Products and methods relating to single nucleotide polymorphism tm6SF2 RS58542926

By employing blocking antisense oligonucleotides to inhibit the interaction between miR-432-5p and TM6SF2 rs58542926 RNA, the method addresses the instability and associated risks of this specific genetic variation, effectively stabilizing the RNA and protein levels and reducing the risks of NAFLD, NASH, and hepatocellular carcinoma.

WO2025122848A2PCT designated stage expired Publication Date: 2025-06-12RGT UNIV OF CALIFORNIA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/058837
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-07
Filing Date
2024-12-06
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

There is a need for effective treatments for patients carrying the TM6SF2 rs58542926 single nucleotide polymorphism, which is associated with increased risk of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and hepatocellular carcinoma, due to the instability of TM6SF2 rs58542926 RNA and its interaction with miR-432-5p.

Method used

The use of blocking antisense oligonucleotides that specifically target the binding of miR-432-5p to TM6SF2 rs58542926 RNA, stabilizing the RNA and protein levels, thereby mitigating the deleterious effects of the polymorphism.

Benefits of technology

The proposed method effectively stabilizes TM6SF2 rs58542926 RNA and protein levels, reducing the associated risks of steatosis, fibrosis, and hepatocellular neoplasia, and providing a therapeutic target for patients with this specific genetic variation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000030_0001
    Figure IMGF000030_0001
  • Figure 00000041_0000
    Figure 00000041_0000
  • Figure 00000041_0001
    Figure 00000041_0001
Patent Text Reader

Abstract

The present disclosure provides products and methods treating a patient carrying the TM6SF2 rs58542926 single nucleotide polymorphism. Methods are provided for blocking binding of miRNA-432-5p to TM6SF2 rs58542926 RNA. Products provided include, but are not limited to, blocking antisense oligonucleotides.
Need to check novelty before this filing date? Find Prior Art

Description

PRODUCTS AND METHODS RELATING TO SINGLE NUCLEOTIDE POLYMORPHISM TM6SF2 RS58542926 Cross-Reference to Related Applications

[0001] This application claims the benefit of U.S. provisional application No.63 / 607,559 filed December 7, 2023, which is incorporated herein by reference in its entirety. Incorporation By Reference Of Material Submitted Electronically

[0002] The Sequence Listing, which is a part of the present disclosure, is submitted concurrently with the specification as a text file. The name of the text file containing the Sequence Listing is "56908A_SeqListing.xml", which was created on December 6, 2024 and is 12,723 bytes in size. The subject matter of the Sequence Listing is incorporated herein in its entirety by reference. Field

[0003] The present disclosure provides products and methods treating a patient carrying the TM6SF2 rs58542926 single nucleotide polymorphism. Methods are provided for blocking binding of miRNA-432-5p to TM6SF2 rs58542926 RNA. Products provided include, but are not limited to, blocking antisense oligonucleotides. Background

[0004] With the increasing worldwide obesity epidemic, non-alcoholic fatty liver disease [NAFLD; recently termed metabolic dysfunction-associated steatotic liver disease (MASLD)] is quickly becoming one of the most prevalent diseases affecting 24% of the world population (1, 2). Twenty-one percent of patients with NAFLD will develop non- alcoholic steatohepatitis [NASH, recently termed metabolic dysfunction-associated steatohepatitis (MASH)], leading to progressive fibrosis and eventually cirrhosis with an increased risk for hepatocellular carcinoma (HCC) (3, 4). The prevailing view of the NAFLD pathogenesis involves insulin resistance, followed by intrahepatic lipid accumulation with a maladaptive hepatic endoplasmic reticulum (ER) and oxidative stress response to the lipid overload (5-7). End-stage liver disease secondary to NASH will soon be the most common cause of liver transplantation in the US. While management of diabetes, insulin resistance, and diet may all positively affect NAFLD, there is currently no definitive treatment to stop NASH progression. Even in the absence of progression to HCC or liver failure, there are serious adverse consequences to NAFLD and NASH, including increased risk of cardiovascular disease, which is the leading cause of death for individuals with NAFLD.

[0005] Genome-wide association studies have identified genetic loci related to steatosis and NAFLD, including PNPLA3 (encoding patatin-like phospholipase domain-containing protein 3), TM6SF2 (NCBI Gene 53345) (encoding transmembrane 6 superfamily member 2; UniProtKB / Swiss-Prot: Q9BZW4), GCKR (encoding glucokinase regulatory protein), PPP1R3B (encoding protein phosphatase 1 regulatory subunit 3b), TRIB1 (encoding tribbles-1) and others. Single nucleotide polymorphisms (SNPs) in some of the loci influence NAFLD risk, including associated progression to fibrosis and HCC (8-10). However, the molecular mechanisms underlying the disease risk and progression have yet to be elucidated. The most prevalent SNPs include patatin-like phospholipase domain- containing protein 3 (PNPLA3) rs738409 and transmembrane 6 superfamily 2 (TM6SF2) rs58542926, among others. While a number of publications relating to the effects of PNPLA3 rs738409 have appeared (8, 11-14), there is a gap in understanding of the effects of TM6SF2 rs58542926. The rs58542926 SNP results in a single nucleotide substitution cytosine-to-thymine at nucleotide 499 which results in replacement of glutamate at residue 167 of the protein with lysine (c.499C>T; p.Glu167Lys), creating a missense mutation (10, 15). The reported effects of wild-type TM6SF2 have been inconsistent. In initial reported studies, expression of the recombinant protein in Huh7 cells showed no change in relative mRNA but a 50% decrease in protein (1). TM6SF2 knock-down in mice has been reported to increase hepatic TG (1), but this phenotype was not replicated in either a second knock- down model or a liver-specific TM6SF2 knockout (16). Hepatic TM6SF2 overexpression was reported to elevate hepatic TG (16) but a second model found no effect (17).

[0006] There remains a need in the art for products and methods for treating deleterious effects of the TM6SF2 rs58542926 SNP. Summary

[0007] The Examples herein demonstrate for the first time that TM6SF2 rs58542926 is extremely unstable at the RNA level and that the rs58542926 SNP results in a new binding site for miR-432-5p in TM6SF2 rs58542926 RNA that is not present in the wild-type mRNA. TM6SF2 rs58542926 RNA is efficiently degraded upon binding by miR-432-5p, resulting in: upregulation of de novo lipogenesis and increased steatosis (via IGF2 / PI3K / AKT) (20), increased secretion of interleukin 6 (IL6) and interleukin 11 (IL11) (increased risk of fibrosis), and increased risk for hepatocellular neoplasia (via WNT / β CATENIN) (21). Furthermore, quenching of miR-432-5p is contemplated to result in transcriptional upregulation of miR-32-5p pre-microRNA which includes miR-136 and therefore secondarily increase levels of miR-136. Therefore, miR-432-5p represents a direct therapeutic target for patients with TM6SF2 rs58542926, which affects a nexus ofgenetic molecular risks. Methods of blocking rs585429926 RNA and miR-432-5p interaction to stabilize TM6SF2 rs58542926 RNA and protein levels are provided herein.

[0008] The disclosure provides blocking antisense oligonucleotides that block binding of miR-432-5p and TM6SF2 rs58542926 RNA. The blocking antisense oligonucleotides do not trigger degradation of the TM6SF2 rs58542926 RNA. The blocking antisense oligonucleotides do not trigger degradation of the miR-432-5p.

[0009] The blocking antisense oligonucleotides (“miR-432-5p ASO” given miR-Mask names) that bind TM6SF2 rs58542926 RNA can have, for example, the following structures. miR-Mask1 (SEQ ID NO: 1) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG*rArG-3’, wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond miR-Mask2 (SEQ ID NO: 2) 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*+G*+A*G-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask3 (SEQ ID NO: 3) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG-3’, wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond miR-Mask4 (SEQ ID NO: 4) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU-3’, wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond miR-Mask5 (SEQ ID NO: 5) 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask6 (SEQ ID NO: 6) 5’-+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residueand * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask7 (SEQ ID NO: 7) 5’-+G*+G*+A*G*CTGTATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask8 (SEQ ID NO: 8) 5’-+G*+C*+T*G*TATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask9 (SEQ ID NO: 9) 5’-+C*+T*G*TATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA

[0010] The antisense oligonucleotides provided can comprise, for example, a N- acetylgalactosamine (Gal-Nac) modification or a cholesterol modification to facilitate uptake by the liver.

[0011] The disclosure provides methods of blocking binding of miR-432-5p to TM6SF2 rs58542926 RNA in a cell comprising delivering to the cell blocking antisense oligonucleotides that bind the TM6SF2 rs58542926 RNA or miR-432-5p, or blocking antisense oligonucleotides to both. The cell can be, for example, a hepatocyte or an intestinal epithelial cell. The blocking antisense oligonucleotide can be a blocking antisense oligonucleotide provided herein.

[0012] The disclosure provides methods of treating a patient carrying a TM6SF2 rs585429926 SNP comprising delivering to the patient a blocking antisense oligonucleotide that binds the TM6SF2 rs58542926 RNA or miR-432-5p, or blocking antisense oligonucleotides to both. The blocking antisense oligonucleotide can be a blocking antisense oligonucleotide provided herein.

[0013] The treatment methods provided herein can include first determining the patient carries the TM6SF2 rs585429926 SNP.

[0014] Carrier patients treated in methods herein can have long-term liver inflammation, liver damage or liver disease. More specifically, the carrier patient can have fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH).

[0015] Methods provided herein prevent or slow cellular senescence in the carrier patient liver.

[0016] Methods provided herein prevent liver disease from developing in carrier patients who are children, adolescents or adults.

[0017] Methods provided herein prevent or treat cancer in the carrier patient liver or small intestine.

[0018] Carrier patients treated in methods provided herein can have alcoholic liver disease.

[0019] Carrier patients treated in methods herein can be taking liver-damaging medications.

[0020] Carrier patients treated herein can be diabetic. Brief Description of the Drawings

[0021] Figure 1: Discovery of coding microRNA binding site in rs58542926 (A) Quantitative PCR (qRT-PCR) for mRNA expression of TM6SF2 relative to GAPDH in rs58542926 carrier NASH patient versus four non-carrier controls (GM03529A, AG02602A-2, AG16104-5, and AG16086) (n=3). Data were analyzed by Student’s t test and presented as mean ± SD. * p < 0.05; ** p < 0.01. (B) Bioinformatic prediction of hypothetical microRNA sites in coding RNA region surrounding 50bp on each side of rs58542926. miRDB predicted 6 hypothetical microRNA binding sites without rs58542926, and with rs58542926 now the presence of miR-432-5p with a target score of 70. The miR-432 seed sequence used for miRDB searches is also shown. (C) miRNA luciferase reporter assay shows that miR-432-5p binds the human rs58542926 coding DNA region. Experimental groups labeled on the X-axis included DNA from wild-type TM6SF23’UTR (labeled TM6SF23’ UTR), fragment of wild-type DNA surrounding the location where s58542926 would be located (labeled 1_Wild- type), equivalent-sized DNA fragment with the actual rs58542926 SNP (labeled 2_rs585), equivalent-sized DNA fragment with a negative control DNA (labeled NC), and finally an equivalent-sized DNA fragment with a positive control DNA (labeled PC). Each of the experimental groups was tested with both mimic negative control (mimic NC) and human miR-432-5p (has-miR-432-5p mimic). Relative normalizedRenilla luciferase activity was graphed. Data were analyzed by Student’s t test and presented as mean ± SD. * p < 0.05; ** p < 0.01. (D) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in noncarrier and carrier rs58542926 in iPSCs treated by either a negative control ASO transfection or miR-432-5p ASO shows that repression of rs58542926 RNA levels can be rapidly reversed by treatment of carrier cells with ASO (anti-sense oligonucleotide). (E) Schematic of miR-432-5p binding to c.499 C>T and miR-432-5p ASO treatment resulting in stabilized mRNA of TM6SF2 rs58542926. (F) Western blot of TM6SF2 in iPSCs and iHeps using noncarrier control (1023) versus rs58542926 carriers 7017 and 7129. Levels of TM6SF2 protein were reduced in carriers. Blot normalized to Beta-tubulin. (n=3 technical replicates in 3 different cell lines). Western blots quantified with Odyssey LiCor imaging system.

[0022] Figure 2 (A) miRNA luciferase reporter assay experimental group photographs in brightfield after transfection. No significant cellular differences were noted. (B) Synopsys of qRT-PCR data from TM6SF2 expression between different exon-exon junctions in a number of TM6SF2 noncarriers (A3-4; AG16104-5, 1023-5) and TM6SF rs58542926 carriers (7017-2; AS7192, 7191Y8). (C) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in noncarrier and carrier rs58542926 in iPSCs treated by either a negative control ASO transfection or miR-432-5p ASO shows that repression of rs58542926 RNA levels can be rapidly reversed by treatment of carrier cells with ASO (anti-sense oligonucleotide) (n=4 for each). Here they are all graphed on one graph. (D) Chromatograph from 7017-2 (TM6SF2 rs58542926 carrier) showing the heterozygous SNP.

[0023] Figure 3: Functional experiments with rs58542926 (A) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in HepG2 cells, HepG2 with overexpression of wildtype TM6SF2 (OE wild-type), and HepG2 with overexpression of TM6SF2 rs58542926 (OE rs58542926). This shows the dramatic stability of the wild-type non-carrier versus RNA instability of rs58542926 even in HepG2. (B) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in HepG2 cells carrying wild-type TM6SF2 Overexpression or TM6SF2 rs58542926 overexpression treated by either a negative control ASO transfection or miR-432-5p ASO. The experiment demonstrates that unstable rs58542926 RNA levels can be rapidly reversed by treatment of carrier cells with ASO (anti-sense oligonucleotide) in HepG2 cells with an overexpression system.(C) Western blot of Flag-tagged wild-typeTM6SF2, flag-tagged TM6SF2 r s58542926 and a negative control overexpression vector all in HEK293 cells. The Western blot demonstrates very low levels of protein inferred due to low levels of RNA from the prior two experiments. Experiment was normalized to Beta-Tubulin. (D) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in carrier TM6SF2 rs58542926 iHeps (7017 cells) treated by either nothing (vehicle), a negative control ASO (control), 432-5p ASO, or 432-3p ASO. The data shows that only miR-432-5p ASO can rescue expression of TM6SF2 rs58542926. Data were analyzed by Student’s t test and presented as mean ± SD. *** p < 0.001. (E) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in three additional non-carriers and three additional carrier TM6SF2 rs58542926 iHeps including a homozygous carrier (carrier 2). Data were analyzed by Student’s t test and presented as mean ± SD. * p < 0.05. (F) Diagram comparing mouse (mmu-miR-432) and human (has-miR432-5p) miR-432 microRNA sequences.

[0024] Figure 4 (A) Plasmid map for TM6SF2 O / E vector (B) Plasmid map for TM6SF2 rs58542926 O / E vector (C) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in HepG2 cells carrying wild-type TM6SF2 Overexpression or TM6SF2 rs58542926 overexpression treated by either a negative control ASO transfection or miR-432-5p ASO. The experiment demonstrates that unstable rs58542926 RNA levels can be rapidly reversed by treatment of carrier cells with ASO (anti-sense oligonucleotide) in HepG2 cells with an overexpression system. Here they graphed separately. Data were analyzed by Student’s t test and presented as mean ± SD. *** p < 0.001.

[0025] Figure 5: Stable Cell line Studies – miR-432-5p as therapeutic Target (A) Chart showing lentiviral vectors we developed for use in our studies, their promoters, and selection or fluorescent markers present. These were transfected into iPSC lines creating stable cell lines for further studies. (B) qRT-PCR for mRNA expression of TM6SF2 relative to GAPDH in carrier TM6SF2 rs58542926 iPSCs (7017 cells) stably transfected by nothing (WT), miR-432-5p ASO expression (miR432 ASO), negative control ASO (NC ASO), miR-432 microRNA overexpressing (miR432 OE), or negative control microRNA overexpressing (NC OE). As expected miR-432-5p ASO reverses TM6SF2 rs58542926 RNA instability. Data were analyzed by Student’s t test and presented as mean ± SD. ** p < 0.01.(C) Baseline Lipid accumulation in iHeps after 0.5 mM Oleate challenge in cell lines 1023-5 (non-carrier), GM03529 (non-carrier), 7017-2 (rs58542926 carrier), A3-4 (non-carrier). Data were analyzed by Student’s t test and presented as mean ± SD. ** p < 0.01. (D) Immunofluorescence of iHep line NASH (7017 rs58542926 carrier) and Control (1023 non-carrier) after staining with Nile Red and Hoechst 33342 and imaging in GFP channel. Both lines were imaged at baseline (no lipids) or under 0.5 mM Oleate challenge. Scale bar represents 100µm. (E) Experimental stable cell line Immunofluorescence of iHep line NASH (7017 rs58542926 carrier) and after staining with Nile Red and Hoechst 33342 and imaging in GFP channel. The different lines including WT (rs58542926 carrier), ASO NC (negative control ASO), and miR-432 ASO (miR-432-5p ASO). Lines were imaged at baseline (BSA) or under 300µM Oleate challenge. Scale bar represents 100µm. Data was quantified with Cytation 5 imaging and graphed as mean GFP per cell (see methods). (F) Experimental stable cell line Immunofluorescence of iPSC line NASH (7017 rs58542926 carrier) and after staining with Nile Red and Hoechst 33342 and imaging in GFP channel. The different lines including WT (rs58542926 carrier), ASO NC (negative control ASO), and miR-432 ASO (miR-432-5p ASO). Lines were imaged at baseline (BSA) or under 300µM Oleate challenge. Scale bar represents 100µm. Data was quantified with Cytation 5 imaging and graphed as mean GFP per cell (see methods). Data were analyzed by Student’s t test and presented as mean ± SEM. * p < 0.05; ** p < 0.01.

[0026] Figure 6: Beyond Steatosis, Molecular Consequences (A) Secretion of TG (triglycerides) by iHep cell lines non-carrier1 (1023) versus carrier 1 (7017), and carrier 2 (7192) in mg / dL as measured by Infinity Triglyceride assay and normalized. (n=3 technical replicates). Data were analyzed by Student’s t test versus control and presented as mean ± SD. * p < 0.05. (B) RNA sequencing data extraction for expression of IL6 in TM6SF2 rs58542926 Non- carrier 1, Non-Carrier 2, versus Carrier 1 and Carrier 2. RNA Sequencing was previously published with targeted reanalysis here (22). Data is reported as RPKM (number of reads mapped to a gene x 103x 106divided by total number of mapped reads from given library times gene length in base pairs). (C) RNA sequencing data extraction for expression of IL11 in TM6SF2 rs58542926 Non- carrier 1, Non-Carrier 2, versus Carrier 1 and Carrier 2. RNA Sequencing waspreviously published with targeted reanalysis here (22). Data is reported as RPKM (number of reads mapped to a gene x 103x 106divided by total number of mapped reads from given library times gene length in base pairs). (D) ELISA quantification of secreted cytokines from TM6SF2 non-carrier and Carrier TM6SF2 rs58542926 secretome from iHeps. Cytokines TNF-alpha, IL-6, IL-7, TNF- RII, MCP-1, and MCP-3 were quantified in pg / mL). (n=3 technical replicates in 3 different cell lines). Data were analyzed by Student’s t test versus control and presented as mean ± SEM. * p < 0.05. (E) Cartoon schematic of TM6SF2 wild-type, TM6SF2 rs58542926 with miR-432-5p binding and mRNA degradation with phenotypic triglyceride retention and intrahepatic steatosis. Ideally, we envision and are screening anti-miR-432 inhibitor backbone stabilized oligonucleotides that can block miR432-5p binding specifically to TM6SF2 rs58542926 therefore normalizing both levels of TM6SF2 RNA as well as miR-432 regulation. (F) Cartoon schematic of miR-432 and TM6SF2 rs58542926 functioning as a competing endogenous RNA therefore titrating miR-432-5p away from its normally regulated RNA targets.

[0027] Figure 7: Vectors for AAV transduction (A) pAAV[Exp]-TRE3G>hTM6SF2[NM_001001524.3]:SV40pA- TBG>Tet3G:hMIR432_NR_030173.1:WPRE (“VB230307-1241wwp”) (B) pAAV[Exp]-TRE3G>hTM6SF2[NM_001001524.3]: SV40 pA- UBC>Tet3G:hMIR432_NR_030173.1:WPRE (“VB230307-1244ada”) (C) pAAV[Exp]-TRE3G>hTM6SF2[NM_001001524.3]* (E167K): SV40 pA- UBC>Tet3G:hMIR432_NR_030173.1:WPRE (VB230307-1251gsq) (D) pAAV[Exp]-TRE3G>hTM6SF2[NM_001001524.3]* (E167K): SV40 pA- TBG>Tet3G:hMIR432_NR_030173.1:WPRE (VB230307-1255nzx) Detailed Description

[0028] The disclosure provides products and methods for treating patients carrying the TM6SF2 rs58542926 SNP (“carriers” or “carrier patients”). The disclosure contemplates treating carriers to block binding of miR-432-5p and TM6SF2 rs58542926: • to treat long-term liver inflammation, liver damage or liver disease (including, but not limited to, fatty liver disease, NALFD or NASH); • to prevent cellular senescence in liver; • to prevent liver disease in child, adolescent or adult carriers; • to be used as an anti-neoplastic in liver and / or small intestine;• to be used as a preventative in carriers who also have alcoholic liver disease or another metabolic or caustic disease process; • to be used as a preventative treatment for carriers on liver-damaging medications; and • to be used as therapeutic or preventative in carriers that are diabetic (including those with type I or type II diabetes, or insulin resistance) to prevent liver damage.

[0029] Identifying patients carrying the TM6SF2 rs58542926 SNP

[0030] The TM6SF2 rs58542926 SNP, a single nucleotide substitution (C>T) at nucleotide 499 of the TM6SF2 gene, is identified in patients by methods standard in the art.

[0031] Well-known methods for detecting SNPs include, but are not limited to, DNA genome sequencing methods [e.g., whole-genome sequencing (WGS) such as next- generation sequences (NGS) and targeted gene sequencing], PCR-based methods (especially using real-time PCR platforms) and additional detection methods such as mass spectrometry, SNaPshot, microchip methods, and denaturing high-performance liquid chromatography (DHPLC).

[0032] The general steps for clinical NGS include DNA extraction, library preparation, target enrichment, and sequencing. The resulting raw sequencing data reads undergo various steps, including demultiplexing, quality control, mapping the reads to the reference genome (also called resequencing), variant identification, and annotation. Ultimately, a variant call file is generated with the aforementioned procedure. When a consistent difference is exhibited in multiple reads, a SNP can be called.

[0033] PCR-based methods for the detection of SNPs / mutations can be divided into two types: 1) primers matched with substituted nucleotides or oligonucleotides, to clamp or block the non-targeted template, are used to match mutant-allele-directed specific or polymorphic analysis, and 2) melting curve analysis, using hybridization probes, hydrolysis probes, or double-stranded DNA-binding fluorescent dyes, combined with real-time PCR techniques.

[0034] Allele-specific PCR (ASPCR) is a sequence-specific amplification method using PCR and is also known as mismatch amplification mutation assay. In this method, an amplification-refractory mutation system is used to detect known SNPs / mutations. Primers or probes used in ASPCR are specific for the SNP / mutation under detection, and a PCR amplicon is needed to identify this SNP / mutation. TaqMan probe-based ASPCR for SNP detection has been commercialized for many years, and serves as a basic method to detect SNPs / mutations. This method is appropriate for low-throughput applications. It is based on the energy transfer of fluorescence, in which the proximity of the indicator and quencher dyes in the intact probes reduces the indicator dye fluorescence. When theprobes are mismatched with the template, the difference in annealing temperature varies, influencing the degradation of the probe. These changes are reflected in fluorescence, suggesting the detection of homozygous or heterozygous conditions with mutant or wild- type alleles.

[0035] Melting curve analysis, especially high-resolution melting curve (HRM) analysis, is also widely used to detect SNPs / mutations. HRM analysis can be performed to detect both known and unknown SNPs. Based on variations in the fluorescence of DNA-binding dye, through the conversion of double-stranded DNA to single-stranded DNA with a change in temperature, HRM analysis can detect the existence of SNPs / mutations and confirm the nucleotide substitution type. Melting temperature (Tm) is an elementary thermodynamic characteristic of DNA that can be altered by differences in nucleotide sequence, GC content, and amplicon length. A change in fluorescence indicates a shift in Tm that is visible in the melting curve analysis. Four classes of SNPs can be differentiated by HRM analysis, because these four kinds of SNPs have different Tm changes. G / A and C / T base exchanges (like the C / T base exchange in TM6SF2 rs58542926) comprise the first class of SNP, while G / T and C / A form class two. Classes three and four consist of C / G and A / T base exchanges, respectively. Among the four classes of SNPs, class one and two base exchanges can be clearly genotyped by HRM because of their high Tm differences, of 0.5°C. Class three base exchange induces a Tm difference of 0.4°C, while a difference of 0.3°C is produced by class four base exchange.

[0036] Digital PCR and co-amplification at lower denaturing temperature PCR (COLD- PCR) are also used for detecting SNPs / mutations. In digital PCR (also called realistic single-molecule PCR), a DNA template is typically diluted in 96-well plates, where two wells cover one template molecule, on average. Thereafter, this diluted template is later used for PCR amplification in nested PCR. To distinguish wild-type or mutant sequences, two molecular beacons are added to the reaction mixture before PCR amplification, and the two beacons are labeled with different fluorescent dyes. Without cloning the PCR products in advance, digital PCR is able to determine whether the variants are present in each allele or in only one allele, which is different from other methods. In contrast, the COLD-PCR method is named for its ability to enhance the amplification efficiency of one template by optimizing the denaturing temperature. In COLD-PCR, a critical denaturation temperature (Tc, at which mutation-containing DNA is preferentially melted over wild type) should be used that is lower than the melting temperature (Tm). Furthermore, wild-type and mutant allele heteroduplexes are preferentially denatured over wild-type homoduplexes, enabling the heteroduplexes to be amplified several times more than thehomoduplexes. There are a number of modified COLD-PCR methods, including improved and complete enrichment COLD-PCR and temperature-tolerant COLD-PCR.

[0037] Mass spectrometry, especially matrix-assisted laser desorption ionization time- of-flight mass spectrometry (MALDI-TOF-MS), is also used to analyze genetic variation. SNP genotyping was the first application developed on this platform. MALDI-TOF-MS is very fast, particularly when accompanied by time-of-flight analysis and is useful for analyzing DNA mixtures. In addition, MALDI-TOF-MS enables numerous SNPs to be genotyped in a single multiplexed experiment.

[0038] SNP arrays are a high-throughput method with a considerably automated procedure. SNP arrays are a type of DNA microarray that are designed with probes specific to the targeted genome. The probes are hybridized with a DNA sample to confirm the specific allele of the SNP.

[0039] SNaPshot® (Applied Biosystems) is a commercial mini-sequencing method based on the mechanism of single-base extension. Multiplex PCR is used to amplify the DNA template, to generate targeted amplicons that might contain the focused SNP. This is followed by a purification procedure to degrade unincorporated dNTPs and unbound primers. The 3’-end of the SNaPshot primer binds the focused SNP and is lengthened by DNA polymerase, while the oligonucleotide tails (i.e., CT or poly C) can be incorporated into the 5’-end of the detection primer, which aids in the detection of single-base extension products by capillary electrophoresis. These features enable SNaPshot to multiplex up to 30 to 40 SNPs in a single assay.

[0040] DHPLC is also widely used in SNP detection and analysis. It utilizes a reusable matrix that is primarily composed of alkylated nonporous poly beads (styrene- divinylbenzene), meaning that results can be obtained without the need for visible gel electrophoresis. Heteroduplex fractions, such as variant alleles, can be concentrated by DHPLC, and this is followed by direct sequencing or cloning plus sequencing to characterize the detected variation.

[0041] Patients carrying the TM6SF2 rs58542926 SNP are treated with products and methods provided here.

[0042] At the most general level, products and methods provided herein block binding of of microRNA 432 (miR-532-5p) to TM6SF2 rs58542926 RNA. Alternatively, products and methods provided herein revert the TM6SF2 rs58542926 SNP to the wild-type base pair at position 499 of the gene.

[0043] Antisense oligonucleotides

[0044] Antisense oligonucleotides (ASOs) are short, synthetic stretches of RNA or DNA analogs complementary to a target RNA. ASOs can be broadly subdivided based on the mode of action. One class of ASOs, referred to as blocking ASOs herein, functions throughsteric hindrance. Blocking ASOs do not trigger target mRNA degradation. Blocking ASO products provided herein (“miR-432-5P ASO”) block binding of miR-432-5p to rs58542926 RNA. Blocking ASOs provided herein can bind to miR-432-5P or to rs58542926 RNA.

[0045] Various chemical modifications can increase the stability, affinity, and activity of ASOs. Blocking ASO products provided herein comprise ASOs about eighteen to about thirty nucleotides long, and have a phosphorothioate (PS) linkage between the nucleosides that form the oligonucleotide backbone or have 2′MOE and 2′OMe substituents. In addition, nucleotides at each flank can be further modified to protect the ASO from exonucleases, increasing its stability in vivo. LNA modification can be used to improve the binding of ASO to mRNA and reduce the side effects that are associated with the presence of phosphorothioate residues.

[0046] Sequences of illustrative blocking ASOs for TM6SF2 rs58542926 RNA are set out below. 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG*rArG-3’ (Mir-Mask-001 or miR-Mask1) (SEQ ID NO: 1) wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*+G*+A*G-3’ (Mir-Mask-002 or miR- Mask2) (SEQ ID NO: 2) wherein + indicates locked nucleic acid technology and * indicates a phosphorothioate bond (The “locked” part of the name comes from a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring (Figure 1). The bridge bond fixes the pentose ring in the 3′-endo conformation. The oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA.) miR-Mask3 (like miR-Mask1 but part of seed excluded) (SEQ ID NO: 3) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG-3’, wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond miR-Mask4 (like miR-Mask1 but part of seed excluded) (SEQ ID NO: 4) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU-3’ wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bondmiR-Mask5 (like miR-Mask2 but part of seed excluded) (SEQ ID NO: 5) 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask6 (covers 3’ part of strand, part of seed excluded) (SEQ ID NO: 6) 5’-+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask7 (covers 3’ part of strand, part of seed excluded) (SEQ ID NO: 7) 5’-+G*+G*+A*G*CTGTATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask8 (covers 3’ part of strand, seed excluded) (SEQ ID NO: 8) 5’-+G*+C*+T*G*TATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA miR-Mask9 (covers 3’ part of strand, seed excluded) (SEQ ID NO: 9) 5’-+C*+T*G*TATCTTCCATGGT+G*+C*-3’, wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA UCUUGGAGUAGGUCAUUGGGUGG (Sigma HLTUD0572) (SEQ ID NO: 10)

[0047] ASO delivery

[0048] ASOs can be delivered to a patient, for example, using nonviral delivery systems. Illustrative nonviral delivery systems are described in Huang et al., Nonviral delivery systems for antisense oligonucleotide therapeutics. Biomaterials Res 26, 49 (2022) (doi.org / 10.1186 / s40824-022-00292-4).

[0049] As another example, Gal-Nac or cholesterol-modified ASOs are contemplated herein. Such modified ASOs are taken-up by liver receptors (18). These can be injected or eaten in pill form and absorbed into the liver.

[0050] ASOs can be delivered, as yet another example, using a viral vector comprising a polynucleotide encoding an RNA ASO.

[0051] The disclosure provides viral vector products comprising a polynucleotide of the disclosure or a combination of polynucleotides of the disclosure. Provided are viral vectors [such as adeno-associated virus (AAV), adenovirus, retrovirus, lentivirus, equine- associated virus, alphavirus, pox virus, herpes virus, herpes simplex virus, polio virus, sindbis virus, vaccinia virus or a synthetic virus, e.g., a chimeric virus, mosaic virus, or pseudotyped virus, and / or a virus that contains a foreign protein, synthetic polymer, nanoparticle, or small molecule] to deliver the polynucleotides disclosed herein.

[0052] AAV vectors

[0053] AAV is a replication-deficient parvovirus, the single-stranded DNA genome of which is about 4.7 kb in length including 145 nucleotide inverted terminal repeat (ITRs). There are multiple serotypes of AAV. The nucleotide sequences of the genomes of the AAV serotypes are known. For example, the complete genome of AAV-1 is provided in GenBank Accession No. NC_002077; the complete genome of AAV-2 is provided in GenBank Accession No. NC_001401 and Srivastava et al., J. Virol., 45: 555-564 (1983); the complete genome of AAV-3 is provided in GenBank Accession No. NC_1829; the complete genome of AAV-4 is provided in GenBank Accession No. NC_001829; the AAV- 5 genome is provided in GenBank Accession No. AF085716; the complete genome of AAV-6 is provided in GenBank Accession No. NC_001862; at least portions of AAV-7 and AAV-8 genomes are provided in GenBank Accession Nos. AX753246 and AX753249, respectively; the AAV -9 genome is provided in Gao et al., J. Virol., 78: 6381-6388 (2004); the AAV-10 genome is provided in Mol. Ther., 13(1): 67-76 (2006); the AAV-11 genome is provided in Virology, 330(2): 375-383 (2004); portions of the AAV-12 genome are provided in Genbank Accession No. DQ813647; portions of the AAV-13 genome are provided in Genbank Accession No. EU285562. The sequence of the AAV rh.74 genome is provided in see U.S. Patent 9,434,928, incorporated herein by reference. The sequence of the AAV- B1 genome is provided in Choudhury et al., Mol. Ther., 24(7): 1247-1257 (2016). Cis- acting sequences directing viral DNA replication (rep), encapsidation / packaging and hostcell chromosome integration are contained within the AAV ITRs. Three AAV promoters (named p5, p19, and p40 for their relative map locations) drive the expression of the two AAV internal open reading frames encoding rep and cap genes. The two rep promoters (p5 and p19), coupled with the differential splicing of the single AAV intron (at nucleotides 2107 and 2227), result in the production of four rep proteins (rep 78, rep 68, rep 52, and rep 40) from the rep gene. Rep proteins possess multiple enzymatic properties that are ultimately responsible for replicating the viral genome. The cap gene is expressed from the p40 promoter and it encodes the three capsid proteins VP1, VP2, and VP3. Alternative splicing and non-consensus translational start sites are responsible for the production of the three related capsid proteins. A single consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are reviewed in Muzyczka, Current Topics in Microbiology and Immunology, 158: 97-129 (1992).

[0054] AAV possesses unique features that make it attractive as a vector for delivering foreign DNA to cells, for example, for ASO delivery, gene editing or gene therapy. AAV infection of cells in culture is noncytopathic, and natural infection of humans and other animals is silent and asymptomatic. Moreover, AAV infects many mammalian cells allowing the possibility of targeting many different tissues in vivo. Moreover, AAV transduces slowly dividing and non-dividing cells, and can persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is infectious as cloned DNA in plasmids which makes construction of recombinant genomes feasible. Furthermore, because the signals directing AAV replication, genome encapsidation and integration are contained within the ITRs of the AAV genome, some or all of the internal approximately 4.3 kb of the genome (encoding replication and structural capsid proteins, rep-cap) may be replaced with foreign DNA. The rep and cap proteins may be provided in trans. Another significant feature of AAV is that it is an extremely stable and hearty virus. It easily withstands the conditions used to inactivate adenovirus (56 to 65oC for several hours), making cold preservation of AAV less critical. AAV may even be lyophilized. Finally, AAV-infected cells are not resistant to superinfection.

[0055] As exemplified herein, the AAV vector lacks rep and cap genes. The AAV can be a recombinant AAV (rAAV) or a self-complementary recombinant AAV (scAAV). The AAV has a capsid serotype can be from, for example, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, AAV rh.74, AAV rh.8, or AAVrh.10.

[0056] Viral vectors provided include, for example, AAV1 (i.e., an AAV containing AAV1 inverted terminal repeats (ITRs) and AAV1 capsid proteins), AAV2 (i.e., an AAV containingAAV2 ITRs and AAV2 capsid proteins), AAV3 (i.e., an AAV containing AAV3 ITRs and AAV3 capsid proteins), AAV4 (i.e., an AAV containing AAV4 ITRs and AAV4 capsid proteins), AAV5 (i.e., an AAV containing AAV5 ITRs and AAV5 capsid proteins), AAV6 (i.e., an AAV containing AAV6 ITRs and AAV6 capsid proteins), AAV7 (i.e., an AAV containing AAV7 ITRs and AAV7 capsid proteins), AAV8 (i.e., an AAV containing AAV8 ITRs and AAV8 capsid proteins), AAV9 (i.e., an AAV containing AAV9 ITRs and AAV9 capsid proteins), AAVrh74 (i.e., an AAV containing AAVrh74 ITRs and AAVrh74 capsid proteins), AAVrh.8 (i.e., an AAV containing AAVrh.8 ITRs and AAVrh.8 capsid proteins), AAVrh.10 (i.e., an AAV containing AAVrh.10 ITRs and AAVrh.10 capsid proteins), AAV11 (i.e., an AAV containing AAV11 ITRs and AAV11 capsid proteins), AAV12 (i.e., an AAV containing AAV12 ITRs and AAV12 capsid proteins), or AAV13 (i.e., an AAV containing AAV13 ITRs and AAV13 capsid proteins).

[0057] DNA plasmids of the disclosure comprise recombinant AAV (rAAV) genomes of the disclosure. The DNA plasmids are transferred to cells permissible for infection with a helper virus of AAV (e.g., adenovirus, E1-deleted adenovirus or herpes virus) for assembly of the rAAV genome into infectious viral particles. Techniques to produce rAAV particles, in which an AAV genome to be packaged, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep genes may be from any AAV serotype for which recombinant virus can be derived and may be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. IAAV DNA in the rAAV genomes can be from any AAV serotype for which a recombinant virus can be derived including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, AAV-anc80, and AAV rh.74. Other types of rAAV variants, for example rAAV with capsid mutations, are also included in the disclosure. See, for example, Marsic et al., Molecular Therapy 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art. Use of cognate components is specifically contemplated. Production of pseudotyped rAAV is disclosed in, for example, WO 01 / 83692 which is incorporated by reference herein in its entirety.

[0058] The AAV vector can be a pseudotyped AAV, containing ITRs from one AAV serotype and capsid proteins from a different AAV serotype. The pseudo-typed AAV can be AAV2 / 9 (i.e., an AAV containing AAV2 ITRs and AAV9 capsid proteins). The pseudotyped AAV can be AAV2 / 8 (i.e., an AAV containing AAV2 ITRs and AAV8 capsidproteins). The pseudotyped AAV can be AAV2 / 1 (i.e., an AAV containing AAV2 ITRs and AAV1 capsid proteins).

[0059] The AAV vector can contain a recombinant capsid protein, such as a capsid protein containing a chimera of one or more of capsid proteins from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh74, AAVrh.8, or AAVrh.10, AAV10, AAV11, AAV12, or AAV13. Other types of rAAV variants, for example rAAV with capsid mutations, are also contemplated. See, for example, Marsic et al., Molecular Therapy, 22(11): 1900-1909 (2014). As noted above, the nucleotide sequences of the genomes of various AAV serotypes are known in the art.

[0060] AAV vectors herein lack rep and cap genes. The AAV can be a recombinant AAV, a recombinant single-stranded AAV (ssAAV), or a recombinant self-complementary AAV (scAAV).

[0061] Recombinant AAV genomes provided herein comprise an expression cassette comprising a promoter that directs transcription of one or more polynucleotides of interest. The polynucleotides of interest can encode, for example, an ASO, a prime editing system, the wild type TM6SF2 protein (UniProtKB / Swiss-Prot: Q9BZW4) or a combination thereof. As another example, the polynucleotide of interest can overexpress miR-432-p5 and TM6SF2 as an alternative way to de-repress TM6SF2. Promoters that function in the target cell type, such as hepatocytes and / or intestinal epithelial cells, are chosen. Illustrative promoters include, but are not limited to, TTR1, EF1alpha, Afp, Albumin, TBG and U6 promoters for microRNA or ASO.

[0062] A method of generating a packaging cell is to create a cell line that stably expresses all the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) comprising a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing [Samulski et al., Proc. Natl. Acad. S6. USA, 79:2077-2081 (1982)], addition of synthetic linkers containing restriction endonuclease cleavage sites [Laughlin et al., Gene, 23:65-73 (1983)] or by direct, blunt-end ligation [Senapathy & Carter, J. Biol. Chem., 259:4661-4666 (1984)]. The packaging cell line is then infected with a helper virus such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large- scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus rather than plasmids to introduce rAAV genomes and / or rep and cap genes into packaging cells.

[0063] General principles of rAAV production are reviewed in, for example, Carter, Current Opinions in Biotechnology, 1533-1539 (1992); and Muzyczka, Curr. Topics inMicrobiol. and Immunol., 158: 97-129 (1992). Various approaches are described in Ratschin et al., Mol. Cell. Biol.4:2072 (1984); Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984); Tratschin et al., Mol. Cell. Biol.5: 3251 (1985); McLaughlin et al., J. Virol., 62: 1963 (1988); and Lebkowski et al., Mol. Cell. Biol., 7: 349 (1988). Samulski et al., J. Virol., 63: 3822-3828 (1989); U.S. Patent No.5,173,414; WO 95 / 13365 and corresponding U.S. Patent No.5,658.776; WO 95 / 13392; WO 96 / 17947; PCT / US98 / 18600; WO 97 / 09441 (PCT / US96 / 14423); WO 97 / 08298 (PCT / US96 / 13872); WO 97 / 21825 (PCT / US96 / 20777); WO 97 / 06243 (PCT / FR96 / 01064); WO 99 / 11764; Perrin et al., Vaccine, 13:1244-1250 (1995); Paul et al., Hum. Gene Ther., 4:609-615 (1993); Clark et al., Gene Ther., 3: 1124-1132 (1996); U.S. Patent. No.5,786,211; U.S. Patent No. 5,871,982; U.S. Patent. No.6,258,595; and McCarty, Mol. Ther., 16(10): 1648-1656 (2008). The foregoing documents are hereby incorporated by reference in their entirety herein, with particular emphasis on those sections of the documents relating to rAAV production. The production and use of self-complementary (sc) rAAV are specifically contemplated and exemplified.

[0064] The disclosure further provides packaging cells that produce AAV vectors. Packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells and PerC.6 cells (a cognate 293 line). In another embodiment, packaging cells are cells that are not transformed cancer cells, such as low passage 293 cells (human fetal kidney cells transformed with E1 of adenovirus), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells) and FRhL-2 cells (rhesus fetal lung cells).

[0065] Recombinant AAV (rAAV) (i.e., infectious encapsidated rAAV particles) are thus provided herein. The genomes of the rAAV lack AAV rep and cap DNA, that is, there is no AAV rep or cap DNA between the ITRs of the genomes of the rAAV.

[0066] The rAAV may be purified by methods standard in the art such as by column chromatography or cesium chloride gradients. Methods for purifying rAAV vectors from helper virus are known in the art and include methods disclosed in, for example, Clark et al., Hum. Gene Ther., 10(6): 1031-1039 (1999); Schenpp and Clark, Methods Mol. Med., 69: 427-443 (2002); U.S. Patent No.6,566,118 and WO 98 / 09657.

[0067] Compositions comprising the nucleic acids and viral vectors of the disclosure are provided. Compositions comprising delivery vehicles (such as rAAV) described herein are provided. Such compositions also comprise a pharmaceutically acceptable carrier. The compositions may also comprise other ingredients such as diluents and adjuvants. Acceptable carriers, diluents and adjuvants are nontoxic to recipients and are preferably inert at the dosages and concentrations employed, and include buffers such as phosphate, citrate, or other organic acids; antioxidants such as ascorbic acid; low molecular weightpolypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and / or nonionic surfactants such as Tween, pluronics or polyethylene glycol (PEG).

[0068] Methods of treatment with delivery by AAV

[0069] The disclosure provides methods of treatment of carrier patients comprising delivery of an AAV. ASO provided herein can be delivered, for example, by AAV encoding the ASO as described above. As another example, rAAV can deliver components of a prime editing system (a gene editing system) described below that reverts the rs58542926 SNP to wild-type. As yet another example, rAAV can deliver a wild-type TM6SF2 gene for gene therapy as described below.

[0070] Methods of transducing a target cell with a delivery vehicle (such as rAAV), in vivo or in vitro, are contemplated. Target cells include, but are not limited to, hepatocytes and intestinal epithelial cells. The in vivo methods comprise the step of administering an effective dose, or effective multiple doses, of a composition comprising a delivery vehicle (such as rAAV) to a patient (including a human patient) in need thereof. If the dose is administered prior to development of a disorder / disease, the administration is prophylactic. If the dose is administered after the development of a disorder / disease, the administration is therapeutic. An effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease state being treated, that slows or prevents progression to a disorder / disease state, that slows or prevents progression of a disorder / disease state, that diminishes the extent of disease, that results in remission (partial or total) of disease, and / or that prolongs survival. As examples, an effective dose is contemplated to result in: lowered AST and / or ALT serum enzyme levels; decreased miR- 122 serum levels; decreased evidence of inflammation and / or apoptosis on liver biopsy; decreased markers of liver inflammation; decreased markers of fatty liver disease or alcoholic liver disease; decreased markers of any other liver disease; and / or decreased makers of liver damage.

[0071] Titers of rAAV to be administered in methods of the invention will vary depending, for example, on the particular rAAV, the mode of administration, the treatment goal, the individual, and the cell type(s) being targeted, and may be determined by methods standard in the art. Titers of rAAV may range from about 1x106, about 1x107, about 1x108, about 1x109, about 1x1010, about 1x1011, about 1x1012, about 1x1013, about 1x1014, about 1x1016, or more DNase resistant particles (DRP) per ml. Dosages may be expressed in units of viral genomes (vg). Dosages contemplated herein include about1x107vg, about 1x108vg, about 1x109vg, about 5x109vg, about 6 x109vg, about 7x109vg, about 8x109vg, about 9x109vg, about 1x1010vg, about 2x1010vg, about 3x1010vg, about 4x1010vg, about 5x1010vg, about 1x1011vg, about 1.1x1011vg, about 1.2x1011vg, about 1.3x1011vg, about 1.2x1011vg, about 1.3x1011vg, about 1.4x1011vg, about 1.5x1011vg, about 1.6x1011vg, about 1.7x1011vg, about 1.8x1011vg, about 1.9x1011vg, about 2x1011vg, about 3x1011vg, about 4x1011vg, about 5x1011vg, about 1x1012vg, about 1x1013vg, about 1.1x1013vg, about 1.2x1013vg, about 1.3x1013vg, about 1.5x1013vg, about 2 x1013vg, about 2.5 x1013vg, about 3 x 1013vg, about 3.5 x 1013vg, about 4x 1013vg, about 4.5x 1013vg, about 5 x 1013vg, about 6x1013vg, about 1x1014vg, about 2 x1014vg, about 3 x 1014vg, about 4x 1014vg, about 5x1014vg, about 1x1015vg, to about 1x1016vg, or more total viral genomes. Dosages of about 1x109vg to about 1 x1010vg, about 5x 109vg to about 5 x1010vg, about 1x1010vg to about 1x 1011vg, about 1x1011vg to about 1x1015vg, about 1x1012vg to about 1x1015vg, about 1x1012vg to about 1x1014vg, about 1x1013vg to about 6x1014vg, and about 6x1013vg to about 1.0x1014vg, 2.0x1014vg, 3.0x1014vg, 5.0x1014are also contemplated. For example, CSF doses can range between about 1x1013vg / patient to about 1 x1015vg / patient based on age groups. For example, intravenous delivery doses can range between 1x1013vg / kilogram (kg) body weight and 2 x1014vg / kg.

[0072] Molecular, biochemical, histological, and functional outcome measures demonstrate the therapeutic efficacy of the methods.

[0073] Combination therapies are also contemplated by the invention. Combination as used herein includes both simultaneous treatment and sequential treatments. Combinations of methods described herein with standard medical treatments and supportive care are specifically contemplated.

[0074] Thus, methods are provided of administering an effective dose (or doses, administered essentially simultaneously or doses given at intervals) of rAAV described herein to subject in need thereof.

[0075] Methods of treatment using prime editing

[0076] The disclosure provides methods of treating carrier patients by prime editing.

[0077] Prime editing uses specialized machinery consisting of a prime editing guide RNA (pegRNA) and a Cas9 enzyme fused to a reverse transcriptase. The version of Cas9 used in prime editing has one of its two nuclease domains deactivated, turning it into a “nickase” that will only cut one of the DNA strands, rather than both. When the pegRNA binds to the target sequence in the DNA, the Cas9 nickase cuts the strand and creates a DNA “flap.” The other end of the pegRNA acts as a template; part of it complements the flap, and another part bears the desired edit. The flap binds to a matching site, and the reverse transcriptase adds in the desired edit. The edited flap is incorporated back into theDNA, and with the help of a second nick on the complementary strand, DNA repair mechanisms fix the other strand to match the edit.

[0078] Instead of using a fully functional Cas9 endonuclease, prime editing uses PEs. All PEs contain the Cas9 nickase, the domain of the RNA-guided Cas9 protein that cuts DNA. The Cas9 nickase domain is fused to a reverse transcriptase (RT) domain, which reencodes RNA back into DNA. The two domains combine and form a complex with a prime editing guide RNA (pegRNA). PegRNA provides the template for the desired edits to be integrated into target cells. All pegRNA sequences comprise three components. First, the pegRNA contains a spacer sequence that indicates to the PE the target DNA sequence to be modified. Second, the sgRNA scaffold guides the PE to the target region. Lastly, the sgRNA is extended with a 3’ extension sequence. This sequence contains a primer binding sequence (PBS) complementary to a portion of the PAM sequence, the protospacer, and an RT template that contains the desired edit. Precise genome editing begins with the PE complex coming to its binding site and binding the target sequence. Once bound, the Cas9 nickase domain cuts the PAM-containing strand at the region indicated by the pegRNA. The double-stranded DNA then becomes single-stranded at the target region. PegRNA hybridization to the target sequence: One of the single strands hybridizes with the pegRNA spacer sequence. The 3’ end of the pegRNA binds the PBS sequence with the PAM strand. This creates the DNA complex that enables the edited DNA to be reverse-transcribed. The RT domain of the PE then reverse transcribes the RNA sequence containing the gene edit into the target DNA sequence. This yields a DNA flap from the old DNA sequence that equilibrates to ultimately allow the reverse- transcribed DNA sequence to ligate into the DNA template.

[0079] Thus, in prime editing treatment methods provided herein, the pegRNA comprises an RT template that directs the replacement of the rs58542926 SNP cytosine at position 499 to the wild-type thymine. As yet another example, in gene therapy treatment methods provided herein, rAAV can deliver a wild-type TM6SF2 gene.

[0080] Methods of treatment by AAV gene therapy

[0081] The disclosure provides methods of treating carrier patients by gene therapy.

[0082] The methods deliver a rAAV comprising a genome comprising a wild-type TM6SF2 gene (NCBI Gene 53345) encoding transmembrane 6 superfamily member 2 (UniProtKB / Swiss-Prot: Q9BZW4).

[0083] Other terminology and disclosure

[0084] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any element, e.g., any optional element.As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0085] When a range of values is provided herein, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0086] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure.

[0087] Experiments described were run in at least triplicate. Statistical significance was represented as standard error of the mean (SEM) and was determined using Student t test or Anova analysis as appropriate (GraphPad Prism, La Jolla, CA).

[0088] All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials for the purpose for which the publications are cited.

[0089] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. This disclosure is intended to provide support for all such combinations.

[0090] As used herein, “may,” “may comprise,” “may be,” “can,” “can comprise,” “can be” and “contemplated” all indicate something envisaged by the inventors that is functional and available as part of the subject matter provided. Examples

[0091] NAFLD and its associated liver scarring and neoplastic risk has a much higher prevalence in patients with relatively recently discovered SNPs. Previously, TM6SF2 rs585429926 was discovered through GWAS studies as a SNP strongly associated with hepatic steatosis, fibrosis, inflammation, and liver cancer as well as inversely associatedwith serum cholesterol and triglycerides (10). Early studies in synthetic vector constructs using tumor lines demonstrated that rs585429926 resulted in protein degradation with stable RNA.

[0092] In experiments described herein, bonafide NASH family skin cells were reprogrammed to iPSCs (induced pluripotent stem cells) and differentiated to iHeps using previously established methods. Quantification of endogenous RNA levels in patient- derived heterozygous rs585429926 iHeps showed approximately half the level of available RNA available for translation into protein. Prompted by these findings, the reason for this instability in rs585429926 RNA was determined. The experiments described herein demonstrate that rs585429926 leads to the generation of a novel but unusual microRNA 432 (miR-432-5p) binding site corresponding to a region in the coding sequence of TM6SF2.

[0093] Indeed, wild-type TM6SF2 RNA is not predicted to be targeted by miR-432-5p by either Targetscan or miRDB (23, 24). For example, all seventeen predicted microRNA targets in miRDB were present in the 3’ untranslated region (3’-UTR). Instead, our predicted target is within the exon coding region. MicroRNA regulation of genes by binding within coding regions is less common than within the 3’-UTR, and in TM6SF2 may represent a novel mechanism more similar to that of plant microRNAs (37). More commonly, mature mammalian microRNAs complex with Argonaute forming the RNA- induced silencing complex (RISC) with the microRNA guiding the protein to its target via complementarity. The RISC complex then binds the 3’-UTR resulting in either RNA destabilization or stalling of the protein translation complex (38). mRNA degradation also usually requires a near-perfect match to its target, and our microRNA match is imperfect (mirDB predicted targeting score of 70) (39).

[0094] ASO (anti-sense oligonucleotide) studies quenching miR-432-5p described herein rescued stability of TM6SF2 rs585429926 RNA restoring its function and normalizing hepatocyte functions including reducing steatosis. Treatment of cells with miR- 432-5p ASO binds up all available miR-432-5p and stabilizes TM6SF2 rs58542926 RNA allowing translation of functional TM6SF2 protein and normal VLDL lipidation. Consistent with these results, the disclosure contemplates that miR-432-5p and rs585429926 represent a competitive endogenous axis connecting long-term risk factors for steatosis, inflammation, fibrosis, and carcinoma in this unique patient cohort.

[0095] While the following examples describe specific embodiments, variations and modifications will occur to those skilled in the art. Accordingly, only such limitations as appear in the claims should be placed on the invention. Example 1rs585429926 NASH patient iPSCs and iHeps show unstable RNA

[0096] Experiments by Kozlitina et al. were reported to show that overexpression of wild-type TM6SF2 versus rs58542926 resulted in nearly equivalent expression in Huh7 cultures (1). This result was treated as dogma in the literature in the field, and the assumption was that TM6SF2 E167K missense protein was a catalytically inactive or unstable protein (40, 41).

[0097] In experiments detailed below, the gene expression of genotyped TM6SF2 cell lines with wild-type TM6SF2 (non-carrier) and TM6SF2 rs58542926 (carrier) was tested. For these experiments, three independent individuals with wild-type TM6SF2 and three additional individuals with rs58542926 TM6SF2 were tested for gene expression by real- time quantitative PCR (qRT-PCR) in both induced pluripotent stem cells (iPSC) and iPSC- derived hepatocytes (iHep) from the same individuals. On average, patient samples in both iHep and iPSC samples showed approximately half the gene expression in TM6SF2 rs58542926 carriers versus wild-type non-carrier controls using multiple different primers pairs tested. This demonstrated there was a stability problem with the TM6SF2 rs58542926 RNA which was not previously recognized.

[0098] In the experiments, patients that had undergone transplant for severe NASH were biopsied and skin fibroblasts were reprogrammed to induced pluripotent stem cells (IPSC) (22) using lentiviral vectors.

[0099] Cell Culture of iPSCs

[0100] The media conditions to maintain human iPSCs were previously described (29). Cells were grown on growth factor reduced Matrigel Matrix basement membrane (REF 356231, lot 7114006, Corning). For passaging the cells Accutase (StemCell Technologies, Vancouver, BC) was used for 5 min at 37°C and then stopped and pelleted by gentle centrifugation with iPSC media containing 10µM Y-27632 (Selleckchem, Houston, TX) (30). The dissociated iPSCs were seeded in new plates with media containing Y-27632, and after 24 hours replaced with media alone. IPSC media was changed daily. Cells were routinely tested and confirmed negative for Mycoplasma contamination by MycoAlert (Lonza).

[0101] Lentiviral constructs and protocol.

[0102] Lentiviral constructs were ordered from Vectorbuilder. Lentivirus was grown, concentrated and produced by standard techniques.

[0103] FACS clonal isolation of cells.

[0104] After infection by lentiviral vectors, cells were separated on a FACS AriaII (BD Biosciences) for single cells with clonal outgrowth and / or selection. Individual clones were grown out and tested for whether other not desired genetic edits were present by Sanger Sequencing, RTqPCR, and additional experiments. Individual clones were isolated bysorting single iPSCs to wells of a 96-well plate precoated with Matrigel with iPSC media containing 10µM Y-27632 and 2µM doxycycline. Clonal iPSC isolates were expanded by weekly passaging and standard iPSC culture as described above.

[0105] iPSC-Heps differentiation

[0106] Induction of Definitive Endoderm (days 0-7).

[0107] IPSCs were plated on 6, 12, or 96-well Matrigel-coated plates (growth factor reduced, REF 356231, lot 7114006, Corning) at different densities for differentiation. For example, typical plating density in a single well of a 6 well plate was 500,000 cells or 20,000 cells per well for 96 well plates. The differentiation process consisted on one week of RPMI media supplemented with Gem21 NeuroPlex without insulin (Gemini Bio-Products catalog #400-962, Gemini, West Sacramento, California), Glutagro catalog# 25-015-Cl (Corning, Manassas, VA), Non-essential amino acids catalog # 11-140-050 (Gibco), Sodium Butyrate (0.5 mM) catalog # B5887 (Sigma Aldrich) and recombinant human Activin A (100 ng / mL) Peprotech catalog #120-14E for 7 days at 20% oxygen, 5% C02. On the day before differentiation (day 0), cells were re-plated on Matrigel coated plates in the presence of 2µM doxycycline and 10µM Y-27632. On day 1 of induction, 2% KnockOut Serum Replacement (KSR) Gibco Catalog # 10828028, CHIR-99021 Selleckchem catalog # S2924 (3mM), PI-103 (50nM) Selleckchem catalog # S1038 and recombinant human BMP4 (10ng / mL) Peprotech catalog #120-05ET and FGF2 (20ng / mL) Peprotech catalog #100-18B were added to the media. On day 2, 1% KSR, PI-103 (50nM) and BMP4 (10ng / mL) and FGF2 (20ng / mL) and on day 3, 0.2% KSR and PI-103 (50nM) were added to the media. Doxycycline hyclate (Acros Organics catalog #446061000) was added throughout definitive endoderm induction at various doses as described in text with a standard dose being 2μM.

[0108] Differentiation of Definitive Endoderm to hepatocytes (days 8-23).

[0109] IPSC-derived human endoderm from above was cultured continuously on Matrigel or split up to 1:4 onto Matrigel plates for hepatic differentiation. Definitive endoderm (DE) was cultured in Iscove’s modified Dulbecco’s medium (Gibco catalog # supplemented with Gem21 NeuroPlex without insulin (Gemini Bio-Products catalog #400- 962), Glutagro, NEAA, 0.3 mM monothioglycerol, 0.126 M / mL human insulin (Sigma), and 100 nM dexamethasone. To induce hepatoblasts, cells were treated with FGF2 (10 ng / mL) and BMP4 (20 ng / mL) for 5 days at 5% oxygen, 5% C02. To further differentiate the cells towards hepatocytes, cells were treated with FGF2 (10 ng / mL), BMP4 (20 ng / mL), and recombinant human HGF (20 ng / mL) Peprotech catalog #100-39 for 5 days at 5% oxygen, 5% C02. This was followed by changing the culture conditions to Lonza Hepatocyte Culture Media BulletKit (HCM Catalog # CC-3198) with HGF (20 ng / mL) and recombinanthuman Oncostatin M (20 ng / mL) Peprotech catalog # 300-10 for 5 additional days at 20% oxygen, 5% C02. In the BulletKit, use of EGF was excluded.

[0110] From whole genome sequencing, a family of patients was determined to be carriers of TM6SF2 rs585429926 which was confirmed by Sanger Sequencing (Figure 2D). As part of an overall analysis, the endogenous transcription of TM6SF2 was characterized in these heterozygous rs585429926 carriers compared to numerous non- carrier lines from 17 different iPSCs and their derived iPSC-hepatocytes (iHEPs).

[0111] RNA isolation, Real-Time PCR analysis, and RNA Sequencing.

[0112] Total RNA was isolated by Qiagen RNeasy mini kit or Zymo Direct-zol RNA kits. Complementary DNA (cDNA) was synthesized by qScript cDNA SuperMix (Quantabio). Quantitative Real-Time PCR (qrtPCR) was performed using FastStart Universal SYBR Green, Roche Diagnostics (Indianapolis, IN) Primers were made by IDT. Primers used for qrtPCR include Taqman primers for TM6SF2 including Assay ID Hs00403495_m1.

[0113] Immunohistochemistry and Cell staining

[0114] IPSCs and iHeps were fixed using 4% paraformaldehyde for 15 min, permeabilized using 0.1% triton X-100 for 10 minutes followed by 3x PBS (phosphate buffered saline, Corning Life Sciences) rinses and blocked with 1.5% bovine serum albumin for 1 h. Samples were incubated with primary antibody overnight (List of all antibodies with dilutions 1:100 - 1:1000,OCT3 / 4 (Santa Cruz, #sc-9081, 1:500, SOX2 (Proteintech, #11064-1-AP, 1:1000), NANOG (Proteintech, #14295-1-AP, 1:1000), SSEA (Proteintech, #19497-1-AP, 1:500), TRA 1-60 (Proteintech, #18150-1-AP, 1:500), HNF⍺4 (Proteintech, #26245-1-AP, 1:500, Albumin (Bethyl, #A80-129A, 1:500, AFP (Thermo Scientific, #RB-365-A1, 1:500), ki-67 (8D5) (Cell Signaling, #9449, 1:800), Cleaved Caspase-3 (Cell Signaling, #9661, 1:400)) in blocking solution. The cells were rinsed extensively with PBS and incubated for 60 min with secondary antibody at 1:1000 in blocking solution. The secondary antibodies used were: Alexa Fluor 555 donkey anti- mouse IgG (H+L), Alexa Fluor 488 goat anti-rabbit (H+L) (Invitrogen, Carlsbad, CA). After washing 3 times with PBS, DAPI (4′,6-diamidino-2-phenylindole, MP Biomedicals, Solon, OH) was added at 300 nM for 15 min. After 3x PBS washes, the cells were imaged using an BIOTEK Cytation 5 Microscope (Winooski, VT). MitoTracker Orange CMTMRos staining was performed as follows: iPSCs were plated, induced 24 hours with or without 1mM doxycycline, and 24 hours later, Mitotracker Orange dye was added for 45 minutes in PBS buffer at 37 degrees for 30 minutes, and then rinsed in PBS. Cells were then fixed with 4% PFA and Hoechst 33342, rinsed in PBS and imaged with Cytation5 imager, BioTek Instruments. Image were analyzed using Biotek Imaging software. Primary and secondary mask analyses on digital images were used to quantify based on nuclei and antibody staining in secondary mask. Threshold analysis was set to exclude artifacts.

[0115] Luminex ELISA assay. Performed as per manufacturers’ specifications. Briefly, iHep or iPSC Supernatant was collected from normalized cell number and analyzed per specification using the ProcartaPlex multiplex assay Preconfigured panels (ThermoFisher Scientific).

[0116] As explained above, in contrast to the original description of rs585429926 and synthetic construct experiments which showed stable RNA expression, the experiments herein showed unstable RNA with an approximate ~50% decrease in RNA levels (Figure 1A). This disproves the Glu167Lys variant form is “misfolded” and undergoing accelerated intracellular degradation as previously reported (10).

[0117] Further experiments in both iPSCs and iHeps from a bonafide NASH family confirmed a decrease in TM6SF2 protein levels (by western blot) in heterozygous rs585429926 carriers as might be expected by decreased RNA levels (Figure 1F).

[0118] Western blot analysis. Performed as previously described (31). Protein bands were visualized by Odyssey Infrared Imager scanner and band intensities were quantified using the Image Studio software (LI-COR Biosciences).

[0119] The western blots of TM6SF2 were performed in iPSC and iHep lines carrying both wild-type and rs58542926. Unfortunately, none of the commercial TM6SF2 antibodies showed convincing specificity so lentivectors were generated expressing either wild-type or rs58542926 TM6SF2 driven by a CMV promoter with a C-terminal triple epitope FLAG tag (amino acid motif DYKDDDDK) engineered with a flexible linker. Both lentivectors were transfected into HEK293 and HepG2 cells, creating stable cell lines. The presence of integrated vectors was confirmed by PCR of genes present on the vectors, also guaranteeing efficient equivalent integration across the cell lines. Next, in order to check the protein levels, protein extracts were made from HepG2 -TM6SF2-wt, HepG2-TM6SF2- rs58542926, HEK293 -TM6SF2-wt, and HEK293 -TM6SF2- rs58542926 cell lines and western blots performed. In all cases, the TM6SF2 rs58542926 cell lines showed significantly decreased levels of protein. Repeated qRT-PCR from the HepG2 -TM6SF2-wt and from HepG2-TM6SF2-rs58542926 confirmed a much lower RNA level for HepG2- TM6SF2-rs58542926.

[0120] Then, to identify the cause of RNA instability, multiple possibilities were explored including alternative splicing, novel RNA configurations, new protein binding sites and creation of a novel microRNA binding site. Extensive bioinformatic studies were performed as well. RNA sequencing and extensive exon-exon junction PCR experiments did not reveal any clear evidence of alternative splicing or exon instability (Figure 2B). Using miRDB with custom analysis setting (24), a single nucleotide change in rs585429926 was determined herein to introduce a strong microRNA binding site for microRNA 432-5p (miR- 432-5p) with a target score of 70 (Figure 1B).

[0121] Specifically, to explore whether TM6SF2 rs58542926 was introducing or removing a novel microRNA binding site that was either degrading or protecting the RNA product, a software algorithm was used to perform a custom prediction using a user- provided gene target sequence (21). Using a 140-base target with the region of the rs58542926 centralized in the query (tctgtctca gaacaaacaa acaaacagat gtccagcagg gttctggcat ggctgatgcc ctctctcctg caccatggaa gatacagctc caagatcagg cctgccttct tcctcaccat cccctacctg ctggtgccat), a specific region was found that was targeted hypothetically by six microRNAs for the wild-type sequence and by the same six microRNAs plus a new microRNA binding site for hsa-miR-432-5p. Wild-t e non-carrier rs58542926 carrier redictions G

[0122] Further investigating whether miR-432-5p was targeting the specific TM6SF2 rs58542926 polymorphism, a preliminary experiment was performed using a back-bone stabilized 2’-O-methylated nucleotide ASO [Sigma Mission S-TuD] that binds to miR-432-5p. The specific ASO inhibitor was a small-double-stranded RNA molecule based on the synthetic ‘Tough Decoy’ (TuD) molecule (24). Using the specific miR-432-5p ASO (targeting human) and an ASO negative control (from Arabidopsis thaliana), reverse transfection was used to deliver negative control ASO or miR-432-5p ASO into HepG2 lines overexpressing either Flag-tagged TM6SF2 wild-type or Flag-tagged TM6SF2 rs58542926. After 60 hours of incubation, the cells were harvested for RNA or protein analysis. qRT-PCR analysis showed that, compared to a negative control ASO transfection, miR-432-5p ASO caused a 55-fold increase in level (de-repression) of TM6SF2 mRNA in TM6SF2 rs58542926 compared to wild-type TM6SF2. There was no statistical difference in TM6SF2 levels in the wild-type linewith miR-432-5p ASO compared to transfection with negative control. This result was very striking, given its magnitude and specificity.

[0123] As an additional experiment, transfection was performed with negative control ASO and miR-432-5p ASO in human iPSC cell lines from TM6SF2 rs58542926 carriers and non- carriers for 60 hours. Surprisingly, in these native iPSC lines without any synthetic overexpression vectors, a 52-fold increase (de-repression) of TM6SF2 mRNA in TM6SF2 rs58542926 carrier human iPSC was again observed compared to wild-type TM6SF2 non- carrier line. This was a striking result again given the magnitude in native human lines from patients with known NAFLD versus controls.

[0124] While miR-432-5p is not a highly expressed human liver microRNA (25), it has been documented that when quenched, it is involved in hepatocarcinogenesis (21, 26). It also was shown to be involved in regulation of Wnt / β-catenin signaling (21) and regulation of cell proliferation (27-29). Furthermore, expression of miR-432-5p is severely repressed in Huh7 and HepG2 cells, which is contemplated herein to explain the findings of previous research groups (10, 21, 30). Example 2 miR-432-5p shows very strong affinity binding to TM6SF2 rs58542926

[0125] To characterize the molecular interaction of miR-432-5p with the coding RNA in TM6SF2 rs58542926, the entire TM6SF23’ UTR (untranslated region), the WT TM6SF2 fragment of DNA surrounding the E167 coded variant, the equivocal fragment of DNA containing rs58542926, a negative control, and a positive control were subcloned and repression of a luciferase activity assay was tested after transfection in HEK293 cells (Figure 1C). The negative control (NC) mimic had no effect on any of the reporter constructs, while the hsa-miR-432-5p mimic specifically repressed the rs58542926 clone greater than 60% approaching levels of the repression seen in the positive control. Interestingly but not surprisingly, the hsa-miR-432-5p mimic also had a small but statistically significant effect on WT TM6SF2 (Figure 1C). There was no effect on cellular morphology or density across the experiment (Figure 2A). Example 3 ASO targeting miR-432-5p shows strong de-repression of TM6SF2 rs58542926 RNA

[0126] Next, functional testing was performed of the predicted miR-432-5p interaction with the TM6SF2 rs58542926 in inhibition experiments using ASO for miR-432-5p [Sigma Mission ASOs and lentiviral ASOs such as Sigma HLTUD0572 (UCUUGGAGUAGGUCAUUGGGUGG)] Since TM6SF2 is also expressed in human iPSCs (31), initial experiments were performed using this platform and followed up in iHeps.Negative control and miR-432-5p ASOs were transfected first into a non-carrier iPSC line which showed no statistical difference in TM6SF2 expression (iPSC line 1023) (Figure 1D). Next, negative control and miR-432-5p ASOs were transfected into the rs58542926 carrier which showed a nearly ~50-fold increase in TM6SF2 expression level (Figure 1D). Both experiments are shown graphed together in Figure 2C demonstrating the dramatic nature of the regulation. A model of this regulated exon RNA process is shown in Figure 1E. This dramatic coding RNA regulation has not previously been reported for SNPs identified in metabolic disease or carcinogenesis. Example 4 miR-432-5p ASO Experiments in HepG2

[0127] To further characterize molecular aspects of TM6SF2 rs58542926 instability, additional experiments were performed in HepG2 cells. First, both wild-type and rs58542926 variants were subcloned into lentiviral overexpression vectors under the control of the strong CMV promoter (Figure 4A and B). The vectors were then integrated and selected for in HepG2 cells, a human hepatoma tumor cell line (data not shown). Measurement of TM6SF2 gene expression in the strongly overexpressed wild-type TM6SF2 in HepG2 showed a greater than several 1000-fold increase over HepG2 control cell lines within our constructs and within the earliest passage HepG2 cells that we had procured from ATCC (see methods). In contrast, overexpression of TM6SF2 rs58542926 showed significant instability with no significant increase in RNA over HepG2 control levels, despite strong overexpression (Figure 3A). Then, the ability of miR-432-5p ASO to rescue overexpression of both overexpressed wild-type TM6SF2 (Figure 4C) as well as overexpressed TM6SF2 rs58542926 (Figure 4C) was tested in HepG2. Again, miR-432-5p ASO was able to drastically stabilize TM6SF2 rs58542926 and slightly increased the levels of wild-type TM6SF2 in miR-432-5p ASO-treated cells, though not statistically significantly. When graphed together, the miR-432-5p ASO experiment shows a much larger effect on TM6SF2 rs58542926 in HepG2 (Figure 3B). Finally, both wild-type and rs58542926 variants were subcloned into lentiviral overexpression vectors under the control of the strong CMV promoter with added 3x Flag tags and transfected these into HEK293 cells (data not shown). Western blot analysis of the flag-tagged TM6SF2 showed that wild-type is much more stable than the rs58542926 (Figure 3C). Example 5 miR-432-5p ASO Experiments in human iHeps

[0128] Returning to a non-tumor cell line, carrier (7017) iHeps were used to characterize the effects of miR-432-5p vs. miR-432-3p on de-repression. Compared to vehicle andnegative control ASO treated carrier iHeps, miR-432-3p ASO did not show any significant change in TM6SF2 levels, whereas miR-432-5p ASO efficiently derepressed TM6SF2 levels (Figure 3D). The repertoire of patients tested for TM6SF2 gene expression was also expanded to additional non-carrier (x3) and three additional novel carriers (including heterozygous and homozygous). In all cases, the endogenous gene expression carriers showed 50% or less gene expression compared to the non-carriers again demonstrating that endogenous RNA was unstable. Example 6 Comparison of human and mouse microRNA 432

[0129] Several mouse knockout experiments and TM6SF2 overexpression experiments were previously performed in mice which showed confusing and contradictory results. The most interesting results were reported by Newberry et al. which showed increased steatosis in hepatocyte-specific knockout but rescue with AAV8 in-trans provided Tm6sf2 or Tm6sf2 E167k mutant AAV8 (32). To try to explain these results, human and mouse microRNA 432 were compared (Figure 3F). Comparison of these two microRNA shows significant sequence differences between the two microRNA and may explain why mouse experiments to date failed to replicate findings in humans. It is contemplated herein that mouse microRNA 432 may be incompatible with the human variant RNA and vice versa. Example 7 Functional Phenotypic Studies of miR-432-5p Modulation

[0130] To further characterize functional phenotypes, isogenic stable iPSC and iHeps were developed using lentiviral constructs including constitutively expressed miR-432-5p ASO, negative control ASO, miR-432-5p moderate overexpression, and negative control over-expression. We transduced these lentiviruses and generated stable cell lines. Experiments with these stable cell lines again confirmed that TM6SF2 RNA levels were derepressed in carriers of TM6SF2 rs58542926 with miR-432-5p compared to negative control ASO (Figure 5B). As expected miR-432-5p overexpression was similar to wild-type lines.

[0131] Challenging iPSCs or iHeps with oleate can enhance and clarify / isolate phenotypes. Challenging carrier TM6SF2 rs58542926 (7017) with 0.5 mM oleate versus noncarrier lines show clear increase in steatosis (Figure 5C). Similarly, imaging these cells in green channel including carrier TM6SF2 rs58542926 (NASH) with non-carrier TM6SF2 (control) under conditions of no lipids and 0.5 mM oleate showed very striking differences (Figure 5C). Definitive experiments using control (BSA only treatment) or Oleate challenged (300µM) iHeps shows that miR-432-5p ASO constitutively expressed is therapeutic andreduces steatosis functionally (Figure 5E). The same experiment weres performed in iPSCs with quantification and similar results were obtained (Figure 5F). Example 8 Molecular Consequences

[0132] Comprehensive measurable differences in phenotypes were determined. In carriers versus non-carriers, triglyercerides were found to be significantly decrease (Figure 6A) and looking at RNA sequencing data, IL 6 and IL11 were upregulated in carriers (Figure 6B and 6C). Because gene expression does not equal function, secreted proteins were also examined using quantitative methods. TNF-alpha, IL-6, IL-7, TNF-RII and MCP-3 were all elevated in carrier compared to non-carrier media from iHeps (Figure 6D).

[0133] In summary, miR-432-5p normally regulates other genes, but in rs58542926 it binds to TM6SF2 RNA therefore leading to RNA degradation, triglyceride retention, and intrahepatic steatosis (Figure 6E). Anti-miR-432-5p inhibitors are contemplated herein as useful to block the interaction of miR-432-5p and TM6SF2 rs58542926 and return miR-432- 5p normalized regulation. Finally, it is contemplated herein that without treatment TM6SF2 rs58542926 results in numerous de-repressed pathways with a competing endogenous RNA situation, including pathways involving IFG2, IL6 and IL11, and WNT, Beta-catenin (Figure 6F). Over decades, this de-repression leads to increased proliferation and significantly increased risk of cancer, which is correlated in the clinical history of actual patient carriers of rs58542926. Discussion of the Results

[0134] Characterization of the molecular consequences of TM6SF2 rs58542926 has been shrouded by studies in human tumor lines that had effectively lost the same miR- 432-5p microRNA involved in the disease process. Furthermore, mouse experiments failed to uncover clear phenotypes because of lack of human-mouse microRNA conservation.

[0135] This disclosure represents the first molecular connection of NASH phenotypic findings to a born-out mechanism, based on a single nucleotide change in the TM6SF2 gene and represents the power of single nucleotide changes within the human genome. While numerous metabolic therapies have been developed to treat NASH by burning up excess lipid such as chronic FGF21 treatments, it is unlikely that these alone will reduce the risk associated with carrying these strong molecular genetic drivers of inflammation, fibrosis, and proliferation (carcinogenesis). It is contemplated herein that the molecular therapeutics provided by the present disclosure can be used to prevent or treat the long- term disease process.Example 9 Preclinical Model of Human miR-432 / TM6SF2 rs58542926 in Mouse Tm6sf2 Knockout Background

[0136] A Tm6sf2 knockout (KO) mouse (32) is used to express human TM6SF2 rs58542926, as well as co-express human miR-432 by AAV8 delivery, replicating the human genetics in the mouse. The resulting mouse model can be used to demonstrate the therapeutic activity of miR-432-5p ASO provided herein.

[0137] Four types of AAV8 vectors were generated. For the two of the four, carrier TM6SF2 rs58542926 with GFP was subcloned into a AAV8-TTR vector (33) under the regulation of the tetracycline inducible TRE3G promoter, with miR-432 expressed from either a UBC or a TBG promoter (Figure 7A and 7B). For the other two, non-carrier TM6SF2 with GFP was subcloned into a AAV8-TTR vector under the regulation of the tetracycline inducible TRE3G promoter, with miR-432 expressed from either a UBC or a TBG promoter (Figure 7C and 7D).

[0138] About 4 x 1011viral genomes / mouse of AAV8-TTR-TM6SF2-GFP rs58542926 are injected into 10 male and 10 female 8 to 10-week old Tm6sf2 KO mice. The expression of the TM6SF2 is confirmed one week later by checking the liver of some killed mice for expression of GFP in liver sections by fluorescent microscopy, by qRT-PCR for TM6SF2-GFP, and by western blot for TM6SF2-GFP. Then, in vivo grade miR-432-5p ASO, negative control ASO, miR-432-5p mimic, or mimic negative control are injected 10 µg / g body weight by intraperitoneal injection. Four weeks after co-delivery of AAV8-TTR- TM6SF2-GFP rs58542926 and anti-miR-432-5p ASO, negative control, or mimic, mice are killed and analyzed for expression of GFP in liver sections by fluorescent microscopy, by qRT-PCR for TM6SF2-GFP and by western blot for TM6SF2-GFP. Mouse liver is stained for steatosis by Oil-Red-O. Serum is collected from the animals and fractionated for differences in VLDL secretion. Overall features of MASH are quantified. All assays are performed in triplicate per cell line, with a student’s t-test used to identify statistically significant differences between conditions.Documents Referenced 1. Lazo M, Hernaez R, Eberhardt MS, Bonekamp S, Kamel I, Guallar E, Koteish A, et al. Prevalence of nonalcoholic fatty liver disease in the United States: the Third National Health and Nutrition Examination Survey, 1988-1994. Am J Epidemiol 2013;178:38-45. 2. Younossi Z, Anstee QM, Marietti M, Hardy T, Henry L, Eslam M, George J, et al. Global burden of NAFLD and NASH: trends, predictions, risk factors and prevention. Nat Rev Gastroenterol Hepatol 2018;15:11-20. 3. Cohen JC, Horton JD, Hobbs HH. Human fatty liver disease: old questions and new insights. Science 2011;332:1519-1523. 4. Piccinin E, Villani G, Moschetta A. Metabolic aspects in NAFLD, NASH and hepatocellular carcinoma: the role of PGC1 coactivators. Nat Rev Gastroenterol Hepatol 2019;16:160-174. 5. Duwaerts CC, Maher JJ. Mechanisms of Liver Injury in Non-Alcoholic Steatohepatitis. Curr Hepatol Rep 2014;13:119-129. 6. Gentile CL, Frye M, Pagliassotti MJ. Endoplasmic reticulum stress and the unfolded protein response in nonalcoholic fatty liver disease. Antioxid Redox Signal 2011;15:505-521. 7. Cusi K. Role of obesity and lipotoxicity in the development of nonalcoholic steatohepatitis: pathophysiology and clinical implications. Gastroenterology 2012;142:711- 725 e716. 8. Romeo S, Kozlitina J, Xing C, Pertsemlidis A, Cox D, Pennacchio LA, Boerwinkle E, et al. Genetic variation in PNPLA3 confers susceptibility to nonalcoholic fatty liver disease. Nat Genet 2008;40:1461-1465. 9. Yang J, Trepo E, Nahon P, Cao Q, Moreno C, Letouze E, Imbeaud S, et al. PNPLA3 and TM6SF2 variants as risk factors of hepatocellular carcinoma across various etiologies and severity of underlying liver diseases. Int J Cancer 2019;144:533-544. 10. Kozlitina J, Smagris E, Stender S, Nordestgaard BG, Zhou HH, Tybjaerg-Hansen A, Vogt TF, et al. Exome-wide association study identifies a TM6SF2 variant that confers susceptibility to nonalcoholic fatty liver disease. Nat Genet 2014;46:352-356. 11. He S, McPhaul C, Li JZ, Garuti R, Kinch L, Grishin NV, Cohen JC, et al. A sequence variation (I148M) in PNPLA3 associated with nonalcoholic fatty liver disease disrupts triglyceride hydrolysis. J Biol Chem 2010;285:6706-6715. 12. Smagris E, BasuRay S, Li J, Huang Y, Lai KM, Gromada J, Cohen JC, et al. Pnpla3I148M knockin mice accumulate PNPLA3 on lipid droplets and develop hepatic steatosis. Hepatology 2015;61:108-118. 13. BasuRay S, Smagris E, Cohen JC, Hobbs HH. The PNPLA3 variant associated with fatty liver disease (I148M) accumulates on lipid droplets by evading ubiquitylation. Hepatology 2017;66:1111-1124.14. BasuRay S, Wang Y, Smagris E, Cohen JC, Hobbs HH. Accumulation of PNPLA3 on lipid droplets is the basis of associated hepatic steatosis. Proc Natl Acad Sci U S A 2019;116:9521-9526. 15. Smagris E, Gilyard S, BasuRay S, Cohen JC, Hobbs HH. Inactivation of Tm6sf2, a Gene Defective in Fatty Liver Disease, Impairs Lipidation but Not Secretion of Very Low Density Lipoproteins. J Biol Chem 2016;291:10659-10676. 16. Holmen OL, Zhang H, Fan Y, Hovelson DH, Schmidt EM, Zhou W, Guo Y, et al. Systematic evaluation of coding variation identifies a candidate causal variant in TM6SF2 influencing total cholesterol and myocardial infarction risk. Nat Genet 2014;46:345-351. 17. Mahdessian H, Taxiarchis A, Popov S, Silveira A, Franco-Cereceda A, Hamsten A, Eriksson P, et al. TM6SF2 is a regulator of liver fat metabolism influencing triglyceride secretion and hepatic lipid droplet content. Proc Natl Acad Sci U S A 2014;111:8913-8918. 18. Debacker AJ, Voutila J, Catley M, Blakey D, Habib N. Delivery of Oligonucleotides to the Liver with GalNAc: From Research to Registered Therapeutic Drug. Mol Ther 2020;28:1759-1771. 19. Qi X, Zhang DH, Wu N, Xiao JH, Wang X, Ma W. ceRNA in cancer: possible functions and clinical implications. J Med Genet 2015;52:710-718. 20. Wang X, Cao X, Dong D, Shen X, Cheng J, Jiang R, Yang Z, et al. Circular RNA TTN Acts As a miR-432 Sponge to Facilitate Proliferation and Differentiation of Myoblasts via the IGF2 / PI3K / AKT Signaling Pathway. Mol Ther Nucleic Acids 2019;18:966-980. 21. Jiang N, Chen WJ, Zhang JW, Xu C, Zeng XC, Zhang T, Li Y, et al. Downregulation of miR-432 activates Wnt / beta-catenin signaling and promotes human hepatocellular carcinoma proliferation. Oncotarget 2015;6:7866-7879. 22. Peaslee C, Esteva-Font C, Su T, Munoz-Howell A, Duwaerts CC, Liu Z, Rao S, et al. Doxycycline Significantly Enhances Induction of Induced Pluripotent Stem Cells to Endoderm by Enhancing Survival Through Protein Kinase B Phosphorylation. Hepatology 2021;74:2102-2117. 23. Agarwal V, Bell GW, Nam JW, Bartel DP. Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015;4. 24. Chen Y, Wang X. miRDB: an online database for prediction of functional microRNA targets. Nucleic Acids Res 2020;48:D127-D131. 25. Tzur G, Israel A, Levy A, Benjamin H, Meiri E, Shufaro Y, Meir K, et al. Comprehensive gene and microRNA expression profiling reveals a role for microRNAs in human liver development. PLoS One 2009;4:e7511. 26. Wang Y, Xu W, Zu M, Xu H. Circular RNA circ_0021093 regulates miR-432 / Annexin A2 pathway to promote hepatocellular carcinoma progression. Anticancer Drugs 2021;32:484-495.27. Yao J, Tan W, Wu W, Ye R, Li Y, Chen Y. Effects of miR-432 and miR-548c-3p on the proliferation and invasion of osteosarcoma cells. J BUON 2020;25:1562-1568. 28. Zhou W, Yang F. Circular RNA circRNA-0039459 promotes the migration, invasion, and proliferation of liver cancer cells through the adsorption of miR-432. Bioengineered 2022;13:11810-11821. 29. Gong Y, Zhang S, Wang H, Huang Y, Fu X, Xiang P, Fan T. The involvement of the circFOXM1-miR-432-Galpha12 axis in glioma cell proliferation and aggressiveness. Cell Death Discov 2022;8:9. 30. Ehrhardt N, Doche ME, Chen S, Mao HZ, Walsh MT, Bedoya C, Guindi M, et al. Hepatic Tm6sf2 overexpression affects cellular ApoB-trafficking, plasma lipid levels, hepatic steatosis and atherosclerosis. Hum Mol Genet 2017;26:2719-2731. 31. Munoz A, Theusch E, Kuang YL, Nalula G, Peaslee C, Dorlhiac G, Landry MP, et al. Undifferentiated Induced Pluripotent Stem Cells as a Genetic Model for Nonalcoholic Fatty Liver Disease. Cell Mol Gastroenterol Hepatol 2022;14:1174-1176 e1176. 32. Newberry, E. P. et al. Liver-Specific Deletion of Mouse Tm6sf2 Promotes Steatosis, Fibrosis, and Hepatocellular Cancer. Hepatology 2021; 74:1203-1219. 33. Aras N Mattis, Guisheng Song, Kelly Hitchner, Roy Y Kim, Andrew Y Lee, Amar D Sharma, Yann Malato, Michael T McManus, Christine C Esau, Erich Koller, Suneil Koliwad, Lee P Lim, Jacquelyn J Maher, Robert L Raffai, Holger Willenbring. A screen in mice uncovers repression of lipoprotein lipase by microRNA-29a as a mechanism for lipid distribution away from the liver. Hepatology 2015 Jan;61(1):141-52.

Claims

Claims I claim:

1. An antisense oligonucleotide having the following structure: a) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG*rArG-3’ (SEQ ID NO: 1), wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond; b) 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*+G*+A*G-3’ (SEQ ID NO: 2), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond; c) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU*rG*rG -3’ (SEQ ID NO: 3), wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond; d) 5’-rGrGrA*rA*rG*rArArGrGrCrA*rGrGrC*rCrUrGrArUrCrUrU-3’ (SEQ ID NO: 4), wherein r indicates a ribonucleoside residue and * indicates a phosphorothioate bond; e) 5’-+G*+G*+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’ (SEQ ID NO: 5), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA; f) 5’-+A*+A*GAAGGCAGGCCTGATCT+T*+G*-3’ (SEQ ID NO: 6), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA; g) 5’-+G*+G*+A*G*CTGTATCTTCCATGGT+G*+C*-3’ (SEQ ID NO: 7), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA; h) 5’-+G*+C*+T*G*TATCTTCCATGGT+G*+C*-3’ (SEQ ID NO: 8), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA; or i) 5’-+C*+T*G*TATCTTCCATGGT+G*+C*-3’ (SEQ ID NO: 9), wherein + indicates a methylene bridge bond linking the 2′ oxygen to the 4′ carbon of the RNA pentose ring of the adjacent residue and * indicates a phosphorothioate bond and wherein the oligonucleotide represents a mixed RNA and DNA in which all non-modified nucleosides are DNA.

2. The antisense oligonucleotide of claim 1 comprising a N-acetylgalactosamine (Gal- Nac) modification.

3. The antisense oligonucleotide of claim 1 comprising a cholesterol modification.

4. A method of blocking binding of miR-432-5p to TM6SF2 rs58542926 RNA in a cell comprising delivering to the cell a blocking antisense oligonucleotides that binds TM6SF2 rs58542926 RNA or miR-432-5p, or a blocking antisense oligonucleotides that binds TM6SF2 rs58542926 RNA and a blocking antisense oligonucleotide that binds miR-432-5p.

5. The method of claim 4 wherein the cell is a hepatocyte or an intestinal epithelial cell.

6. The method of claim 4 wherein the blocking antisense oligonucleotide binds TM6SF2 rs58542926 RNA and is an antisense oligonucleotide of claim 1, 2 or 3.

7. A method of treating a patient carrying a TM6SF2 rs585429926 SNP comprising delivering to the patient a blocking antisense oligonucleotide that binds TM6SF2 rs58542926 RNA or miR-432-5p, or a blocking antisense oligonucleotides that binds TM6SF2 rs58542926 RNA and a blocking antisense oligonucleotide that binds miR-432-5p.

8. The method of claim 7 wherein the blocking antisense oligonucleotide binds TM6SF2 rs58542926 RNA and is an antisense oligonucleotide of claim 1, 2 or 3.

9. The method of claim 7 or 8 comprising first determining the patient carries the TM6SF2 rs585429926 SNP.

10. The method of claim 7, 8 or 9, wherein the patient has long-term liver inflammation, liver damage or liver disease.

11. The method of claim 10 wherein the patient has fatty liver disease, non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH).

12. The method of claim 7, 8 or 9, wherein the treatment prevents or slows cellular senescence in liver.

13. The method of claim 7, 8 or 9, wherein the patient is a child, adolescent or adult.

14. The method of claim 13 wherein the treatment prevents liver disease. 15.The method of claim 7, 8 or 9, wherein the treatment prevents or treats cancer in the liver or small intestine.

16. The method of claim 7, 8 or 9, wherein the patient has alcoholic liver disease.

17. The method of claim 7, 8 or 9, wherein the patient takes liver-damaging medications.

18. The method of claim 7, 8 or 9, wherein the patient is diabetic.