom, preferably a hydrogen atom.

[0239] In general formula (II), X, R ４ , and R ６ ~R ９ are each as defined in formula (I), and preferred examples of each are also as given as preferred examples in formula (I).

[0240] In general formulas (II) and (IV), R １１ The group represented by (n) (where n is an integer of 0 to 8) means 0 to 8 substituents that may be present on the cyclohexene ring portion of the tetrahydrocarbazole ring, where examples of up to 8 substituents are, independently of one another, groups independently selected from the group consisting of (C1-C12) alkyl optionally substituted with one or more substituents, (C3-C8) cycloalkyl optionally substituted with one or more substituents, carbamoyl optionally substituted with one or more substituents, (C1-C6) alkoxy optionally substituted with one or more substituents, hydroxy, and a halogen atom. Here, preferred examples of the (C1-C12) alkyl optionally substituted by one or more substituents, the (C3-C8) cycloalkyl optionally substituted by one or more substituents, the carbamoyl optionally substituted by one or more substituents, the (C1-C6) alkoxy optionally substituted by one or more substituents, the hydroxy, and the halogen atom are the (C1-C12) alkyl optionally substituted by one or more substituents, the (C3-C8) cycloalkyl optionally substituted by the above substituents, and the carbamoyl optionally substituted by one or more substituents. More preferred examples of these are methyl, ethyl, propyl, tert-butyl, cyclopentyl, N-methylcarbamoyl, and hydroxymethyl.

[0241] In general formula (III), X, R ４ and R ９ are as defined in formula (I) and formula (II), respectively, and preferred examples thereof are also as given as preferred examples in formula (I) and formula (II). １１ The group represented by (n) (where n is an integer of 0 to 8) is as defined in formula (II). Preferred examples thereof are also as given as preferred examples in formula (II).

[0242] In general formula (IV), C-R in Z １２ or N is preferably C—R １２ is.

[0243] In general formula (IV), R １２ ~R １６ In the above, a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, a (C6-C12) aryloxy which may be substituted by one or more substituents, a (C6-C12) arylcarbonyl which may be substituted by one or more substituents, a heterocyclyl group which may be substituted by one or more substituents, a (5-12) heteroaryl which may be substituted by one or more substituents, a (C1-C6) alkylcarbonyl which may be substituted by one or more substituents, The group represented by aryl, (C1-C6)alkoxycarbonyl optionally substituted by one or more substituents, (C1-C6)alkylaminocarbonyl optionally substituted by one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro is preferably a hydrogen atom, a halogen atom, a (C1-C12)alkyl optionally substituted by one or more substituents, a (C1-C6)alkoxy optionally substituted by one or more substituents, a (C6-C12)aryl optionally substituted by one or more substituents, a (5-12)heteroaryl optionally substituted by one or more substituents, a (C1-C6)alkoxycarbonyl optionally substituted by one or more substituents, a carboxy, or nitro group, more preferably a hydrogen atom, a halogen atom, methyl, ethyl, methoxy, nitro, carboxy, methoxycarbonyl, ethoxycarbonyl, pyridyl, phenyl, morpholinyl, and piperidinyl. Preferred examples of the halogen atom include a fluorine atom, a bromine atom, a chlorine atom, and an iodine atom.

[0244] In general formula (V), X, Z and R １２ ~R １６are each as defined in formula (IV), and preferred examples of each are also as given as preferred examples in formula (IV).

[0245] In general formula (VI), Z and R １２ ~R １６ are each as defined in formula (IV), and preferred examples of each are also as given as preferred examples in formula (IV).

[0246] In general formula (VII), R １２ ~R １６ are each as defined in formula (IV), and preferred examples of each are also as given as preferred examples in formula (IV).

[0247] Confirmation of HCV Inhibitory Activity The effects of the compounds of the present invention can be confirmed, for example, by in vitro cell-free experiments using the inhibitory activity against the interaction between NS2 and SPCS1 as an indicator ( FIG. 1 ). As another example, as shown in the Examples below, the effects can be confirmed by experiments using cultured cells as an inhibitory effect on the number of HCV genome copies contained in HCV-infected cells. Furthermore, provided that ethically appropriate procedures are followed, the effects can also be appropriately confirmed by administration experiments to HCV-infected individuals (humans or model animals such as chimpanzees).

[0248] An example of a specific method for confirming HCV inhibitory activity is as follows: HuH-7-derived HCV JFH-1 persistently infected cells (SL2 cells; prepared by the inventor) were seeded (1 x 10 cells) into a 24-well plate containing Dulbecco's modified Eagle's medium. ５The cells are cultured overnight at 1000 x g of ... Here, quantitative RT-PCR can be performed using, for example, the TaqMan (registered trademark) Fast Virus 1-Step Multiplex Master Mix for qPCR kit (manufactured by Thermo Fisher). Primers for detecting the HCV genome are as follows: HCV-F: 5'-GAGTGTCGTGCAGCCTCCA-3' (SEQ ID NO: 1) HCV-R: 5'-CACTCGCAAGCACCCTATCA-3' (SEQ ID NO: 2). The TaqMan (registered trademark) probe (FAM / ZEN / 3IABkFQ labeled probe) used was HCV-T containing the following sequence: HCV-T: 5'-56FAM / CCCGCAAGA / ZEN / CTGCTAGCCGAGTAGTGTTGG / 3IABkFQ / -3' In the HCV-T probe, the base sequence of 5'-CTGCTAGCCGAGTAGTGTTGG-3' is designated as SEQ ID NO:3.

[0249] Using the HCV RNA copy number determined by the above-mentioned method, the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells treated with 10 μM of the test compound is calculated, assuming that the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells not treated with the compound is 1, and the HCV inhibitory activity of the test compound is evaluated by this calculation. For example, if the calculated value for test compound X is 0.41, this means that "addition of 10 μM of test compound X inhibits HCV production by 59%." The compounds of the present invention have significant HCV inhibitory activity and exhibit a value calculated by the above-mentioned evaluation method of 0.86 or less, preferably 0.7 or less, more preferably 0.6 or less, even more preferably 0.5 or less, and even more preferably 0.4 or less.

[0250] Another method for assessing the HCV inhibitory activity of a test compound is to ５０ For example, as described above, parallel tests are conducted in which the test compound is added at 0.63, 1.25, 2.5, 5, 10, or 20 μM, and the amount of HCV (HCV RNA copy number) produced by HuH7.5.1 cells is determined in each test. The relationship between the concentration of the test compound and the determined amount of HCV is then plotted on a graph, and the concentration of the test compound that reduces the amount of HCV produced by untreated HuH7.5.1 cells by 50% is calculated, and this concentration is designated as the EC ５０ value (μM) (where EC ５０ is IC ５０ Similarly, the EC ５０ The compounds of the present invention have significant HCV inhibitory activity, and the EC value (μM) calculated by the above evaluation method can be determined. ５０The value is 20 μM or less, preferably 15 μM or less, more preferably 10 μM or less, even more preferably 5 μM or less, and most preferably 2 μM or less. In this experimental system, by measuring the cell number and total RNA amount after culturing the virus-producing cells, it is also possible to evaluate whether or not the test compound has cytotoxicity.

[0251] The compounds represented by formulas (I) to (VII) will now be described. The indole derivatives represented by general formula (I) and the tetrahydrocarbazole derivatives represented by general formulas (II) to (VII) of the present invention can all be produced by methods and techniques known to those skilled in the art. For example, they can be produced by the method shown below or a method similar thereto. The synthesized compounds can also be confirmed by well-known means such as NMR.

[0252] General Methods: All reactions involving air- or moisture-sensitive reagents were carried out in dry glassware under a nitrogen atmosphere using commercially available solvents and reagents unless otherwise noted. Thin-layer chromatography (TLC) was performed on Merck 60F254 precoated silica gel plates and visualized by conventional methods. Flash column chromatography was performed using silica gel 60N (Kanto Chemical Co., Inc.).

[0253] Characteristic Data １ H NMR (400 MHz) and １３ C NMR (100 MHz) spectra were recorded on a Bruker Biospin AVANCE III HD. Chemical shifts were recorded using MeCl2 as an internal standard. ４ Si(CDCl ３ Infrared (IR) spectra were recorded on a JASCO FT / IR 6300 and are reported in wavenumbers (cm －１ ) Low-resolution (LRMS) and high-resolution (HRMS) mass spectra were recorded on a Bruker Daltonics compact (ESI-MS) spectrometer in positive and negative detection mode.

[0254] The compound represented by formula (I) will now be described. The compound represented by formula (I) can be produced roughly through the following steps.

[0255] Compound J6-032 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound J6-032, which has the structure shown below.

[0256]

[0257] Compound J6-032 can be synthesized according to the route shown below using known materials and conventional methods.

[0258]

[0259]

[0260] Compound J4-026 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound J4-026, which has the structure shown below.

[0261]

[0262] Compound J4-026 can be synthesized according to the route shown below using known materials and conventional methods.

[0263]

[0264] Compound K7-025 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K7-025, which has the structure shown below.

[0265]

[0266] Compound K7-025 can be synthesized according to the route shown below using known materials and conventional methods.

[0267]

[0268] Compound K6-001 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K6-001, which has the structure shown below.

[0269]

[0270] Compound K6-001 can be synthesized according to the route shown below using known materials and conventional methods.

[0271]

[0272] Compound K7-034 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K7-034, which has the structure shown below.

[0273]

[0274] Compound K7-034 can be synthesized according to the route shown below using known materials and conventional methods.

[0275]

[0276] Compound K9-030 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K9-030, which has the structure shown below.

[0277]

[0278] Compound K9-030 can be synthesized according to the route shown below using known materials and conventional methods.

[0279]

[0280] In addition to the above route, compound K9-030 can also be synthesized by amidating the following ester compound.

[0281]

[0282] Compound K24-023 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K24-023, which has the structure shown below.

[0283]

[0284] Compound K24-023 can be synthesized according to the route shown below using known materials and conventional methods.

[0285]

[0286] Compound K25-012 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K25-012, which has the structure shown below.

[0287]

[0288] Compound K25-012 can be synthesized according to the route shown below using known materials and conventional methods.

[0289]

[0290] Compound K25-013 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K25-013, which has the structure shown below.

[0291]

[0292] Compound K25-013 can be synthesized according to the route shown below using known materials and conventional methods.

[0293]

[0294] Compound K25-018 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K25-018, which has the structure shown below.

[0295]

[0296] Compound K25-018 can be synthesized according to the route shown below using known materials and conventional methods.

[0297]

[0298] Next, the compound represented by formula (IV) will be described. The compound represented by formula (IV) can be roughly produced through the following steps. In addition, the steps shown for the above compound K7-025 etc. can also be referred to for production.

[0299] Compound K28-039 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K28-039, which has the structure shown below.

[0300]

[0301] Compound K28-039 can be synthesized according to the route shown below using known materials and conventional methods.

[0302]

[0303] Compound K29-013 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-013, which has the structure shown below.

[0304]

[0305] Compound K29-013 can be synthesized according to the route shown below using known materials and conventional methods.

[0306]

[0307] Compound K29-026 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-026, which has the structure shown below.

[0308]

[0309] Compound K29-026 can be synthesized according to the route shown below using known materials and conventional methods.

[0310]

[0311] Compound K29-027 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-027, which has the structure shown below.

[0312]

[0313] Compound K29-027 can be synthesized according to the route shown below using known materials and conventional methods.

[0314]

[0315] Compound K29-030 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-030, which has the structure shown below.

[0316]

[0317] Compound K29-030 can be synthesized according to the route shown below using known materials and conventional methods.

[0318]

[0319] Compound K29-035 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-035, which has the structure shown below.

[0320]

[0321] Compound K29-035 can be synthesized according to the route shown below using known materials and conventional methods.

[0322]

[0323] Compound K29-036 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K29-036, which has the structure shown below.

[0324]

[0325] Compound K29-036 can be synthesized according to the route shown below using known materials and conventional methods.

[0326]

[0327] Compound K30-031 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K30-031, which has the structure shown below.

[0328]

[0329] Compound K30-031 can be synthesized according to the route shown below using known materials and conventional methods.

[0330]

[0331] Compound K24-037 One example of a compound of the present invention that has hepatitis C virus inhibitory activity is compound K24-037, which has the structure shown below.

[0332]

[0333] Compound K24-037 can be synthesized according to the route shown below using known materials and conventional methods.

[0334]

[0335] Preparation of a hepatitis C virus inhibitor (a preventive and / or therapeutic agent for hepatitis C) comprising, as an active ingredient, a compound of the present invention which is an indole derivative and / or tetrahydrocarbazole derivative represented by formula (I) to (VII), or a salt thereof, or a solvate thereof. The active ingredient, a compound represented by formula (I) or formulas (II) to (VI) of the present invention, can be the indole derivative and / or tetrahydrocarbazole derivative represented by formula (I) or formulas (II) to (VII) itself, or a salt or solvate thereof. Salts and solvates of compounds can be prepared by conventional methods. In this specification, even when a compound represented by formula (I) or formulas (II) to (VII) is simply referred to, it is understood that the invention equally encompasses the use of a salt or solvate of a compound represented by formula (I) or formulas (II) to (VII).

[0336] The salt is not particularly limited as long as it is pharmaceutically acceptable, and examples thereof include alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts; organic base salts such as ammonium salts and trialkylamine salts; mineral acid salts such as hydrochlorides and sulfates; organic acid salts such as acetates, etc. Examples of the solvates include hydrates and alcohol solvates (e.g., ethanol solvates).

[0337] The route of administration of the preventive and / or therapeutic agent for hepatitis C (hepatitis C virus inhibitor) of the present invention, which contains as an active ingredient an indole derivative and / or tetrahydrocarbazole derivative represented by formula (I) or formulas (II) to (VII), is not particularly limited, and the agent may be administered orally or parenterally. For example, the agent may be administered orally in the form of tablets, capsules, granules, powder, syrup, or the like. The agent may also be administered parenterally in the form of injections, eye drops, nasal drops, ointments, creams, lotions, gels, sprays, or the like. These preparations can be produced by known methods. For example, oral preparations can be produced by appropriately combining and formulating solubilizers such as gum tragacanth, gum arabic, sucrose fatty acid esters, lecithin, olive oil, soybean oil, PEG 400, etc.; excipients such as starch, mannitol, lactose, etc.; binders such as methylcellulose, sodium carboxymethylcellulose, hydroxypropylcellulose, etc.; disintegrants such as crystalline cellulose, calcium carboxymethylcellulose, etc.; lubricants such as talc, magnesium stearate, etc.; flow improvers such as light anhydrous silicic acid, etc. Furthermore, injectable preparations can be prepared, for example, by dissolving or diluting a sterilely stored dried product or stock solution of the indole derivative and / or tetrahydrocarbazole derivative represented by formula (I) or formulas (II) to (VII) of the present invention with physiological saline or a buffer solution for intravenous injection. To increase the solubility of the indole derivatives and / or tetrahydrocarbazole derivatives represented by formula (I) or formulas (II) to (VII) of the present invention, known methods can be appropriately utilized, such as changing the solvent, ultrafinely particle-forming the indole derivatives and / or tetrahydrocarbazole derivatives represented by formula (I) or formulas (II) to (VII) of the present invention, or inclusion in cyclodextrins. Subcutaneous, intramuscular, and intravenous injections can be prepared by adding a pH adjuster, buffer, stabilizer, isotonicity agent, local anesthetic, etc. to the indole derivatives and / or tetrahydrocarbazole derivatives represented by formula (I) or formulas (II) to (VII) of the present invention using conventional methods. Examples of pH adjusters and buffers include sodium citrate, sodium acetate, and sodium phosphate.Examples of stabilizers include sodium pyrosulfite, EDTA (sodium edetate), thioglycolic acid, thiolactic acid, etc. Examples of local anesthetics include procaine hydrochloride, lidocaine hydrochloride, etc. Examples of isotonic agents include sodium chloride, glucose, etc.

[0338] Dosage Form of a Prophylactic and / or Therapeutic Agent for Hepatitis C (Hepatitis C Virus Inhibitor) Comprising an Indole Derivative and / or Tetrahydrocarbazole Derivative Represented by Formula (I) or Formulas (II) to (VII) of the Present Invention as an Active Ingredient: The effective dose of the indole derivative and / or tetrahydrocarbazole derivative represented by Formula (I) or Formulas (II) to (VII) of the Present Invention, which is the active ingredient of the Prophylactic and / or Therapeutic Agent for Hepatitis C of the Present Invention, can be appropriately adjusted depending on various factors, such as the patient's condition and symptoms. When administered orally, the daily dose of the indole derivative and / or tetrahydrocarbazole derivative represented by Formula (I) or Formulas (II) to (VII) of the Present Invention can be administered once a day or in divided doses. Conversely, a dosage equivalent to several days' worth can be administered at a single time, allowing for an administration cycle of once every two or more days. When administered systemically as an injection, the dosage of the indole derivative and / or tetrahydrocarbazole derivative represented by Formula (I) or Formulas (II) to (VII) of the present invention can be administered once a day or in divided doses. Conversely, a dosage equivalent to several days can be administered once, so that the administration cycle is every two or more days. Continuous administration by infusion or the like is also possible. When parenterally administered topically as an ointment, lotion, cream, gel, spray, or other parenteral preparation, the amount of the indole derivative and / or tetrahydrocarbazole derivative represented by Formula (I) or Formulas (II) to (VII) of the present invention in the pharmaceutical composition for topical use, the frequency of topical administration, and the area of ​​application can be adjusted as appropriate. In either case, administration does not necessarily have to be continuous or regular, and can be performed at appropriate intervals depending on changes in symptoms, etc. If a single administration results in cure or remission, multiple administrations are not necessary. Administration can be resumed if symptoms recur or worsen. The method of administration of the agent for preventing and / or treating hepatitis C, which contains as an active ingredient an indole derivative and / or tetrahydrocarbazole derivative represented by formula (I) or formulas (II) to (VII) of the present invention, is not particularly limited. The administration period can be adjusted appropriately depending on the condition of the patient.The dosage during the administration period can be adjusted as appropriate, but examples include administering a constant amount continuously, or administering a relatively high dose only at the beginning of administration, followed by a transition to a lower maintenance constant dose.

[0339] The indole derivatives and / or tetrahydrocarbazole derivatives represented by formula (I) or formulas (II) to (VII) of the present invention can also be used in combination with other drugs for the prevention and / or treatment of hepatitis C. One example of a combination partner is interferon. Another example of a combination partner is ribavirin. Yet another example of a combination partner is DAA. When these drugs are used in combination, the number of drugs to be combined can be any number of two or more. The dosage and administration mode can be the same as those when each drug is used alone, but can also be changed appropriately in consideration of the combined use. The combined drugs may be administered simultaneously or at different times. When the multiple drugs to be administered in combination are all prepared as oral preparations, a combined drug for combined administration may be prepared and used, or drugs prepared separately may be used. When the multiple drugs to be administered in combination are all administered in simultaneous administration by injection or infusion, the multiple drugs may be mixed in advance before administration to prepare an injection or infusion liquid. In order to administer multiple medicines in combination, a kit containing multiple medicines intended for the prevention and / or treatment of hepatitis C can also be prepared. The kit may further include instructions or package inserts for such use.

[0340] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples in any way.

[0341] <Search for Compounds Inhibiting the Interaction between NS2 and SPCS1> As shown schematically in Figure 1, HCV NS2 is a three-transmembrane protein. Purification is difficult, making it difficult to establish an in vitro experimental system, hindering high-throughput screening of inhibitors. Therefore, the present inventors utilized a cell-free protein synthesis system that also enables the preparation of active membrane proteins to establish an in vitro NS2-SPCS1 binding assay system, as shown schematically in Figure 2. By applying test compounds from a compound library to this assay system, they were able to screen for HCV inhibitors. More specifically, when the interaction between NS2 and SPCS1 is inhibited in the presence of a test compound, the 520-620 nm emission in response to 680 nm excitation light irradiation is attenuated (compared to a control in the absence of the test compound). Therefore, compounds with inhibitory activity against this interaction were screened using the attenuation of emission as an indicator. As a result, several compounds, including Compound A, a tetrahydrocarbazole derivative, were selected.

[0342] <Confirmation of Hepatitis C Virus Inhibitory Activity of Compounds with Inhibitory Activity against NS2-SPCS1 Interaction> The compounds with inhibitory activity against NS2-SPCS1 interaction selected by the in vitro cell-free assay system were tested in the following cell culture system to determine whether they actually have significant inhibitory activity against viral particle production of hepatitis C virus and can be used as hepatitis C virus inhibitors. HuH-7-derived HCV JFH-1 persistently infected cells (SL2 cells; prepared by the inventor) were seeded (1 x 10 cells) into 24-well plates containing Dulbecco's modified Eagle's medium. ５The cells were incubated overnight at a concentration of 100 μL / mL (N=3). The test compound was then added, and the cells were further incubated for 3 days. After incubation, the culture supernatant was collected, and 150 μL of the culture solution was added to 350 μL of medium containing HuH7.5.1 cells (human hepatocellular carcinoma-derived cells). After incubation for 3 days, the cells were harvested. Total RNA was prepared from the harvested cells by a standard method, and the HCV RNA copy number was determined by quantitative RT-PCR. The test compound was added at 10 μM. Quantitative RT-PCR was performed using TaqMan® Fast Virus 1-Step Multiplex Master Mix for qPCR (Thermo Fisher). The primers and probes used were as described above.

[0343] Using the HCV RNA copy number determined by the above-mentioned method, the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells treated with 10 μM of the test compound was calculated, assuming that the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells not treated with the compound was 1, thereby evaluating the HCV inhibitory activity of the test compound (hereinafter, the value calculated by the above-mentioned method is referred to as the "inhibitory activity value" of the test compound). As a result, it was confirmed that the amount of HCV (HCV RNA copy number) was reduced by 59% in the presence of the tetrahydrocarbazole derivative Compound A, and the inhibitory activity value of Compound A was 0.41. Furthermore, a test was also carried out by adding 0.63, 1.25, 2.5, 5, 10 or 20 μM of the test compound, and the amount of HCV (the number of HCV RNA copies) produced by HuH7.5.1 cells was measured in each case, and the concentration of the compound added that reduced the amount of HCV produced by untreated HuH7.5.1 cells by 50%, i.e., EC ５０ The EC value (μM) of Compound A was calculated. ５０ The value (μM) was 8.87.

[0344] For Compound A, a clear reduction in HCV RNA copy number was observed in the presence of 10 μM, with an EC ５０As a result, it was found for the first time that compounds that inhibit NS2-SPCS1 binding actually have HCV particle production inhibitory activity. ５０ A compound exhibiting this value can be expected to exhibit significant hepatitis C virus inhibitory activity not only in cell culture systems but also in vivo. Similar expectations can be expected when a clear reduction in HCV RNA copy number is observed in the presence of 10 μM (e.g., an inhibitory activity value of 0.86 or less, preferably 0.7 or less, more preferably 0.6 or less, even more preferably 0.5 or less, and even more preferably 0.4 or less). Furthermore, the compound is comparable in any way to existing anti-HCV drugs such as DAA, and is expected to become a practical pharmaceutical that provides a new treatment option. Furthermore, in this experimental system, the cell count and total RNA amount after culture of virus-producing cells were measured to evaluate whether the test compound exhibited cytotoxicity. Compound A did not cause a significant decrease in cell number or total RNA amount within the tested concentration range of 0.63 to 20 μM, and no substantial cytotoxicity was observed for Compound A within this concentration range. Consequently, Compound A can be said to be a new hepatitis C virus inhibitor from the perspective of safety as well.

[0345] Based on these results, it was expected that tetrahydrocarbazole derivatives and indole derivatives that are highly structurally similar to compound A may contain compounds that inhibit NS2-SPCS1 binding and may serve as active ingredients in hepatitis C virus inhibitors. Therefore, the present inventors decided to use compound A as a lead compound to design and synthesize a large number of compounds by adding various structural mutations, and to measure the inhibitory activity of the synthesized compounds on HCV particle production according to the above-mentioned method.

[0346] [Example 1] Preparation of Compounds In this example, the compounds were prepared by applying known technical means in addition to the procedures specifically described below. Analytical methods such as NMR, infrared (IR) spectra, low-resolution (LRMS) and high-resolution (HRMS) mass spectra, which were used to confirm the synthesis of the compounds, were performed under the conditions described in the "Characteristic Data" section above.

[0347] Example 1-1: Preparation of compound J6-032

[0348]

[0349] Compound J6-032 was synthesized according to the route and procedures shown below.

[0350]

[0351] Ethyl 4-((2,3,4,9-tetrahydro-1H-carbazole)-6-sulfonamido)benzoate (Compound 1): Cyclohexanone (Compound 2) (1.0 mL, 10.0 mmol) was added to a solution of phenylhydrazine hydrochloride (1590.6 mg, 11.0 mmol) in acetic acid (40 mL), and the mixture was stirred at 150°C for 1 hour. The precipitate was filtered and recrystallized from MeOH to give 1,2,3,4-tetrahydrocarbazole as a brown solid (1064.9 mg, 6.2 mmol, 62% yield). 1,2,3,4-tetrahydrocarbazole (1712.0 mg, 10.0 mmol) was added to a round-bottom flask at 0°C with ClSO. ３ C.H (20.0 mL) was added dropwise and stirred at room temperature overnight. After checking by TLC, the mixture was added dropwise to an ice bath. ２ Cl ２ Extracted with Na ２ SO ４ The mixture was dried over CH. Concentration under reduced pressure gave a yellow amorphous solid which was used immediately in the next step without purification. ２ Cl ２ To a solution of the carbazole intermediate (1911.9 mg, 7.1 mmol) in 28.4 mL of ethyl-4-aminobenzoate (2345.3 mg, 14.2 mmol) and triethylamine (3.0 mL, 21.3 mmol) were added under nitrogen at 0°C. After stirring until the reaction was complete as determined by TLC, the reaction mixture was quenched with 1N hydrochloric acid and extracted with ethyl acetate. The extract was washed with brine and the Na ２ SO ４After concentration under reduced pressure, flash chromatography on silica gel using n-hexane-EtOAc (3:2 to 1:1) gave compound 1 as a white solid (1630.0 mg, 14.1 mmol, 41% yield over two steps). The synthesis of the intermediate compound depicted as compound 1 in the above reaction scheme was confirmed by NMR and HRMS.

[0352] Compound 1: 1 H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 10.61 (s, 1H), 7.90 (s, 1H), 7.75 - 7.81 (m, 2H), 7.46 (d, J = 8.5 Hz, 1H), 7.36 (d, J = 8.5 Hz, 1H), 7.21 - 7.25 (m, 2H), 4.22 (q, J = 7.1 Hz, 2H), 2.66 (dt, J = 23.2, 5.4 Hz, 4H), 1.80 (q, J = 8.4 Hz, 4H), 1.25 (t, J = 7.1 Hz, 3H); 13 C{ 1 H} NMR (100 MHz, DMSO-d6) δ 165.7, 143.5, 138.1, 137.9, 130.9, 129.0, 126.9, 124.5, 118.9, 118.1, 117.7, 111.5, 110.1, 60.8, 23.1, 23.0, 20.7, 14.6; HRMS (ESI), m / z calcd for C 21 H 23 N2O4S [M+H] + 399.1373, found 399.1373.

[0353]

[0354] 4-((1,2,3,4-Tetrahydrocyclopenta[b]indole)-7-sulfonamido)benzoic acid (J6-032; Compound 5): To a solution of the ester compound (Compound 1) in methanol (2.5 mL) was added 2N sodium hydroxide, and the mixture was stirred at room temperature until the reaction was complete. The mixture was quenched with 1N hydrochloric acid, extracted with ethyl acetate, and then eluted with Na２ SO ４ The mixture was dried over ice and concentrated under reduced pressure to give J6-032 (compound 5) as a reddish-brown solid without further purification (34.8 mg, 0.099 mmol, yield 98%). The synthesis of compound J6-032 was confirmed by NMR and HRMS.

[0355] 1 H NMR (400 MHz, DMSO-d6) δ 12.55 (s, 1H), 11.25 (s, 1H), 10.57 (s, 1H), 7.90 (s, 1H), 7.74 - 7.80 (m, 2H), 7.46 (d, J = 8.6 Hz, 1H), 7.37 (d, J = 8.5 Hz, 1H), 7.18 - 7.25 (m, 2H), 2.66 (dt, J = 23.4, 5.4 Hz, 4H), 1.80 (qt, J = 10.1, 5.5 Hz, 4H); 13 C{ 1 H} NMR (100 MHz, DMSO-d6) δ 167.3, 143.1, 138.1, 137.9, 131.1, 129.1, 126.9, 125.4, 118.9, 118.1, 117.7, 111.5, 110.1, 23.1, 23.0, 21.5, 21.2, 20.7, 14.6.; HRMS (ESI), m / z calcd for C 19 H 19 N2O4S [M+H] + 371.1060, found 371.1060.

[0356] Example 1-2: Preparation of compound J4-026

[0357]

[0358] Compound J4-026 was synthesized according to the route shown below, with reference to the above-mentioned method for synthesizing J6-032.

[0359]

[0360] Molecular weight analysis of compound J4-026 by LRMS: 432.54, LRMS (ESI) [M+H]+: 433.1538

[0361] [Example 1-3] Preparation of compound K7-025

[0362]

[0363] Compound K7-025 was synthesized using known materials and conventional methods along the route shown below.

[0364]

[0365] 4-((9-(2-Ethylhexyl)-2,3,4,9-tetrahydro-1H-carbazole)-6-sulfonamido)benzoic acid (K7-025; Compound 8): To a solution of NaH (174.5 mg, 55%, 4.0 mmol) in dry DMF (13.3 mL) was added dropwise a solution of 1,2,3,4-tetrahydrocarbazole in dry DMF (2.0 mL) at 0°C. After stirring at 0°C for 30 minutes, 1-bromo-2-ethylhexane was added dropwise, and the reaction mixture was stirred at room temperature overnight. After checking by TLC, the mixture was heated at 0°C for 1 hour under reduced pressure. ２ The mixture was quenched with 0. The mixture was extracted with diethyl ether and washed with brine. ２ SO ４ The mixture was dried over ice and concentrated under reduced pressure. The crude product was purified by flash chromatography using n-hexane-EtOAc (49:1) to give compound 7 as a colorless oil (450.3 mg, 79%). Compound K7-025 (compound 8) was prepared from compound 7 (259 mg, 0.45 mmol, 80% yield in 2 steps) according to the procedure shown in the diagram above. The synthesis of compound K7-025 was confirmed by NMR and HRMS.

[0366] 1H NMR (400 MHz, CDCl3) δ 8.07 (s, 1H), 7.94 - 7.88 (m, 2H), 7.58 (d, J = 8.7 Hz, 1H), 7.23 (d, J = 8.7 Hz, 1H), 7.13 - 7.20 (m, 2H), 3.85 (dd, J = 7.5, 3.3 Hz, 2H), 2.68 (q, J = 7.0 Hz, 4H), 1.82 - 1.97 (m, 4H), 1.73 - 1.82 (m, 1H), 1.23 (dqd, J = 24.3, 13.3, 5.0 Hz, 10H), 0.84 (dt, J = 9.6, 7.0 Hz, 7H); 13 C{ 1 H} NMR (100 MHz, CDCl3) δ 170.9, 142.5, 138.8, 138.8, 131.7, 127.8, 126.8, 124.3, 118.9, 118.8, 118.2, 111.3, 109.5, 47.5, 40.3, 30.8, 28.7, 24.1, 23.1, 23.0, 22.8, 22.6, 20.8, 14.0, 10.9; HRMS (ESI), m / z calcd for C 27 H 35 N2O4S [M+H] + 483.2312, found 483.2312.

[0367] [Examples 1-4] Preparation of Compound K6-001

[0368]

[0369] Compound K6-001 was synthesized by a conventional method according to the route shown below in a yield of 55%.

[0370]

[0371] The data for compound K6-001 are as follows: Molecular weight: 362.43, LRMS (ESI) [M+H] + : 363.1763

[0372] [Example 1-5] Preparation of compound K7-034

[0373]

[0374] K7-034 was synthesized by a conventional method according to the route shown below.

[0375]

[0376] The data for compound K7-034 are as follows: Molecular weight: 334.38, LRMS (ESI) [M+H] + : 335.1340

[0377] [Example 1-6] Preparation of compound K9-030

[0378]

[0379] Compound K9-030 was synthesized in a standard manner according to the route shown below in a yield of 74%.

[0380]

[0381] The data for compound K9-030 are as follows: Molecular weight: 383.466 1 H NMR (400 MHz, DMSO-d6) δ 11.22 (s, 1H), 10.36 (s, 1H), 8.19 (q, J = 4.4 Hz, 1H), 7.85 (s, 1H), 7.60 - 7.66 (m, 2H), 7.41 (dd, J = 8.8, 2.0 Hz, 1H), 7.33 (d, J = 8.8 Hz, 1H), 7.10 - 7.16 (m, 2H), 2.70 (d, J = 4.4 Hz, 4H), 2.58 - 2.69 (m, 4H), 1.74 - 1.87 (m, 4H).

[0382] [Example 1-7] Preparation of compound K24-023

[0383]

[0384] Compound K24-023 was synthesized using known materials and conventional methods along the route shown below.

[0385]

[0386] The synthesis of compound K24-023 was confirmed by NMR.

[0387] 1 H NMR (400 MHz, CDCl3) δ 8.06 (d, J = 1.6 Hz, 1H), 7.89 - 7.95 (m, 2H), 7.54 - 7.61 (m, 1H), 7.21 - 7.29 (m, 1H), 7.24 (d, J = 8.4 Hz, 1H), 7.13 - 7.18 (m, 2H), 3.92 - 4.01 (m, 2H), 2.64 - 2.73 (m, 4H), 1.80 - 1.98 (m, 4H), 1.60 - 1.73 (m, 2H), 1.17 - 1.34 (m, 10H), 0.77 - 0.91 (m, 3H).

[0388] [Example 1-8] Preparation of compound K25-012

[0389]

[0390] Compound K25-012 was synthesized using known materials and conventional methods along the route shown below.

[0391]

[0392] The synthesis of compound K25-012 was confirmed by NMR.

[0393] 1 H NMR (400 MHz, CDCl3) δ 8.05 (s, 1H), 7.89 - 7.95 (m, 2H), 7.55 - 7.60 (m, 1H), 7.08 - 7.21 (m, 4H), 4.07 - 3.95 (m, 2H), 2.61 - 2.77 (m, 4H), 1.99 - 2.10 (m, 7H), 1.80 - 1.90 (m, 6H), 1.46 - 1.69 (m, 6H), 1.23 - 1.35 (m, 2H).

[0394] [Examples 1-9] Preparation of compound K25-013

[0395]

[0396] Compound K25-013 was synthesized using known materials and conventional methods along the route shown below.

[0397]

[0398] The synthesis of compound K25-013 was confirmed by NMR.

[0399] 1 H NMR (400 MHz, CDCl3) δ 8.04 (d, J = 1.6 Hz, 1H), 7.89 - 7.95 (m, 2H), 7.55 (dd, J = 8.8, 2.0 Hz, 1H), 7.29 (d, J = 8.8 Hz, 1H), 7.22 (s, 1H), 7.16 (d, J = 8.8 Hz, 2H), 3.74 (s, 2H), 2.60 - 2.77 (m, 4H), 1.89 - 2.09 (m, 14H), 1.55 - 1.64 (m, 2H), 1.49 - 1.54 (m, 4H).

[0400] [Example 1-10] Preparation of compound K25-018

[0401]

[0402] Compound K25-018 was synthesized using known materials and conventional methods along the route shown below.

[0403]

[0404] The synthesis of compound K25-018 was confirmed by NMR.

[0405] 1H NMR (400 MHz, CDCl3) δ 8.02 (d, J = 2.0 Hz, 1H), 7.90 - 7.95 (m, 2H), 7.52 (dd, J = 8.8, 2.0 Hz, 1H), 7.22 (d, J = 8.4 Hz, 1H), 7.13 - 7.17 (m, 2H), 7.02 (s, 1H), 3.80 - 3.92 (m, 2H), 2.82 - 2.88 (m, 4H), 2.49 - 2.59 (m, 2H), 1.77 - 1.86 (m, 1H), 1.15 - 1.34 (m, 8H), 0.78 - 0.92 (m, 6H).

[0406] [Example 1-11] Preparation of compound K28-039

[0407]

[0408] Compound K28-039 was synthesized using known materials and conventional methods along the route shown below.

[0409]

[0410] The synthesis of compound K28-039 was confirmed by NMR.

[0411] 1 H NMR (400 MHz, CDCl3) δ 10.45 (s, 1H), 8.23 ​​(s, 1H), 8.11 (s, 1H), 7.80 - 7.85 (m, 1H), 7.71 (d, J = 8.0 Hz, 1H), 7.63 (d, J = 8.8 Hz, 1H), 7.48 - 7.54 (m, 2H), 7.39 - 7.45 (m, 2H), 7.32 - 7.36 (m, 1H), 7.21 - 7.25 (m, 2H), 3.75 - 3.91 (m, 2H), 2.59 - 2.75 (m, 4H), 1.70 - 1.96 (m, 5H), 1.09 - 1.36 (m, 8H), 0.72 - 0.91 (m, 6H).

[0412] [Example 1-12] Preparation of compound K29-013

[0413]

[0414] Compound K29-013 was synthesized using known materials and conventional methods along the route shown below.

[0415]

[0416] The synthesis of compound K29-013 was confirmed by NMR.

[0417] 1 H NMR (400 MHz, CDCl3) δ 7.96 - 7.92 (m, 1H), 7.90 (d, J = 2.0 Hz, 1H), 7.83 (d, J = 8.8 Hz, 1H), 7.79 (s, 1H), 7.33 - 7.45 (m, 4H), 7.22 (d, J = 8.8 Hz, 1H), 6.90 - 6.97 (m, 2H), 6.84 (s, 1H), 3.81 - 3.93 (m, 2H), 2.61 - 2.74 (m, 4H), 1.75 - 1.99 (m, 5H), 1.11 - 1.36 (m, 8H), 0.75 - 0.92 (m, 6H).

[0418] [Example 1-13] Preparation of compound K29-026

[0419]

[0420] Compound K29-026 was synthesized using known materials and conventional methods along the route shown below.

[0421]

[0422] The synthesis of compound K29-026 was confirmed by NMR.

[0423] 1H NMR (400 MHz, CDCl3) δ 10.60 (s, 1H), 8.08 (d, J = 1.6 Hz, 1H), 7.82 (d, J = 8.8 Hz, 1H), 7.60 (dd, J = 8.8, 2.0 Hz, 1H), 7.23 (d, J = 8.8 Hz, 1H), 7.11 (d, J = 2.8 Hz, 1H), 6.41 (dd, J = 9.2, 2.4 Hz, 1H), 3.82 - 3.91 (m, 2H), 3.80 (t, J = 5.2 Hz, 4H), 3.27 (t, J = 5.2 Hz, 4H), 2.62 - 2.73 (m, 4H), 1.74 - 1.96 (m, 5H), 1.13 - 1.34 (m, 8H), 0.75 - 0.92 (m, 6H).

[0424] [Example 1-14] Preparation of compound K29-027

[0425]

[0426] Compound K29-027 was synthesized using known materials and conventional methods along the route shown below.

[0427]

[0428] The synthesis of compound K29-027 was confirmed by NMR.

[0429] 1 H NMR (400 MHz, CDCl3) δ 10.38 (s, 1H), 8.07 (d, J = 2.4 Hz, 1H), 8.05 (d, J = 2.4 Hz, 1H), 7.65 (d, J = 8.8 Hz, 1H), 7.56 (dd, J = 8.8, 2.0 Hz, 1H), 7.53 (dd, J = 8.8, 2.4 Hz, 1H), 7.23 (d, J = 8.8 Hz, 1H), 3.78 - 3.93 (m, 2H), 2.62 - 2.75 (m, 4H), 1.74 - 1.98 (m, 5H), 1.13 - 1.35 (m, 8H), 0.77 - 0.92 (m, 6H).

[0430] [Example 1-15] Preparation of compound K29-030

[0431]

[0432] Compound K29-030 was synthesized using known materials and conventional methods along the route shown below.

[0433]

[0434] The synthesis of compound K29-030 was confirmed by NMR.

[0435] 1 H NMR (400 MHz, CDCl3) δ 10.37 (s, 1H), 8.11 (d, J = 2.0 Hz, 1H), 7.80 (d, J = 2.0 Hz, 1H), 7.74 (d, J = 8.4 Hz, 1H), 7.63 (dd, J = 8.8, 2.0 Hz, 1H), 7.30 (dd, J = 8.4, 2.0 Hz, 1H), 7.24 (d, J = 8.8 Hz, 1H), 7.03 (s, 2H), 3.82 - 3.94 (m, 2H), 2.88 - 2.96 (m, 1H), 2.64 - 2.75 (m, 4H), 2.42 - 2.52 (m, 2H), 1.75 - 1.98 (m, 5H), 1.17 - 1.35 (m, 14H), 0.98 - 1.06 (m, 12H), 0.76 - 0.92 (m, 6H).

[0436] [Example 1-16] Preparation of compound K29-035

[0437]

[0438] Compound K29-035 was synthesized using known materials and conventional methods along the route shown below.

[0439]

[0440] The synthesis of compound K29-035 was confirmed by NMR.

[0441] 1H NMR (400 MHz, CDCl3) δ 10.48 (s, 1H), 8.09 (d, J = 2.0 Hz, 1H), 7.96 - 8.03 (m, 2H), 7.59 - 7.60 (m, 1H), 7.55 (dd, J = 8.8, 2.0 Hz, 2H), 7.19 (d, J = 8.8 Hz, 1H), 6.89 (s, 2H), 6.75 - 6.81 (m, 2H), 3.78 - 3.92 (m, 2H), 2.59 - 2.76 (m, 4H), 2.33 (s, 3H), 1.72 - 1.97 (m, 11H), 1.11 - 1.37 (m, 8H), 0.77 - 0.91 (m, 6H).

[0442] [Example 1-17] Preparation of compound K29-036

[0443]

[0444] Compound K29-036 was synthesized using known materials and conventional methods along the route shown below.

[0445]

[0446] The synthesis of compound K29-036 was confirmed by NMR.

[0447] 1 H NMR (400 MHz, CDCl3) δ 10.51 (s, 1H), 7.98 - 8.05 (m, 2H), 7.66 (d, J = 1.6 Hz, 1H), 7.51 - 7.56 (m, 1H), 7.18 (d, J = 8.4 Hz, 1H), 7.02 (s, 2H), 6.87 (dd, J = 8.0, 1.6 Hz, 1H), 3.78 - 3.92 (m, 2H), 2.88 - 2.99 (m, 1H), 2.55 - 2.72 (m, 4H), 2.31 - 2.44 (m, 2H), 1.71 - 1.96 (m, 5H), 1.12 - 1.35 (m, 14H), 0.90 - 1.05 (m, 12H), 0.77 - 0.91 (m, 6H).

[0448] [Example 1-18] Preparation of compound K30-031

[0449]

[0450] Compound K30-031 was synthesized using known materials and conventional methods along the route shown below.

[0451]

[0452] The synthesis of compound K30-031 was confirmed by NMR.

[0453] 1 H NMR (400 MHz, CDCl3) δ 10.36 (s, 1H), 8.08 (d, J = 2.4 Hz, 1H), 8.06 (d, J = 2.0 Hz, 1H), 7.66 (d, J = 8.8 Hz, 1H), 7.56 (dd, J = 8.8, 2.0 Hz, 1H), 7.53 (dd, J = 8.8, 2.4 Hz, 1H), 7.23 (d, J = 8.8 Hz, 1H), 3.79 - 3.92 (m, 2H), 2.64 - 2.74 (m, 4H), 1.73 - 1.96 (m, 5H), 1.13 - 1.36 (m, 18H), 0.75 - 0.92 (m, 6H).

[0454] [Example 1-19] Preparation of compound K24-037

[0455]

[0456] Compound K24-037 was synthesized using known materials and conventional methods along the route shown below.

[0457]

[0458] The synthesis of compound K24-037 was confirmed by NMR.

[0459] 1H NMR (400 MHz, CDCl3) δ 10.35 (s, 1H), 8.05 (d, J = 1.6 Hz, 1H), 7.92 (s, 1H), 7.68 - 7.75 (m, 1H), 7.56 (d, J = 8.8 Hz, 1H), 7.40 (d, J = 8.8 Hz, 1H), 7.22 (d, J = 8.8 Hz, 1H), 3.78 - 3.92 (m, 2H), 2.62 - 2.75 (m, 4H), 1.73 - 1.97 (m, 5H), 1.12 - 1.35 (m, 8H), 0.85 (m, 6H).

[0460] [Example 1-20] to [Example 1-] In the same manner as in the above synthesis examples, the following indole derivatives or tetrahydrocarbazole derivatives of the present invention were also synthesized.

[0461] [Example 1-20] Preparation of compound K1-032

[0462]

[0463] Molecular weight: 384.45, LRMS (ESI) [M+H] + : 385.1165

[0464] [Example 1-21] Preparation of compound K2-004

[0465]

[0466] Molecular weight: 412.504 1H NMR (400 MHz, DMSO-d6) δ 11.27 (s, 1H), 10.60 (s, 1H), 7.92 (s, 1H), 7.75 - 7.80 (m, 2H), 7.42 (dd, J = 8.4, 1.6 Hz, 1H), 7.34 (d, J = 8.4 Hz, 1H), 7.20 - 7.25 (m, 2H), 4.22 (q, J = 7.2 Hz, 2H), 2.72 - 2.83 (m, 4H), 1.81 - 1.84 (m, 2H), 1.60 - 1.76 (m, 5H), 1.25 (t, J = 7.2 Hz, 3H)

[0467] [Example 1-22] Production of compound K1-036

[0468]

[0469] Molecular weight: 426.53, LRMS (ESI) [M+Na] + : 449.2808

[0470] [Example 1-23] Production of compound K4-036

[0471]

[0472] Molecular weight: 356.396 1 H NMR (400 MHz, DMSO-d6) δ 11.40 (s, 1H), 10.56 (s, 1H), 7.86 (s, 1H), 7.74 - 7.77 (m, 2H), 7.43 (dd, J = 8.8, 2.0 Hz, 1H), 7.39 (d, J = 8.8 Hz, 1H), 7.16 - 7.21 (m, 2H), 2.78 (m, 4H), 2.44 - 2.50 (m, 2H).

[0473] [Example 1-24] Production of compound K4-038

[0474]

[0475] Molecular weight: 384.45 1H NMR (400 MHz, DMSO-d6) δ 12.62 (s, 1H), 11.27 (s, 1H), 10.55 (s, 1H), 7.91 (s, 1H), 7.72 - 7.78 (m, 2H), 7.42 (dd, J = 8.8, 2.0 Hz, 1H), 7.33 (d, J = 8.8 Hz, 1H), 7.16 - 7.22 (m, 2H), 2.72 - 2.82 (m, 4H), 1.81 - 1.84 (m, 2H), 1.66 - 1.70 (m, 4H).

[0476] [Example 1-25] Production of compound K5-010

[0477]

[0478] Molecular weight: 398.477 1 H NMR (400 MHz, DMSO-d6) δ 11.26 (s, 1H), 10.52 (s, 1H), 7.91 (s, 1H), 7.72 - 7.78 (m, 2H), 7.42 (dd, J = 8.8, 2.0 Hz, 1H), 7.35 (d, J = 8.4 Hz, 1H), 7.17 - 7.23 (m, 2H), 2.74 - 2.85 (m, 4H), 1.56 - 1.74 (m, 4H), 1.26 - 1.43 (m, 4H).

[0479] [Example 1-26] Production of compound K2-011

[0480]

[0481] Molecular weight: 412.50, LRMS (ESI) [M+H] + : 413.1516

[0482] [Example 1-27] Production of compound K2-017

[0483]

[0484] Molecular weight: 412.50, LRMS (ESI) [M+H]+: 413.2653

[0485] Example 1-28: Preparation of compound K9-033

[0486]

[0487] Molecular weight: 452.57, LRMS (ESI) [M+H] + : 453.1757

[0488] Example 1-29: Preparation of compound K8-004

[0489]

[0490] Molecular weight: 455.53, LRMS (ESI) [M+H] + : 456.1575

[0491] [Example 1-30] Preparation of compound K9-036

[0492]

[0493] Molecular weight: 428.50, LRMS (ESI) [M+H] + : 429.1399

[0494] [Example 1-31] ​​Preparation of compound K5-024

[0495]

[0496] Molecular weight: 412.504 1H NMR (400 MHz, DMSO-d6) δ 11.24 (s, 1H), 10.54 (s, 1H), 7.88 (s, 1H), 7.72 - 7.77 (m, 2H), 7.44 (dd, J = 8.4, 2.0 Hz, 1H), 7.35 (d, J = 8.4 Hz, 1H), 7.16 - 7.21 (m, 2H), 2.78 (td, J = 13.8, 5.8 Hz, 2H), 2.71 (d, J = 7.4 Hz, 3H), 2.19 (dd, J = 15.6, 9.6 Hz, 1H), 1.90 - 2.01 (m, 2H), 1.64 - 1.80 (m, 2H), 1.34 - 1.53 (m, 8H), 0.87 - 0.98 (m, 5H).

[0497] [Example 1-32] Production of compound K5-026

[0498]

[0499] Molecular weight: 426.531 1 H NMR (400 MHz, DMSO-d6) δ 11.22 (s, 1H), 10.52 (s, 1H), 7.91 (d, J = 2.0 Hz, 1H), 7.73 - 7.77 (m, 2H), 7.42 (d, J = 7.6 Hz, 1H), 7.34 (d, J = 8.8 Hz, 1H), 7.16 - 7.21 (m, 2H), 2.60 - 2.86 (m, 3H), 2.24 - 2.38 (m, 1H), 2.01 - 2.12 (m, 1H), 0.98 (s, 9H).

[0500] [Example 1-33] Production of compound K5-025

[0501]

[0502] Molecular weight: 412.504 1H NMR (400 MHz, CDCl3) δ 8.05 (s, 1H), 7.89 - 7.95 (m, 2H), 7.55 - 7.60 (m, 1H), 7.08 - 7.21 (m, 4H), 4.07 - 3.95 (m, 2H), 2.61 - 2.77 (m, 4H), 1.99 - 2.10 (m, 7H), 1.80 - 1.90 (m, 6H), 1.46 - 1.69 (m, 6H), 1.23 - 1.35 (m, 2H).

[0503] [Example 1-34] Production of compound K2-002

[0504]

[0505] Molecular weight: 358.41 1 H NMR (400 MHz, DMSO-d6) δ 11.46 (s, 1H), 10.62 (s, 1H), 7.96 (s, 1H), 7.74 - 7.79 (m, 2H), 7.45 (dd, J = 8.4, 1.6 Hz, 1H), 7.38 (d, J = 8.4 Hz, 1H), 7.18 - 7.24 (m, 2H), 6.30 (s, 1H), 4.21 (q, J = 7.2 Hz, 2H), 2.38 (s, 3H), 1.25 (t, J = 7.2 Hz, 3H).

[0506] [Example 1-35] Production of compound K2-003

[0507]

[0508] Molecular weight: 372.44 1H NMR (400 MHz, DMSO-d6) δ 11.25 (s, 1H), 10.60 (s, 1H), 7.91 (s, 1H), 7.74 - 7.80 (m, 2H), 7.43 (dd, J = 8.8, 2.0 Hz, 1H), 7.33 (d, J = 8.4 Hz, 1H), 7.20 - 7.25 (m, 2H), 4.22 (q, J = 7.2 Hz, 2H), 2.31 (s, 3H), 2.16 (s, 3H), 1.25 (t, J = 7.2 Hz, 3H).

[0509] [Example 1-36] Production of compound K6-023

[0510]

[0511] Molecular weight: 414.52, LRMS (ESI) [M+H] + : 415.1659

[0512] [Example 1-37] Production of compound K7-004

[0513]

[0514] Molecular weight: 384.466 1 H NMR (400 MHz, CDCl3) δ 8.07 (s, 1H), 7.98 (s, 1H), 7.92 (d, J = 8.4 Hz, 2H), 7.54 (d, J = 8.8 Hz, 1H), 7.28 (d, J = 8.8 Hz, 1H), 7.15 (d, J = 8.4 Hz, 2H), 6.81 (s, 1H), 2.70 (t, J = 7.6 Hz, 4H), 1.67 (t, J = 7.8 Hz, 3H), 1.17 (t, J = 7.6 Hz, 3H), 0.99 (t, J = 7.5 Hz, 3H).

[0515] [Example 1-38] Production of compound K3-013

[0516]

[0517] Molecular weight: 420.48, LRMS (ESI) [M+H] + : 421.1238

[0518] Example 1-39: Preparation of compound K6-022

[0519]

[0520] Molecular weight: 490.62, LRMS (ESI) [M+H] + : 491.1965

[0521] [Example 1-40] Preparation of compound K5-014-2

[0522]

[0523] Molecular weight: 452.50, LRMS (ESI) [M+H] + : 453.1276

[0524] [Example 1-41] Preparation of compound K7-003

[0525]

[0526] Molecular weight: 462.56, LRMS (ESI) [M+H] + : 463.1611

[0527] [Example 1-42] Preparation of compound K5-028

[0528]

[0529] Molecular weight: 424.446 1H NMR (400 MHz, DMSO-d6) δ 11.75 (s, 1H), 10.62 (s, 1H), 8.08 (s, 1H), 7.74 - 7.79 (m, 2H), 7.73 - 7.65 (m, 3H), 7.54 (dd, J = 8.8, 2.0 Hz, 1H), 7.46 (d, J = 8.8 Hz, 1H), 7.40 (s, 1H), 7.34 - 7.39 (m, 2H), 7.19 - 7.25 (m, 2H), 2.39 (s, 3H).

[0530] [Example 1-43] Preparation of compound K18-036

[0531]

[0532] Molecular weight: 412.50

[0533] [Example 1-44] Preparation of compound K18-037

[0534]

[0535] Molecular weight: 426.53, LRMS (ESI) [M+H] + : 427.1589

[0536] Example 1-45: Preparation of compound K20-010

[0537]

[0538] Molecular weight: 440.56, LRMS (ESI) [M+H] + : 441.1747

[0539] [Example 1-46] Preparation of compound K19-034

[0540]

[0541] Molecular weight: 454.59, LRMS (ESI) [M+H] + : 455.1884

[0542] [Example 1-47] Preparation of compound K19-033

[0543]

[0544] Molecular weight: 494.65, LRMS (ESI) [M+H] + : 495.2184

[0545] Example 1-48: Preparation of compound K20-016-3

[0546]

[0547] Molecular weight: 454.54, LRMS (ESI) [M+H] + : 455.1532

[0548] [Example 1-49] Preparation of compound K19-037

[0549]

[0550] Molecular weight: 384.45, LRMS (ESI) [M+H] + : 385.1123

[0551] [Example 1-50] Preparation of compound K19-038

[0552]

[0553] Molecular weight: 398.48, LRMS (ESI) [M+H] + : 399.1278

[0554] [Example 1-51] Preparation of compound K20-022

[0555]

[0556] Molecular weight: 412.50, LRMS (ESI) [M+H] + : 413.1417

[0557] [Example 1-52] Preparation of compound K20-013

[0558]

[0559] Molecular weight: 426.53, LRMS (ESI) [M+H] + : 427.1585

[0560] [Example 1-53] Preparation of compound K20-012

[0561]

[0562] Molecular weight: 466.60, LRMS (ESI) [M+H] + : 467.1883

[0563] [Example 1-54] Preparation of compound K21-004

[0564]

[0565] 1 H NMR (400 MHz, CDCl3) δ 8.38 (s, 1H), 8.08 (d, J = 8.8 Hz, 2H), 8.04 (s, 1H), 7.79 (d, J = 8.8 Hz, 2H), 7.68 (d, J = 8.8 Hz, 1H), 7.31 (d, J = 8.8 Hz, 1H), 3.84 - 3.97 (m, 2H), 2.68 - 3.96 (m, 4H), 1.80 - 2.01 (m, 5H), 1.40 - 1.18 (m, 8H), 0.87 - 0.94 (m, 6H).

[0566] Example 1-55: Preparation of compound K27-015

[0567]

[0568] 1 ​​H NMR (400 MHz, CDCl3) δ 9.83 (s, 1H), 8.05 (s, 1H), 8.01 (s, 1H), 7.89 (d, J = 9.2 Hz, 1H), 7.54 (d, J = 8.8, Hz, 1H), 7.48 (d, J = 9.2, Hz, 1H), 7.24 (d, J = 8.8 Hz, 4H), 3.79 - 3.92 (m, 2H), 2.65 - 2.74 (m, 4H), 1.83 - 1.97 (m, 4H), 1.74 - 1.82 (m, 1H), 1.19 - 1.35 (m, 8H), 0.80 - 0.91 (m, 6H).

[0569] [Example 1-56] Production of compound K27-020

[0570]

[0571] 1 H NMR (400 MHz, CDCl3) δ 10.43 (s, 1H), 8.08 (s, 1H), 7.98 (d, J = 8.0 Hz, 1H), 7.74 (d, J = 8.4 Hz, 1H), 7.59 (d, J = 8.8 Hz, 1H), 7.46 (dd, J = 8.8, 8.4 Hz, 1H), 7.22 (d, J = 8.8 Hz, 1H), 7.01 (dd, J = 8.4, 8.0 Hz, 1H), 3.77 - 3.90 (m, 2H), 2.68 (dt, J = 14.8, 6.0 Hz, 4H), 1.81 - 1.92 (m, 4H), 1.75 - 1.80 (m, J 1H), 1.10 - 1.35 (m, 8H), 0.76 - 0.91 (m, 6H).

[0572] [Example 1-57] Production of compound K27-029

[0573]

[0574] 1 ​​H NMR (400 MHz, CDCl3) δ 10.39 (s, 1H), 8.26 (s, 1H), 8.06 (s, 1H), 7.70 (d, J = 8.8 Hz, 1H), 7.57 (d, J = 8.8 Hz, 1H), 7.52 (d, J = 8.8 Hz, 1H), 7.23 (d, J = 8.8 Hz, 1H), 3.80 - 3.92 (m, 2H), 2.69 (dt, J = 14.0, 6.0 Hz, 4H), 1.81 - 1.96 (m, 5H), 1.76 - 1.81 (m, 1H), 1.17 - 1.31 (m, 8H), 0.78 - 0.93 (m, 6H).

[0575] [Example 1-58] Production of compound K27-035

[0576]

[0577] 1 H NMR (400 MHz, CDCl3) δ 10.13 (s, 1H), 8.02 (s, 1H), 7.76 (dd, J = 9.2, 4.8 Hz, 1H), 7.62 (dd, J = 88, 3.2 Hz, 1H), 7.53 (d, J = 8.8 Hz, 1H), 7.17 - 7.24 (m, 2H), 3.78 - 3.91 (m, 2H), 2.68 (q, J = 7.2 Hz, 4H), 1.75 - 1.94 (m, 5H), 1.14 - 1.34 (m, 8H), 0.84 (m, 6H).

[0578] [Example 1-59] Production of compound K30-013

[0579]

[0580] 1 ​​H NMR (400 MHz, CDCl3) δ 9.96 (s, 1H), 7.99 (d, J = 2.0 Hz, 1H), 7.71 (d, J = 9.2 Hz, 1H), 7.49 (dd, J = 8.8, 2.0 Hz, 1H), 7.41 (d, J = 2.8 Hz, 1H), 7.18 (d, J = 8.8 Hz, 1H), 7.07 (dd, J = 9.2, 3.2 Hz, 1H), 3.81 - 3.87 (m, 2H), 3.77 (s, 3H), 2.67 (q, J = 6.4 Hz, 4H), 1.72 - 1.93 (m, 5H), 1.11 - 1.34 (m, 8H), 0.78 - 0.91 (m, 6H).

[0581] [Example 1-60] Production of compound K22-013

[0582]

[0583] 1 H NMR (400 MHz, CDCl3) δ 7.91 (d, J = 2.0 Hz, 1H), 7.42 (dd, J = 8.8, 2.0 Hz, 1H), 7.20 (d, J = 8.4 Hz, 1H), 6.70 (d, J = 2.4 Hz, 1H), 6.64 (d, J = 8.4 Hz, 1H), 6.49 (dd, J = 8.4, 2.4 Hz, 1H), 6.30 (s, 1H), 3.82 - 3.92 (m, 2H), 3.79 (s, 3H), 3.73 (s, 3H), 2.68 (q, J = 6.4 Hz, 4H), 1.74 - 1.98 (m, 5H), 1.13 - 1.36 (m, 8H), 0.86 (tt, J = 7.2, 6.8 Hz, 6H).

[0584] [Example 1-61] Production of compound K23-007

[0585]

[0586] 1 ​​H NMR (400 MHz, CDCl3) δ 8.99 (d, J = 2.0 Hz, 1H), 8.15 (dd, J = 9.2, 2.4 Hz, 1H), 8.11 (d, J = 2.0 Hz, 1H), 7.62 (dd, J = 8.8, 2.0 Hz, 1H), 7.45 (d, J = 8.8 Hz, 1H), 7.24 (d, J = 8.7 Hz, 1H), 3.79 - 3.93 (m, 5H), 2.70 (tt, J = 13.4, 6.1 Hz, 4H), 1.73 - 1.98 (m, 5H), 1.12 - 1.36 (m, 8H), 0.79 - 0.91 (m, 6H).

[0587] [Example 1-62] Production of compound K23-008

[0588]

[0589] 1 H NMR (400 MHz, CDCl3) δ 8.05 (d, J = 2.0 Hz, 1H), 7.79 (dd, J = 8.4, 1.6 Hz, 1H), 7.71 (dd, J = 8.0 Hz, 1H), 7.65 (dd, J = 10.8, 2.0 Hz, 1H), 7.57 (dd, J = 8.8, 2.0 Hz, 1H), 7.24 (d, J = 8.8 Hz, 1H), 7.15 (d, J = 3.6 Hz, 1H), 3.79 - 3.92 (m, 2H), 2.69 (tt, J = 12.4, 6.4 Hz, 4H), 1.71 - 1.97 (m, 5H), 1.12 - 1.36 (m, 10H), 0.77 - 0.92 (m, 7H).

[0590] [Example 1-63] Production of compound K27-007

[0591]

[0592] 1 ​​H NMR (400 MHz, CDCl3) δ 7.89 (d, J = 1.6 Hz, 1H), 7.76 (dd, J = 8.0, 1.6 Hz, 1H), 7.59 (dd, J = 8.0, 1.2 Hz, 1H), 7.41 (dd, J = 8.4, 2.0 Hz, 1H), 7.15 - 7.23 (m, 2H), 6.61 (s, 1H), 3.81 - 3.93 (m, 2H), 2.67 (tt, J = 11.2, 5.6 Hz, 4H), 2.24 (s, 3H), 1.76 - 1.97 (m, 5H), 1.12 - 1.35 (m, 8H), 0.89 - 0.92 (m, 6H).

[0593] [Example 1-64] Production of compound K27-008

[0594]

[0595] 1 H NMR (400 MHz, CDCl3) δ 10.46 (s, 1H), 8.09 (d, J = 1.6 Hz, 1H), 7.98 (d, J = 2.0 Hz, 1H), 7.80 (d, J = 8.4 Hz, 1H), 7.61 (dd, J = 8.8, 2.0 Hz, 1H), 7.25 (d, J = 7.6 Hz, 1H), 7.11 (dd, J = 8.8, 2.0 Hz, 1H), 3.79 - 3.92 (m, 2H), 2.63 - 2.78 (m, 4H), 1.72 - 1.97 (m, 5H), 1.12 - 1.35 (m, 8H), 0.77 - 0.92 (m, 6H).

[0596] [Example 1-65] Production of compound K27-010

[0597]

[0598] 1 ​​H NMR (400 MHz, CDCl3) δ 8.25 (s, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.55 (dd, J = 8.0, 2.0 Hz, 2H), 7.22 (d, J = 8.0 Hz, 1H), 7.08 (dd, J = 8.8, 2.0 Hz, 1H), 7.02 (d, J = 8.8 Hz, 1H), 3.67 - 3.80 (m, 2H), 2.66 (s, 3H), 2.54 (tt, J = 11.6, 6.0 Hz, 4H), 1.63 - 1.80 (m, 5H), 1.06 - 1.35 (m, 8H), 0.75 - 0.92 (m, 6H).

[0599] [Example 1-66] Production of compound K27-011

[0600]

[0601] 1 H NMR (400 MHz, CDCl3) δ 8.01 (d, J = 1.6 Hz, 1H), 7.84 (dd, J = 8.4, 2.0 Hz, 1H), 7.77 (s, 1H), 7.49 - 7.57 (m, 2H), 7.22 (d, J = 8.8 Hz, 1H), 6.73 (s, 1H), 3.78 - 3.93 (m, 2H), 2.63 - 2.75 (m, 4H), 2.11 (s, 3H), 1.73 - 1.98 (m, 5H), 1.11 - 1.35 (m, 8H), 0.77 - 0.93 (m, 6H).

[0602] [Example 1-67] Production of compound K23-019

[0603]

[0604] 1 ​​H NMR (400 MHz, CDCl3) δ 8.42 (d, J = 2.0 Hz, 1H), 8.06 (d, J = 2.0 Hz, 1H), 7.67 (dd, J = 8.0, 2.0 Hz, 1H), 7.57 (dd, J = 8.8, 2.0 Hz, 1H), 7.31 (d, J = 8.4 Hz, 1H), 7.24 (d, J = 8.8 Hz, 1H), 7.16 (s, 1H), 3.80 - 3.92 (m, 2H), 2.69 (tt, J = 12.8, 6.4 Hz, 4H), 1.74 - 1.97 (m, 5H), 1.13 - 1.35 (m, 8H), 0.76 - 0.92 (m, 6H).

[0605] [Example 1-68] Production of compound K27-024

[0606]

[0607] 1 H NMR (400 MHz, CDCl3) δ 8.06 (d, J = 2.0 Hz, 1H), 7.88 (d, J = 8.4 Hz, 1H), 7.57 (dd, J = 8.8, 2.0 Hz, 1H), 7.35 (s, 1H), 7.20 - 7.26 (m, 2H), 7.07 (dd, J = 8.8, 2.4 Hz, 1H), 3.80 - 3.93 (m, 2H), 2.70 (tt, J = 12.0, 6.0 Hz, 4H), 1.72 - 1.98 (m, 5H), 1.12 - 1.35 (m, 8H), 0.75 - 0.94 (m, 6H).

[0608] [Example 1-69] Production of compound K27-025

[0609]

[0610] 1 ​​H NMR (400 MHz, CDCl3) δ 8.05 (d, J = 2.0 Hz, 1H), 7.96 (d, J = 2.0 Hz, 1H), 7.87 (dd, J = 8.4, 2.0 Hz, 1H), 7.73 (d, J = 8.8 Hz, 1H), 7.57 (dd, J = 8.8, 2.0 Hz, 1H), 7.41 (s, 1H), 7.24 (d, J = 8.8 Hz, 1H), 3.80 - 3.92 (m, 2H), 2.69 (tt, J = 12.6, 6.4 Hz, 4H), 1.74 - 1.97 (m, 5H), 1.12 - 1.35 (m, 8H), 0.75 - 0.93 (m, 6H).

[0611] [Example 1-70] Production of compound K27-026

[0612]

[0613] 1 H NMR (400 MHz, CDCl3) δ 8.12 (d, J = 2.0 Hz, 1H), 8.04 (d, J = 2.0 Hz, 1H), 7.90 (dd, J = 8.8, 2.0 Hz, 1H), 7.72 (d, J = 8.8 Hz, 1H), 7.56 (dd, J = 8.4, 2.0 Hz, 1H), 7.41 (s, 1H), 7.24 (d, J = 8.8 Hz, 1H), 3.80 - 3.92 (m, 2H), 2.69 (tt, J = 12.4, 6.0 Hz, 4H), 1.73 - 1.78 (m, 5H), 1.12 - 1.35 (m, 8H), 0.75 - 0.92 (m, 6H).

[0614] [Example 1-71] Production of compound K30-036

[0615]

[0616] 1 ​​H NMR (400 MHz, CDCl3) δ 8.00 (d, J = 1.6 Hz, 1H), 7.71 (s, 1H), 7.66 (d, J = 8.8 Hz, 1H), 7.51 (dd, J = 8.8, 2.0 Hz, 1H), 7.23 - 7.29 (m, 1H), 7.19 (d, J = 8.8 Hz, 1H), 3.77 - 3.90 (m, 2H), 3.07 - 3.21 (m, 4H), 2.67 (q, J = 6.4 Hz, 4H), 1.74 - 1.94 (m, 9H), 1.11- 1.36 (m, 8H), 0.78 - 0.92 (m, 6H).

[0617] Example 2 Measurement of HCV production inhibitory activity of the compounds of the present invention The HCV production inhibitory activity of the compounds of the present invention was measured. The materials and methods used for the measurement are described in the section "Confirmation of HCV inhibitory activity" in this specification as "An example of a specific method for confirming HCV inhibitory activity," and are also as described in the section "Confirmation of Hepatitis C virus inhibitory activity of compounds with inhibitory activity against NS2-SPCS1 interaction" in this Example (the administration concentration of the test compound was 10 μM). In addition, for some examples of the compounds produced in Example 1, tests were conducted at multiple administration concentrations (specifically, 0.63, 1.25, 2.5, 5, and 10 μM; 0.1, 1, and 10 μM; or 1, 3, and 10 μM; N=3 for each concentration), and the EC 2000 values ​​for HCV production inhibitory activity were calculated. ５０ The inhibitory activity of the compound of the present invention was evaluated by calculating the inhibitory activity against HCV production (the amount of HCV RNA copies) produced from HuH7.5.1 cells treated with 10 μM of the compound of the present invention (prepared in Example 1), assuming that the amount of HCV produced from untreated HuH7.5.1 cells (the number of HCV RNA copies) was 1 (inhibitory activity value) (N=3 for each compound). The results (average inhibitory activity values) are specifically shown below.

[0618]

[0619] In addition, as a result of the test in which the compound K7-025 was administered in the concentration range of 0.63 to 10 μM, the EC ５０ The EC value was 0.49 μM, and the EC ５０ The concentration was 4.19 μM. No substantial cytotoxicity was observed when administered within these concentration ranges.

[0620] To evaluate the inhibitory activity of the following compounds of the present invention against HCV production, the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells treated with 0.1, 1, or 10 μM of a compound of the present invention (prepared in Example 1) was calculated (inhibitory activity value) when the amount of HCV (HCV RNA copy number) produced from untreated HuH7.5.1 cells was set to 1 (N=3 for each compound). The results (average inhibitory activity values) are specifically shown below.

[0621]

[0622] To evaluate the inhibitory activity of the following compounds of the present invention against HCV production, the amount of HCV (HCV RNA copy number) produced from HuH7.5.1 cells treated with 1, 3, or 10 μM of a compound of the present invention (prepared in Example 1) was calculated (inhibitory activity value) when the amount of HCV (HCV RNA copy number) produced from untreated HuH7.5.1 cells was set to 1 (N=3 for each compound). The results (average inhibitory activity values) are specifically shown below.

[0623]

[0624] As described above, it has been confirmed that the compounds of the present invention, which are indole derivatives or tetrahydrocarbazole derivatives, have HCV inhibitory activity. Therefore, the compounds of the present invention and compositions containing them are expected to be useful as HCV inhibitors and agents for the prevention and / or treatment of hepatitis C.

[0625] Since the compounds having the structures of formulae (I) to (VII) have HCV inhibitory activity, the compounds, compositions, HCV inhibitors, prophylactic and / or therapeutic agents, medicines, treatment methods, uses, or kits for hepatitis C of the present invention are useful for the prevention / treatment of hepatitis C and have industrial applicability.

Claims

1. Formula (I) [Wherein: X is S(=O) ２ or C(=O); R １ is a hydrogen atom or -COOR ９ Or -CONHR １０ where R ９ and R １０ are each independently a hydrogen atom or a (C1-C6) alkyl group optionally substituted by one or more substituents; R ２ is a hydrogen atom or a phenoxy group which may be substituted by one or more substituents; R ３ is a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, or a (C6-C10) aryl which may be substituted by one or more substituents; R ４ and R ５ are each independently a hydrogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C6-C10) aryl which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a carboxy, or a (C1-C6) alkoxycarbonyl which may be substituted by one or more substituents; ４ and R ５ may be bonded to each other to form a hydrocarbon ring together with adjacent carbon atoms; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl group which may be substituted by one or more substituents, a (C1-C6) alkoxy group which may be substituted by one or more substituents, a hydroxyl group or a halogen atom; where X is S(=O) ２ and R １ is an ethoxycarbonyl group, R ２ and R ３ is a hydrogen atom, R ４ and R ５ are bonded to each other to form an unsubstituted cyclohexene ring together with adjacent carbon atoms, and R ６ ~R ８ and R 1 and R 2 are each independently a hydrogen atom, or a salt or solvate thereof, which is an inhibitor of hepatitis C virus.

2. The compound represented by formula (I) is represented by the following formula (II): [Wherein: X is S(=O) ２ or C(=O); R ３ , and R ６ ~R ９ are each as defined in formula (I); R １１ In (n), n is an integer from 0 to 8; R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; where X is S(=O) ２ and R ３ , and R ６ ~R ８ are all hydrogen atoms, R ９ is ethyl, and R １１ The hepatitis C virus inhibitor according to claim 1, which is a compound represented by the following formula (n): (excluding the case where n=0 in n).

3. The compound represented by formula (II) is represented by the following formula (III): [In the formula: X, R ３ , R ９ and R １１ are each as defined in formula (II); where X is S(=O) ２ and R ３ is a hydrogen atom, R ９ is ethyl, and R １１ The hepatitis C virus inhibitor according to claim 2, which is a compound represented by the following formula (n): (excluding the case where n=0 in n).

4. X is S (=O) ２ The hepatitis C virus inhibitor according to claim 1 , 5. R １ is -COOR ９ So, here is R ９ The hepatitis C virus inhibitor according to claim 1, wherein is a hydrogen atom, methyl or ethyl.

6. The hepatitis C virus inhibitor according to claim 1, wherein the compound represented by formula (I) is any one of the following:

7. The hepatitis C virus inhibitor according to any one of claims 1 to 6, wherein the inhibition of hepatitis C virus is suppression of hepatitis C.

8. The hepatitis C virus inhibitor according to any one of claims 1 to 6, wherein the inhibition of hepatitis C virus is the prevention and / or treatment of hepatitis C.

9. The hepatitis C virus inhibitor according to claim 8, wherein the hepatitis C is a liver disease caused by infection with hepatitis C virus (HCV) selected from the group consisting of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma.

10. Any of the following compounds, or a salt or solvate thereof:

11. A composition comprising the compound according to claim 10, or a salt thereof, or a solvate thereof, and a pharma- ceutically acceptable carrier.

12. A compound represented by the following formula (IV), or a salt thereof, or a solvate thereof: In formula (IV), X is S(=O) ２ or C(=O); Z is C-R １２ or N; R ６ ~R ８ are each independently a hydrogen atom, a (C1-C12) alkyl group which may be substituted by one or more substituents, a (C1-C6) alkoxy group which may be substituted by one or more substituents, a hydroxyl group or a halogen atom; R １１ In (n), n is an integer from 0 to 8; R １１ are each independently a group selected from the group consisting of (C1-C12) alkyl optionally substituted by one or more substituents, (C3-C8) cycloalkyl optionally substituted by one or more substituents, carbamoyl optionally substituted by one or more substituents, (C1-C6) alkoxy optionally substituted by one or more substituents, hydroxy, and a halogen atom; R １２ ~R １６ are each independently a hydrogen atom, a halogen atom, a (C1-C12) alkyl which may be substituted by one or more substituents, a (C3-C8) cycloalkyl which may be substituted by one or more substituents, a (C2-C6) alkenyl which may be substituted by one or more substituents, a (C2-C6) alkynyl which may be substituted by one or more substituents, a (C1-C6) alkoxy which may be substituted by one or more substituents, a (C1-C6) haloalkyl which may be substituted by one or more substituents, a (C6-C12) aryl which may be substituted by one or more substituents, and (C6-C12)aryloxy optionally substituted by one or more substituents, (C6-C12)arylcarbonyl optionally substituted by one or more substituents, a heterocyclyl group optionally substituted by one or more substituents, a (5-12)heteroaryl optionally substituted by one or more substituents, (C1-C6)alkylcarbonyl optionally substituted by one or more substituents, (C1-C6)alkoxycarbonyl optionally substituted by one or more substituents, (C1-C6)alkylaminocarbonyl optionally substituted by one or more substituents, carboxy, carbamoyl, cyano, hydroxy, amino, or nitro.

13. The compound according to claim 12, which is represented by the following formula (V), or a salt thereof, or a solvate thereof: In formula (V), X, Z, and R １２ ~R １６ are each as defined in formula (IV).

14. The compound according to claim 12, which is represented by the following formula (VI), or a salt thereof, or a solvate thereof: In formula (VI), Z and R １２ ~R １６ are each as defined in formula (IV).

15. The compound according to claim 12, which is represented by the following formula (VII), or a salt thereof, or a solvate thereof: In formula (VII), R １２ ~R １６ are each as defined in formula (IV).

16. The compound according to claim 12, wherein the compound represented by formula (IV) is any one of the following, or a salt thereof, or a solvate thereof:

17. A composition comprising a compound according to any one of claims 12 to 16, or a salt thereof, or a solvate thereof, and a pharma- ceutically acceptable carrier.

18. A hepatitis C virus inhibitor comprising the compound according to any one of claims 12 to 16, or a salt thereof, or a solvate thereof.

19. The hepatitis C virus inhibitor according to claim 18, wherein the hepatitis C virus inhibition is hepatitis C suppression.

20. The hepatitis C virus inhibitor according to claim 18, wherein the inhibition of hepatitis C virus is the prevention and / or treatment of hepatitis C.

21. The hepatitis C virus inhibitor according to claim 20, wherein the hepatitis C is a liver disease caused by infection with hepatitis C virus (HCV), selected from the group consisting of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma.

Images