Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells using aqueous mastic gum

The composition of water-soluble mastic gum induces the differentiation of adipose-derived stem cells into hair papilla cells, addressing the limitations of current hair loss treatments and offering a viable cell therapy option.

WO2025121568A1PCT designated stage expired Publication Date: 2025-06-12FROMBIO CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/007204
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-05
Filing Date
2024-05-28
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Current hair loss treatments have limitations, including side effects, limited applicability, and high costs, necessitating the development of effective cell therapy using hair papilla cells.

Method used

A composition using water-soluble mastic gum is employed to induce the differentiation of adipose-derived stem cells into hair papilla cells, potentially overcoming the limitations of existing treatments.

Benefits of technology

The use of water-soluble mastic gum effectively differentiates adipose-derived stem cells into hair papilla cells, providing a promising cell therapy for hair loss that avoids the drawbacks of existing treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024007204_12062025_PF_FP_ABST
    Figure KR2024007204_12062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention discloses a composition for inducing the differentiation of adipose-derived stem cells into dermal papilla cells using an aqueous mastic gum. The composition for inducing differentiation according to the present invention can differentiate adipose-derived stem cells into dermal papilla cells using water-soluble mastic gum, and the differentiated dermal papilla cells may have useful effects as a cell therapeutic agent for hair loss treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells using water-soluble mastic gum

[0001] The present invention relates to a composition for inducing differentiation of adipose-derived stem cells into mammary papilla cells using a water-soluble mastic gum.

[0002] Normal human hair undergoes a cycle of growth and shedding, alternating between a growth phase (anagen), where hair actively grows, a regression phase (catagen), where hair begins to decline, and a resting phase (telogen), where hair growth ceases or enters a resting state. Hair loss can be broadly categorized into natural hair loss, where hair in the anagen phase naturally falls out from the hair follicle through a normal growth cycle, and abnormal hair loss, which can be caused by genetic factors, hormonal imbalances, psychological stress, illness, or medication side effects.

[0003] Hair grows from the hair follicle, which is a skin accessory organ. The hair follicle contains the hair bulb, dermal papilla, hair matrix, melanocytes, sebaceous glands, and aerolimus. Dermal papilla cells are a type of dermal fibroblast cells located in the dermal papilla at the bottom of the hair follicle. Dermal papilla cells have capillaries distributed throughout them, which supply oxygen and nutrients to the hair follicle. They also secrete growth factors such as IGF-1 (insulinlike growth factor-1), KGF (keratinocyte growth factor), β-FGF (β-fibroblast growth factor), HGF (hepatocyte growth factor), SCF (stem cell factor), and VEGF (vascular endothelial growth factor), and inhibitory factors such as EGF (Epidermal growth factor) and TGF-β (transforming growth factor-β), thereby regulating the growth of hair follicle epithelial cells.

[0004] Therefore, if the death of hair papilla cells is suppressed and their proliferation promoted, hair becomes healthy, hair growth is promoted, and hair loss can be suppressed. Hair growth progresses when the epithelial cells surrounding the hair papilla divide to form the hair shaft. This epithelial cell division is regulated by the hair papilla cells. In androgens in male pattern baldness, the hair papilla is also the site where male hormones act on the hair follicle, and the hair papilla cells play a very important role in hair growth.

[0005] Currently, hair loss treatments approved by the U.S. Food and Drug Administration (FDA) include minoxidil, finasteride, and baricitinib. However, finasteride has side effects such as decreased sexual function and birth defects, and is limited to use on male patients. Minoxidil has side effects such as allergic dermatitis, itching, and hair loss recurrence when use is discontinued. Baricitinib has cardiovascular side effects and is limited to use on severe alopecia areata.

[0006] Surgical procedures such as injection of the stromal vascular fraction of adipose tissue containing adipose-derived stem cells (ADSCs) into the scalp or transplantation of hair tissue suspension have been attempted, and these surgical procedures have been reported to be effective, but surgical procedures have the disadvantages of being painful and expensive (Stem Cell Res. Ther. 12 (1) (2021) 486).

[0007] Therefore, the development of cell therapy for hair loss treatment is still in demand, and in particular, cell therapy using dermal papilla cells, which are hair-producing cells, is receiving attention. The effectiveness of dermal papilla cells in treating hair loss has been proven in various animal models (Proc. Natl. Acad. Sci. USA 110 (49) (2013) 19679-19688; Br. J. Dermatol. 181 (3) (2019) 523-534). Therefore, technologies for manufacturing and culturing dermal papilla cells for use as cell therapy are required, and technologies for differentiating from induced pluripotent stem cells or adipose-derived stem cells, and culturing under hypoxic conditions have been proposed as such technologies (Sci. Rep. 7 (2017) 42777; Br. J. Dermatol. 181 (3) (2019) 523-534).

[0008] The present invention discloses a technique for differentiating human adipose tissue-derived mesenchymal stem cells into breast papilla cells using a water-soluble mastic gum.

[0009] The purpose of the present invention is to provide a composition for inducing differentiation of adipose-derived stem cells into dermal papilla cells using a water-soluble mastic gum.

[0010] Another object of the present invention is to provide a method for differentiating adipose-derived stem cells into dermal papilla cells using the composition.

[0011] Other or specific purposes of the present invention will be presented below.

[0012] The present invention was completed by confirming that, as confirmed in the examples below, water-soluble mastic gum induces differentiation of human adipose-derived stem cells into dermal papilla cells when treated with factors such as BMP2 (Bone morphogenetic protein 2) and BMP4 (Bone morphogenetic protein 4).

[0013] The present invention is provided based on these experimental results, and in one aspect, the present invention can be understood as a composition for inducing differentiation of adipose-derived (i.e., isolated from adipose tissue) stem cells into dermal papilla cells, including a water-soluble mastic gum as an active ingredient.

[0014] In the present invention, water-soluble mastic gum acts as an active ingredient that induces differentiation of adipose-derived stem cells into dermal papilla cells, either alone or together with an inactive carrier component.

[0015] In the present invention, water-soluble mastic gum refers to a suspension (i.e., a suspension that does not aggregate or precipitate in the water as a solvent and is maintained in a dispersed state) obtained by suspending mastic gum in water as a solvent by pulverizing mastic gum into fine particles or nanoparticles (average particle diameter range of 1 to 999 μm). Such water-soluble mastic gum can be obtained by pulverizing mastic gum into fine particles or nanoparticles, adding water thereto, stirring, and mixing. In particular, it may be preferable to obtain mastic gum by pulverizing mastic gum into fine particles, adding water thereto, mixing, and pulverizing the mixture (or mixed liquid) to form nanoparticles of mastic gum in the mixture. At this time, in order to stabilize the dispersed particles and prevent aggregation or precipitation, a suspending agent may be added in an appropriate amount before and after mixing the mastic gum in the fine particles or nanoparticles with water and before and after pulverization. Any suspending agent known in the art can be used, for example, a water-soluble polymer such as gum arabic, gum tragacanth, agar, karaya gum, locust bean gum, guar gum, xanthan gum, ghatti gum, pectin, cyclodextrin, glycerin or its fatty acid ester derivatives, modified cellulose such as methylcellulose or hydroxymethylcellulose, various surfactants, etc. These suspending agents can be used alone or in combination of two or more, and can be used in an appropriate amount for suspension, specifically in a range of 20 to 200 parts by weight per 100 parts by weight of mastic gum.For more specific details regarding the production of water-soluble mastic gum, reference may be made to the examples below or to the method disclosed in Korean Patent No. 10-1865712 entitled "Method for producing a mastic gum aqueous solution with enhanced dispersing power and water-soluble power through nanoparticle formation." Here, mastic gum refers to a resin obtained from a mastic tree (Pistacia lentiscus).

[0016] The composition of the present invention may further include BMP2 (Bone morphogenetic protein 2), BMP4, etc., in addition to the active ingredient, water-soluble mastic gum, to supplement or increase the differentiation-inducing activity of water-soluble mastic gum, and these factors may be of human origin (meaning those isolated from human blood, etc., or manufactured by a genetic recombination method, and having the same amino acid sequence as that of a human).

[0017] In addition, the composition of the present invention may additionally include 6BIO (6-Bromoindirubin-3'-oxime) in order to supplement or increase the differentiation-inducing activity of the water-soluble mastic gum, in addition to the water-soluble mastic gum as an active ingredient. 6BIO is a known substance with the CAS number 667463-62-9, a semisynthetic derivative of indirubin found in edible mollusks and plants, and is an inhibitor of Glycogen synthase kinase 3β (Gsk-3β). It is known to play an important role in inducing osteogenic differentiation of bone marrow mesenchymal stem cells, osteogenic differentiation of periodontal ligament stem cells, and bone regeneration (Int J Mol Sci. 2022 Aug 4;23(15):8676; An Acad Bras Cienc. 2019 Mar 21;91(1):e20180459; ACS Biomater. Sci. Eng. 2021 Jan 11;7(1):232-231).

[0018] The composition of the present invention may contain the active ingredient, water-soluble mastic gum, in an amount sufficient to differentiate adipose-derived stem cells into dermal papilla cells to a sufficient or desired degree. Typically, the amount will be in the range of 50 to 1,000 ppm, and more particularly, 100 to 300 ppm.

[0019] In addition, when the composition of the present invention includes BMP2, BMP4, and 6BIO, it is preferable to include BMP2 and BMP4 in the range of 0.3 to 3 ng / ml, and 6BIO in the range of 1 to 10 μM, in order to sufficiently or to the intended extent differentiate into mammary papilla cells.

[0020] The composition of the present invention may include a solvent in addition to the active ingredient, water-soluble mastic gum. Such a solvent may be a cell culture medium, a buffer, an isotonic solution, or any other suitable solvent, such as purified water or dimethyl sulfoxide (DMSO).

[0021] Additionally, in the present invention, the cell culture medium is not particularly limited and any basic medium used in the art for mammalian cell culture can be used. The basic medium is intended for cell growth, proliferation, and / or expansion, and basically contains sugars, amino acids, and inorganic salts, and may optionally contain vitamins, trace elements, antimicrobial agents, growth factors, hormones, buffers, isotonic agents, and the like.

[0022] Monosaccharides, disaccharides, etc. may be used as the sugar, and specifically, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or a mixture of one or more thereof may be used.

[0023] The amino acids included in the basic medium include aspartic acid, glutamic acid, asparagine, serine, glutamine, histidine, glycine, threonine, arginine, alanine, tyrosine, cysteine, valine, methionine, norvaline, tryptophan, phenylalanine, isoleucine, leucine, lysine, hydroxyproline, sarcosine and / or proline. The amino acids are preferably synthetic amino acids, and such synthetic amino acids may be in the form of dipeptides or tripeptides. Such dipeptides or tripeptides can be converted into free amino acids in a cell culture containing cells.

[0024] In addition to sugars and amino acids, the basic medium may additionally contain inorganic salts such as sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, and sodium dihydrogen phosphate, which help maintain osmotic balance and regulate membrane potential by providing sodium, potassium, and calcium ions.

[0025] The basal medium may optionally include vitamins. Many vitamins are essential for cell growth and proliferation and cannot be synthesized in sufficient quantities by cells, so they must be sufficiently supplemented in the cell culture medium. Vitamins such as vitamin A, B vitamins, vitamin C, and vitamin E may be included in the basal medium. In particular, B vitamins such as thiamine, riboflavin, pyridoxine, cyanocobalamin, biotin, folic acid, pantothenic acid, and nicotinamide are recommended for promoting cell growth.

[0026] Additionally, the basic medium may optionally contain, in addition to sugars, amino acids, and vitamins, trace elements, antibiotics, growth factors, hormones, buffers, and tonics.

[0027] Trace elements may be added to the basal medium to ensure proper cell growth and maintain enzyme function, and examples of such trace elements include copper, zinc, selenium, and tricarboxylic acid intermediates.

[0028] Antimicrobial agents may be added to the basic medium to prevent contamination by external microorganisms, and specifically, antibiotics such as penicillin, streptomycin, and fungizone, antifungal agents such as amphotericin B, and mycoplasma inhibitors such as gentamicin, ciprofloxacin, azithromycin, and tylosin may be used.

[0029] Growth factors can be added to the basal medium to promote cell proliferation, and examples of such growth factors include epidermal growth factor (EGF), fibroblast growth factor (FGF), insulin-like growth factor (IGF), nerve growth factor (NGF), platelet-derived growth factor (PDGF), transforming growth factor (TGF), vascular endothelial growth factor (VEGF), fibroblast growth factor-2 (bFGF), and activin A.

[0030] Hormones that can be added to the basic medium include insulin, hydrocortisone, triiodothyronine, estrogen, androgen, progesterone, prolactin, follicle-stimulating hormone, gastrin-releasing peptide, dexamethasone, estradiol, and glucagon.

[0031] Additionally, the basic medium may contain buffers such as citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, and Tris, or isotonic agents such as sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene glycol, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, and glucose.

[0032] Additionally, the basic medium may contain cell adhesion factors such as type I or type II collagen, gelatin, fibronectin, laminin, poly-L-lysine, poly-D-lysine, albumin that binds salts, free fatty acids, hormones, and vitamins and transports them between tissues and cells, and regulates pH and osmotic pressure, and transferrin that plays an important role in iron transport.

[0033] These basic media can be prepared directly or used commercially, and commercially available media include, for example, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM / F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A medium, AmnioMax complete medium, AminoMaxⅡ complete medium, EBM (Endothelial Basal Medium) medium, Chang's Medium, MesenCult-XF, DMEM / HG (Dulbecco's Modified Eagle's Medium high glucose) medium, and MCDB+DMEM / LG (MCDB + Dulbecco's Modified Eagle's Medium low glucose) medium. Can be.

[0034] The solvent included in the composition of the present invention may be a buffer, and the buffer may be a saline solution containing citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, histidine, Tris, etc. as a buffer. In particular, it may be phosphate buffered saline (PBS), Tris buffered saline (TBS), HEPES buffered saline, DPBS (Dulbecco's phosphate-buffered saline), etc.

[0035] The solvent included in the composition of the present invention may also be an isotonic solution containing sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. as isotonic agents. Such isotonic solutions may be Ringer's solution, lactated Ringer's solution, acetate Ringer's solution, bicarbonate Ringer's solution, 5% glucose aqueous solution, and may be manufactured and used directly or purchased and used commercially.

[0036] The adipose-derived stem cells (ADSCs) of the present invention have self-renewal ability and can differentiate into various cell lineages such as skin, cartilage, and bone. In addition, compared to bone marrow-derived stem cells or umbilical cord blood-derived stem cells, they are easy to collect, can be mass-cultivated, and have a high stem cell content, so they have high utility in cell therapy. As long as the adipose-derived stem cells have self-renewal and differentiation ability, there is no particular limitation on their origin, and they may be derived from humans, monkeys, pigs, horses, cows, sheep, dogs, cats, mice, or rabbits. Preferably, they are derived from humans. Methods for isolating, culturing, and expanding adipose-derived stem cells are known in the art, and are specifically described in the literature [Aronowitz et al. SpringerPlus (2015) 4:713], the literature [Scientific Report, 2017, 7:10015], the literature [J Vis Exp. 2019 Dec; 16(154):e59419], literature [Cell Regeneration (2015) 4:7], Korean Patent Registration No. 10-2431623, etc. can be referenced.

[0037] In another aspect, the present invention relates to a method for producing dermal papilla cells differentiated from adipose-derived stem cells, comprising the step of treating and culturing a culture medium for adipose-derived stem cells with the composition for inducing differentiation of the present invention as described above.

[0038] In the method of the present invention, the culture temperature may be in the range of 25 to 40°C, preferably 35±2°C.

[0039] In addition, in the method of the present invention, culturing is performed until differentiation into mammary papilla cells is sufficient or to the desired extent. In some embodiments, culturing may be performed for a period of 24 hours, 48 ​​hours, 72 hours, 96 hours, 5 days, 6 days, 7 days, 8 days, 9 days, or more.

[0040] In addition, in the method of the present invention, the culture may be performed in an amount of carbon dioxide (CO2) of 10% to 1% (v / v), preferably 8% to 2% (v / v), and especially 5% (v / v), so that differentiation into mammary gland cells can occur smoothly.

[0041] In addition, in the method of the present invention, the culturing may be performed in a closed incubator, particularly in a closed incubator maintained in a sterile state. Incubators suitable for the present invention may be GE Xuri W25, GE Xuri W5, Sartorius BioSTAT RM 20 | 50, Finesse SmartRocker Bioreactor Systems, Pall XRS Bioreactor Systems, etc.

[0042] In another aspect, the present invention relates to a pharmaceutical composition comprising mammary papilla cells differentiated from adipose-derived stem cells obtained according to the manufacturing method described above.

[0043] The pharmaceutical composition of the present invention, in addition to including differentiated mammary papilla cells, may be prepared as an oral or parenteral formulation by a conventional method known in the art depending on the route of administration, including a pharmaceutically acceptable carrier or excipient.

[0044] Such pharmaceutically acceptable carriers or excipients are those that do not have special toxicity to the human body and do not inhibit the activity or properties of the drug, and may be lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water (e.g., saline solution and sterile water), syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, Ringer's solution, buffers, maltodextrin solution, glycerol, ethanol, dextran, albumin, or any combination thereof. In particular, when the pharmaceutical composition of the present invention is formulated as a liquid solution, suitable carriers or excipients include saline solution, sterile water, Ringer's solution, buffered saline solution, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, etc., and one or more components may be used alone or in combination. If necessary, other conventional pharmaceutical additives such as antioxidants, buffers, and bacteriostatic agents may be added and used.

[0045] When the pharmaceutical composition of the present invention is formulated as an oral dosage form, it can be manufactured in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc. When formulated as a parenteral dosage form, especially as an injection, it can be manufactured in the form of unit dosage ampoules or multiple dosage forms. The pharmaceutical composition of the present invention can also be manufactured in the form of solutions, suspensions, tablets, pills, capsules, sustained-release preparations, etc.

[0046] The pharmaceutical composition of the present invention is formulated in the form of a unit dosage form suitable for administration into a patient's body according to a method conventional in the pharmaceutical field, and can be administered by an oral route or a parenteral route such as a skin, intralesional, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intraventricular, pulmonary, transdermal, subcutaneous, intraperitoneal, intranasal, intragastric, topical, sublingual, vaginal, or rectal route using an administration method conventionally used in the art.

[0047] The dosage (effective amount) of the pharmaceutical composition of the present invention can be prescribed in various ways depending on factors such as the formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity, and a person skilled in the art can appropriately determine the dosage by considering these factors. In a preferred embodiment, the pharmaceutical composition of the present invention is prepared as an injection in the form of a unit dose, and when prepared as an injection in the form of a unit dose, the amount of mast cells contained per unit dose of the pharmaceutical composition of the present invention is 10 2 -10 7 It can be in the cell / ml range.

[0048] In another aspect, the present invention relates to a method for producing a pharmaceutical composition, comprising the steps of treating and culturing human adipose-derived stem cells with a composition for inducing differentiation of adipose-derived stem cells (particularly human adipose-derived stem cells) into dermal papilla cells, which comprises a water-soluble mastic gum as an active ingredient, to differentiate the human adipose-derived stem cells into dermal papilla cells, obtaining differentiated dermal papilla cells, and mixing the obtained dermal papilla cells with the pharmaceutically acceptable carrier or excipient described above to produce a pharmaceutical composition.

[0049] In the method of the present invention, the composition for inducing differentiation of the present invention may additionally contain BMP2 (Bone morphogenetic protein 2), BMP4, etc., in addition to the active ingredient, water-soluble mastic gum, to supplement or increase the differentiation-inducing activity of the water-soluble mastic gum, and may also additionally contain 6BIO (6-Bromoindirubin-3'-oxime). For the appropriate content of these components, reference may be made to the above.

[0050] As described above, according to the present invention, a composition for inducing differentiation of adipose-derived stem cells into mammary papilla cells using a water-soluble mastic gum can be provided.

[0051] The composition for inducing differentiation of the present invention is a technology capable of differentiating hair papilla cells from adipose-derived stem cells, and such differentiated hair papilla cells can be usefully used as a cell therapy agent for hair loss treatment.

[0052] Figure 1 is a schematic diagram showing the process of differentiating mammary papilla cells from human adipose-derived stem cells according to the present invention.

[0053] Figures 2 to 4 show the results of confirming the degree of differentiation of human adipose-derived stem cells into dermal papilla cells and the degree of expression of dermal papilla cell-specific factors LEF-1, Wnt5α, and BMP4 using FACS (fluorescence activated cell sorter) or RT-PCR (reverse transcription polymerase chain reaction).

[0054] The present invention will be described below with reference to examples. However, the scope of the present invention is not limited to these examples.

[0055]

[0056] <Example> Experiment on the activity of water-soluble mastic gum to induce differentiation of adipose-derived stem cells into dermal papilla cells

[0057] <Example 1> Isolation and culture of human adipose-derived stem cells

[0058] The human adipose tissue used in the present invention was purchased from Goma Biotech Co., Ltd. (Seoul, Korea), and the isolation of stem cells from the adipose tissue was performed according to the method of Zuk et al. (Mol Biol Cell. 2022 Dec; 13(12): 4279-4295).

[0059] After isolating stem cells from adipose tissue, they were cultured in DMEM (Dulbecco's Modified Eagle's Medium) supplemented with penicillin (100 U / ml), streptomycin (100 ug / ml), and 10% heat-inactivated serum at 37°C, 95% air, 5% CO₂. Once the cells attached to the culture dish and grew, they were collected using 0.05% trypsin / EDTA and maintained in DMEM supplemented with 10% (w / v) Fetal Bovine Serum (FBS).

[0060] <Example 2> Preparation of differentiation-inducing medium

[0061] In the present invention, a new composition of differentiation-inducing medium was prepared to differentiate human adipose-derived stem cells into dermal papilla cells. The medium was prepared by adding a substance known as a differentiation-inducing substance, glycogen synthase 3a / b inhibitor (6-Bromoindirubin-3'-oxime; 6BIO), water-soluble mastic gum, bone morphogenetic protein 2 (BMP2), and / or bone morphogenetic protein 4 (BMP4), to the medium used to culture human adipose-derived stem cells as in Example 1 to induce differentiation into dermal papilla cells. Four different differentiation-inducing culture media were prepared and used. The concentrations of the differentiation-inducing substances used in the media and the compositions of the four different differentiation-inducing media are as shown in Tables 1 and 2 below.

[0062] Concentration of differentiation-inducing substances Substance name 6BIOBMP2BMP4Mastic gum Concentration 5 μM1 ng / mL1 ng / mL200 ppm

[0063] Differentiation induction medium compositionBasic mediumDifferentiation induction substanceFBS 10% addedDMEM1234-Mastic gum6BIO6BIOBMP4BMP4BMP2Mastic gumBMP2

[0064] The differentiation inducers used in this experiment, 6BIO, BMP2, and BMP4, were purchased from Sigma-Aldrich (USA). After visually inspecting the mastic gum powder for color and foreign matter, 20% of the selected mastic gum powder weight, 75.7% of purified water weight, 4% of cyclodextrin weight, and 0.3% of additive (ghatti gum) weight were added and dispersed using a homomixer (KNS Company, Ltd.) at 30 to 50℃ and 2,000 to 3,000 rpm for 30 to 60 minutes to a particle size of approximately 20 to 50 μm. The mastic gum dispersion was then processed using a bead mill (DNTech, Ltd.) at 20 to 40℃ for 3 to 6 hours to obtain a final dispersed particle size of 600 to 1,000 nm on average. Afterwards, the suspension was filtered through a 40 to 60 μm housing filter to obtain a mastic gum aqueous solution. The obtained water-soluble mastic gum was stored in a refrigerator at 4°C, and when using the original solution, it was left at 40°C for 30 minutes and then shaken sufficiently to use the homogenized solution.

[0065] <Example 3> Induction of differentiation from human adipose-derived stem cells into dermal papilla cells

[0066] To induce differentiation of human adipose-derived stem cells into dermal papilla cells, 1 × 10 5The cells were cultured for 24 hours under the culture conditions used in Example 1 at a concentration of 10 cells / well. When the cells adhered to the bottom, they were washed with the solvent DPBS (Dulbecco's Phosphate-buffered saline), and differentiation was induced for 7 days using each differentiation medium prepared in Example 2. At this time, the differentiation medium was replaced daily, and differentiation was induced by removing the existing differentiation medium and replacing it with 2 mL of new differentiation medium afterward. A schematic diagram of the differentiation process from human adipose-derived stem cells of the present invention into dermal papilla cells is shown in Figure 1.

[0067] <Example 4> Confirmation of the characteristics of mammary papilla cells through flow cytometry after differentiation induction

[0068] The expression levels of LEF-1 and Wnt5α, which are specific factors of dermal papilla cells, were confirmed using FACS (fluorescence activated cell sorter) for human adipose-derived stem cells differentiated according to the above method (Annals of Dermatology 2019;31(2):164-174; Int J Med Sci. 2013; 10(6):738-746; Int J Mol Sci. 2023 Feb; 24(4): 3961). Human adipose-derived stem cells differentiated according to each condition were treated with 0.05% trypsin / EDTA to detach the cells, and then permeabilized using a Fixation / Permeabilization solution kit (BDcytofix / Cytoperm TM , BD) were used to fix and stain cells. The cells were fixed for 20 minutes at 4°C with BD Cytofix / Cytoper solution in the kit, and BD Perm / Wash TMThe cells were washed three times with buffer. Afterwards, LEF-1 antibody (Anti-LEF-1 antibody phycoerythrin, PE-A; Santacruz) or Wnt5a antibody (Anti-Wnt5a antibody phycoerythrin, PE-A; Santacruz) was added to BD Perm / Wash TM After adding the diluted solution to the buffer, staining was performed at 4°C for 30 minutes. After staining, BD Perm / Wash TM The cells were washed three times using buffer, and finally suspended using PBS, and analyzed using a flow cytometer (FACSLyric, BD Biosciences).

[0069] The results are shown in Figures 2 and 3 for LEF-1 and Wnt5α, respectively.

[0070] As confirmed in Fig. 2, compared to human-derived adipose stem cells that were not differentiated (dotted line), when treated with only BMP4, the proportion of cells positive for LEF-1, a dermal papilla cell-specific factor, did not increase much (Fig. 2 (A), but when treated with BMP4 and mastic gum together, the proportion of cells positive for LEF-1 increased significantly (Fig. 2 (B). In addition, when treated with 6BIO and BMP2, which are known dermal papilla cell differentiation substances, compared to human-derived adipose stem cells that were not differentiated (dotted line), the proportion of cells positive for LEF-1, a dermal papilla cell-specific factor, increased (Fig. 2 (C), and when treated with 6BIO, BMP2, and mastic gum together, the proportion of cells positive for LEF-1, a dermal papilla cell-specific factor, increased even more significantly (Fig. 2 (D)).

[0071] As confirmed in Fig. 3, when treated with 6BIO and BMP2, the proportion of cells positive for Wnt5α, a papilla cell-specific factor, increased compared to human-derived adipose stem cells that were not induced to differentiate (dotted line) (Fig. 3 (A), and when treated with 6BIO, BMP2, and mastic gum together, the proportion of cells positive for Wnt5α, a papilla cell-specific factor, increased more significantly (Fig. 3 (B)).

[0072] These results suggest that mastic gum can induce differentiation of human-derived adipose stem cells into dermal papilla cells.

[0073] <Example 5> Confirmation of mammary papilla cell characteristics through RT-PCR after differentiation induction

[0074] To confirm the level of expression of essential genes in mammary papilla cells through RT-PCR, human adipose-derived stem cells were seeded at 1x10 in a 6-well plate. 5 Cells / well were prepared and cultured for 24 hours in a 37°C, 5% CO2 incubator. After 24 hours of culture, the culture medium was removed, washed with DPBS, and differentiation was induced for 7 days using each differentiation medium prepared in Example 2. After differentiation, total RNA was isolated from the cells attached to the bottom using Trizol Reagent (Invitrogen). The isolated RNA was collected by NanoDrop TMQuantification was performed using 1 μg of each total RNA sample and cDNA was synthesized using the AccuPower CycleScript RT PreMix (dN6) Kit (Bioneer, Korea). 80 μl of RNase-water was added to 20 μl of the synthesized cDNA and used as a cDNA template. qPCR was performed on each sample, which was mixed with 1 μl of cDNA template, 10 μl of SYBR™ Green Master Mix, 1 μl each of BMP4 and LEF-1 gene primers, and 7 μl of RNase-free water, using a QuantStudio 3 Real-Time PCR instrument, and the primer information is as shown in Table 3. The CT value measured through qPCR was 2 -△△CT The relative expression rates were calculated and compared using the method.

[0075] Primer GenePrimer Sequence BMP4-ForwardCGGGCCAGGAAGAAGAATAAG (SEQ ID NO: 1) BMP4-ReverseCCAGTCATTCCAGCCCACAT (SEQ ID NO: 2) LEF-1-ForwardACAGATCACCCCACCTCTTG (SEQ ID NO: 3) LEF-1-ReverseATAGCTGGATGAGGGATGCC (SEQ ID NO: 4)

[0076] The results are shown in Fig. 4. Referring to Fig. 4, when treated with 6BIO, it was confirmed that the gene expression level of BMP4, a dermal papilla cell-specific factor, increased compared to human-derived adipose stem cells that were not differentiated, compared to the control ADSCs, and when 6BIO and mastic gum were treated together, the gene expression of BMP4 increased further (Fig. 4 (A)), and this trend was also observed in the gene expression level of LEF-1. BMP4 is a specific factor expressed in dermal papilla cells and is used as an indicator factor showing the degree of dermal papilla cell differentiation (Genes Dev. 2008 Feb 15; 22(4): 543-557; J Cell Sci (2012) 125 (17): 4114-4125). The above results also show that mastic gum can induce differentiation of human-derived adipose stem cells into dermal papilla cells.

Claims

1. A composition for inducing differentiation of adipose-derived stem cells into mammary papilla cells, comprising a water-soluble mastic gum as an active ingredient.

2. In paragraph 1, The composition is characterized in that, in addition to the active ingredient, water-soluble mastic gum, it additionally contains at least one of BMP2 (Bone morphogenetic protein 2), BMP4, and 6BIO.

3. In paragraph 1, A composition characterized in that the above-mentioned water-soluble mastic gum is a suspension obtained by suspending mastic gum in water as a solvent by dividing it into microparticles (having an average particle diameter of 1 to 999 μm) or nanoparticles (having an average particle diameter of 1 to 999 nm).

4. In paragraph 1, The above stem cells are a composition derived from human adipose tissue.

5. A method for differentiating adipose-derived stem cells into mammary papilla cells, comprising the step of treating and culturing adipose-derived stem cells with the composition described in any one of claims 1 to 4.

6. A method for producing papilla cells from adipose-derived stem cells, comprising the steps of treating and culturing adipose-derived stem cells with the composition described in any one of clauses 1 to 3 to differentiate the adipose-derived stem cells into papilla cells, and obtaining differentiated papilla cells.

7. A method for producing a pharmaceutical composition, comprising the steps of treating and culturing adipose-derived stem cells with the composition described in any one of clauses 1 to 3 to differentiate the adipose-derived stem cells into mammary papilla cells, obtaining differentiated mammary papilla cells, and mixing the obtained mammary papilla cells with a pharmaceutically acceptable carrier or excipient to produce a pharmaceutical composition.

Citation Information

Patent Citations

  • Manufacturing method of aqueous solution of mastic resin comprising methyl sulfonyl methane and aqueous solution

    KR101607124B1

  • Compositions Comprising Acidic Extracts Of Mastic Gum

    KR1020180080345A

  • Cosmetic composition for preventing hair loss or promoting hair growth containing mastic gum aqueous solution

    KR102300227B1

  • Skin-lightening Compositions for Improving Freckles, Age Spots, etc. Using Solubilized Mastic Gum

    KR102429548B1

  • Composition for improving skin barrier using solubilized mastic gum

    KR102603568B1