Methods of treating cancer by detecting gen1 variation

By detecting GEN1 variants and administering a therapeutic agent that reduces MUS81 and/or EME1 activity, this method provides a personalized and effective cancer treatment with reduced side effects.

WO2025122974A1PCT designated stage expired Publication Date: 2025-06-12DANA FARBER CANCER INSTITUTE INC +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/059034
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-08
Filing Date
2024-12-06
Publication Date
2025-06-12

AI Technical Summary

Technical Problem

Current cancer treatments, such as chemotherapy and radiation therapy, often come with significant side effects and variable efficacy across patient populations, necessitating the development of personalized medicine and theranostics approaches.

Method used

The method involves detecting variants in the GEN1 genetic locus, specifically the p.Lys839fs SNP or variants in linkage disequilibrium, to determine if a therapeutic agent reducing the activity or expression of MUS81 and/or EME1 should be administered. If variants are detected, a therapeutic agent with an IC50 of 100 nM or less is used; otherwise, standard care treatment is administered.

Benefits of technology

This approach allows for tailored cancer treatment that is more effective and has fewer side effects by targeting cancer cells dependent on MUS81 and/or EME1 for survival, based on the presence of specific GEN1 variants.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000049_0001
    Figure IMGF000049_0001
  • Figure 00000053_0000
    Figure 00000053_0000
  • Figure 00000054_0000
    Figure 00000054_0000
Patent Text Reader

Abstract

A method of detecting one or more variants in the GEN1 genetic locus in a sample from a subject suffering from a cancer, or a healthy subject not yet diagnosed with cancer, wherein if the GEN1 mutation is detected, then a therapeutic agent inhibiting MUS81, EME1, or both is administered. The tumor cells or tissue are heterozygous for the variant(s) of GEN1 or have a loss of heterozygosity. The inhibitors used to target MUS81, EME1, or both are either small molecules, antibodies, PROTACs, bi-functional molecules, recombinant gene therapy vectors, RNAi agents, antisense RNA agents, or a gene editing system.
Need to check novelty before this filing date? Find Prior Art

Description

METHODS OF TREATING CANCER BY DETECTING GEN1 VARIATION STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0001] This invention was made with government support under CA188228, CA262462, and CA219943 awarded by National Institutes of Health. The government has certain rights in the invention. CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 608,083, filed on December 8, 2023, the disclosure of which is incorporated by reference herein in its entirety. SEQUENCE LISTING

[0003] This application contains a Sequence Listing electronically submitted via EFS-Web to the United States Patent and Trademark Office as an XML file entitled “680003398WO01.xml” having a size of 27,299 bytes and created on December 6, 2024. The information contained in the Sequence Listing is incorporated by reference herein. TECHNICAL FIELD

[0004] The subject matter disclosed herein is generally directed methods of treating cancers with GEN1 variants. BACKGROUND

[0005] Cancer remains one of the leading causes of mortality worldwide. Traditional cancer treatments, such as chemotherapy and radiation therapy, are often associated with significant side effects and variable efficacy across patient populations. This variability in treatment response has led to the emergence of personalized medicine and theranostics as a promising approach in cancer therapy.

[0006] Personalized medicine refers to the tailoring of medical treatment to the individual characteristics of each patient. It involves the use of diagnostic tests to select appropriate andoptimal therapies based on the context of a patient’s genetic content or other molecular or cellular analysis. The benefits of personalized medicine are particularly evident in oncology, where genetic variations often impact how individuals respond to various cancer treatments.

[0007] Theranostics, a term combining 'therapeutics' and 'diagnostics', represents an innovative approach to medicine, particularly in oncology, combining diagnostic testing with targeted therapy based on the test results. This approach facilitates tailored treatments that are more effective and have fewer side effects compared to traditional treatments.

[0008] One notable example of the successful application of personalized medicine and theranostics in oncology is the relationship between the BRCA genes (BRCA1 and BRCA2) and PARP inhibitors. BRCA1 and BRCA2 are human genes that produce tumor suppressor proteins, which help repair damaged DNA. Variants in these genes can lead to a higher risk of developing certain cancers, including breast and ovarian cancers.

[0009] PARP inhibitors are a class of drugs that target and inhibit the enzyme poly (ADP- ribose) polymerase (PARP), which is involved in DNA repair. They are particularly effective in treating cancers with BRCA variants because the cancer cells rely on PARP to repair their DNA and continue proliferating. By inhibiting PARP, these drugs cause cancer cells to accumulate DNA damage and eventually die.

[0010] The effectiveness of PARP inhibitors in patients with BRCA variants exemplifies the potential of personalized medicine and theranostics in cancer treatment. It highlights the importance of understanding the genetic basis of cancers to develop targeted therapies that offer improved efficacy and reduced side effects compared to conventional treatments.

[0011] Citation or identification of any document in this application is not an admission that such a document is available as prior art to the present disclosure. SUMMARY

[0012] In some aspects, the techniques described herein relate to a method of treating cancer including: detecting one or more variants in the GEN1 genetic locus in a sample from a subject suffering from a cancer, or a healthy subject not yet diagnosed with cancer; wherein if one or more GEN1 variants are detected, then administering a therapeutic agent that reduces activity and / orexpression of MUS81, EME1, or both; wherein if one or more GEN1 variants are not detected, then administering a standard of care treatment for the cancer.

[0013] More specifically, there are described methods of treating cancer in a subject in need thereof, the method comprising: detecting a single nucleotide polymorphism (SNP) p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 in a sample from the subject; wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are detected, then administering a therapeutic agent that reduces activity and / or expression of MUS81, EME1, or both; wherein the therapeutic agent exhibits a cellular inhibitory concentration at 50% (IC50) of 100 nM or less; and wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are not detected, then administering a standard of care treatment.

[0014] In some aspects, the one or more GEN1 variants are in a coding region of GEN1, such as one or more GEN1 variants mutates an auto-regulatory domain of GEN1.

[0015] In some aspects, the techniques described herein relate to a method, wherein the one or more GEN1 mutation lead to a truncated C-terminus of a protein encoded by GEN1.

[0016] In some aspects, the techniques described herein relate to a method, wherein the one or more variants include a single nucleotide polymorphism (SNP), p.Lys839fs.

[0017] In some aspects, the techniques described herein relate to a method, wherein the one or more GEN1 variants are detected in a benign (e.g., germline) cell.

[0018] In some aspects, the techniques described herein relate to a method, wherein the benign cell is heterozygous for the one or more GEN1 variants. In some aspects, the one or more GEN1 variants are detected in a tumor cell.

[0019] In some aspects, the techniques described herein relate to a method, wherein the tumor cell is heterozygous for the one or more GEN1 variants or has loss heterozygosity at the one or more GEN1 mutation loci.

[0020] In some aspects, the techniques described herein relate to a method, wherein the inhibitor of MUS81, EME1, or a combination thereof is (a) one or more small molecules that bind MUS81 and / or EME1, or both; (b) one or more antibodies, antibody fragments, or antibody-like protein scaffolds that bind MUS81 and / or EME1, or both; (c) one or more PROTACs including a small molecule binder of MUS81 and / or EME1, or both; (d) a bi-functional molecule including apost-translation modification enzyme linked to a small molecule binder of one or more gene products of MUS81, EME1, or both, wherein the post-translation modification enzyme makes one or more post-translation modifications to the one or more gene products that inhibit or reduce activity; (e) one or more recombinant gene therapy vectors for reducing expression of MUS81 and / or EME1, or both; (f) one or more RNAi agents for decreasing expression of MUS81 and / or EME1, or both; (g) one or more antisense RNA agents for decreasing expression of MUS81 and / or EME1, or both; (h) a gene editing system that modifies expression of MUS81 and / or EME1, or both via introduction of one or more modifications including insertions, deletions or replacements that result in reduced expression or activity of the one or more genes; (i) a gene editing system that introduces one or more modifications to a regulatory element controlling expression of the MUS81 and / or EME1, or both such that expression of the one or MUS81 and / or EME1, or both is reduced; (j) a gene editing system that modifies expression of the MUS81 and / or EME1, or both by binding a transcriptional repressor to an enhancer region that controls expression of the one or more genes such that that expression of the genes is reduced; (k) a gene editing system capable of editing one or more CTCF motifs in a cell genome such that one or more chromosomal loops including the MUS81 and / or EME1, or both are removed; or (l) a gene editing system capable of making one or more epigenetic modifications of a cell genome such that expression of MUS81 and / or EME1, or both is reduced.

[0021] In some aspects, the techniques described herein relate to a method, wherein the modifications introduced by the gene editing system of h) are: (i) introduction of one or more missense mutations; (ii) introduction of a pre-mature stop codon; (iii) removal of one or more splice sites resulting in a non-functional gene product; (iv) introduction of one or more splice-sites resulting in a non-functional gene product; (v) introduction of one or more post-translational modification sites that results in one or more post-translational modifications that result in a gene product with reduced activity; (vi) removal of one or more post-translational modification sites that results in a gene product with reduced activity; (vii) deletion of a portion of a coding sequence resulting in a non-functional gene or gene product; (viii) introduction of one or more non- functional sequences into an otherwise functional gene that results in a non-functional gene product; (ix) replacement of a portion of a functional sequence of a gene with a non-functional sequence resulting in a non-functional gene or gene produce; (x) introduction of one or more RNAitarget sites into a gene or gene product; (xi) introduction of a degron or degradation signal; (xii) deletion of one or more copies of a gene; or (xiii) a combination thereof.

[0022] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(vi) is a programmable nuclease configured to introduce the one or more modifications via NHEJ-mediated indels.

[0023] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(xi) is a programmable nuclease configured to introduce the one or more modifications using a donor template and HDR-mediated repair.

[0024] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(vi) is a DNA base editing system.

[0025] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (v) or (vi) is a RNA base editing system.

[0026] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(xi) is a prime editing system.

[0027] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(xii) is a twin prime editing system, optionally further including an integrase.

[0028] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(xii) is a CRISPR-associated transposase (CAST) system.

[0029] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(xii) includes a non-LTR retrotransposon system.

[0030] In some aspects, the techniques described herein relate to a method, wherein the modifications introduced by the gene editing system of i) are: (xiv) removing a portion of the regulatory element of the one or more genes such that expression of the one or more genes is reduced; (xv) introducing a non-functional sequence into the regulatory element such that binding of a transcription machinery to the regulatory element is reduced; (xvi) introducing one or more single nucleotide edits such that binding of the transcription machinery to the regulatory element is reduced; a (xvii) a combination thereof.

[0031] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (i)-(iii) is a programmable nuclease configured to introduce the one ormore modifications via NHEJ-mediated indels, a programmable nuclease configured to introduce the one or more modifications using a donor template and HDR-mediated repair, a prime editing system, a double prime editing system, a CAST system, or a Non-LTR retrotransposon system.

[0032] In some aspects, the techniques described herein relate to a method, wherein the gene editing system used for (iii) is a DNA base editing system.

[0033] In some aspects, the techniques described herein relate to a method, wherein the cancer is ovarian cancer, breast cancer, or melanoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] An understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure may be utilized, and the accompanying drawings of which.

[0035] FIG. 1: Manhattan plot illustrating genetic variants associated with MUS81 dependence in DepMap. Each dot is the p-value (y-axis) for a single variant.

[0036] FIG.2: Bar graph displaying GEN1 Lys839Fs SNP frequency across different donor groups.

[0037] FIG.3: MUS81 chronos score map displaying mutant status of GEN1 SNP and cells that are homozygous for GEN1 SNP are dependent on MUS81 for survival.

[0038] FIG.4: qq-plot of genetic dependencies associated with rs149936944.

[0039] FIG. 5: EME1 chronos score map displaying mutant status of GEN1 SNP and cells that are homozygous for GEN1 SNP are dependent on EME1 for survival.

[0040] FIG. 6: Diagram indicating predicted disorder of the GEN1 amino acid structure. Diagram of GEN1 protein structure with key N-terminal domains indicated (A). Early truncation mutation resulting from the rs149936944 mutation is indicated by "GEN1 MUT". Predicted local order / disorder of the protein is indicated below (B). Ordered or disordered regions are predicted by IUPred2.

[0041] FIG. 7. Histogram displaying frequency of loss of heterozygosity at the GEN1 locus across tumors and cancer types. Histogram was generated from publicly available data from The Cancer Genome Atlas Program.

[0042] FIG. 8. Fraction of mCherry-positive cells among cells engineered to express Luciferase (A), wild-type GEN1 (B) and Lys839Fs GEN1 in a CRISPR competition assay to measure the impact of MUS81 and EME1 silencing.

[0043] FIG. 9. Correlation between the rs149936944 SNP of GEN1 and other SNPs on chromosome 2.

[0044] FIG.10. Western blot showing GEN1 expression by immunoblotting for a C-terminal V5 tag or using an antibody that recognizes the native GEN1 protein structure.

[0045] FIG. 11. GWAS identifying associations between SNPs and genetic dependencies. Gene Chronos scores for both benign and malignant cells by peak SNP are displayed. The figures herein are for illustrative purposes only and are not necessarily drawn to scale.

[0046] FIG.12. Table displaying GEN1 SNP frequency across different ancestry groups.

[0047] The figures herein are for illustrative purposes only and are not necessarily drawn to scale. DETAILED DESCRIPTION OF THE EXAMPLE EMBODIMENTS

[0048] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. Definitions of common terms and techniques in molecular biology may be found in Molecular Cloning: A Laboratory Manual, 2ndedition (1989) (Sambrook, Fritsch, and Maniatis); Molecular Cloning: A Laboratory Manual, 4thedition (2012) (Green and Sambrook); Current Protocols in Molecular Biology (1987) (F.M. Ausubel et al. eds.); the series Methods in Enzymology (Academic Press, Inc.): PCR 2: A Practical Approach (1995) (M.J. MacPherson, B.D. Hames, and G.R. Taylor eds.): Antibodies, A Laboratory Manual (1988) (Harlow and Lane, eds.): Antibodies A Laboratory Manual, 2ndedition 2013 (E.A. Greenfield ed.); Animal Cell Culture (1987) (R.I. Freshney, ed.); Benjamin Lewin, Genes IX, published by Jones and Bartlet, 2008 (ISBN 0763752223); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0632021829); Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 9780471185710); Singleton et al., Dictionary of Microbiology and Molecular Biology 2nd ed., J. Wiley & Sons (New York, N.Y. 1994), March, Advanced Organic Chemistry Reactions,Mechanisms and Structure 4th ed., John Wiley & Sons (New York, N.Y. 1992); and Marten H. Hofker and Jan van Deursen, Transgenic Mouse Methods and Protocols, 2ndedition (2011).

[0049] As used herein, the singular forms “a”, “an”, and “the” include both singular and plural referents unless the context clearly dictates otherwise.

[0050] The term “optional” or “optionally” means that the subsequent described event, circumstance or substituent may or may not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0051] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

[0052] The terms “about” or “approximately” as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, are meant to encompass variations of and from the specified value, such as variations of + / -10% or less, + / -5% or less, + / - 1% or less, and + / -0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed methods. It is to be understood that the value to which the modifier “about” or “approximately” refers is itself also specifically, and preferably, disclosed.

[0053] As used herein, a “biological sample” may contain whole cells and / or live cells and / or cell debris. The biological sample may contain (or be derived from) a “bodily fluid”. The present disclosure encompasses embodiments wherein the bodily fluid is selected from amniotic fluid, aqueous humour, vitreous humour, bile, blood serum, breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph, perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (including nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, vomit and mixtures of one or more thereof. Biological samples include cell cultures, bodily fluids, cell cultures from bodily fluids. Bodily fluids may be obtained from a mammal organism, for example by puncture, or other collecting or sampling procedures.

[0054] The terms “subject,” “individual,” and “patient” are used interchangeably herein to refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, murines, simians, humans, farm animals, sport animals, and pets. Tissues, cells and their progeny of a biological entity obtained in vivo or cultured in vitro are also encompassed.

[0055] The term “IC50” refers to the concentration at which a therapeutic agent described herein is required to inhibit activity of a target described herein by 50% under experimental conditions described herein.

[0056] The term “loss of heterozygosity” in a locus refers to the loss or inactivation of one of two different alleles of a locus in a diploid cell, resulting in a cell that no longer has two different alleles of the locus. Typically, a cell that has lost heterozygosity will become homozygous of a single allele. However, sometimes, a cell may lose a copy of the locus such that it only has one allele.

[0057] The term “linkage disequilibrium” refers to an association of alleles in a genome that are inherited together at a greater frequency than would be expected by chance. Linkage disequilibrium can occur because of the proximity of the alleles on a chromosome.

[0058] The term “single nucleotide polymorphism” (SNP) refers to a variation in DNA caused by the replacement of a single nucleotide by another nucleotide.

[0059] The term “variant” refers to different forms of the same gene or genetic marker. Variants can arise as a result of a permanent change in the DNA sequence of a gene or genetic marker.

[0060] The term “coding region” refers to the nucleotide sequence of a gene’s DNA or RNA that codes for a protein. Coding regions include exons. The term “non-coding region” refers to a DNA or RNA nucleotide sequence that does not code for a protein.

[0061] The term “benign” is used herein to refer to a cell found in a subject’s body that is not known to be cancerous. Benign cells are sometimes referred to as “germline” cells, indicating that the genotype of the cell is found throughout the subject’s body. Typically, cells having a benign genotype (i.e., benign cells) are not cancerous and are not associated with development of cancer.

[0062] The term “malignant” is used herein to refer to a cell found in a subject’s body that is thought to be cancerous. Malignant cells are sometimes referred to as “somatic” cells. Malignant cells are typically cancerous and / or associated with development of cancer. Typically, the malignant cells of the present disclosure have loss of a wild-type copy of the GEN1 allele.

[0063] The term “auto-regulatory domain” refers to a portion of a gene or its associated protein that is involved in self-regulation of the expression or activity of the gene or protein.

[0064] As used herein, “have,” “has,” “having,” “include,” “includes,” “including,” “comprise,” “comprises,” “comprising” or the like are used in their open-ended inclusive sense, and generally mean “include, but not limited to,” “includes, but not limited to,” or “including, but not limited to.” Further, wherever embodiments are described herein with the language “have,” “has,” “having,” “include,” “includes,” “including,” “comprise,” “comprises,” “comprising” and the like, otherwise analogous embodiments described in terms of “consisting of” and / or “consisting essentially of” are also provided. The term “consisting of” means including, and limited to, that which follows the phrase “consisting of.” That is, “consisting of” indicates that the listed elements are required or mandatory, and that no other elements may be present. The term “consisting essentially of” indicates that any elements listed after the phrase are included, and that other elements than those listed may be included provided that those elements do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements.

[0065] As used herein, the term “nucleic acid” or “oligonucleotide” refers to polynucleotides such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Nucleic acids include but are not limited to genomic DNA, cDNA, mRNA, iRNA, miRNA, tRNA, ncRNA, rRNA, and recombinantly produced and chemically synthesized molecules such as aptamers, plasmids, anti- sense DNA strands, shRNA, ribozymes, nucleic acids conjugates, and oligonucleotides. A nucleic acid may be single-stranded, double-stranded, linear, or covalently circularly closed molecule. A nucleic acid can be isolated. The term “isolated nucleic acid” means that the nucleic acid (i) was amplified in vitro, for example via polymerase chain reaction (PCR), (ii) was produced recombinantly by cloning, (iii) was purified, for example, by cleavage and separation by gel electrophoresis, (iv) was synthesized, for example, by chemical synthesis, or (vi) extracted from a sample. A nucleic might be introduced—i.e., transfected—into cells. When RNA is used to transfect cells, the RNA may be modified by stabilizing modifications, capping, or polyadenylation.

[0066]

[0067] Various embodiments are described hereinafter. It should be noted that the specific embodiments are not intended as an exhaustive description or as a limitation to the broader aspects discussed herein. One aspect described in conjunction with a particular embodiment is not necessarily limited to that embodiment and can be practiced with any other embodiment(s).Reference throughout this specification to “one embodiment”, “an embodiment,” “an example embodiment,” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present disclosure. Thus, appearances of the phrases “in one embodiment,” “in an embodiment,” or “an example embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to a person skilled in the art from this disclosure, in one or more embodiments. Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the disclosure. For example, in the appended claims, any of the claimed embodiments can be used in any combination.

[0068] All publications, published patent documents, and patent applications cited herein are hereby incorporated by reference to the same extent as though each individual publication, published patent document, or patent application was specifically and individually indicated as being incorporated by reference. OVERVIEW

[0069] The present methods seek to advance the field of personalized medicine and theranostics by introducing method of treating cancer that select cancer patients who would benefit from treatment with a therapeutic agent that reduces activity and / or expression of MUS81 and / or EME1. The methods aim to provide improved cancer treatment efficacy, reduced side effects, enhanced patient quality of life. The present disclosure describes a benign variant in the GEN1genetic locus that indicate a susceptibility of a tumor that arises in such a genetic background to treatment with therapeutic agents that inhibit MUS81 and / or EME1.

[0070] In particular, the method of treating cancer in a subject in need thereof may comprise: detecting a single nucleotide polymorphism (SNP) p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 in a sample from the subject; wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are detected, then administering a therapeutic agent that reduces activity and / or expression of MUS81, EME1, or both; wherein the therapeutic agent is administered at a cellular inhibitoryconcentration at 50% (IC50) of 100 nM or less; and wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are not detected, then administering a standard of care treatment.

[0071] The subject may have cancer or may be at risk of having cancer. The cancer may be ovarian cancer, breast cancer, or melanoma.

[0072] The p.Lys839fs SNP of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may reduce GEN1 activity and / or expression.

[0073] The one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may comprise a mutation in a coding region of GEN1, a mutation in a non-coding region of GEN1, or both. The one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may comprise a mutation in an auto-regulatory domain of GEN1. The one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may lead to a truncated C-terminus of a protein encoded by GEN1. The one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may comprise one or more SNPs.

[0074] The p.Lys839fs SNP of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may be detected in a benign cell. The benign cell may be heterozygous for p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1.

[0075] The p.Lys839fs SNP of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may be detected in a cancer cell. The cancer cell may be heterozygous for p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1, or may have a loss of heterozygosity at one or more GEN1 mutation loci.

[0076] Detecting p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 may comprise a polymerase chain reaction (PCR), Sanger sequencing, next-generation sequence (NGS), whole exome sequencing (WES), whole genome sequencing (WGS), a microarray analysis, fluorescence in-situ hybridization (FISH), multiplex ligation- dependent probe amplification (MLPA), a variation thereof, or a combination thereof.

[0077] The sample may be taken from blood, saliva, a buccal swab, amniotic fluid, a tissue biopsy, urine, skin, or bone marrow.

[0078] The therapeutic agent that inhibits of MUS81, EME1, or both may comprise: one or more small molecules that bind MUS81, EME1, or both; one or more antibodies, antibody fragments, or antibody-like protein scaffolds that bind MUS81, EME1, or both; one or more PROTACs comprising a small molecule binder of MUS81, EME1, or both; a bi-functional molecule comprising a post-translation modification enzyme linked to a small molecule binder of one or more gene products of MUS81, EME1, or both, wherein the post-translation modification enzyme makes one or more post-translation modifications to the one or more gene products that inhibit or reduce activity; one or more recombinant gene therapy vectors for reducing expression of MUS81, EME1, or both; one or more RNAi agents for decreasing expression of MUS81, EME1, or both; one or more antisense RNA agents for decreasing expression of MUS81, EME1, or both; a gene editing system that modifies expression of MUS81, EME1, or both via introduction of one or more modifications comprising insertions, deletions or replacements that result in reduced expression or activity of the one or more genes; a gene editing system that introduces one or more modifications to a regulatory element controlling expression of the MUS81, EME1, or both such that expression of MUS81, EME1, or both is reduced; a gene editing system that modifies expression of the MUS81, EME1, or both by binding a transcriptional repressor to an enhancer region that controls expression of the one or more genes such that that expression of the genes is reduced; a gene editing system capable of editing one or more CTCF motifs in a cell genome such that one or more chromosomal loops comprising the MUS81, EME1, or both are removed; or a gene editing system capable of making one or more epigenetic modifications of a cell genome such that expression of MUS81, EME1, or both is reduced. METHOD OF TREATING CANCER BY DETECTING GEN1 VARIANTS

[0079] In one aspect, the present disclosure provides for a method of treating a cancer comprising: detecting one or more variants in the GEN1 Holliday Junction 5’ Flap Endonuclease (GEN1) genetic locus in a sample from subject suffering from cancer, or a healthy subject not yet diagnosed with cancer. Cells with the one or more GEN1 variants are dependent on the proteins encoded by the genes MUS81 Structure-specific Endonuclease Subunit (MUS81) and / or Essential Meiotic Structure-specific Endonucleases (EME1) for survival. The proteins GEN1 and MUS81are functionally redundant Holliday junction resolvases. GEN1 forms a homodimer to resolve Holiday junctions. Separately MUS81 and EME1 form a complex with two other proteins to resolve Holiday junctions. Cancer cells that arise in the context of the one or more GEN1 variants are highly dependent on MUS81 and / or EME1 for survival. Accordingly, therapeutics that inhibit MUS81 and / or EME1 provide an effective therapeutic strategy for treating cancer cells having the one or more GEN1 variants. Likewise, subjects that have not yet been diagnosed with cancer but that would benefit from MUS81 and / or EME1 inhibition can also be identified Detecting One or More GEN1 Variants

[0080] The one or more GEN1 variants may be detected using amplification-based methods such as, for example, polymerase chain reaction (PCR) and variants thereof, Sanger sequencing, next-generation sequence (NGS), whole exome sequencing (WES), whole genome sequencing (WGS), microarrays, fluorescence in-situ hybridization (FISH), and multiplex ligation-dependent probe amplification (MLPA).

[0081] In one or more embodiments, the one or more GEN1 variants are in a non-coding region. In one or more embodiments, the one or more GEN1 variants are in a coding region. In one or more embodiments, the one or more GEN1 variants are in an auto-regulatory domain of GEN1. In one or more embodiments, the one or more variants lead to a truncated C-terminus protein encoded by GEN1. In one or more embodiments the C-terminal truncation is between 20-80 amino acids, 20-70 amino acids, 20-60 amino acids, 20-50 amino acids, 20-40 amino acids, 20-30 amino acids, 30-80 amino acids, 30-70 amin acids, 30-60 amino acids, 30-50 amino acids, 30-40 amino acids, 40-80 amino acids, 40-70 amino acids, 40-60 amino acids, 40-50 amino acids, 50-80 amino acids, 50-70 amino acids, 50-60 amino acids, 60-80 amino acids, 60-70 amino acids. In one or more embodiments the C-terminal truncation is between 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 amino acids. In one or more embodiments, the one or more GEN1 variants comprise a single nucleotide polymorphism (SNP). In one or more embodiments, the SNP is NM_001130009.3(GEN1):c.2515_2519del (p.Lys839fs). The C-terminus of GEN1 comprises an intrinsically disordered region (IDR) and IDRs are known to regulate protein-protein interactions, protein-DNA interactions, stability, and localization. The amino acid sequence of GEN1 Lys839Fs is shown in SEQ ID NO: 15.

[0082] The sample used for detecting of the one or more GEN1 variants may comprise any relevant clinical and genetic sample, including, for example, blood, saliva, buccal swab, amniotic fluid, tissue biopsy, urine, skin cells, and bone marrow.

[0083] In one or more embodiments, the one or more GEN1 variants are detected in a benign cell. In one or more embodiments, the benign cell is heterozygous for the one or more GEN1 variants. In another embodiment, the one or more GEN1 variants are detected in a cancer cell. In one or more embodiments, the cancer cell is heterozygous for the one or more GEN1 variants or has loss heterozygosity of the one or more GEN1 variant loci. Administering Therapeutics That Inhibit MUS81, EME1, or both

[0084] If the one or more GEN1 variants are detected in the sample from the subject to be treated, then a therapeutic agent that reduces activity and / or expression of MUS81 and / or EME1 is administered to the subject. As used herein the term “inhibit” or “inhibitor” refers to a therapeutic agent that may decrease expression of MUS81 and / or EME1, inhibit the catalytic activity of MUS81 and / or EME1 or disrupt the ability of MUS81 and / or EME1 to form a complex. If the one or more GEN1 variants are not detected, then a standard of care therapeutic is administered to the subject for the subject’s given cancer. The term “standard of care” as used herein refers to the current treatment that is accepted by medical experts as a proper treatment for a certain type of disease and that is widely used by healthcare professionals. Standard of care is also called best practice, standard medical care, and standard therapy. Standards of care for cancer generally include surgery, lymph node removal, radiation, chemotherapy, targeted therapies, antibodies targeting the tumor, and immunotherapy. Immunotherapy can include checkpoint blockers (CBP), chimeric antigen receptors (CARs), and adoptive T-cell therapy. The standards of care for the most common cancers can be found on the website of National Cancer Institute (cancer.gov / cancertopics).

[0085] In one or more embodiments, the cancer is ovarian, breast, or melanoma. In one or more embodiments, the cancer is ovarian. In another embodiment, the cancer is breast. In another embodiment, the cancer is a melanoma. In another embodiment, the cancer is thymoma. In another embodiment, the cancer is blood cancer. In another embodiment, the cancer is thyroid carcinoma. In another embodiment, the cancer is colon adenocarcinoma. In another embodiment, the cancer is kidney renal papillary cell carcinoma. In another embodiment, the cancer is kidney renal clearcell carcinoma. In another embodiment, the cancer is testicular germ cell tumors. In another embodiment, the cancer is uterine corpus endrometroid carcinoma. In another embodiment, the cancer is colorectal cancer. In another embodiment, the cancer is prostate adenocarcinoma. In another embodiment, the cancer is cervical squamous cell carcinoma. In another embodiment, the cancer is blood low grade glioma. In another embodiment, the cancer is cholangiocarcinoma. In another embodiment, the cancer is pheochromocytoma and paraganglioma. In another embodiment, the cancer is lung squamous cell carcinoma. In another embodiment, the cancer is glial cancer. In another embodiment, the cancer is lung cancer. In another embodiment, the cancer is glioblastoma multiforme. In another embodiment, the cancer is lung adenocarcinoma. In another embodiment, the cancer is stomach adenocarcinoma. In another embodiment, the cancer is uterine carcinosarcoma. In another embodiment, the cancer is liver hepatocellular carcinoma. In another embodiment, the cancer is kidney cancer. In another embodiment, the cancer is bladder urothelial carcinoma. In another embodiment, the cancer is diffuse B-cell lymphoma. In another embodiment, the cancer is head and neck squamous cell carcinoma. In another embodiment, the cancer is epithelial cancer. In another embodiment, the cancer is rectum adenocarcinoma. In another embodiment, the cancer is esophageal carcinoma. In another embodiment, the cancer is pancreatic adenocarcinoma. In another embodiment, the cancer is mesothelioma. In another embodiment, the cancer is cutaneous melanoma. In another embodiment, the cancer is ovarian serious cystadenocarcinoma. In another embodiment, the cancer is breast invasive adenocarcinoma. In another embodiment, the cancer is adrenocortical carcinoma. In another embodiment, the cancer is sarcoma. In another embodiment, the cancer is kidney chromophobe. Small Molecules for inhibiting MUS81, EME1 or both

[0086] In one or more embodiments, the inhibitor of MUS81 and / or EME1, or a combination comprises one or more small molecules.

[0087] The term “small molecule” refers to compounds, preferably organic compounds, with a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, peptides, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, e.g., up to about 4000, preferably up to 3000 Da, more preferably up to 2000 Da, even more preferably up to about 1000 Da, e.g., up to about900, 800, 700, 600 or up to about 500 Da. In example embodiments, the small molecule may act as an antagonist or agonist.

[0088] In one or more embodiments, the small molecule may be dyngo-4a. Zhang et al. “Identification of small-molecule inhibitors of human MUS81-EME1 / 2 by FRET-based high- throughput screening” Bioorganic & Medicinal Chemistry. 90, 15 July 2023, 117383, which is incorporated herein by reference.

[0089] In one or more embodiments, the small molecule may be a PROTACs, or Proteolysis Targeting Chimeras, are bifunctional small molecules that induce the degradation of a target protein by targeting it to the ubiquitin-proteasome system (Gilbertson B, Subbarao K. A new route to vaccines using PROTACs. Nat Biotechnol. 2022;40(9):1328-1329). They typically consist of two covalently linked moieties: one that binds to the protein of interest and another that binds to a cytosolic E3 ubiquitin ligase, such as von Hippel-Lindau or cereblon (Crunkhorn S. Developing antibody-based PROTACs. Nat Rev Drug Discov. 2022;21(11):795). By forming a ternary complex with the target protein and the E3 ligase, PROTACs facilitate the ubiquitination and subsequent degradation of the target protein. Id. This therapeutic strategy has gained significant interest in drug development as it enables the targeting of previously undruggable proteins, offering new possibilities for the treatment of various diseases, including cancer (Zografou- Barredo NA, Hallatt AJ, Goujon-Ricci J, Cano C. A beginner's guide to current synthetic linker strategies towards VHL-recruiting PROTACs. Bioorg Med Chem.2023;88-89:117334; and Gao H, Sun X, Rao Y. PROTAC Technology: Opportunities and Challenges. ACS Med Chem Lett. 2020;11(3):237-240). A number of known PROTAC may be found in the PROTAC-DB database found at cadd.zju.edu.cn / protacdb / about. (See also, Weng et al. (2020). PROTAC-DB: An online database of protacs. Nucleic Acids Research, 49(D1)) or any others known in literature

[0090] Accordingly, a PROTAC for use in the context of this disclosure would utilize a target binding moiety specific for the gene product of MUS81 and / or EME1. The target binding moiety can be any small molecule that binds the gene expression product of MUS81 and / or EME1.

[0091] In addition to selection of the targeting moiety, design considerations include selection of the E3 ligase ligand and the linker that connects these two components. There are a large number of E3 ligases available (Zorba A, Nguyen C, Xu Y, et al. Delineating the role of cooperativity in the design of potent PROTACs for BTK. Proc Natl Acad Sci U S A.2018;115(31):E7285-E7292).However, the selection can be refined by focusing on target-ligase pairs that colocalize in similar cellular compartments and targets with accessible Lys residues for ubiquitination (Zorba, et al. 2018). Among the numerous E3 ligases, a few have been utilized for PROTAC technology, such as CRBN, VHL, IAP, and MDM2 (Bricelj A, Steinebach C, Kuchta R, Gütschow M, Sosič I. E3 Ligase Ligands in Successful PROTACs: An Overview of Syntheses and Linker Attachment Points. Front Chem.2021;9:707317). An important factor to consider when selecting the optimal E3 ligase is the structural perspective of the PROTAC targets. The target should have a small- molecule binding surface that can be approached by an E3 ligase and, ideally, have an unstructured region that can be threaded into the E3 ligase (Békés M, Langley DR, Crews CM. PROTAC targeted protein degraders: the past is prologue. Nat Rev Drug Discov.2022;21(3):181-200). There are computational tools and databases, such as PROTAC-DB (Weng et al.2020), which can help in the design and optimization of PROTAC molecules, including the selection of the optimal E3 ligase. Other Bifunctional Molecules

[0092] In addition to PROTACS, other bi-functional molecules have been developed that may be used in the context of the present disclosure. In general, the E3 ligase binding portion is replaced with a binder of an enzyme capable of introducing a post-translational modification (PTM). For example, binders may be selected that bind to deubiquitinases kinases, phosphatases, acetylases, de-acetylases, methylases and demethylases. In embodiments, the enzyme is a kinase, a phosphatase, transferase, glycosyltransferase, ligase, histone acetylases (HATs), or histone deacetylases (HDACs), hydroxylase, a Glutamine Synthetase Adenyl Transferases (GSATase), enzymes catalyzing hydroxylation of protein residues, oxygenase, or sulfotransferase. As with PROTACS, theses binders are then linked to a small molecular binding of the target protein to be modified via linker. The type of bifunctional molecule used will depend on the target gene and whether a particular PTM activates / stabilizes or deactivates / de-stabilizes / degrades that particular target gene. For example, if the goal is to increase activity of the target gene product and phosphorylation is necessary to activate the gene product, then a kinase would be selected. Conversely, if the goal is to increase activity of the target gene product and de-phosphorylation is necessary to activate the product, then a phosphatase would be selected and so forth.PHICS

[0093] Phosphorylation-inducing chimeric molecules, also known as Phosphorylation- Inducing Chimeric Small molecules (PHICS), are a new class of small molecules designed to induce phosphorylation, a process that alters the structure and function of a protein by attaching a phosphate group to it (Siriwardena SU, Munkanatta Godage DNP, Shoba VM, et al. Phosphorylation-Inducing Chimeric Small Molecules. J Am Chem Soc. 2020;142(33):14052- 14057). Traditionally, small molecules have been used to inhibit enzyme function, but PHICS represents a novel approach that endows new functions to enzymes via proximity-mediated effects (Siriwardena, et al.2020).

[0094] PHICS function by bringing a kinase, an enzyme that transfers phosphate groups, into proximity with a target protein, which allows the kinase to phosphorylate the target protein (Siriwardena, et al.2020). This process can enable a kinase to function at a new cellular location or phosphorylate non-native substrates or sites, otherwise known as neo-substrates or neo- phosphorylations (Shoba VM, Munkanatta Godage DNP, Chaudhary SK, Deb A, Siriwardena SU, Choudhary A. Synthetic Reprogramming of Kinases Expands Cellular Activities of Proteins. Angew Chem Int Ed Engl.2022;61(29):e202202770).

[0095] In one or more embodimentss, MUS81 and / or EME1 are targeted with chimeric molecules that recruit enzymes (e.g., kinases or phosphatases) to the target protein by a similar mechanism as PROTACs (see, e.g., Shoba VM, Munkanatta Godage DNP, Chaudhary SK, Deb A, Siriwardena SU, Choudhary A. Synthetic Reprogramming of Kinases Expands Cellular Activities of Proteins. Angew Chem Int Ed Engl. 2022;61(29):e202202770; and International patent application publication No. WO2021142351A1). Phosphorylation-inducing chimeric small molecules (PHICS) can enable a kinase to act at a new cellular location or phosphorylate non- native substrates (neo-substrates) / sites (neo-phosphorylations). PHICS are formed by linking small-molecule binders of the kinase or the phosphatase and the target protein. The molecule that binds the target protein is the same as for PROTACs described herein and can be rationally designed in the same way. In example embodiments, modulating modifications at sites that regulate the target protein or at neo-sites inactivates or reduces the function of the target protein.

[0096] PHICS is formed by joining a kinase binder with a binder of the target protein-of- interest so that the kinase is brought into proximity to the target protein. The resulting increase inthe effective concentration of the target protein around the kinase will result in target protein phosphorylation. The PHICS molecule should have sufficient stability to maintain its structure and function under physiological conditions. A target kinase should be selected based on its ability to effectively phosphorylate the site(s) of interest on the target protein. Selecting a kinase that is highly expressed in a cell type or tissue type of interest may also be desirable to ensure adequate levels of activity. A number of kinase-specific databases are known that may be used to select both the appropriate kinase and kinase binder, which include, but are not limited to, the following:

[0097] KinaseMD: This database presents information on mutations in kinase genes which can impact drug treatment sensitivity and resistance (Hu R, Xu H, Jia P, Zhao Z. KinaseMD: kinase mutations and drug response database. Nucleic Acids Res.2021;49(D1):D552-D561).

[0098] Human Kinase Protein Pockets Database: This resource provides information on kinase pocket structures, which is crucial for drug discovery targeting cancer or other diseases (Wang H, Qiu J, Liu H, Xu Y, Jia Y, Zhao Y. HKPocket: human kinase pocket database for drug design. BMC Bioinformatics.2019;20(1):617).

[0099] Kinase-Ligand Interaction Fingerprints and Structure Database (KLIFS): KLIFS offers detailed information about kinase-ligand interaction derived from all structures of catalytic domains of human and mouse protein kinases deposited in the Protein Data Bank (van Linden OP, Kooistra AJ, Leurs R, de Esch IJ, de Graaf C. KLIFS: a knowledge-based structural database to navigate kinase-ligand interaction space. J Med Chem.2014;57(2):249-277; Kooistra AJ, Kanev GK, van Linden OP, Leurs R, de Esch IJ, de Graaf C. KLIFS: a structural kinase-ligand interaction database. Nucleic Acids Res.2016;44(D1):D365-D371).

[0100] KinBase: Available on Kinase.com, KinBase is a resource that includes genomic and evolutionary analyses (kinomes), classification, disease associations, and an extensive database of protein kinase genes.

[0101] Kinase Knowledge Base (KKB): KKB is a kinase structural database that covers all human kinase domain structures that have been deposited in the Protein Data Bank (Brooijmans N, Chang YW, Mobilio D, Denny RA, Humblet C. An enriched structural kinase database to enable kinome-wide structure-based analyses and drug discovery. Protein Sci. 2010;19(4):763- 774).

[0102] There are several resources available to search for known binders of kinases. One resource is the Published Kinase Inhibitor Set (PKIS), which is a set of 367 small-molecule ATP- competitive kinase inhibitors that was made freely available to expand research in this field. Elkins, J., Fedele, V., Szklarz, M. et al. Comprehensive characterization of the Published Kinase Inhibitor Set. Nat Biotechnol 34, 95–103 (2016). Another resource is the use of databases such as NCI, NPD, and MLSMR, which are frequently used in the virtual screening of kinase inhibitors. Singh, N., Sun, H., Chaudhury, S. et al. A physicochemical descriptor-based scoring scheme for effective and rapid filtering of kinase-like chemical space. J Cheminform 4, 4 (2012). Computational approaches have also been developed to predict molecular targets for small- molecule drugs. R. Cao, Y. Wang, ChemMedChem 2016, 11, 1352.

[0103] As with PROTACS design linker selection is also a relevant design consideration and many if not all of the linker design considerations discussed above in the context of PROTACS may be considered when selecting an appropriate linker for PHICS molecule design. Vector Based Gene Knock-out

[0104] In one or more embodiments, the therapeutic agent that reduces activity and / or expression of MUS81 and / or EME1 may comprise one or more recombinant expression vectors, wherein the vectors are configured to knock-down expression of MUS81, EME1 or both. See e.g., Hendrie and Russell “Gene Targeting with Viral Vectors” Molecular Therapy 12(1):9-18 (2005). In general, a vector that is designed for gene targeting, including gene knock-out, comprises sequences that are homologous to regions of a target gene (referred to as the homology arms) so as to facilitate insertion of a vector sequence that is between the homology arms in the target gene via homologous recombination with the target gene between two homology arms. The homology arms are designed to hybridize with chromosomal DNA in the target gene. The types of modification that may be introduced include substitutions, deletions and / or insertions, that prevent expression of the target gene or modify the target gene such that a non-functional gene product is ultimately expressed (e.g., frame-shift mutations, introduction of pre-mature stop codon, introduction of alternative splice sites, introduction or removal of post-translation modification sites).

[0105] In general, and throughout this specification, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include,but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g., circular); nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of polynucleotides known in the art. There are no limitations regarding the type of vector that can be used. The vector can be a cloning vector, suitable for propagation and for obtaining polynucleotides, gene constructs or expression vectors incorporated to several heterologous organisms. Suitable vectors include eukaryotic expression vectors based on viral vectors (e.g., adenoviruses, adeno- associated viruses as well as retroviruses and lentiviruses), as well as non- viral vectors such as plasmids.

[0106] In one example embodiment, the vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication defective retroviruses, adenoviruses, replication defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are . Such vectors are referred to herein as “expression vectors.” Vectors for and that result in expression in a eukaryotic cell can be referred to herein as “eukaryotic expression vectors.” In another example embodiment, the vector integrates the gene into the cell genome or is maintained episomally.

[0107] In one example embodiment, the vector is a “plasmid,” which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.

[0108] In one example embodiment, the vector is an mRNA vector (see, e.g., Sahin, U, Kariko, K and Tureci, O (2014). mRNA-based therapeutics - developing a new class of drugs. Nat Rev Drug Discov 13: 759–780; Weissman D, Karikó K. mRNA: Fulfilling the Promise of Gene Therapy. Mol Ther. 2015;23(9):1416-1417. doi:10.1038 / mt.2015.138; Kowalski PS, Rudra A, Miao L, Anderson DG. Delivering the Messenger: Advances in Technologies for Therapeutic mRNA Delivery. Mol Ther.2019;27(4):710-728. doi:10.1016 / j.ymthe.2019.02.012; Magadum A,Kaur K, Zangi L. mRNA-Based Protein Replacement Therapy for the Heart. Mol Ther. 2019;27(4):785-793. doi:10.1016 / j.ymthe.2018.11.018; Reichmuth AM, Oberli MA, Jaklenec A, Langer R, Blankschtein D. mRNA vaccine delivery using lipid nanoparticles Ther Deliv. 2016;7(5):319-334. doi:10.4155 / tde-2016-0006; and Khalil AS, Yu X, Umhoefer JM, et al. Single- dose mRNA therapy via biomaterial-mediated sequestration of overexpressed proteins. Sci Adv. 2020;6(27):eaba2422). In an exemplary embodiment, mRNA encoding for a target gene is delivered using lipid nanoparticles (see, e.g., Reichmuth, et al., 2016) and administered directly to tumor tissue. In an exemplary embodiment, mRNA encoding for a target gene is delivered using biomaterial-mediated sequestration (see, e.g., Khalil, et al., 2020) and administered directly to tumor tissue. Sequences present in mRNA molecules, as described further herein, are applicable to mRNA vectors (e.g., Kozak consensus sequence, miRNA target sites and WPRE).

[0109] In one example embodiment, the non-viral vector for use in gene transfer and / or nanoparticle formulations is a lipid. In one example embodiment the non-viral lipid vector may comprise: 1,2-Dioleoyl-sn-glycero-3-phosphatidylcholine; 1,2-Dioleoyl-sn-glycero-3- phosphatidylethanolamine; Cholesterol; N-[1-(2,3-Dioleyloxy)propyl]N,N,N- trimethylammonium chloride; 1,2-Dioleoyloxy-3-trimethylammonium-propane; Dioctadecylamidoglycylspermine; N-(3-Aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)-1- propanaminium bromide; Cetyltrimethylammonium bromide; 6-Lauroxyhexyl ornithinate; 1-(2,3- Dioleoyloxypropyl)-2,4,6-trimethylpyridinium; 2,3-Dioleyloxy-N-[2(sperminecarboxamido- ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate; 1,2-Dioleyl-3-trimethylammonium- propane; N-(2-Hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide; Dimyristooxypropyl dimethyl hydroxyethyl ammonium bromide; 3β-[N-(N′,N′- Dimethylaminoethane)-carbamoyl]cholesterol; Bis-guanidium-tren-cholesterol; 1,3-Diodeoxy-2- (6-carboxy-spermyl)-propylamide; Dimethyloctadecylammonium bromide; Dioctadecylamidoglicylspermidin; rac-[(2,3-Dioctadecyloxypropyl)(2-hydroxyethyl)]- dimethylammonium chloride; rac-[2(2,3-Dihexadecyloxypropyl- oxymethyloxy)ethyl]trimethylammonium bromide; Ethyldimyristoylphosphatidylcholine; 1,2- Distearyloxy-N,N-dimethyl-3-aminopropane; 1,2-Dimyristoyl-trimethylammonium propane; O,O′-Dimyristyl-N-lysyl aspartate; 1,2-Distearoyl-sn-glycero-3-ethylphosphocholine; N- Palmitoyl D-erythro-sphingosyl carbamoyl-spermine; N-t-Butyl-N0-tetradecyl-3-tetradecylaminopropionamidine; Octadecenolyoxy[ethyl-2-heptadecenyl-3 hydroxyethyl] imidazolinium chloride; N1-Cholesteryloxycarbonyl-3,7-diazanonane-1,9-diamine; 2-(3-[Bis(3- amino-propyl)-amino]propylamino)-N-ditetradecylcarbamoylme-ethyl-acetamide; 1,2- dilinoleyloxy-3-dimethylaminopropane; 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane; and dilinoleyl-methyl-4-dimethylaminobutyrate.

[0110] In one example embodiment, the non-viral vector for use in gene transfer and / or nanoparticle formulations is a polymer. In one example embodiment the non-viral polymer vector may comprise: Poly(ethylene)glycol; Polyethylenimine; Dithiobis(succinimidylpropionate); Dimethyl-3,3′-dithiobispropionimidate; Poly(ethylene imine) biscarbamate; Poly(L-lysine); Histidine modified PLL; Poly(N-vinylpyrrolidone); Poly(propylenimine); Poly(amidoamine); Poly(amido ethylenimine); Triethylenetetramine; Poly(β-aminoester); Poly(4-hydroxy-L-proline ester); Poly(allylamine); Poly(α-[4-aminobutyl]-L-glycolic acid); Poly(D,L-lactic-co-glycolic acid); Poly(N-ethyl-4-vinylpyridinium bromide); Poly(phosphazene)s; Poly(phosphoester)s; Poly(phosphoramidate)s; Poly(N-2-hydroxypropylmethacrylamide); Poly (2- (dimethylamino)ethyl methacrylate); Poly(2-aminoethyl propylene phosphate); Chitosan; Galactosylated chitosan; N-Dodacylated chitosan; Histone; Collagen; and Dextran-spermine. Targeted Tissue Vector Delivery and Expression

[0111] Vector expression, such as the expression of the vectors or polynucleotides thereof described herein, can be targeted to a particular cell or tissue type. In one or more embodiments, the vectors are configured to have expression of one or more vector polynucleotides or sequences regulated by cell or tissue specific regulatory elements, such as promoters, enhancers, inhibitors, and / or the like. This can be accomplished as described elsewhere herein by operatively linking a polynucleotide to be expressed to one or more tissue specific regulatory elements. Additionally, or alternatively, the vectors can be delivered using a targeted delivery vehicle, such as a virus or viral like particle or capsid that has a tissues specific tropism. In one or more embodiments, the delivery vehicle comprises a targeting moiety that specifically targets a molecule on the surface of a target cell thus facilitating targeted delivery of the vector and ultimately targeted expression. Vectors may be used to specifically target malignant cells, such as oncolytic viruses (see, e.g., Xie, L, Han, Y, Liu, Y, et al. Viral vector-based cancer treatment and current clinical applications. MedComm – Oncology.2023; 2:e55).Targeted Delivery

[0112] As previously mentioned, the vector or other polynucleotide for gene knock out / down (or knock / in) can be delivered to the cell using a targeted delivery approach so as to limit delivery and thus expression of a polynucleotide to only cells in which it is delivered. In one or more embodiments, the delivery vehicle (or composition) used to deliver the vector or other polynucleotide can allow for targeted delivery to a specific cell, tissue, organ, or system. In such embodiments, the delivery vehicle can include one or more targeting moieties that can direct targeted delivery of the cargo(s). In an embodiment, the delivery vehicle comprises a targeting moiety that can target a tumor cell. As used herein, “targeting moiety” refers to molecules, complexes, agents, and the like that is capable of specifically or selectively interacting with, binding with, acting on or with, or otherwise associating or recognizing a target molecule, agent, and / or complex that is associated with, part of, coupled to, another object, complex, surface, and the like, such as a cell or cell population, tissue, organ, subcellular locale, particle etc. Targeting moieties can be chemical, biological, metals, polymers, or other agents and molecules with targeting capabilities. Targeting moieties can be amino acids, peptides, polypeptides, nucleic acids, polynucleotides, lipids, sugars, metals, small molecule chemicals, combinations thereof, and the like. Targeting moieties can be antibodies or fragments thereof, aptamers, DNA, RNA such as guide RNA for a RNA guided nuclease or system, ligands, substrates, enzymes, combinations thereof, and the like. The specificity or selectivity of a targeting moiety can be determined by any suitable method or technique that will be appreciated by those of ordinary skill in the art. For example, In one or more embodiments, the methods described herein include determining the disassociation constant for the targeting moiety and target. In one or more embodiments, the targeting moiety has a specificity the equilibrium dissociation constant, Kd, is 10−3M or less, 10−4M or less, 10−5M or less, 10−6M or less, 10−7M or less, 10−8M or less, 10−9M or less, 10−10M or less, 10−11M or less, or 10−12M or less under the conditions employed, e.g., under physiological conditions such as those inside a cell or consistent with cell survival. In one or more embodiments, specific binding can be accomplished by a plurality of weaker interactions (e.g., a plurality of individual interactions, wherein each individual interaction is characterized by a Kd of greater than 10−3M). In one or more embodiments, the targeting moiety has increased binding with, association with, interaction with, activity on as compared to non-targets, such as a 1 to 500 or more foldincrease. Targets of targeting moieties can be amino acids, peptides, polypeptides, nucleic acids, polynucleotides, lipids, sugars, metals, small molecule chemicals, combinations thereof, and the like. Targets can be receptors, biomarkers, transporters, antigens, complexes, combinations thereof, and the like. RNAi and antisense oligonucleotides (ASO)

[0113] In one or more embodiments, the inhibitor comprises one or more RNAi or ASO agents directed to MUS81 and / or EME1 such that expression MUS81 and / or EME1 is reduced. As used herein, “gene silencing” or “gene silenced” in reference to an activity of an RNAi molecule, for example a siRNA or miRNA refers to a decrease in the mRNA level in a cell for a target gene by at least about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, about 100% of the mRNA level found in the cell without the presence of the miRNA or RNA interference molecule. In one preferred embodiment, the mRNA levels are decreased by at least about 70%, about 80%, about 90%, about 95%, about 99%, about 100%. Additionally, inhibitory nucleic acid molecules such as RNAi and ASOs can be used in vivo (see, e.g., Yan Y, Liu XY, Lu A, Wang XY, Jiang LX, Wang JC. Non- viral vectors for RNA delivery. J Control Release. 2022;342:241-279). In one or more embodiments, the RNAi may be the RNAi disclosed in Zhong et al.”MUS81 inhibition increases the sensitivity to therapy effect in epithelial ovarian cancer via regulating cyclinB pathway” J. Cancer 2019; 10(1):2276-2287 which is incorporated by reference herein.

[0114] As used herein, the term “RNAi” refers to any type of interfering RNA, including but not limited to, siRNAi, shRNAi, endogenous microRNA and artificial microRNA. For instance, it includes sequences previously identified as siRNA, regardless of the mechanism of down-stream processing of the RNA (i.e., although siRNAs are believed to have a specific method of in vivo processing resulting in the cleavage of mRNA, such sequences can be incorporated into the vectors in the context of the flanking sequences described herein). The term “RNAi” can include both gene silencing RNAi molecules, and also RNAi effector molecules which activate the expression of a gene.

[0115] As used herein, a “siRNA” refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is present or expressed in the same cell as the target gene. The double strandedRNA siRNA can be formed by the complementary strands. In one or more embodiments, a siRNA refers to a nucleic acid that can form a double stranded siRNA. The sequence of the siRNA can correspond to the full-length target gene, or a subsequence thereof. Typically, the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is about 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferably about 19-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).

[0116] As used herein “shRNA” or “small hairpin RNA” (also called stem loop) is a type of siRNA. In one or more embodiments, these shRNAs are composed of a short, e.g., about 19 to about 25 nucleotide, antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand can precede the nucleotide loop structure and the antisense strand can follow.

[0117] The terms “microRNA” or “miRNA” are used interchangeably herein are endogenous RNAs, some of which are known to regulate the expression of protein-coding genes at the posttranscriptional level. Endogenous microRNAs are small RNAs naturally present in the genome that are capable of modulating the productive utilization of mRNA. The term artificial microRNA includes any type of RNA sequence, other than endogenous microRNA, which is capable of modulating the productive utilization of mRNA. MicroRNA sequences have been described in publications such as Lim, et al., Genes & Development, 17, p.991 - 1008 (2003), Lim et al Science 299, 1540 (2003), Lee and Ambros Science, 294, 862 (2001), Lau et al., Science 294, 858-861 (2001), Lagos-Quintana et al, Current Biology, 12, 735-739 (2002), Lagos Quintana et al, Science 294, 853- 857 (2001), and Lagos-Quintana et al, RNA, 9, 175- 179 (2003), which are incorporated herein by reference. Multiple microRNAs can also be incorporated into a precursor molecule. Furthermore, miRNA-like stem-loops can be expressed in cells as a vehicle to deliver artificial miRNAs and short interfering RNAs (siRNAs) for the purpose of modulating the expression of endogenous genes through the miRNA and or RNAi pathways.

[0118] Antisense therapy is a form of treatment that uses antisense oligonucleotides (ASOs) to target messenger RNA (mRNA). ASOs are capable of altering mRNA expression through a variety of mechanisms, including ribonuclease H mediated decay of the pre-mRNA, direct steric blockage, and exon content modulation through splicing site binding on pre-mRNA (see, e.g.,Crooke ST, Liang XH, Baker BF, Crooke RM. Antisense technology: A review. J Biol Chem. 2021;296:100416. doi:10.1016 / j.jbc.2021.100416). Antisense oligonucleotides (ASO) generally inhibit their target by binding target mRNA and sterically blocking expression by obstructing the ribosome. ASOs can also inhibit their target by binding target mRNA thus forming a DNA-RNA hybrid that can be a substrate for RNase H. Commonly used antisense mechanisms to degrade target RNAs include RNase H1-dependent and RISC-dependent mechanisms. Preferred ASOs include Locked Nucleic Acids (LNA), Peptide Nucleic Acids (PNA), and morpholinos. Genetic Modification Systems

[0119] In one example embodiment, the inhibitor of MUS81 and / or EME1 may be programmable nuclease, such as, a CRISPR system, a zinc finger nuclease system, a TALEN, or a meganuclease, or an OMEGA system. In addition, a number of alternate gene modification systems have been developed by modifying Cas nuclease so that they are catalytically inactive (“dead Cas” or “dCas”) or cut only a single strand of DNA (“nickase”) and then coupling these modified Cas nuclease with a further functional domain such as base editors, reverse transcriptases, recombinases, transposases and retrotransposases. For sake of convenience these alternative systems (e.g., Base Editors, Prime Editors, CAST, Non-LTR Retrotransposon Systems, Epigenetic Editors) are described further below in the context of use with a modified Cas. However, it is further contemplated that the modified Cas could be substituted with another similarly modified programmable nuclease like a Zinc Finger nucleases, TALENs, Omega nucleases (e.g., Iscb, Isrb, TnpB, Fanzor), meganuclease. In example embodiments, the genetic modifying agent is administered using a vector, such as a viral vector or liposome. In example embodiments, the genetic modifying agent is targeted to tumor cells (see, e.g., Montaño-Samaniego M, Bravo- Estupiñan DM, Méndez-Guerrero O, Alarcón-Hernández E, Ibáñez-Hernández M. Strategies for Targeting Gene Therapy in Cancer Cells With Tumor-Specific Promoters. Front Oncol. 2020;10:605380; and Jafari M, Kadkhodazadeh M, Shapourabadi MB, et al. Immunovirotherapy: The role of antibody based therapeutics combination with oncolytic viruses. Front Immunol. 2022;13:1012806). In example embodiments, the genetic modifying agent is administered directly to a tumor. Programmable nucleases may use two different cell repair pathways to effectuate edits to one or more target sequences, non-homologous end joining (NHEJ) or homology-directed repair Transcription Repressors and Transcription Activators

[0120] In one or more embodiments, the method includes modulating gene expression of one or more target genes by modifying DNA binding sites and / or methylation sites for one or more DNA binding or interaction molecules or complexes. In one or more embodiments, the DNA binding or interaction molecules comprise, transcriptional activators, and / or transcriptional repressors. In one or more embodiments, the method comprises administering or otherwise introducing an engineered transcriptional activator or repressor to one or more tumor cells such that expression of a MUS81 and / or EME1. Exemplary Engineered Transcriptional Repressors

[0121] CRISPR interference (CRISPRi) is a CRISPR-Cas system variant that allows selective silencing or repression of gene expression by sterically repressing transcription by blocking transcription initiation or elongation (see e.g., Li et al., Cell.152 (5): 1173–1183 (2013) of a target gene that is targeted by the dCas component of the system. A CRISPRi system comprises a dCas (e.g., dCas9) fused or otherwise linked to a repressor protein or domain (e.g., a KRAB (Krüppel- associated box) domain, mSin3A, NCoR (nuclear receptor co-repressor, Lsd1 (lysine-specific demethylase 1), MeCP2 (methyl-CpG-binding protein 2, HP1 (heterochromatin protein 1), and REST (RE1-silencing transcription factor)). In operation, the dCas portion is directed to a target gene whose expression is to be repressed, by a target gene specific guide RNA. The repressor domain then represses transcription by blocking initiation and / or elongation. In one or more embodiments, repression of gene transcription is greater than 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, up to and including 100%. Pharmaceutical Formulations and Administration

[0122] Also described herein are pharmaceutical formulations that can contain an amount, effective amount, and / or least effective amount, and / or therapeutically effective amount of one or more compounds, molecules, compositions, vectors, vector systems, cells as described above, or a combination thereof (which are also referred to as the primary active agent or ingredient elsewhere herein) described in greater detail elsewhere herein a pharmaceutically acceptable carrier or excipient. As used herein, “pharmaceutical formulation” refers to the combination of an active agent, compound, or ingredient with a pharmaceutically acceptable carrier or excipient, making the composition suitable for diagnostic, therapeutic, or preventive use in vitro, in vivo, or ex vivo. As used herein, “pharmaceutically acceptable carrier or excipient” refers to a carrier orexcipient that is useful in preparing a pharmaceutical formulation that is generally safe, non-toxic, and is neither biologically or otherwise undesirable, and includes a carrier or excipient that is acceptable for veterinary use as well as human pharmaceutical use. A “pharmaceutically acceptable carrier or excipient” as used in the specification and claims includes both one and more than one such carrier or excipient. When present, the compound can optionally be present in the pharmaceutical formulation as a pharmaceutically acceptable salt. In one or more embodiments, the pharmaceutical formulation can include, such as an active ingredient, a CRISPR-Cas system or component thereof described in greater detail elsewhere herein. In one or more embodiments, the pharmaceutical formulation can include, such as an active ingredient, a CRISPR-Cas polynucleotide described in greater detail elsewhere herein. In one or more embodiments, the pharmaceutical formulation can include, such as an active ingredient one or more modified cells, such as one or more modified cells described in greater detail elsewhere herein.

[0123] In one or more embodiments, the active ingredient is present as a pharmaceutically acceptable salt of the active ingredient. As used herein, “pharmaceutically acceptable salt” refers to any acid or base addition salt whose counter-ions are non-toxic to the subject to which they are administered in pharmaceutical doses of the salts. Suitable salts include, hydrobromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, napthalenesulfonate, propionate, malonate, mandelate, malate, phthalate, and pamoate.

[0124] The pharmaceutical formulations described herein can be administered to a subject in need thereof via any suitable method or route to a subject in need thereof. Suitable administration routes can include, but are not limited to auricular (otic), buccal, conjunctival, cutaneous, dental, electro-osmosis, endocervical, endosinusial, endotracheal, enteral, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra- arterial, intra-articular, intrabiliary, intrabronchial, intrabursal, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebral, intracisternal, intracorneal, intracoronal (dental), intracoronary, intracorporus cavernosum, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal,intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumor, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intraventricular, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, occlusive dressing technique, ophthalmic, oral, oropharyngeal, other, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (inhalation), retrobulbar, soft tissue, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, and / or vaginal administration, and / or any combination of the above administration routes, which typically depends on the disease to be treated and / or the active ingredient(s).

[0125] Where appropriate, compounds, molecules, compositions, vectors, vector systems, cells, or a combination thereof described in greater detail elsewhere herein can be provided to a subject in need thereof as an ingredient, such as an active ingredient or agent, in a pharmaceutical formulation. As such, also described are pharmaceutical formulations containing one or more of the compounds and salts thereof, or pharmaceutically acceptable salts thereof described herein. Suitable salts include, hydrobromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, napthalenesulfonate, propionate, malonate, mandelate, malate, phthalate, and pamoate. Pharmaceutically Acceptable Carriers and Secondary Ingredients and Agents

[0126] The pharmaceutical formulation can include a pharmaceutically acceptable carrier. Suitable pharmaceutically acceptable carriers include, but are not limited to water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxy methylcellulose, and polyvinyl pyrrolidone, which do not deleteriously react with the active composition.

[0127] The pharmaceutical formulations can be sterilized, and if desired, mixed with agents, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and / or aromatic substances, and the like which do not deleteriously react with the active compound.

[0128] In one or more embodiments, the pharmaceutical formulation can also include an effective amount of secondary active agents, including but not limited to, biologic agents or molecules including, but not limited to, e.g. polynucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, hormones, immunomodulators, antipyretics, anxiolytics, antipsychotics, analgesics, antispasmodics, anti-inflammatories, anti-histamines, anti-infectives, chemotherapeutics, and combinations thereof. Effective Amounts

[0129] In one or more embodiments, the amount of the primary active agent and / or optional secondary agent can be an effective amount, least effective amount, and / or therapeutically effective amount. As used herein, “effective amount” refers to the amount of the primary and / or optional secondary agent included in the pharmaceutical formulation that achieve one or more therapeutic effects or desired effect. As used herein, “least effective” amount refers to the lowest amount of the primary and / or optional secondary agent that achieves the one or more therapeutic or other desired effects. As used herein, “therapeutically effective amount” refers to the amount of the primary and / or optional secondary agent included in the pharmaceutical formulation that achieves one or more therapeutic effects. In one or more embodiments, the one or more therapeutic effects are promoting actin cytoskeleton remodeling processes, promoting accumulation of lipids in targeted cells, and promoting insulin-sensitivity.

[0130] The effective amount, least effective amount, and / or therapeutically effective amount of the primary and optional secondary active agent described elsewhere herein contained in the pharmaceutical formulation can range from about 0 to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870,880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 pg, ng, μg, mg, or g or be any numerical value with any of these ranges.

[0131] In one or more embodiments, the effective amount, least effective amount, and / or therapeutically effective amount can be an effective concentration, least effective concentration, and / or therapeutically effective concentration, which can each range from about 0 to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 pM, nM, μM, mM, or M or be any numerical value with any of these ranges.

[0132] In other embodiments, the effective amount, least effective amount, and / or therapeutically effective amount of the primary and optional secondary active agent can range from about 0 to 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000 IU or be any numerical value with any of these ranges.

[0133] In one or more embodiments, the primary and / or the optional secondary active agent present in the pharmaceutical formulation can range from about 0 to 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5, 0.51, 0.52, 0.53, 0.54, 0.55, 0.56, 0.57, 0.58, 0.59, 0.6, 0.61, 0.62, 0.63, 0.64, 0.65, 0.66, 0.67, 0.68, 0.69, 0.7, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.8, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.9, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.9, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83,84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % w / w, v / v, or w / v of the pharmaceutical formulation.

[0134] In one or more embodiments where a cell population is present in the pharmaceutical formulation (e.g., as a primary and / or or secondary active agent), the effective amount of cells can range from about 2 cells to 1×101 / mL, 1×1020 / mL or more, such as about 1×101 / mL, 1×102 / mL, 1×103 / mL, 1×104 / mL, 1×105 / mL, 1×106 / mL, 1×107 / mL, 1×108 / mL, 1×109 / mL, 1×1010 / mL, 1×1011 / mL, 1×1012 / mL, 1×1013 / mL, 1×1014 / mL, 1×1015 / mL, 1×1016 / mL, 1×1017 / mL, 1×1018 / mL, 1×1019 / mL, to / or about 1×1020 / mL.

[0135] In one or more embodiments, the amount or effective amount, particularly where an infective particle is being delivered (e.g. a virus particle having the primary or secondary agent as a cargo), the effective amount of virus particles can be expressed as a titer (plaque forming units per unit of volume) or as a MOI (multiplicity of infection). In one or more embodiments, the effective amount can be 1×101 particles per pL, nL, μL, mL, or L to 1×1020 / particles per pL, nL, μL, mL, or L or more, such as about 1×101, 1×102, 1×103, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015, 1×1016, 1×1017, 1×1018, 1×1019, to / or about 1×1020particles per pL, nL, μL, mL, or L. In one or more embodiments, the effective titer can be about 1×101transforming units per pL, nL, μL, mL, or L to 1×1020 / transforming units per pL, nL, μL, mL, or L or more, such as about 1×101, 1×102, 1×103, 1×104, 1×105, 1×106, 1×107, 1×108, 1×109, 1×1010, 1×1011, 1×1012, 1×1013, 1×1014, 1×1015, 1×1016, 1×1017, 1×1018, 1×1019, to / or about 1×1020transforming units per pL, nL, μL, mL, or L. In one or more embodiments, the MOI of the pharmaceutical formulation can range from about 0.1 to 10 or more, such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10 or more.

[0136] In one or more embodiments, the amount or effective amount of the one or more of the active agent(s) described herein contained in the pharmaceutical formulation can range from about 1 pg / kg to about 10 mg / kg based upon the bodyweight of the subject in need thereof or averagebodyweight of the specific patient population to which the pharmaceutical formulation can be administered.

[0137] In embodiments where there is a secondary agent contained in the pharmaceutical formulation, the effective amount of the secondary active agent will vary depending on the secondary agent, the primary agent, the administration route, subject age, disease, stage of disease, among other things, which will be one of ordinary skill in the art.

[0138] When optionally present in the pharmaceutical formulation, the secondary active agent can be included in the pharmaceutical formulation or can exist as a stand-alone compound or pharmaceutical formulation that can be administered contemporaneously or sequentially with the compound, derivative thereof, or pharmaceutical formulation thereof.

[0139] In one or more embodiments, the effective amount of the secondary active agent can range from about 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % w / w, v / v, or w / v of the total secondary active agent in the pharmaceutical formulation. In additional embodiments, the effective amount of the secondary active agent can range from about 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 % w / w, v / v, or w / v of the total pharmaceutical formulation. Dosage Forms

[0140] In one or more embodiments, the pharmaceutical formulations described herein can be provided in a dosage form. The dosage form can be administered to a subject in need thereof. The dosage form can be effective generate specific concentration, such as an effective concentration, at a given site in the subject in need thereof. As used herein, “dose,” “unit dose,” or “dosage” can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the primary active agent, and optionally present secondary active ingredient, and / or apharmaceutical formulation thereof calculated to produce the desired response or responses in association with its administration. In one or more embodiments, the given site is proximal to the administration site. In one or more embodiments, the given site is distal to the administration site. In some cases, the dosage form contains a greater amount of one or more of the active ingredients present in the pharmaceutical formulation than the final intended amount needed to reach a specific region or location within the subject to account for loss of the active components such as via first and second pass metabolism.

[0141] The dosage forms can be adapted for administration by any appropriate route. Appropriate routes include, but are not limited to, oral (including buccal or sublingual), rectal, intraocular, inhaled, intranasal, topical (including buccal, sublingual, or transdermal), vaginal, parenteral, subcutaneous, intramuscular, intravenous, internasal, and intradermal. Other appropriate routes are described elsewhere herein. Such formulations can be prepared by any method known in the art.

[0142] Dosage forms adapted for oral administration can discrete dosage units such as capsules, pellets or tablets, powders or granules, solutions, or suspensions in aqueous or non- aqueous liquids; edible foams or whips, or in oil-in-water liquid emulsions or water-in-oil liquid emulsions. In one or more embodiments, the pharmaceutical formulations adapted for oral administration also include one or more agents which flavor, preserve, color, or help disperse the pharmaceutical formulation. Dosage forms prepared for oral administration can also be in the form of a liquid solution that can be delivered as a foam, spray, or liquid solution. The oral dosage form can be administered to a subject in need thereof. Where appropriate, the dosage forms described herein can be microencapsulated.

[0143] The dosage form can also be prepared to prolong or sustain the release of any ingredient. In one or more embodiments, compounds, molecules, compositions, vectors, vector systems, cells, or a combination thereof described herein can be the ingredient whose release is delayed. In one or more embodiments the primary active agent is the ingredient whose release is delayed. In one or more embodiments, an optional secondary agent can be the ingredient whose release is delayed. Suitable methods for delaying the release of an ingredient include, but are not limited to, coating or embedding the ingredients in material in polymers, wax, gels, and the like. Delayed release dosage formulations can be prepared as described in standard references such as“Pharmaceutical dosage form tablets,” eds. Liberman et. al. (New York, Marcel Dekker, Inc., 1989), “Remington - The science and practice of pharmacy”, 20th ed., Lippincott Williams & Wilkins, Baltimore, MD, 2000, and “Pharmaceutical dosage forms and drug delivery systems”, 6th Edition, Ansel et al., (Media, PA: Williams and Wilkins, 1995). These references provide information on excipients, materials, equipment, and processes for preparing tablets and capsules and delayed release dosage forms of tablets and pellets, capsules, and granules. The delayed release can be anywhere from about an hour to about 3 months or more.

[0144] Examples of suitable coating materials include, but are not limited to, cellulose polymers such as cellulose acetate phthalate, hydroxypropyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate; polyvinyl acetate phthalate, acrylic acid polymers and copolymers, and methacrylic resins that are commercially available under the trade name EUDRAGIT® (Roth Pharma, Westerstadt, Germany), zein, shellac, and polysaccharides.

[0145] Coatings may be formed with a different ratio of water-soluble polymer, water insoluble polymers, and / or pH dependent polymers, with or without water insoluble / water soluble non-polymeric excipient, to produce the desired release profile. The coating is either performed on the dosage form (matrix or simple) which includes, but is not limited to, tablets (compressed with or without coated beads), capsules (with or without coated beads), beads, particle compositions, “ingredient as is” formulated as, but not limited to, suspension form or as a sprinkle dosage form.

[0146] Where appropriate, the dosage forms described herein can be a liposome. In these embodiments, primary active ingredient(s), and / or optional secondary active ingredient(s), and / or pharmaceutically acceptable salt thereof where appropriate are incorporated into a liposome. In embodiments where the dosage form is a liposome, the pharmaceutical formulation is thus a liposomal formulation. The liposomal formulation can be administered to a subject in need thereof.

[0147] Dosage forms adapted for topical administration can be formulated as ointments, creams, suspensions, lotions, powders, solutions, pastes, gels, sprays, aerosols, or oils. In one or more embodiments for treatments of the eye or other external tissues, for example the mouth or the skin, the pharmaceutical formulations are applied as a topical ointment or cream. When formulated in an ointment, a primary active ingredient, optional secondary active ingredient,and / or pharmaceutically acceptable salt thereof where appropriate can be formulated with a paraffinic or water-miscible ointment base. In other embodiments, the primary and / or secondary active ingredient can be formulated in a cream with an oil-in-water cream base or a water-in-oil base. Dosage forms adapted for topical administration in the mouth include lozenges, pastilles, and mouth washes.

[0148] Dosage forms adapted for nasal or inhalation administration include aerosols, solutions, suspension drops, gels, or dry powders. In one or more embodiments, a primary active ingredient, optional secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate can be in a dosage form adapted for inhalation is in a particle-size-reduced form that is obtained or obtainable by micronization. In one or more embodiments, the particle size of the size reduced (e.g. micronized) compound or salt or solvate thereof, is defined by a D50 value of about 0.5 to about 10 microns as measured by an appropriate method known in the art. Dosage forms adapted for administration by inhalation also include particle dusts or mists. Suitable dosage forms wherein the carrier or excipient is a liquid for administration as a nasal spray or drops include aqueous or oil solutions / suspensions of an active (primary and / or secondary) ingredient, which may be generated by various types of metered dose pressurized aerosols, nebulizers, or insufflators. The nasal / inhalation formulations can be administered to a subject in need thereof.

[0149] In one or more embodiments, the dosage forms are aerosol formulations suitable for administration by inhalation. In some of these embodiments, the aerosol formulation contains a solution or fine suspension of a primary active ingredient, secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate and a pharmaceutically acceptable aqueous or non-aqueous solvent. Aerosol formulations can be presented in single or multi-dose quantities in sterile form in a sealed container. For some of these embodiments, the sealed container is a single dose or multi-dose nasal or an aerosol dispenser fitted with a metering valve (e.g. metered dose inhaler), which is intended for disposal once the contents of the container have been exhausted.

[0150] Where the aerosol dosage form is contained in an aerosol dispenser, the dispenser contains a suitable propellant under pressure, such as compressed air, carbon dioxide, or an organic propellant, including but not limited to a hydrofluorocarbon. The aerosol formulation dosage forms in other embodiments are contained in a pump-atomizer. The pressurized aerosol formulation canalso contain a solution or a suspension of a primary active ingredient, optional secondary active ingredient, and / or pharmaceutically acceptable salt thereof. In further embodiments, the aerosol formulation also contains co-solvents and / or modifiers incorporated to improve, for example, the stability and / or taste and / or fine particle mass characteristics (amount and / or profile) of the formulation. Administration of the aerosol formulation can be once daily or several times daily, for example 2, 3, 4, or 8 times daily, in which 1, 2, 3 or more doses are delivered each time. The aerosol formulations can be administered to a subject in need thereof.

[0151] For some dosage forms suitable and / or adapted for inhaled administration, the pharmaceutical formulation is a dry powder inhalable-formulations. In addition to a primary active agent, optional secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate, such a dosage form can contain a powder base such as lactose, glucose, trehalose, manitol, and / or starch. In some of these embodiments, a primary active agent, secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate is in a particle-size reduced form. In further embodiments, a performance modifier, such as L-leucine or another amino acid, cellobiose octaacetate, and / or metals salts of stearic acid, such as magnesium or calcium stearate. In one or more embodiments, the aerosol formulations are arranged so that each metered dose of aerosol contains a predetermined amount of an active ingredient, such as the one or more of the compositions, compounds, vector(s), molecules, cells, and combinations thereof described herein.

[0152] Dosage forms adapted for vaginal administration can be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulations. Dosage forms adapted for rectal administration include suppositories or enemas. The vaginal formulations can be administered to a subject in need thereof.

[0153] Dosage forms adapted for parenteral administration and / or adapted for injection can include aqueous and / or non-aqueous sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, solutes that render the composition isotonic with the blood of the subject, and aqueous and non-aqueous sterile suspensions, which can include suspending agents and thickening agents. The dosage forms adapted for parenteral administration can be presented in a single-unit dose or multi-unit dose containers, including but not limited to sealed ampoules or vials. The doses can be lyophilized and re-suspended in a sterile carrier to reconstitute the doseprior to administration. Extemporaneous injection solutions and suspensions can be prepared In one or more embodiments, from sterile powders, granules, and tablets. The parenteral formulations can be administered to a subject in need thereof.

[0154] For some embodiments, the dosage form contains a predetermined amount of a primary active agent, secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate per unit dose. In an embodiment, the predetermined amount of primary active agent, secondary active ingredient, and / or pharmaceutically acceptable salt thereof where appropriate can be an effective amount, a least effect amount, and / or a therapeutically effective amount. In other embodiments, the predetermined amount of a primary active agent, secondary active agent, and / or pharmaceutically acceptable salt thereof where appropriate, can be an appropriate fraction of the effective amount of the active ingredient. Co-Therapies and Combination Therapies

[0155] In one or more embodiments, the pharmaceutical formulation(s) described herein can be part of a combination treatment or combination therapy. The combination treatment can include the pharmaceutical formulation described herein and an additional treatment modality. The additional treatment modality can be a chemotherapeutic, a biological therapeutic, surgery, radiation, diet modulation, environmental modulation, a physical activity modulation, and combinations thereof.

[0156] In one or more embodiments, the co-therapy or combination therapy can additionally include but not limited to, polynucleotides, amino acids, peptides, polypeptides, antibodies, aptamers, ribozymes, hormones, immunomodulators, antipyretics, anxiolytics, antipsychotics, analgesics, antispasmodics, anti-inflammatories, anti-histamines, anti-infectives, chemotherapeutics, and combinations thereof. Administration of the Pharmaceutical Formulations

[0157] The pharmaceutical formulations or dosage forms thereof described herein can be administered one or more times hourly, daily, monthly, or yearly (e.g.1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more times hourly, daily, monthly, or yearly). In one or more embodiments, the pharmaceutical formulations or dosage forms thereof described herein can be administered continuously over a period of time ranging from minutes to hours to days. Devices and dosages forms are known in the art and described herein that are effective to providecontinuous administration of the pharmaceutical formulations described herein. In one or more embodiments, the first one or a few initial amount(s) administered can be a higher dose than subsequent doses. This is typically referred to in the art as a loading dose or doses and a maintenance dose, respectively. In one or more embodiments, the pharmaceutical formulations can be administered such that the doses over time are tapered (increased or decreased) overtime so as to wean a subject gradually off of a pharmaceutical formulation or gradually introduce a subject to the pharmaceutical formulation.

[0158] As previously discussed, the pharmaceutical formulation can contain a predetermined amount of a primary active agent, secondary active agent, and / or pharmaceutically acceptable salt thereof where appropriate. In some of these embodiments, the predetermined amount can be an appropriate fraction of the effective amount of the active ingredient. Such unit doses may therefore be administered once or more than once a day, month, or year (e.g.1, 2, 3, 4, 5, 6, or more times per day, month, or year). Such pharmaceutical formulations may be prepared by any of the methods well known in the art.

[0159] Where co-therapies or multiple pharmaceutical formulations are to be delivered to a subject, the different therapies or formulations can be administered sequentially or simultaneously. Sequential administration is administration where an appreciable amount of time occurs between administrations, such as more than about 15, 20, 30, 45, 60 minutes or more. The time between administrations in sequential administration can be on the order of hours, days, months, or even years, depending on the active agent present in each administration. Simultaneous administration refers to administration of two or more formulations at the same time or substantially at the same time (e.g. within seconds or just a few minutes apart), where the intent is that the formulations be administered together at the same time. Viral Vector Formulation, Dosage, and Delivery

[0160] Compositions may be formulated for delivery to human subjects, as well as to animals for veterinary purposes (e.g. livestock (cattle, pigs, others)), and other non-human mammalian subjects. The dosage of the formulation can be measured or calculated as viral particles or as genome copies (“GC”) / viral genomes (“vg”). Any method known in the art can be used to determine the genome copy (GC) number of the viral compositions. In one example embodiment, the viral compositions can be formulated in dosage units to contain an amount of viral vectors thatis in the range of about 1.0 x 109 GC to about 1.0 x 1015 GC (to treat an average subject of 70 kg in body weight), and preferably 1.0 x 1012 GC to 1.0 x 1014 GC for a human patient. Preferably, the dose of virus in the formulation is 1.0 x 109 GC, 5.0 X 109 GC, 1.0 X 1010 GC, 5.0 X 1010 GC, 1.0 X 1011GC, 5.0 X 1011 GC, 1.0 X 1012 GC, 5.0 X 1012 GC, or 1.0 x 1013 GC, 5.0 X 1013 GC, 1.0 X 1014 GC, 5.0 X 1014 GC, or l .0 x l015 GC.

[0161] The viral vectors can be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients. The viral vectors may be formulated for parenteral administration by injection (e.g. by bolus injection or continuous infusion). Formulations for injection may be presented in unit dosage form (e.g. in ampoules or in multi-dose containers) with an added preservative. The viral compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, or dispersing agents. Liquid preparations of the viral vector formulations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g. sorbitol syrup, cellulose derivatives or hydrogenated edible fats), emulsifying agents (e.g. lecithin or acacia), non-aqueous vehicles (e.g. almond oil, oily esters, ethyl alcohol or fractionated vegetable oils), and preservatives (e.g. methyl or propyl-p- hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts. Alternatively, the compositions may be in powder form for constitution with a suitable vehicle (e.g. sterile pyrogen-free water) before use. Recombinant Protein Formulation, Dosage, and Delivery

[0162] In one example embodiment, virus like particles (VLPs) are used to facilitate intracellular recombinant protein therapy (see, e.g., WO2020252455A1, US10577397B2). In certain embodiments, VLPs include a Gag-COBLL1 fusion protein. The Gag-COBLL1 fusion protein may include a matrix protein, a capsid protein, and / or a nucleocapsid protein covalently linked to COBLL1. In certain embodiments, the VLPs include a membrane comprising a phospholipid bilayer with one or more human endogenous retrovirus (HERV) derived ENV / glycoprotein(s) on the external side; a HERV-derived GAG protein in the VLP core, and a COBLL1 fusion protein on the inside of the membrane, wherein COBLL1 is fused to a human- endogenous GAG or other plasma membrane recruitment domain (see, e.g., WO2020252455A1). Fusion proteins can be obtained using standard recombinant protein technology.

[0163] In one example embodiment, cell-penetrating peptides (CPPs) are used to facilitate intracellular recombinant protein therapy (see, e.g., Dinca A, Chien W-M, Chin MT. Intracellular Delivery of Proteins with Cell-Penetrating Peptides for Therapeutic Uses in Human Disease. International Journal of Molecular Sciences. 2016; 17(2):263). In certain embodiments, cell- penetrating peptides can be conjugated to COBLL1, for example, using standard recombinant protein technology. In certain embodiments, cell-penetrating peptides can be concurrently delivered with recombinant COBLL1.

[0164] In one example embodiment, nanocarriers are used to facilitate intracellular recombinant protein therapy (see, e.g., Lee YW, Luther DC, Kretzmann JA, Burden A, Jeon T, Zhai S, Rotello VM. Protein Delivery into the Cell Cytosol using Non-Viral Nanocarriers. Theranostics 2019; 9(11):3280-3292). Non-limiting nanocarriers include, but are not limited to nanoparticles (e.g., silica, gold), polymers, lipid based (e.g., cationic lipid within a polymer shell, lipid-like nanoparticles).

[0165] A pharmaceutical composition may be administered locally or systemically. In a preferred embodiment, the pharmaceutical composition is administered near the tissue whose cells are to be transduced. In a particular embodiment, a pharmaceutical composition may be administered locally to the subcutaneous adipose tissue, which is composed of varying amounts of the two different types of adipose tissue: white adipose tissue (WAT) that stores energy in the form of triacylglycerol (TAG) and brown adipose tissue (BAT) that dissipates energy as heat, “burning” fatty acids to maintain body temperature. In one example embodiment, a pharmaceutical composition is administered in the white adipose tissue (WAT) and / or in the brown adipose tissue (BAT) by intra-WAT or intra-BAT injection. In another preferred embodiment, a pharmaceutical composition is administered systemically.

[0166] The “adeno-associated virus” (AAV) can be formulated with a physiologically acceptable carrier for use in gene transfer and gene therapy applications. The dosage of the formulation can be measured or calculated as viral particles or as genome copies (“GC”) / viral genomes (“vg”). Any method known in the art can be used to determine the genome copy (GC) number of the viral compositions of the disclosure. One method for performing AAV GC number titration is as follows: purified AAV vector samples are first treated with DNase to eliminate un- encapsulated AAV genome DNA or contaminating plasmid DNA from the production process.The DNase resistant particles are then subjected to heat treatment to release the genome from the capsid. The released genomes are then quantitated by real-time PCR using primer / probe sets targeting specific region of the viral genome.

[0167] In any of the described methods the one or more vectors may be comprised in a delivery system. In any of the described methods the vectors may be delivered via liposomes, particles (e.g., nanoparticles), exosomes, microvesicles, a gene-gun. In any of the described methods viral vectors may be delivered by transduction of viral particles. The delivery systems may be administered systemically or by localized administration (e.g., direct injection). The term “systemically administered” and “systemic administration”, as used herein, means that the polynucleotides, vectors, polypeptides, or pharmaceutical compositions of the disclosure are administered to a subject in a non-localized manner. The systemic administration of the polynucleotides, vectors, polypeptides, or pharmaceutical compositions of the disclosure may reach several organs or tissues throughout the body of the subject or may reach specific organs or tissues of the subject. For example, the intravenous administration of a pharmaceutical composition of the disclosure may result in the transduction of more than one tissue or organ in a subject. The term “transduce” or “transduction”, as used herein, refers to the process whereby a foreign nucleotide sequence is introduced into a cell via a viral vector. The term “transfection”, as used herein, refers to the introduction of DNA into a recipient eukaryotic cell.

[0168] Recombinant protein compositions described herein may be administered systemically (e.g., intravenously) or administered locally to adipose tissue (e.g., injection). In preferred embodiments, the recombinant protein compositions are administered with an appropriate carrier to be administered to a mammal, especially a human, preferably a pharmaceutically acceptable composition. A “pharmaceutically acceptable composition” refers to a non-toxic semisolid, liquid, or aerosolized filler, diluent, encapsulating material, colloidal suspension or formulation auxiliary of any type. Preferably, this composition is suitable for injection. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and similar solutions or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions.Cell lines

[0169] In another aspect, the present disclosure relates to an engineered cell, such as a stable cell line. A cell line of the present disclosure typically includes a nucleic acid encoding GEN1, such as WT GEN1 or GEN1Lys839Fs. A cell line may include a nucleic acid configured to express a GEN1 protein, such as WT GEN1 or GEN1Lys839Fs. These cell lines may be useful as research tools, for example, they may be used to test sensitivity to a therapeutic agent. In one or more embodiments, a cell line may be used to test sensitivity of a tumor to a DNA repair inhibitor.

[0170] A cell line of the present disclosure may be prepared using any suitable cell. Typically, suitable cells are immortalized cells, such as immortalized cell lines. Immortalized cell lines useful include cancer cell lines, such as ovarian cancer cell lines, breast cancer cell lines, and melanoma cell lines. In one or more embodiments, a cell line is prepared using HCC1806 cells. However, other cell lines are contemplated.

[0171] Methods of preparing a stable cell line are known to the art, and any suitable method may be used. In one or more preferred embodiments, a cell line is prepared using a lentivirus.

[0172] Further embodiments are illustrated in the following Examples which are given for illustrative purposes only and are not intended to limit the scope of the disclosure. EXAMPLES Example 1: Bioinformatic investigation of GEN1 truncating mutation

[0173] To investigate GEN1Lys839FsSNP frequency across different donor groups, the percentage of subjects diagnosed with cancer who were heterozygous for WT GEN1, homozygous for GEN1Lys839Fs, and homozygous for GEN1Lys839Fswas analyzed (see FIG. 2). In addition, the frequency of loss of heterozygosity of wild-type GEN1 was determined in different tumors and cancer types (see FIG.7). A cancer dependency map comprising of thousands of models and cell lines that were a part of the Cancer Cell Line Encyclopedia (CCLE) project was analyzed to identify ancestry associated dependencies (FIG.12)

[0174] Genetic variants in DepMap cell lines were genotyped with HaplotypeCaller, and the association of each (exonic) germline variant was computed using a GLM while adjusting for cancer lineage, population structure, sex, and cell culture conditions as covariates. Results are shown in FIG.1. The association between rs149936944 and all genetic dependencies profiled inDepMap was computed using linear regression while adjusting for covariates including cancer lineage, population structure, sex, and cell culture conditions (see FIG.4).

[0175] MUS81 chronos score mapping revealed that homozygous cells for the GEN1Lys839Fsare dependent on MUS81 for survival (see FIG.3). And EME1 chronos score mapping revealed that homozygous cells for the GEN1Lys839FsSNP are dependent on EME1 for survival (see FIG. 5). A GWAS identifying associations between SNPs and genetic dependencies is shown in FIG. 11. Gene Chronos scores for both benign and malignant cells by peak SNP are displayed. SNPs in the GEN1 locus are therefore associated with MUS81 and / or EME1 for dependence, and cells that are homozygous for the GEN1Lys839FsSNP or have a loss of heterozygosity depend on MUS81 and / or EME1 for survival.

[0176] Finally, to investigate the predicted functional consequences of premature truncation of GEN1 resulting from the rs149936944 mutation, ordered and disordered regions of the truncated GEN1 amino acid structure were predicted by IUPred2 (see FIG.6). The C-terminus of GEN1 has was found to include an intrinsically disordered region (IDR). IDRs are known to regulate protein- protein interactions, protein-DNA interactions, stability, and localization among other functions. Example 2: Identification of mutations correlated with GEN1 SNPs.

[0177] FIG.9 shows the correlation between the rs149936944 SNP of GEN1 and other SNPs on chromosome 2. The gnomADv31KG+HGDP subset was filtered to include variants - / + 0.1 megabases (Mb) from rs149936944 with a minor allele frequency > 0.001. The gnmoADv3 1KG+HGDP dataset was chosen because it included individualized data that could be used to correlate genomic variants to clinical information. SNPs in linkage disequilibrium with rs149936944 (R2> 0.2) were identified by computing the co-occurrence of each SNP with rs149936944. The y-axis is the degree of co-occurrence (R2) and the x-axis is the SNP position on chromosome 2.

[0178] The tiniest GWAS identified many associations between SNPs and their respective genetic dependencies. Tumor samples have approximately 1000 benign (e.g., germline) variants that map to CRISPR guides in the AVANA library (see FIG.3). As is described herein, SNPs in the GEN1 locus are associated with MUS81 and / or EME1 for dependence. Cells that are heterozygous or lack a functional copy of GEN1 depend on MUS81 and / or EME1 for survival. However, MUS81 and / or EME1 dependence may be predicted by identifying variations otherSNPs in the GEN1 locus directly. The gnomADv31KG+HGDP subset was filtered to include variants - / + 0.1Mb from rs149936944 with a minor allele frequency > 0.001. SNPs in linkage disequilibrium with rs149936944 (R2> 0.2) were identified by computing the co-occurrence of each SNP with rs149936944. The y-axis is the degree of co-occurrence (R2) and the x-axis is the SNP position on chromosome 2. Results are shown in FIG.17. Example 3: Generation of GEN1 and GEN1-Lys829Fs overexpression model and investigation of EME1 and MUS81 knockdown.

[0179] HCC1806 cells were engineered to express Cas9 and were subsequently engineered to express Luciferase (as a negative control), wildtype GEN1, or GEN1Lys839Fs. HCC1806 cells include a single allele of GEN1Lys839Fsand are therefore somewhat dependent on alternative DNA repair pathways. To generate each cell line, cells were transduced with a lentivirus encoding the CDS of interest. The vector used to generate the GEN1 overexpression cell line is shown in SEQ ID NO: 13. The vector used to generate the GEN1Lys839Foverexpression cell line is shown in SEQ ID NO: 14. Cells were cultured in the presence of puromycin to encourage retention of the integrated overexpression cassette.

[0180] Expression of GEN1 or GEN1Lys839Fswas determined by immunoblotting for a C- terminal V5 tag or using an antibody that recognizes the native GEN1 protein structure (see FIG. 10). The detected molecular weight of each protein confirmed the identity of the variant in each cell line. Overexpression of GEN1 or GEN1Lys839Fsresulted in protein levels several orders of magnitude above endogenous levels.

[0181] To determine the effect of EME1 or MUS81 knockdown, cells were transduced with a vector encoding Cas9 in combination with a vector encoding a fluorescent marker and a guide RNA. As a positive control, a first set of cells were transduced with Cas9 and a guide construct including a spacer targeting a protospacer in POLR2B and engineered GFP (eGFP) cDNA. The POLR2B guide was configured to introduce an edit that would be lethal to the cells. As a negative control, a first set of cells were transduced with Cas9 and a guide construct including a spacer targeting a protospacer in mCherry and EGFP cDNA. The mCherry guide was configured to not introduce an edit in the cells. The experimental sets of cells were transduced with Cas9 and a second guide construct encoding an mCherry cDNA and a guide targeting either EME1 or MUS81.The protospacer sequences targeted are shown in Table 1 below. Each set of cells was transduced with a construct encoding exactly one guide RNA and was cultured individually for three days. Table 1. Group 1, 2, and 3 guide RNA protospacer sequences. Gene target Sequence Group SEQ ID NO POLR2B GAGTGGAGTATATTGATACCC 1 1e s were e ac e ree ays pos - rans uc on an were m xe a a : ra o. ells from each respective group were mixed, e.g., cells in group 1 transduced with the first POLR2B- targeting guide (targeting SEQ ID NO: 1) were mixed with cells in group 1 transduced with the first MUS81 targeting guide (targeting SEQ ID NO: 7). Cells were cocultured. To determine which population of cells exhibited superior fitness, the relative mCherry:EGFP ratio was monitored at initial mixing and every third day thereafter with flow cytometry. This fitness assay was conducted independently on cells overexpressing luciferase (FIG. 8A), GEN1WT (FIG. 8B), and GEN1Lys839Fs(FIG.8C). Cells transduced with a guide targeting POLR2B were present in a lower fraction than control cells, indicating decreased fitness (FIG. 8A-C). Control cells expressing luciferase exhibited decreased fitness when treated with guides targeting MUS81 or EME1, indicating reliance on the MUS81 / EME1 complex for survival (FIG.8A). It was observed that the cells overexpressing GEN1WT did not exhibit decreased fitness when treated with guides targeting MUS81 or EME1 (FIG.8B). This indicates that GEN1WT overexpression is sufficient to rescue the viability defects of MUS81 or EME1 knockdown. Interestingly, cells overexpressing GEN1Lys839Fsdid not exhibit sensitivity to MUS81 or EME1 knockdown (FIG. 8C). The lack of sensitivity is thought to be due to the high level of GEN1Lys839Fsprotein present. These data indicatethat endogenous expression of GEN1Lys839Fsis a marker for response to perturbations that reduce activity of MUS81 and / or EME1. ***

[0183] Various modifications and variations of the described methods, pharmaceutical compositions, and kits of the disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the invention has been described in connection with specific embodiments, it will be understood that it is capable of further modifications and that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the invention. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.

Claims

CLAIMS What is claimed is:

1. A method of treating cancer in a subject in need thereof, the method comprising: detecting a single nucleotide polymorphism (SNP) p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 in a sample from the subject; wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are detected, then administering a therapeutic agent that reduces activity and / or expression of MUS81, EME1, or both; wherein the therapeutic agent is administered at a cellular inhibitory concentration at 50% (IC50) of 100 nM or less; and wherein if p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are not detected, then administering a standard of care treatment.

2. The method of claim 1, wherein the subject has cancer or is at risk of having cancer.

3. The method of claim 2, wherein the cancer is ovarian cancer, breast cancer, or melanoma.

4. The method of claim 1, wherein p.Lys839fs of GEN1 and / or one or more variants inlinkage disequilibrium with p.Lys839fs of GEN1 reduce GEN1 expression and / or activity.

5. The method of claim 1, wherein the one or more variants in linkage disequilibrium withp.Lys839fs of GEN1 comprise a mutation in a coding region of GEN1, a mutation in a non- coding region of GEN1, or both.

6. The method of claim 1, wherein the one or more variants in linkage disequilibrium withp.Lys839fs of GEN1 comprise a mutation in an auto-regulatory domain of GEN1.

7. The method of claim 1, wherein the one or more variants in linkage disequilibrium withp.Lys839fs of GEN1 lead to a truncated C-terminus of a protein encoded by GEN1.

8. The method of claim 1, wherein the one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 comprise an SNP.

9. The method of any one of the preceding claims, wherein p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are detected in a benign cell.

10. The method of claim 9, wherein the benign cell is heterozygous for p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1.

11. The method of any one of claims 1 to 8, wherein p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 are detected in a cancer cell.

12. The method of claim 11, wherein the cancer cell is heterozygous for p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1, or has a loss of heterozygosity at one or more GEN1 mutation loci.

13. The method of any one of the preceding claims, wherein detecting p.Lys839fs of GEN1 and / or one or more variants in linkage disequilibrium with p.Lys839fs of GEN1 comprises a polymerase chain reaction (PCR), Sanger sequencing, next-generation sequence (NGS), whole exome sequencing (WES), whole genome sequencing (WGS), a microarray analysis, fluorescence in-situ hybridization (FISH), multiplex ligation-dependent probe amplification (MLPA), or a combination thereof.

14. The method of any one of the preceding claims, wherein the sample is taken from blood, saliva, a buccal swab, amniotic fluid, a tissue biopsy, urine, skin, or bone marrow.

15. The method of any one of the preceding claims, wherein the therapeutic agent that inhibits of MUS81, EME1, or both comprises: a. one or more small molecules that bind MUS81, EME1, or both;b. one or more antibodies, antibody fragments, or antibody-like protein scaffolds that bind MUS81, EME1, or both; c. one or more PROTACs comprising a small molecule binder of MUS81, EME1, or both; d. a bi-functional molecule comprising a post-translation modification enzyme linked to a small molecule binder of one or more gene products of MUS81, EME1, or both, wherein the post-translation modification enzyme makes one or more post-translation modifications to the one or more gene products that inhibit or reduce activity; e. one or more recombinant gene therapy vectors for reducing expression of MUS81, EME1, or both; f. one or more RNAi agents for decreasing expression of MUS81, EME1, or both; or g. one or more antisense RNA agents for decreasing expression of MUS81, EME1, or both.

16. The method of claim 15, wherein the therapeutic agent that inhibits of MUS81, EME1, or both comprises one or more small molecules that bind MUS81, EME1, or both.

17. An engineered cell comprising a nucleic acid configured to encode the protein of SEQ ID NO: 15.

Citation Information

Patent Citations

  • Inhibitor of ATR kinase for use in a method of treating a hyper-proliferative disease

    US20210404012A1