Octadecanoid compositions and methods of activating mucosal repair pathways
Octadecanoid compositions, derived from C-18 fatty acid metabolism intermediates, address the limitations of current treatments for virally induced mucosal dysfunction by activating mucosal repair pathways and enhancing gut health through PPARa signaling and histone crotonylation.
Patent Information
- Application Number
- PCT/US2024/059645
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-12
- Filing Date
- 2024-12-11
- Publication Date
- 2025-06-19
AI Technical Summary
Current treatments for virally induced mucosal dysfunction, such as those caused by HIV, are inadequate as they fail to directly target the site of inflammation and effectively restore gut health and mucosal immunity.
The use of octadecanoid compositions, specifically intermediates of C-18 fatty acid metabolism of gastrointestinal microbes, such as 10-hydroxystearic acid, to activate mucosal repair pathways and promote gut health by targeting metabolic repair mechanisms.
The octadecanoid compositions effectively activate PPARa signaling, induce histone crotonylation, and promote mitochondrial function, leading to improved gut epithelial integrity, reduced inflammation, and restored symbiotic bacterial populations.
Smart Images

Figure US2024059645_19062025_PF_FP_ABST
Abstract
Description
OCTADECANOID COMPOSITIONS AND METHODS OF ACTIVATING MUCOSALREPAIR PATHWAYSCROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. Provisional Patent Application Ser. No. 63 / 608,870, filed Dec. 12, 2023, the entire disclosure of which is hereby incorporated herein by reference.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] This invention was made with government support under Grant number AH23105 and AH53025 awarded by the National Institutes of Health. The Government has certain rights in the invention.SEQUENCE LISTING
[0003] This application contains a computer readable Sequence Listing which has been submitted in XML file format with this application, the entire content of which is incorporated by reference herein in its entirety. The Sequence Listing XML file submitted with this application is entitled “.xml”, was created on December 10, 2024, and is 6,404 bytes in size.BACKGROUND
[0004] Viruses like the human immunodeficiency virus (HIV-1) cause damage to gut epithelial barriers, impair mucosal immunity and promote chronic inflammation and immune dysfunction in part by hijacking mitochondrial energy pathways. Finding innovative approaches to combat virally induced mucosal dysfunction is crucial for achieving functional mucosal immunity and this cannot be achieved through antiviral therapy (e.g., antiretroviral therapy (ART)) alone. Gut epithelial barrier damage in HIV infection, indicated by tight junction disruption, persists even after successful inhibition of viral replication by ART demonstrating the need for supplemental treatments to, for example, restore the functionality of the mitochondria in inflammatory conditions. Cytokine and growth factor treatments have shown lackluster results, even potentially prolonging active HIV infection. Orally administered live probiotics have yielded mixed results. Overall, most treatments so far fail totraffic directly to the site of inflammation in vivo. Repair of virally damaged gut has been an under-investigated area of research. There is a need for effective mucosal repair strategies, reagents, and therapeutic interventions.
[0005] The importance of targeting gut repair pathways goes beyond one infection or condition. Overall gut health is influenced by the synergistic interactions between the intestinal cells and commensal microbial metabolic products. Dysbiosis can be precipitated by factors such as infectious diseases, recurrent antibiotic treatments, and inflammatory conditions. It manifests when beneficial or symbiotic bacterial species become underrepresented, thereby permitting the overrepresentation of opportunistic and potentially harmful species. Thus, there is a widespread need for new treatments that are capable of direct action at the site of inflammation, and that activate rapid gut repair and restore symbiotic bacterial populations.SUMMARY
[0006] The present disclosure provides compositions and methods for activating mucosal repair pathways. Compositions and methods of the present disclosure are predicated on the identification of intermediates of C-18 fatty acid metabolism of gastrointestinal microbes as a regulators of gut physiology, mucosal immunity, epithelial permeability, metabolism, and microbiota interactions.
[0007] In one aspect, embodiments of the present disclosure describe a method comprising incorporating 10-hydroxystearic acid, a derivative thereof, or a salt thereof into a supplement for a human diet at a level sufficient to treat a symptom of metabolic syndrome, wherein the supplement is selected from the group consisting of a food additive, food fortifier, beverage additive, beverage fortifier, or pharmaceutical.
[0008] In certain embodiments, the 10-hydroxystearic acid, the derivative thereof, or the salt thereof can be incorporated into a pharmaceutical formulated as a tablet, an encapsulated pill, a gelcap pill, a liquid suspension, a spray, or a powder.
[0009] In another aspect, embodiments of the present disclosure describe an octadecanoid composition including a therapeutically effective amount of an intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, in a pharmaceutically acceptable vehicle. In certain embodiments, the intermediate of C-18 fatty acid metabolism includes a C- 18 hydroxy fatty acid, C-18 oxo fatty acid, C-18 conjugated fatty acid, C-18 partially saturated trans-fatty acid, a non-natural C-18 fatty acid derivative lacking a free carboxylate head group, or an enantiomer or a salt thereof. In certain embodiments, the intermediate of C- 18 fatty acid metabolism includes 10-hydroxystearic acid (10-HSA), 12-hydroxystearic acid, 9-oxo-octadecadienoic acid, 13-oxo-octadecadienoic acid, 10-hydroxy-cis-12-octadecenoic acid, 10- hydroxy-cis-12, cis- 15 -octadecadienoic acid, 10-hydroxy-cis-6, cis-12-octadecadienoic acid, 10-hydroxy-cis-6, cis- 12, cis-15-octadecatrienoic acid, 10,12-dihydroxyoctadecanoic acid, 10- hydroxy-cis-15-octadecenoic acid, 10-hydroxy-cis-6-octadecenoic acid, 10-hydroxy-cis-6, cis- 15 -octadecadienoic acid, 10-hydroxy -trans- 11 -octadecenoic acid, 10-hydroxy-trans- 11 , cis- 15 -octadecadienoic acid, 10-hydroxy-cis-6, trans- 11 -octadecadienoic acid, and 10- hydroxy-cis-6, trans-11, cis-15-octadecatrienoic acid, 10-oxo-cis-12-octadecenoic acid, 10- oxo-cis-12, cis- 15 -octadecadienoic acid, 10-oxo-cis-6, cis-12-octadecadienoic acid, 10-oxo- cis-6, cis-12, cis-15-octadecatrienoic acid, 10-oxooctadecanoic acid, 10-oxo-cis-6- octadecenoic acid, 10-oxo-cis- 15 -octadecenoic acid, 10-oxo-cis-6, cis-15-octadecadienoic acid, 12-oxooctadecanoic acid, 10-oxo-trans- 11 -octadecenoic acid, 10-oxo-cis-6, trans-11- octadecadienoic acid, 10-oxo-trans- 11, cis- 15 -octadecadienoic acid, 10-oxo-cis-6, trans-11, cis- 15 -octadecatri enoic acid, 12-oxo-cis-9-octadecenoic acid, or an enantiomer or a salt thereof, or a combination thereof. In certain embodiments, the intermediate of C-18 fatty acid metabolism includes 10-hydroxystearic acid, or an enantiomer or a salt thereof. In certain embodiments, the composition includes about 5 to about 95% of the intermediate of C-18 fatty acid metabolism (weightweight). In certain embodiments, the amount of the intermediate of C-18 fatty acid metabolism is within a range of about 10 to 2000 mg, about 30 to 1000 mg, about 50 to 800 mg, about 100 to 600 mg, about 400 mg to about 1800 mg, or about 500 mg to about 1500 mg, or within a range of at least 10 pM to 2 mM. In certain embodiments, the vehicle is an oral, nasal, enteral, parenteral, transdermal, transmucosal, rectal, ophthalmic, or vaginal delivery vehicle. In certain embodiments, the vehicle includes a liquid, solid, or semisolid carrier. In certain embodiments, the carrier includes water, saline, alcohol, oil, wax, polymer, sugar, starch, or a combination thereof. In certain embodiments, the carrier includes a polymer selected from the group consisting of poly(alpha-hydroxy acids), poly(lactide-co- glycolide) (PLGA), polylactide (PLA), polyglycolide (PG), polyethylene glycol (PEG) conjugates of poly(alpha-hydroxy acids), polyorthoesters, polyaspirins, polyphosphagenes, collagen, starch, chitosans, gelatin, alginates, dextrans, vinylpyrrolidone, polyvinyl alcohol (PVA), PVA-g-PLGA, PEGT-PBT copolymer (polyactive), methacrylates, poly(N- isopropylacrylamide), PEO-PPO-PEO (pluronics), PEO-PPO-PAA copolymers, PLGA-PEO- PLGA, polyphosphoesters, polyanhydrides, polyester-anhydrides, polyamino acids, polyurethane-esters, polyphosphazines, polycaprolactones, polytrimethylene carbonates, polydioxanones, polyamide-esters, polyketals, polyacetals, glycosaminoglycans, hyaluronicacid, hyaluronic acid esters, polyethylene-vinyl acetates, silicones, polyurethanes, polypropylene fumarates, polydesaminotyrosine carbonates, polydesaminotyrosine arylates, polydesaminotyrosine ester carbonates, polydesamnotyrosine ester arylates, polyethylene oxides, polyorthocarbonates, polycarbonates, or copolymers or physical blends thereof or combinations thereof. In certain embodiments, the vehicle includes one or more bactericidal agents, stabilizers, buffers, emulsifiers, dispersants, gelling agents, wetting agents, suspending agents, preservatives, sweetening agents, lubricants, binders, disintegration agents, swelling agents, plasticizers, pigments, colorants, glidants, and fillers. In certain embodiments, the composition is formulated as a particle, powder, granule, solution, suspension, gel, paste, emulsion, aerosol, syrup, spray, pill, tablet, capsule, suppository, or lozenge. In certain embodiments, the composition further includes one or more additional active agents. In certain embodiments, the one or more additional active agents can be selected from the group consisting of compounds for treating or managing irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), short bowel syndrome (SBS), celiac disease, small intestinal bacterial overgrowth (SIBO), gastroenteritis, leaky gut syndrome, gastric lymphoma, bacterial infection, viral infection, and parasitic infection. In certain embodiments, the one or more additional active agents include an antimicrobial, a PPAR agonist, a probiotic or prebiotic agent, an immune suppressive agent, or an antiviral agent. In certain embodiments, the antiviral agent can be selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof.
[0010] In another aspect, the present disclosure describes a combination product including (1) the octadecanoid composition according one or more embodiments of the above aspect; and (2) at least one additional active agent composition. In certain embodiments, the octadecanoid composition and the at least one additional agent composition can be formulated as a unitary dosage form. In certain embodiments, the octadecanoid composition can be formulated as a first dosage form and at least one additional agent compositions can be formulated as a second dosage form, wherein the first and the second dosage forms can be copackaged. In certain embodiments the at least one additional active agent composition includes one or more compounds for treating or managing irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), short bowel syndrome (SBS), celiac disease, smallintestinal bacterial overgrowth (SIBO), gastroenteritis, leaky gut syndrome, gastric lymphoma, bacterial infection, viral infection, and parasitic infection. In certain embodiments, the one or more compounds include an antimicrobial, a PPAR agonist, a probiotic or prebiotic agent, an immune suppressive agent, or an antiviral agent. In certain embodiments, the combination product includes an antiviral agent selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof.
[0011] In another aspect, techniques described in the present disclosure include a method of treating an illness, condition, disorder, or disease associated with mucosal dysfunction in a subject in need thereof, the method comprising administering the octadecanoid composition or the combination product according to any embodiments of the above aspects. In certain embodiments, the illness, disease, disorder, or condition associated with mucosal dysfunction includes one or more of chronic inflammatory reactions, autoimmune reactions, bacterial infection or overgrowth, viral infection, parasitic infection, mucosal diseases disrupting mitochondria, bowel resection, chronic diarrhea, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), dysbiosis, short bowel syndrome (SBS), and small intestinal bacterial overgrowth (SIBO)), celiac disease, gastroenteritis, increased intestinal permeability, malabsorption syndromes, and gastrointestinal lymphoma. In certain embodiments, the illness, disease, disorder, or condition can be a mucosal disease that disrupts mitochondria. In certain embodiments, the mucosal dysfunction can be caused by a dysbiosis, overgrowth of a pathogenic bacterium, a viral infection, a food antigen, or a toxin. In certain embodiments, the mucosal dysfunction can be caused by a viral infection. In certain embodiments, the viral infection can be caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV). In certain embodiments, the method further includes administering one or more antiviral agents to the subject. In certain embodiments, the subject can be administered a dose of the octadecanoid composition including the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight. In certainembodiments, at least one dose of the octadecanoid composition can be administered per day or per week. In certain embodiments, the octadecanoid composition can be administered at least once per day or as a single daily dose. In certain embodiments, the octadecanoid composition and the additional active agent composition of the combination product can be co-administered.
[0012] In another aspect, techniques described in the present disclosure include a method of treating a gastrointestinal symptom in a HIV-infected patient in need thereof, the method including administering an octadecanoid composition or a combination product according to any of the above aspects. In certain embodiments, the gastrointestinal symptom includes one or more of diarrhea, rectal bleeding, malabsorption, abdominal pain, weight loss, fever, anemia, fecal occult blood, fecal leukocytes, crypt abscesses, leukocyte infiltration, cell apoptosis, transmural granulomatous inflammation, superficial mucosal and submucosal inflammation, or an increase in pro-inflammatory cytokines. In certain embodiments, the patient has received or is receiving treatment with one or more antiviral agents. In certain embodiments, the one or more antiviral agents can be selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof. In certain embodiments, the patient can be administered a dose of the octadecanoid composition comprising the intermediate of C-18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight. In certain embodiments, the patient can be administered a liquid dosage form including about 10 pM to about 2 mM of the intermediate of C-18 fatty acid metabolism.
[0013] In another aspect, techniques described in the present disclosure include a method of treating dysbiosis in a subject in need thereof, the method including administering an octadecanoid composition or a combination product according to any of the above aspects. In certain embodiments, the method includes identifying a subject with dysbiosis prior to administering the composition or combination product. In certain embodiments, the dysbiosis includes infection by or overgrowth of one or more pathogenic bacteria selected from the group consisting of Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella,Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bacillus spp., Carbapenem-resistant Enterobacteriaceae (CRE), extended spectrum beta-lactam resistant Enterococci (ESBL), and vancomycin-resistant Enterococci (VRE). In certain embodiments, the dysbiosis includes a reduction in one or more beneficial bacteria selected form the group consisting of Bacteroides, Lactobacillus, Faecalibacterium, Bifidobacterium, Roseburia, Alistipes, Collinsella, Blautia, Coprococcus, Ruminococcus, Eubacterium and Dorea bacteria in the microbiome of the subject. In certain embodiments, administering includes local delivery of the intermediate of C-18 fatty acid metabolism to a lumen of the subject’s digestive, respiratory, or reproductive system. In certain embodiments, the octadecanoid composition can be formulated for delivery to one or more of the oral cavity, esophagus, stomach, small intestine, large intestine, rectum, or vagina of the subject. In certain embodiments, the subject can be administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1 ,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight. In certain embodiments, at least one dose of the octadecanoid composition can be administered per day or per week. In certain embodiments, the octadecanoid composition or the combination product can be administered at least once per day or as a single daily dose. In certain embodiments, the octadecanoid composition and the additional active agent composition are co-administered.
[0014] In another aspect, techniques described in the present disclosure include a method of repairing leaky gut syndrome in a subject in need thereof, the method comprising administering an octadecanoid composition or combination product according to any above aspect, wherein the subject exhibits microbially-mediated damage of the gut epithelial barrier. In certain embodiments, the damage of the gut epithelial barrier can be mediated by pathogenic bacterial infection or overgrowth, viral infection, parasitic infection, dysbiosis, short bowel syndrome (SBS), or small intestinal bacterial overgrowth (SIBO)). In certain embodiments, the damage of the gut epithelial barrier can be mediated by a viral infection. In certain embodiments, the viral infection is caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Humanimmunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV). In certain embodiments, the method further includes administering one or more antimicrobial agents to the subject. In certain embodiments, the subject can be administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight. In certain embodiments, at least one dose of the octadecanoid composition can be administered per day or per week. In certain embodiments, the octadecanoid composition can be administered at least once per day or as a single daily dose. In certain embodiments, the octadecanoid composition and the additional active agent composition of the combination product are coadministered.
[0015] In another aspect, the techniques described in the present disclosure include a method of increasing a relative abundance of a beneficial microorganism in a body canal of a subject in need thereof, the method including administering an octadecanoid composition or combination product according to any of the above aspects to the subject. In certain embodiments, the beneficial microorganism includes at least one microorganism of Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Synergistetes, Verrucomicrobia, Fusobacteria, and Euryarchaeota; at genus level the microorganisms of Bacteroides, Lactobacillus, Faecalibacterium, Bifidobacterium, Roseburia, Alistipes, Collinsella, Blautia, Coprococcus, Ruminococcus, Eubacterium or Dorea phylum, or a combination thereof. In certain embodiments, the method includes increasing the relative abundance of one or more Blautia and Lactobacillus microorganisms. In certain embodiments, the subject has been diagnosed with an illness, disease, disorder, or condition associated with mucosal dysfunction. In certain embodiments, the illness, disease, disorder, or condition associated with mucosal dysfunction comprises one or more of chronic inflammatory reactions, autoimmune reactions, bacterial infection or overgrowth, viral infection, parasitic infection, mucosal diseases disrupting mitochondria, bowel resection, chronic diarrhea, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), dysbiosis, short bowel syndrome (SBS), and small intestinal bacterial overgrowth (SIBO)), celiac disease, gastroenteritis, increased intestinal permeability, malabsorption syndromes, and gastrointestinal lymphoma. In certain embodiments, the mucosal dysfunction can be caused by a dysbiosis, overgrowth of a pathogenic bacterium, a viral infection, a food antigen, or a toxin. In certain embodiments, themucosal dysfunction can be caused by a viral infection. In certain embodiments, the viral infection is caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV). In certain embodiments, the method further includes administering one or more antiviral agents to the subject. In certain embodiments, the octadecanoid composition includes 10-HSA. Specific embodiments consisting with the present disclosure will become evident from the following more detailed description of certain preferred embodiments and the claims.
[0016] In another aspect, the present disclosure describes a method of reducing HIV related complications in a subject in need thereof, comprising administering an effective amount of an intermediate of C- 18 fatty acid metabolism, 10-HSA, or a derivative thereof to the subject. In certain embodiments, an effective amount is an amount effective for activating PPARa signaling and / or a activating histone crotonylation in one or more cells of the subject. In certain embodiments, the subject is at risk of developing an HIV related complications or of hospital re-admission. In certain embodiments, the subject is receiving antiretroviral therapy. In certain embodiments, the effective amount is the amount of the intermediate of C- 18 fatty acid metabolism, 10-HSA, or the derivative thereof that promotes mucosal CD4+ T cell recovery in the subject.
[0017] In another aspect, the present disclosure describes a method of reducing systemic inflammation in a subject receiving antiretroviral therapy, comprising administering an effective amount of an intermediate of C-18 fatty acid metabolism, 10-HSA, or a derivative thereof to the subject. In certain embodiments, an effective amount is an amount effective for promote eubiosis in a mucosal tissue of the subject.
[0018] In another aspect, the present disclosure describes a method of activating PPARa signaling in a subject in need thereof, comprising administering an effective amount of an intermediate of C-18 fatty acid metabolism, 10-HSA, or a derivative thereof to the subject. In certain embodiments the subject has virally inflamed mucosa. In certain embodiments, an effective amount of 10-HSA is an amount that inhibits NF-KB activation the subject’s mucosa.
[0019] In another aspect, the present disclosure describes a method of maintaining or restoring eubiosis of a mucosal tissue in a subject in need thereof, comprising administering an effective amount of an intermediate of C-18 fatty acid metabolism, 10-HSA, or a derivative thereof to the subject. In certain embodiments, the subject is at risk of an increase of proteobacteria and / or the loss of Firmicute populations in a mucosal tissue. In certainembodiments, the Firmicute population is selected from A. muciniphilia, L. animalis, L. salivarus, and L. mucosae. In certain embodiments, the subject is in need of maintaining or restoring the population of a member of the family Butyricioccaceae in a mucosal tissue. In certain embodiments, the mucosal tissue includes an oral cavity tissue. In certain embodiments, the method further comprises administering an additional active agent selected from the group consisting of prebiotics and substrates for a bacterial enzyme. In certain embodiments, the bacterial enzyme is an enzyme for fatty acid production. In certain embodiments, the bacterial enzyme is selected from oleate hydratase, enoyl-CoA hydratase and acetate kinase. In certain embodiments, the method further comprising administering an additional active agent selected from a substrate of oleate hydratase.
[0020] In another aspect, the present disclosure describes a method of promoting mitochondrial function in viral antigen-damaged cells of a subject in need thereof, comprising administering an effective amount of an intermediate of C-18 fatty acid metabolism, 10-HSA, or a derivative thereof to the subject. In certain embodiments, the effective amount is an amount effective for increasing basal and / or maximum respiration, increasing ATP linked respiration or increasing ATP linked oxygen consumption.In another aspect, the present disclosure describes a method of preventing loss of mitochondrial function in epithelial cells of a subject at risk of virally-induced cell damage, comprising administering an effective amount of an intermediate of C-18 fatty acid metabolism, 10-HSA, or derivative thereof to the subject. In certain embodiments, the effective amount is an amount effective for increasing basal and / or maximum respiration, increasing ATP linked respiration or increasing ATP linked oxygen consumption. In certain embodiments, the cell damage is disruption of tight junctions.BRIEF DESCRIPTION OF DRAWINGS
[0021] These and other objects and features of this invention will be better understood from the following detailed description taken in conjunction with the drawings wherein:
[0022] FIG. 1 illustrates dysregulation of gut epithelium caused by HIV / SIV infection (Left panel), and restoration of epithelial integrity and mitochondrial function activated by 10- hydroxystearic acid (10-HSA) (Right panel).
[0023] FIGS. 2A-G show 10-HSA serves as a potent ligand for PPARa and PPARy: (A) Chemical structure of 10-HSA and optimal docking pose with PPARa. Selected based on binding energy, visual inspection, and consistency with known data. Key interacting residues, HTS168, TYR192, PHE46, LEU49, CYS4, GLN5, and THR7, which are within a 3.5 A cutofftypically used for defining hydrogen bonding, are highlighted in yellow. 10-HSA is depicted in a ball-and-stick model in red; (B) PPARa activation by 10-HSA at three different concentrations; (C) PPARy activation by 10-HSA at three different concentrations; (D) Dose testing of 10-HSA in Caco2 human gut epithelial cells by measuring H3K18cr; (E) RT-qPCR data from RNA isolated from stem cell derived monolayers treated with 10-HSA (500pM) in combination with HIV proteins gpl20 (1 pg / mL) and tat (1.4 pg / mL) for 6 hours; (F) RT- qPCR data from RNA isolated from Caco2 treated with 10-HSA, Gpl20 + tat, and NaCr for 6 hours. Caco2 is a p53 null cell line; (G) Proposed mechanism for 10-HSA induced crotonylation and repair, (p < 0.05 = *, p < 0.01 = **, p < 0.001 = ***, p < 0.0001 = ****).
[0024] FIGS. 3A-L show that 10-HSA induces PPARa controlled histone crotonylation in two in vitro models of human gut epithelium: (A) Immunofluorescence (IF) staining detects H3K18cr and H3K14ac levels in stem cell derived epithelial monolayers after 5, 25, and 35 minutes of treatment with 10-HSA + HIV Envelope gpl20 + HIV Tat treatment; (B) IF detects H3K18cr and H3K14ac levels in Caco2 cell cultures after 6 hours of 10-HSA treatment with (C) PPARa inhibitor GW6471; (D) Mean fluorescent intensity of H3K18cr and H3K14ac in stem cell derived epithelial monolayers over a period of 90 minutes; (E) Mean fluorescent intensity of H3K18cr and H3K14ac in Caco2 cells over a period of 6 hours; (F) PPARa controlled gene expression that generates crotonyl group in Caco2; (G) Mean fluorescent intensity of H3K18cr and H3K14ac in Caco2 cells treated with either PPARa agonist GW590735 or antagonist GW6471 treatments over a 6 hour period. (H) Top 6 biological processes identified as enriched from ChlP-seq data analysis; (I) Top 16 enriched genes identified by ChlP-seq data analysis, FE = fold enrichment; (J) Trans epithelial electrical resistance (TEER) assay conducted on Caco2 cells treated with combinations of Gpl20 + tat and 10-HSA over a period of 24 and 48 hours. (K) ROS measurement by quantifying MFI after 24 hours of treatment. (L) Activation of HIV LTR gene and reporter gene GFP levels in the J-Lat cell line models for HIV latency, (p < 0.05 = *, p < 0.01 = **, p < 0.001 = ***, p < 0.0001 = ****) Scale bar = 5 micron. For (D) and (E), data points represent mean and SEM, however, due to the size of the data points, some SEMs are not visible.
[0025] FIGS. 4A-K show that 10-HSA induced histone crotonylation repairs gut epithelium and increased mitochondrial ETC mRNAs in vivo: (A) Representative images of H3K18cr staining in intestinal tissues of SIV-negative rhesus macaques, SIV+ rhesus macaques, and SIV+LP+ rhesus macaques H3K18cr staining; (B) Mean fluorescenceintensity of H3K18cr from panel (A); (C) Representative images of SIV-negative rhesus macaques, SIV+ rhesus macaques, and SIV+10-HSA treated rhesus macaques immunostained for H3K18cr and ZO-1; (D) H3K18cr mean fluorescence intensity for panel (C); (E) ZO-1 mean fluorescence intensity for panel (C); (F) 10-HSA contents in gut lumen of LP treated macaques; (G) Top enriched in vivo ChlP-seq related pathways as determined by RNAseq using Metascape; (H) RNA-seq data showing differentially expressed genes and pathways between SIV+ (vs SIV-negative), SIV+10-HSA (vs SIV-negative), and SIV+10- HSA vs. SIV+ groups (n =3 per group); (I) RNA-seq data based pathway analysis detected previously identified histone crotonylation associated ChlP-seq genes between SIV+10HSA (vs SIV-negative) and SIV+10-HSA vs SIV+ groups (n = 3 per group); (J) RNA-seq data detected gene expression profile of full mitochondrial genome (n = 3 per group). (K) Increased expression of genes regulating the crotonyl-group generation was detected in gut tissues of 10-HSA treated SIV+ macaques as compared to untreated SIV+ controls. P values shown are after correction for multiple comparisons, (p < 0.1 = X, p < 0.05 = *, p < 0.001 = ***, p < 0.0001 = ****). Scale bar = 50 micron.
[0026] FIGS. 5A-K show that 10-HSA repairs damaged mitochondrial morphology and gap junctions in SIV infected gut tissue: (A) Representative images of mitochondria in apical enterocytes in the gut epithelium as viewed by transmission electron microscopy (TEM, n = 3 animals per group, scale bar = 2 micron and 500 nanometers); (B) Representative images of cellular gap junctions in apical enterocytes (n = 3 animals per group, scale bar = 250 nanometers); (C) Mitochondrial circularity to quantify changes in mitochondrial morphology (n = 100 mitochondria per group); (D) Percent of mitochondria in autophagosome like structures as determined by TEM; (E) Area of apical enterocytes occupied by mitochondria; (F) Luminescent ATP assay using Caco2 cell line treated with combinations of treatments with HIV antigens and 10-HSA (n = 9 replicates per treatment); (G) Increased expression of PCG-la / p regulated genes responsible for mitochondrial biogenesis (n = 3 per group) during 10-HSA treatment; (H, I, J, K) RNAseq data show increased expression of genes involved in ATP synthesis and electron transport chain, mitochondrial morphology and organization, TCA cycle and oxidative phosphorylation, and mitochondrial translation following 10-HSA treatment (n = 3 per group). P values shown are after correction for multiple comparisons, (p < 0.1 = X, p < 0.05 = *, p < 0.01 = **, p < 0.001 = ***, p < 0.0001 = ****).
[0027] FIGS. 6A-E show that 10-HSA treatment maintains healthy gut microbiome in SIV infected non-human primates: (A) Top 7 genus of bacteria measured by relative abundance present in fecal swabs at end of study timepoint for SIV-negative (n=4), SIV+ (n=l), SIV+10-HSA (n=3), and SIV+ ART (n = 3) as determined by 16S sequencing; (B) Changes in the relative abundance of order Lactobacillales as measured by 16S sequencing from fecal samples; (C) Changes in the relative abundance of genus Lactobacillus as measured by 16S sequencing from fecal samples; (D) Changes in the relative abundance of genus Blautia as measured by 16S sequencing from fecal samples; (E) Changes in the relative abundance of genus Streptococcus as measured by 16S sequencing from fecal samples, (p < 0.01 =**).
[0028] FIGS. 7A-D show that 10-HSA treatment reduced damage of gut epithelium associated with Aflatoxin Bl poisoning in mice: (A) Representative images of villus structures in jejunum tissue showed the presence of H3K18cr and ZO-1 expression; (B) Immunohistochemical analysis of histone crotonylation fluorescence analysis in mouse jejunum (n = 18 villus / crypt regions per treatment); (C) Evaluation of weight change during the study; (D) Detection and validation of gene expression that was previously identified based on ChlP-seq analysis, (p < 0.05 = *, p < 0.0001 = ****) Scale bar = 25 micron.
[0029] FIGS. 8A-B show that 10-HSA docks to PPARa similar to previously known agonist feno fibrate. (A) Optimal docking of 10-HSA with PPARy, selected based on binding energy, visual inspection, and consistency with known data. Key interacting residues, ILE 326, SER289, ARG288, CYS 285, MET 329, MET 364, ILE 341, SER 342 and GLU 343 are within a 3.5 A cutoff typically used for defining hydrogen bonding, are highlighted in yellow. HSA is depicted in a ball-and-stick model in red. (B) The optimal docking pose of Fenofibrate with PPARa, selected based on binding energy, visual inspection, and consistency with known data. Key interacting residues HIS 168, TYR42, PHE46, LEU49, MET48, CYS4, GLN5, THRU, and SER8, which are within a 3.5 A cutoff typically used for defining hydrogen bonding, are highlighted in yellow. Fenofibrate is depicted in a ball- and-stick model in red.
[0030] FIGS. 9A-C show histone modifications in stem cell derived intestinal epithelial monolayers ex vivo and Caco2 cells in vivo after 10-HSA treatment for 90 minutes and 2-hours respectively: (A) Stem cell derived epithelial monolayers. (B) Caco2 cells. (C) Correlation plot between H3K18cr and H3K14ac modifications as measured by fluorescent signals. Scale bar = 5pm.
[0031] FIGS. 10A-B show that Reactive Oxygen Species (ROS) production is mitigated in 10-HSA treated Caco2 cells. (A) 6-hour treatment with 10-HSA, Gpl20 + tat, and PPARa antagonist GW6471 and PPARa agonist GW590735. (B) Caco2 gene expression data plotted from 6 to 24 hours of 10-HSA treatment. Scale bar = 5pm.
[0032] FIGS. 11A-B show J-Lat cell line (HIV latency model) exhibits reduced activation with 10-HSA treatment. (A) GFP fluorescent signal was determined by Flow cytometry and is reflective of HIV-LTR activation. (B) Sodium crotonate (NaCr) addition to the cells was used as positive control for increasing crotonyl-CoA generation and histone modification, (p < 0.001 = ***, p < 0.0001 = ****).
[0033] FIGS. 12A-D identify a marked difference in the pattern of ChlP-seq enriched genes between 10-HSA treated and NaCr treated gut epithelial cells: (A) Functional breakdown of 10-HSA induced crotonylation gene enrichment. (B) STRING network showing strong relationship between mitochondrial genes enrichment and 10-HSA treatment. (C) Overlapping enriched genes between NaCr and 10-HSA crotonyl group ChlP- seq data. (D) Overlapping enriched genes between Untreated and 10-HSA treated cells from ChlP-seq data.
[0034] FIG. 13 show the Rhesus macaque study design (n = 3 per group).
[0035] FIG. 14A-B show increased levels of histone acetylation in gut epithelium of10-HSA treated macaques but not in L. plantarum treated macaques: (A) Histone acetylation was measured by H3K18ac immunostaining in L. plantarum treated macaques; (B) Histone acetylation was measured by H3K18ac immunostaining in 10-HSA treated macaques.
[0036] FIGS. 15A-D show staining of tight junction protein Claudin 3 and regions of severe damage in SIV+ animals with rescue in 10-HSA treatment. (A and B) Representative images of Claudin 3 staining in jejunal gut compartment of rhesus macaques. (B) Change in fluorescent intensity of Claudin 3 immunofluorescence in SIV+ animals receiving 10-HSA treatment. (C) Mean fluorescent intensity of Claudin 3 immunofluorescence, (p < 0.05 = *) Scale bar = 50 pm.
[0037] FIGS. 16A-C show increased mitochondrial pathway enrichment in jejunum of 10-HSA treated macaques: (A) Heatmap showing significant enrichment of genes by pathway analysis (p < 0.05). (B) GO pathway analysis was performed with Metascape. (C) STRING chart showing interconnection of pathways increased by 10-HSA treatment as compared to SIV+ controls, (n = 3 per group).
[0038] FIG. 17 shows 10-HSA treatment did not significantly alter important immune pathways required to combat viral infection, based on genes associated with GO pathways determined by Metascape required for viral resistance (n =3 per group).
[0039] FIGS. 18A-E show that 10-HSA treatment of mice exposed orally to Aflatoxin pi provides a competitive advantage to beneficial gram positive microbes that benefit each other and are important contributors to the gut health and renewal. (A) shows top 7 genera of bacteria in ileal tissue of untreated (n = 4), Aflatoxin Bl (AFB1) exposed (n = 6), and AFB1+ 10-HSA (n = 6) mice at necropsy. Relative population abundance of (B) Blautia, (C) Turicibacter, (D) Butyricicoccus, and (E) Marvinbryantia in mice at necropsy. All data reported represent the mean and standard error, (p < 0.05 = *, p < 0.01 =**).
[0040] FIGS. 19A-F depict results showing 10-HSA drives epithelial repair ex vivo and in vitro and promotes mitochondrial function in HIV inflamed environment. (A) ZO- 1 (yellow) immuno fluorescent staining in Caco2 cells following 6 hours of treatment with 10- HSA and HIV viral antigens. (B) TEER analysis of gut epithelial electrical resistance monitoring cell-cell junction integrity in Caco2 following 24 and 48 hours with 10-HSA and HIV viral antigen treatments. (C) Tight junction gene expression in SCDM ex vivo and Caco2 in vitro following 6 hours of treatment with 10-HSA and HIV viral antigens. (D,E) Seahorse OCR assay output in Caco2 following 6 hours of treatment with 10-HSA and HIV viral antigens. (F ) ATP luminescent assay in Caco2 cells following 24 hours of treatment with 10-HSA and HIV viral antigens. All data reported as mean and standard error. Scale bar = 5 micron.
[0041] FIGS. 20A-P depict results showing 10-HSA promotes PPARa transcriptional activity ex vivo and in vitro. (A) PPARa activation EC50 curve with 10-HSA and PPARa agonist GW7647 as determined by Luciferase reporter gene fluorescent signal. (B) Inhibition of PPARa activation by PPARa antagonist NXT629 in Luciferase reporter cell line. (C) PPARa regulated gene expression ex vivo and in vitro with 10-HSA and HIV viral antigens as determined by qPCR. (D) TRRUST analysis of significantly upregulated genes from RNA sequencing in SCDM following 10-HSA and HIV antigen treatments. (E, F, G, H, J and K) Seahorse OCR assay output in HCT-116 cells, 116 cells PPARa inhibitor KO cells, and Caco2 cells following 30 minutes with PPARa inhibitor GW6471. (I) Transcriptional analysis identified significant increase in the mRNA expression levels of PPARa regulated genes ACSS2, ACADM, ACADl'L, ACSL3, and HADHA in Caco2 and SCDM treated with HIV antigens and 10-HSA. (L) Ligand binding site 1 close view of the orthosteric pocketamino acid residues establish the canonical interactions with the AF2 helix of PPARa. (M) Second ligand binding site close view of key interactions involved with the H11-H12 loop and the H3 helix of PPARa with ligand occupied in the fl loop. (N) Center of mass (COM) distance between PPARa and 10-HSA, light green represents the first binding site and dark green represents the second binding site. For reference, COM between various PPARa and ligands from known crystal structures are also represented in dotted lines. All data reported as mean and standard error. (O) Visualization of initial GaMD simulation of 10-HSA- PPARa set-up. Water molecules are visualized in gray while 10-HSA is in red. (P) GaMD shows PPARa is capable of binding two 10-HSA molecules simultaneously.
[0042] FIGS. 21A-P depict results showing 10-HSA promotes epigenetic remodeling of histone crotonylation through PPARa activation ex vivo and in vitro. (A) Analysis of Stem cell derived monolayers after 25 minutes of HIV viral antigen and 10-HSA treatment. (B) Analysis of Caco2 cells treated for 6 hours with HIV viral antigens, 10-HSA, PPARa antagonist GW6471 and PPARa agonist GW590735 immunofluorescence staining for H3K18cr and H3K14ac. (C) Semi-quantification of fluorescent signal for H3K18cr and H3K14ac in HCT-116 at 6-hour by utilizing mean fluorescent intensity measurements taken in ImageJ. (D) Genes, ACOX1, ACOX3, and ECHS1 showed minimal to no modulation of the expression in the HCT-116 PPARa-KO cell line following any treatment as determined by qPCR. (E) ZO-1 modulation in the wt and HCT-116 PPARa-KO cell line as determined by qPCR. (F) Pathway analysis of significantly (p < 0.05) enriched genes from 10-HSA treated Caco2 cells ChlP-seq for pan-crotonyl lysine antibody. (G) Pathway analysis of genes with significantly increased expression in RNAseq when comparing 10-HSA HIV viral antigen treated cells to HIV viral antigen treated cells alone from SCDM cross referenced to the 10-HSA treated Caco2 ChlP-seq dataset. (H) HOMER transcription factor target site enrichment for 10-HSA and NaCr compared to no treatment from ChlP-seq data. (I) J-lat cell line HIV LTR GFP fluorescent signal as determined by flow cytometry on live cells stained with DAPI and treated with PMA, NaCr, and 10-HSA for 18 hours. (J) EC50 curve determined by semi-quantification of HCK18cr signal in Caco2 by ImageJ based on 10-HSA dosage. (K) Genes, ACOX1, ACOX3 and AC ADS expression following treatment as determined by qPCR. (L) Genes, ACOX1, ACOX3, and ECHS1 showed minimal to no modulation of the expression in the HCT-116 PPARa-KO cell line following any treatment as determined by qPCR. Pan crotonyl-lysine ChlP-seq data for NaCr and 10-HSA treated and untreated cells with pathway analysis and binding site information for (M) 10-HSAtreated cells, (N) NaCr treated cells, and (O) Untreated cells. (P) results of RNA-seq of SCDM cross referenced with 10-HSA ChlP-seq data showing significant upregulation of genes regulating Ca+ion transport, OXPHOS, and mitochondrial transmembrane transport pathways. All data reported as mean and standard error. Scale bar = 5 micron.
[0043] FIGS. 22A-N depicts results showing 10-HSA- induced histone crotonylation repairs gut epithelium in vivo. (A) Macaque study design and treatments. (B) Longitudinal viral load data from peripheral blood. (C) Longitudinal CD4+ T cell percent change from CBC data in peripheral blood. (D) Prevalence of CD4+T cells in small intestine assessed by flow cytometry at necropsy. (E) Semi-quantitative fluorescent analysis of ZO-1 and H3K18cr representative images of immunofluorescence for ZO-1 and H3K18cr in small intestine of SIVneg (n = 3), SIVpos (n = 3), and 10-HSA (n = 3) treated animals at the study end timepoint utilizing mean fluorescent intensity measurements in ImageJ. (F) IFABP levels in vivo as detected by ELISA at necropsy timepoint using plasma samples. (G) Heatmap showing significantly altered (FDR < 0.15, p < 0.05) genes in intestine of SIVpos- HSA vs SIVpos groups comparison extended across SIVpos-ART vs SIVpos and SIVpos vs SIVneg comparisons as detected by RNAseq data. (H) depicts gating strategy for CD4+ and CD8+T cells in lamina propria mononuclear cell populations. (I) Significantly altered genes in 10-HSA treated SIVpos animals compared to SIVpos animals alone from RNA sequencing extended across SIVposART vs SIVpos and SIVpos vs SIVneg comparisons with focus on pathways altered by SIV infection. (J) PLS-DA plot from peripheral blood untargeted metabolomic data for SIVpos (n = 3), SIVpos with ART (n = 3), and SIVpos with 10-HSA (n = 3) animals. (K) depicts analysis of immunostaining showing significant recovery of Claudin-3 in villus and crypt of 10-HSA treated animals. (L) Metabolites reflective of gut function and tryptophan metabolism from untargeted metabolomic data at necropsy timepoint. (M) Semi-quantification of H3K18cr signal through MFI of representative images of H3K18cr immunofluorescence for HIVneg (n = 4), HIVpos (n = 3) and LTNP (n = 5) individuals in small intestinal biopsies. (N) Microarray data showing increase in fatty acid metabolism driven through PPARa signaling in LTNP population. All data reported as mean and standard error. Scale bar = 25 micron.
[0044] FIGS. 23A-G depict results showing 10-HSA repairs damaged mitochondrial morphology and gap junctions. (A) Mitochondrial area per cell across treatments quantified in ImageJ (n = 10 cells per treatment) from images of mitochondria in apical enterocytes as viewed by transmission electron microscopy of intestinal tissue at the study endpoint (TEM,n = 3 animals per group, scale bar = 2 micron and 500 nanometers). (B) Cell gap junction width across treatments quantified in ImageJ of cellular gap junctions in apical enterocytes from jejunum tissue at the study endpoint (scale bar = 250 nanometers). (C) Mitochondrial aspect ratio across treatments (n = 100 mitochondria per treatment) quantified in ImageJ. (D) Dense body granule count across treatments quantified in ImageJ. (E) Significantly altered (FDR < 0.15, p < 0.05) genes in jejunal mucosal tissue of 10-HSA treated SIVpos animals compared to SIVpos animals alone RNA sequencing data extended across SIVposARTvsSIVpos and SIVposvsSIVneg comparisons with focus on mitochondrially relevant pathways. (F) Metabolites from untargeted metabolomics associated with mitochondrial function. (G) Significantly altered mtDNA transcriptional data determined by RNAseq. All data reported as mean and standard error.
[0045] FIGS. 24A-P depict results showing 10-HSA treatment promotes microbial diversity in the SIV infected gut. (A) Microbiome changes detected by Bray-Curtis PCoA plot of Beta diversity between groups at the study endpoint based on the 16S sequencing data. (B) Microbiome Alpha diversity as determined by Shannon index at the study endpoint based on the 16S sequencing data. (C) Relative abundance of phyla across treatments based on 16S sequencing data. (D) LEISe generated LDA plot comparing microbiomes from SIVpos vs SIVpos-HSA animals using 16S sequencing data. (E) LEISe cladogram generated from metagenomic data comparing gut microbiomes from SIVpos and SIVpos-HSA animals. (F) LDA plot from LEISe analysis focusing on taxa of Actinobacteria and Firmicutes based on SIVpos vs SIVpos-HSA comparisons. (G) Bacilli and Lactobacillus relative abundance in SIVpos and SIVpos-HSA groups as determined by metagenomic sequencing. (H) PCA plot generated by limma.voom showing metagenomic sequenced enzyme gene counts in the gut microbiome of SIVpos (n = 3), SIVpos-HSA (n = 3), and SIVpos-ART (n = 3) animals. (I) Counts per million of OhyA gene from metagenomic data with associated species of bacteria between SIVpos and SIVpos-HSA animals. (J) Counts per million of ECHS gene from metagenomic data with associated species of bacteria between SIVpos and SIVpos-HSA animals. (K) Counts per million of acetate kinase gene from metagenomic data with associated species of bacteria between SIVpos and SIVpos- HSA animals. (L) LEISe LDA analysis identifying unique pathways between SIVpos and SIVpos-HSA gut microbiomes by metagenomic sequencing. (M) LEISe LDA analysis identifying unique taxa between SIVpos and SIVpos-ART groups by metagenomic sequencing. (N) Study design of combined treatments of 10-HSA and ART in SIVpos rhesusmacaques. (O) Flow cytometry data from colo-rectal biopsies taken 2 weeks after initiation of SIVpos-HSA-ART (n = 3) treatment and ART treatment alone (n = 3). (P) Plasma SIV Viral RNA Copies during study, at 2 weeks post infection and at 5 weeks post ART.
[0046] FIGS. 25A-E depict LEfSe Cladogram from 16S sequencing data characterizing enriched taxa from microbiomes of SIVpos and SIVpos-HSA animals and changes in beta diversity of the oral microbiome and increased prevalence of Firmicute taxa in SIVpos-HSA animals. (A) LEfSE cladogram from 16S seq. (B) Heatmap of differentially expressed genes from metagenomic data. (C) Bray-Curtis Beta diversity PCoA. (D) LEfSe cladogram. (E) LEfSe enrichment of taxa based on QIIME2 level 7 data from oral microbiome.
[0047] FIGS. 26A-C present RNA-sequencing data showing clear separation between 10-HSA, SIVpos, ART treated, and SIVneg animals indicating distinct treatment effects. (A) PCA plot of RNAseq data showing significantly enriched pathways based on significantly upregulated gene expression between SIVposHSA and SIVpos treatment groups. (B) Crotonyl generation genes from RNAseq data. (C) KLF4 membrane organization genes from RNAseq data.DETAILED DESCRIPTION
[0048] Embodiments of the disclosure are more particularly described below. The examples set forth herein are intended as illustrative only, as numerous modifications and variations therein will be apparent to those skilled in the art. The terms used in the specification generally have their ordinary meanings in the art, within the context of the invention, and in the specific context where each term is used. Some terms have been more specifically defined below to provide additional guidance to the practitioner regarding the description of the invention.
[0049] Aspects of the disclosure include octadecanoid compositions and methods of treating a disease or condition associated with mucosal dysfunction by administering an octadecanoid composition to a subject in need of such treatment. Embodiments of the present disclosure are predicated on harnessing a therapeutic use of intermediates of C-18 fatty acid metabolism of gastrointestinal microbes to target metabolic repair pathways, including mucosal repair pathways. Targeting metabolic repair pathways can include one or more of the following: transactivating PPARa and / or PPARy controlled genes, inducing PPARa controlled epigenetic modification (e.g., histone crotonylation), inducing epigenetic control of epithelial repair, reducing antigenic- and / or toxin- induced epithelial damage, repairing gapjunctions, restoring functional mitochondrial morphology, restoring mitochondrial homeostasis (e.g., bioenergenic pathways), mitigating Reactive Oxygen Species (ROS) production, maintaining a healthy gut microbiome (e.g., in a pathogen-infected subject), and reducing weight loss due to a mucosal pathophysiology.Octadecanoid compositions
[0050] Aspects of the disclosure include octadecanoid compositions. An octadecanoid is broadly defined as including enzymatic metabolites of 18-carbon (C-18) mono- or polyunsaturated fatty acids (PUFAs) as well as non-enzymatic products, such as the enzymatic metabolites and / or non-enzymatic products of C-18 fatty acids, and which exhibit Peroxisome proliferator-activated receptor (PPAR) binding activity. An octadecanoid can be saturated or unsaturated. An unsaturated octadecanoid can include one or more double bonds at any position of the hydrocarbon chain, in a cis- or trans-configuration. An octadecanoid composition can include a derivative of a C-18 fatty acid, such as oleic acid, linoleic acid, alpha-linolenic acid, and y-linolenic acid. Non-limiting examples of C-18 fatty acid derivatives include hydroperoxides, epoxides, ketones, monohydroxyls, diols, triols or higher polyols, or non-natural C-18 fatty acid derivatives lacking a free carboxylate head group, including, but not limited to, short-chain C-18 acid esters, such as e.g. methyl, ethyl, i-propyl, n-propyl, n- butyl esters or amides, such as e.g., oleamide or N — OH oleamide, hydroxamic acid, and 10- hydroxystearamide, or alcohols, such as e.g., oleyl alcohol. In certain embodiments, the derivative of a C-18 fatty acid includes a triglyceride, such as trihydoxystearic acid (e.g., 9,10,13-trihydroxystearic acid) or trihydroxy stearin or compounds that yield one or more molecules of hydroxystearic acid or hydroxystearate such as mono, di or tri ester of glycerol with hydroxystearic acid. In certain embodiments, the derivative of a C- 18 fatty acid includes a macromolecule, such as a dendrimer comprising fatty acid functionalized dendrons.
[0051] An octadecanoid composition can include an intermediate of C-18 fatty acid metabolism of gastrointestinal microbes from the group consisting of C-l 8 hydroxy fatty acids, C-18 oxo fatty acids, C-18 conjugated fatty acids, and C-18 partially saturated trans-fatty acids, or a salt or solvate thereof. Non-limiting examples of C-18 hydroxy fatty acids and C-18 oxo fatty acids include 10-hydroxystearic acid, 12 -hydroxy stearic acid, 9-oxo-octadecadienoic acid, 13-oxo-octadecadienoic acid, 10-hydroxy-cis-12-octadecenoic acid, 10-hydroxy-cis-12, cis- 15 -octadecadienoic acid, 10-hydroxy-cis-6, cis-12-octadecadienoic acid, 10-hydroxy-cis- 6, cis- 12, cis-15-octadecatrienoic acid, 10,12-dihydroxyoctadecanoic acid, 10-hydroxy-cis-15-octadecenoic acid, 10-hydroxy-cis-6-octadecenoic acid, 10-hydroxy-cis-6, cis-15- octadecadienoic acid, 10-hydroxy -trans- 11 -octadecenoic acid, 10-hydroxy -trans- 11 , cis-15- octadecadienoic acid, 10-hydroxy-cis-6, trans- 11 -octadecadienoic acid, and 10-hydroxy-cis-6, trans-11, cis-15-octadecatrienoic acid, 10-oxo-cis-12-octadecenoic acid, 10-oxo-cis-12, cis- 15 -octadecadienoic acid, 10-oxo-cis-6, cis-12-octadecadienoic acid, 10-oxo-cis-6, cis-12, cis- 15 -octadecatrienoic acid, 10-oxooctadecanoic acid, 10-oxo-cis-6-octadecenoic acid, 10-oxo- cis- 15 -octadecenoic acid, 10-oxo-cis-6, cis- 15 -octadecadienoic acid, 12-oxooctadecanoic acid, 10-oxo-trans-l l -octadecenoic acid, 10-oxo-cis-6, trans- 11 -octadecadienoic acid, 10-oxo- trans-11, cis-15-octadecadienoic acid, 10-oxo-cis-6, trans-11, cis-15-octadecatrienoic acid, and 12-oxo-cis-9-octadecenoic acid, and a derivative thereof as described above.
[0052] In certain embodiments, an octadecanoid composition can include an octadecanoic acid carrying a hydroxy group at position 10, i.e., 10-hydroxystearic acid, or an enantiomer or a salt thereof (referred to interchangeably as “10-HSA”) in vehicle for administration. In certain embodiments, an octadecanoid composition can include an octadecanoic acid carrying a hydroxy group at position 12, i.e., 12-hydroxystearic acid, or an enantiomer or a salt thereof (referred to interchangeably as “12-HSA”) in vehicle for administration. In certain embodiments, an octadecanoid composition can include an octadecanoic acid carrying a hydroxy group at position 10 and a cis or trans double bond at position 12, or an enantiomer or a salt thereof in vehicle for administration. An enantiomer can include an (R) or (5) enantiomer. A salt can include any organic or inorganic bases, including bases for use in pharmaceutically acceptable salt forms. Non-limiting examples can include sodium, potassium, lithium, ammonium, calcium, as well as primary, secondary, and tertiary amines, and esters of lower hydrocarbons, such as methyl, ethyl, and propyl, and the like. In some cases, 10-HSA can be provided as triglyceride, such as trihydoxystearic acid (e.g., 9,10,13-trihydroxystearic acid) or trihydroxy stearin or compounds that yield one or more molecules of 10-hydroxystearate or 10-HSA such as mono, di or tri ester of glycerol with 10- HSA. In certain embodiments, the derivative of a 10-HSA includes a macromolecule, such as a dendrimer comprising one or more 10-HSA functionalized dendrons.
[0053] An octadecanoic acid can be modified at the methyl end or carboxyl end to enhance the stability or improve solubility of the molecule. Such modifications within the knowledge of the ordinary artisan, including chemical functionalization on one or both carboxylic (COOH) and hydroxyl-chain group (OH). The carboxylic group can be conjugated to an amine or ethanolamine, thereby forming amide derivatives (e.g., 10 OH-stearoylethanolamide, 10 OH-SEA), amino acids (e.g., glycine), phenolic compounds (e.g., tyrosol), neurotransmitters (e.g., dopamine). The hydroxyl-chain group can be conjugated to a free fatty acid forming a so-called fatty acyl esters of hydroxyl fatty acids (FAHFAs). In some cases, a hydroxyl group can be methylated, esterified, or oxidized into a ketone.
[0054] An octadecanoid of the present disclosure, or a derivative or salt thereof, can be provided at a specific purity (e.g., a percentage of the octadecanoid, or a derivative or salt thereof, in a bulk form) of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99% purity, or substantially pure. As used herein, “substantially pure” can refer to a composition or product with one or more impurities at a level that does not produce a detectable physiological effect in the final composition. A mixture of octadecanoids, or derivatives or salts thereof, can be present at a purity of at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99% purity as a mixture, or as a substantially pure mixture. In certain embodiments, an octadecanoid of the present disclosure odd chain fatty acid, or a mixture thereof, can be free from other fatty acid derivatives, triglycerides, or phospholipids, or be free from other metabolites of gastrointestinal microbes, or intermediates thereof. In certain embodiments, 10-HSA, or a derivative, or salt thereof, can be substantially free from other intermediates of C-l 8 fatty acid metabolism of gastrointestinal microbes (e.g., substantially free from 12-HSA).
[0055] An octadecanoid of the present disclosure, or derivative or salt thereof, can originate from any source. In certain embodiments, an octadecanoid, or derivative or salt thereof can be present a natural source, isolated from a natural source, semi-synthetic, synthetic, or be a mixture of one or more of these. An octadecanoid, or derivative or salt thereof can be produced in a laboratory, in nature, by enzymatic processes, by a wildtype microorganism, by a genetically modified microbe, isolated from animal tissues, produced by chemical synthesis, or be produced by two or more of these processes.
[0056] In certain embodiments, an octadecanoid of the present disclosure, or derivative or salt thereof, can be derived from natural sources, e.g., vegetable oils such as castor oil, or can be synthesized by methods as are known in the art. In some embodiments, an octadecanoid of the present disclosure, or derivative or salt thereof, can be present in a unrefined orunpurified natural octadecanoid composition, a semi-refined octadecanoid composition, or a refined octadecanoid composition. Removal of undesired components, or enrichment of a desired octadecanoid, or derivative or salt thereof in an octadecanoid composition can be performed using known separation or purification techniques.
[0057] An octadecanoid composition can include a therapeutically effective amount of a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid described above. A therapeutically effective amount of an hydroxylated fatty acid (or other octadecanoid) can be any amount sufficient for promoting a desired treatment outcome in a subject, at a reasonable benefit / risk ratio for the subject. A therapeutically effective amount can vary depending on such factors can vary depending upon factors such as the severity of the subject’s condition or disease, the underlying health of the subject, the age and / or size of the subject, and the form of the composition. One of ordinary skill in the art can empirically determine the therapeutically effective amount of a particular compound without undue experimentation.
[0058] A therapeutically effective amount of a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid described above can be formulated in vehicle as one or more dosage units. The octadecanoid content can vary from about 5 to about 95% of the total composition (weightweight). In certain cases, a composition can include about 0.1 mg to about 10 g, about 1 to 5000 mg, about 10 to 2000 mg, about 30 to 1800 mg, about 50 to 1500 mg, about 100 to 900 mg, or about 300 to about 700 mg octadecanoid, or any value or subrange thereof (e.g., 15 mg, 150 mg, 500 mg, and other values within the ranges above; and 0.1-10 mg, 10-20 mg, 100- 300 mg, and other subranges within the ranges above). The concentration of hydroxylated fatty acid, such as 10-HSA, or other octadecanoid, can be at least 1 pM, at least 5 pM, at least 10 pM, at least 50 pM, at least 100 pM, at least 200 pM, at least 300 pM, at least 500 pM, or greater.
[0059] The therapeutically effective amount can be based on a daily dosage, such as about 10 mg to about 20 g per day, about 50 mg to about 10 g per day, about 100 mg to about 7.5 g per day, about 500 mg to about 5 g per day, about 750 mg to about 2 g per day, about 1 g to about 2.5 g per day, about 50 mg to about 20 g per day, about 100 mg to about 15 g per day, about 500 mg to about 10 g per day, or about 1 g to about 7.5 g per day, formulated in one or more dosage units. A therapeutically effective amount of an octadecanoid administered during an initial treatment phase can be in the range of 50 to 600 mg, 100 mg to 20 g, 100 mg to 30 g per day, 500 mg to 15 g per day, 1 g to 10 g per day, or 2.5 g to 7.5 g per day, for example, formulated in one or more dosage units. A therapeutically effective amount of anoctadecanoid administered during an optional secondary treatment phase, can be 10 mg to 800 mg, 20 mg to 10 g per day, 100 mg to 7.5 g per day, 500 mg to 2.5 g per day, 750 mg to 1.5 g per day, 20 mg to 20 g per day, 100 mg to 10 g per day, 500 mg to 7.5 g per day, or 750 mg to 5 g per day, for example, formulated in one or more dosage units. A therapeutically effective amount of an octadecanoid during an initial treatment phase can be lower or higher than a therapeutically effective amount of a hydroxylated fatty acid during a secondary treatment phase.
[0060] A dosage unit can be a unitary form comprising a single dose which is capable of being administered to a subject, and that may be readily handled and packed, remaining as a physically and chemically stable unit dose comprising a hydroxylated fatty acid, such as 10- HSA, or other octadecanoid described above, in a mixture with a vehicle. For example, 10- HSA can be formulated with or incorporated in a vehicle that allows for predictable release of 10-HSA when administered to a subject.
[0061] A vehicle can include any carrier or inert medium used as a solvent or diluent in which a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can be formulated or incorporated. A vehicle can include an aqueous, oily, solid, or semisolid carrier, such as one or more of water, saline, alcohol, oil (e.g., vegetable oils, animal oils, synthetic oils, etc.), wax, polymer, sugar, starch, or the like, to facilitate delivery of a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid, or manufacture of a dosage unit thereof. A vehicle can further include one or more bactericidal agents, stabilizers, buffers, emulsifiers, dispersants, gelling agents, wetting agents, suspending agents, preservatives, sweetening agents, lubricants, binders, disintegration agents, swelling agents, plasticizers, pigments, colorants, glidants, fillers or other excipient. In certain embodiments, a vehicle includes one or more components selected or formulated to facilitate mucosal deposition of a hydroxylated fatty acid, such as 10- HSA, or other octadecanoid, and / or to promote mucosal penetration thereof (e.g., to promote penetration through mucus covering apical part of epithelial cells).
[0062] The vehicle can include one or more pharmaceutically acceptable carriers suitable for administering a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid, as therapeutically active agent to a subject. The term “pharmaceutically acceptable” refers to compounds, materials, compositions which are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio within the scope of sound medical judgment. Suitability of a vehicle can be based on a desired physical form ofthe octadecanoid composition, which can be provided in the form of a particle, powder, granule, solution, suspension, gel, paste, emulsion, aerosol, syrup, spray, or unit dosage form (e.g., pill, tablet, capsule, suppository, lozenge, etc.), and / or route of delivery. A hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can be formulated with or incorporated in a vehicle suitable for oral, nasal, enteral, parenteral, topical, transdermal, transmucosal, rectal, ophthalmic, or vaginal delivery.
[0063] When formulated for oral use, octadecanoid compositions of the present disclosure can have a physical form selected from the group of pills, tablets, troches, lozenges, aqueous or oil suspensions, dispersible powders or granules, emulsions, hard or soft capsules, gelcap pills, syrups, or elixirs. Oral octadecanoid compositions can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and can contain one or more antioxidants, sweetening agents, flavoring agents, coloring agents, and preserving agents, in order to provide a palatable preparation.
[0064] Tablets containing a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can include a vehicle comprising inert diluents, such as calcium or sodium carbonate, lactose, lactose monohydrate, croscarmellose sodium, povidone, calcium, or sodium phosphate; granulating and disintegrating agents, such as maize starch, or alginic acid; binding agents, such as cellulose, microcrystalline cellulose, starch, gelatin, or acacia; and lubricating agents, such as magnesium stearate, stearic acid, or talc. A tablet can be uncoated or include one or more coatings to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
[0065] Hard gelatin capsules containing hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can include an inert solid diluent, for example pregelatinized starch, calcium phosphate or kaolin. Soft gelatin capsules containing hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can include water or an oil medium, such as peanut oil, liquid paraffin, or olive oil.
[0066] Suspensions can include a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid in an aqueous vehicle. The vehicle can include one or more excipients (e.g., a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropyl methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g.,heptadecaethyleneoxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan monooleate)). An aqueous suspension can include one or more preservatives such as ethyl or n-propyl p- hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, sucralose, or saccharin, for example. In certain embodiments, an aqueous suspension includes dispersible powders and granules incorporating 10-HSA or other octadecanoid and optionally one or more of a dispersing or wetting agent, a suspending agent, a preservative, and sweetening, flavoring and / or coloring agents.
[0067] A suspension can include a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid in an oily vehicle, such as vegetable oil (e.g., such as arachis oil, olive oil, sesame oil or coconut oil), or a mineral oil (e.g., liquid paraffin). An oil suspension can include a thickening agent such as beeswax, hard paraffin or cetyl alcohol, and optionally one or more of a sweetening agent, flavoring agent, and antioxidant such as ascorbic acid, BHT, etc.
[0068] An oil-in-water emulsions can include a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid in one or more of the oily or water phases. An oily phase can include a vegetable oil, such as olive oil or arachis oil, a mineral oil, such as liquid paraffin, or a mixture of these. An emulsion can include one or more emulsifying agents, such as naturally-occurring gums (e.g., gum acacia and gum tragacanth), naturally occurring phosphatides (e.g., soybean lecithin, esters or partial esters derived from fatty acids) and hexitol anhydrides, such as sorbitan monooleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan monooleate. An emulsion can further include sweetening and flavoring agents.
[0069] Syrups and elixirs can be formulated with sweetening agents, such as glycerol, sorbitol, or sucrose, and optionally a demulcent, a preservative, a flavoring, or a coloring agent.
[0070] An octadecanoid composition can be in the form of an injectable preparation, such as a sterile injectable aqueous suspension or oleaginous suspension, as described above. A sterile injectable preparation can include a solvent, such as 1,3-butane-diol, DMSO, water, dihydrolevoglucosenone, ethanol, Ringer’s solution, isotonic sodium chloride solution, fixed oils, optionally including synthetic mono- or diglycerides, fatty acids such as oleic acid, and glucose. An injectable preparation can be configured for parenteral delivery, e.g., for intravenous, intraperitoneal, intrathecal, intraventricular, intrastromal, intracranial, intramuscular, or subcutaneous injection, or by infusion techniques.
[0071] Compositions for intranasal administration or administration by inhalation can be formulated for administration with a dry powder inhaler, an aerosol spray from a pressurized container, or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, a hydrofluoroalkane such as 1, 1,1,2- tetrafluoroethane (HFC 134a), carbon dioxide or other suitable gas. The pressurized container or nebulizer can contain a solution or suspension comprising an hydroxylated fatty acid, such as 10-HSA, or other octadecanoid described above.
[0072] An octadecanoid composition can be formulated for local delivery to mucosa. For example, a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can be formulated with a vehicle for local administration to the GI tract, or a portion thereof. For example, the composition can be a lozenge that includes 10-HSA or other octadecanoid in a flavored base, sucrose and acacia or tragacanth; as a pastille in an inert base such as gelatin and glycerin, or sucrose and acacia; or as a lavage in a suitable liquid carrier. An octadecanoid composition can be formulated for rectal administration. For example 10-HSA or other octadecanoid can be formulated as suppository with a suitable base comprising, for example, cocoa butter or a salicylates. An octadecanoid composition can be formulated for vaginal administration. For example 10-HSA or other octadecanoid can be formulated a pessaries, tampons, creams, gels, pastes, foams, or spray formulations.
[0073] An octadecanoid composition can be formulated for local delivery in the form of a solid or semi-solid depot, such as an implant designed for placement and location within or near a body canal or the surrounding soft tissue. The solid depot can have any shape (e.g., film, microsphere, or rod). For example, a hydroxylated fatty acid, e.g., 10-HSA or other octadecanoid can be encapsulated in polymer to form a solid or semi-solid depot.
[0074] A solid or semi-solid depot can include one or more polymers, non-limiting examples of which include biopolymers such as poly(alpha-hydroxy acids), poly(lactide-co- glycolide) (PLGA), polylactide (PLA), polyglycolide (PG), polyethylene glycol (PEG) conjugates of poly(alpha-hydroxy acids), polyorthoesters, polyaspirins, polyphosphagenes, collagen, starch, chitosans, gelatin, alginates, dextrans, vinylpyrrolidone, polyvinyl alcohol (PVA), PVA-g-PLGA, PEGT-PBT copolymer (polyactive), methacrylates, poly(N- isopropylacrylamide), PEO-PPO-PEO (pluronics), PEO-PPO-PAA copolymers, PLGA-PEO- PLGA, polyphosphoesters, polyanhydrides, polyester-anhydrides, polyamino acids, polyurethane-esters, polyphosphazines, polycaprolactones, polytrimethylene carbonates, polydioxanones, polyamide-esters, polyketals, polyacetals, glycosaminoglycans, hyaluronicacid, hyaluronic acid esters, polyethylene-vinyl acetates, silicones, polyurethanes, polypropylene fumarates, polydesaminotyrosine carbonates, polydesaminotyrosine arylates, polydesaminotyrosine ester carbonates, polydesamnotyrosine ester arylates, polyethylene oxides, polyorthocarbonates, polycarbonates, or copolymers or physical blends thereof or combinations thereof. The biopolymer can provide immediate release or non- immediate (i.e., sustained) release. Examples of suitable sustained-release biopolymers include, but are not limited to, poly(alpha-hydroxy acids), poly(lactide-co-glycolide) (PLGA), polylactide (PLA), polyglycolide (PG), polyethylene glycol (PEG) conjugates of poly(alpha-hydroxy acids), polyorthoesters, polyaspirins, polyphosphagenes, collagen, starch, chitosans, gelatin, alginates, dextrans, vinylpyrrolidone, polyvinyl alcohol (PVA), PVA-g-PLGA, PEGT-PBT copolymer (polyactive), methacrylates, poly(N-isopropylacrylamide), PEO-PPO-PEO (pluronics), PEO-PPO-PAA copolymers, PLGA-PEO-PLGA, or combinations thereof.
[0075] Other suitable formulations may be found in, among others, Remington's Pharmaceutical Sciences, 23rdEd., Academic Press, 2020 (ISBN: 9780128200070) and Handbook of Pharmaceutical Excipients, 9th Ed., American Pharmaceutical Association, 2000 (ISBN: 9780857113757); hereby incorporated by reference in their entirety. The pharmaceutical compositions described herein can be made in a manner well known to those skilled in the art (e.g., by means conventional in the art, including mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes).
[0076] An octadecanoid composition can be formulated in or as a foodstuff, food product, functional food or other comestible, or a nutraceutical. The foodstuff, food product, functional food or nutraceutical can include about 0.1 mg to about 10 g, about 1 to 5000 mg, about 10 to 2000 mg, about 30 to 1800 mg, about 50 to 1500 mg, about 100 to 900 mg, or about 300 to about 700 mg of 10-HSA or other octadecanoid or intermediate of C-l 8 fatty acid metabolism of a gastrointestinal microbe, or a derivative or salt thereof, or any value or subrange thereof. The dosage can vary broadly, depending upon the desired effects and the therapeutic indication, such as a therapeutic indication having assayable marker values for one or more of the conditions, diseases or disorders described below. In certain embodiments, a dosage can be based upon the surface area or weight of an individual (e.g., subject or patient), as understood by those of skill in the art. The exact dosage can be determined on a case-by- case basis. In certain embodiments, the exact dosage can be determined by the subject using their own informed discretion.
[0077] Dosage amount and interval may be adjusted to an individual subject to provide sufficient octadecanoid (e.g., 10-HSA) to achieve or maintain predetermined parameters, indicators, or marker values, or minimal effective concentration. Dosages necessary to achieve the desired result will depend on individual characteristics and route of administration.
[0078] Foodstuffs, food products, functional foods or other comestibles including 10- HSA, an octadecanoid or intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, or derivative or salt thereof as an active agent are provided. In certain embodiments, an amount of the active agent in the foodstuff has been fortified (e.g., enriched or concentrated) as compared to an unfortified foodstuff. The active agent can be added to foodstuffs for consumption by a subject. The active agent can be integrated into one or more ingredients of a foodstuff. The active agent can be added to the food stuff prior to preparation, during preparation, or following preparation. Preparation can include cooking, mixing, flavoring, seasoning, blending, boiling, frying, baking, or other processes known in the art. Fortification can provide the active agent at a level that provides a therapeutic daily dosage of 10-HSA, an octadecanoid or intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, or derivative or salt thereof as described elsewhere herein. Beneficial effects of 10-HSA, an octadecanoid or intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, or derivative or salt thereof can be obtained at amounts below these daily dosages.
[0079] An octadecanoid or intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe as provided herein may be present as a constituent of a foodstuff by altering the metabolic processes of a plant, animal, bacteria, or fungus. In certain embodiments, genetic alteration of a plant, animal, bacteria, or fungus can be employed to increase the concentration of an odd chain fatty acid, or a salt or derivative an intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, or derivative or salt thereof. By way of example, the intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe, e.g., 10-HSA, or derivative or salt thereof can be present in a foodstuff in a concentration of at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, or higher, for example, 1% to 2% or 3% or 4% or 5% or 6% or 7% or 8% or 9% or 10% or 20% or 30% or 40% or 50%.
[0080] A food product can include edible material of one or more macronutrients (e.g., protein, carbohydrate and / or fat used in the body of an organism to sustain growth, repairbreakdown, aid vital processes or furnish energy) and / or one or more micronutrients such as vitamins or minerals, or additional dietary ingredients. A food product can be solid or liquid (e.g., a beverage). Non-limiting examples of food products into which an octadecanoid composition may be incorporated include snack bars, cereals, confectionery, meal replacement beverages, dry drink mixes, etc. A liquid food product can include at least 1 pM, at least 5 pM, at least 10 pM, at least 50 pM, at least 100 pM, at least 200 pM, at least 300 pM, at least 500 pM, or greater of an octadecanoid.
[0081] A nutraceutical can include a food ingredient, food supplement or food product that is considered to provide a medical or health benefit, including the prevention and treatment of disease or condition. In one or more embodiments, a nutraceutical includes one or more micronutrients (e.g., vitamins, minerals, herbs and phytochemicals) which can be present at a higher level than would be found in a corresponding non-nutraceutical food product. A level of micronutrient can be selected based on an intended health benefit when consumed in a single serving or as part of a diet regimen or course of nutritional therapy.
[0082] A functional food can include a food that is marketed as providing a health benefit beyond that of sustenance to the consumer. In one or more embodiments, a functional food includes one or more (e.g., vitamins, minerals, herbs and phytochemicals) which confer a specific health benefit other than a nutritional effect.Combination products
[0083] The present disclosure describes combination products including a therapeutically effective amount of a hydroxylated fatty acid, such as 10-HSA or other octadecanoid (an octadecanoid component), as described above and one or more additional active agents (an additional active agent component). A combination product can have two or more independent modes of action. The independent modes of action can provide a therapeutic benefit via different pathways, or via the same pathway. The independent modes of action can treat one or more diseases or symptoms, directly or indirectly. For example, first mode of action can treat a disease (e.g., by eliminating or preventing the spread of an infection) and a second mode of action can treat a symptom of the disease (e.g., by repairing damaged tissue). In some cases, the octadecanoid component provides a primary mode of action, and the additional active agent component provides a supplemental mode of action, which supports the primary mode of action. In some cases, the additional active agent component provides a supplemental mode of action, and the octadecanoid component provides a primary mode ofaction. The primary and supplemental modes of action can involve the same therapeutic pathways or different pathways. A combination product can include a single-entity combination product (e.g., where the components are physically, chemically, or otherwise combined, such as in a unitary dosage form) or a co-packaged combination product (e.g., where the components physically and chemically separate components are packaged together, such as in separate dosage units). Within a co-packaged combination product, the octadecanoid component can be present in one dosage form and the additional active agent component can be present in a second dosage form. A first and second dosage form can be formulated for administration by the same route or by different routes, as described above.
[0084] A combination product can achieve an additive therapeutic outcome, such as the independent modes of action described above. An additive effect may be attained when the components are: (1) co-formulated and administered or delivered simultaneously (e.g., coadministered); (2) delivered in parallel or serially as separate formulations; or (3) by some other regimen.
[0085] A combination product can achieve a more than additive therapeutic outcome, such as a synergistic effect. A synergistic effect may be attained when the components are: (1) co-formulated and administered or delivered simultaneously (e.g., co-administered); (2) delivered in parallel or serially as separate formulations; or (3) by some other regimen.
[0086] Examples of suitable additional active agents include compounds for treating or managing irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), short bowel syndrome (SBS), celiac disease, small intestinal bacterial overgrowth (SIBO), gastroenteritis, leaky gut syndrome, gastric lymphoma, and bacterial, viral, or parasitic infection or overgrowth.
[0087] In certain embodiments, an additional active agent includes an antimicrobial (e.g., antibiotic), probiotic or prebiotic agent. An antimicrobial agent can be synthetic or isolated from a natural source. Exemplary antibiotic agents include, without limitation, nitroimidazoles, macrolides and beta-lactams, such as 2, 4- and 5-nitroimidazoles, metronidazole (Flagyl), tinidazole, nimorazole, dimetridazole, 6-Amino PA824, omidazole, megazol, and azanidazole, benznidazole, Azithromycin, Clarithromycin, Erythromycin, Fidaxomicin, and Telithromycin, amphotericin B, nystatin, penicillin derivatives (penams), cephalosporins (cephems), monobactams, and carbapenems.
[0088] In certain embodiments, an additional active agent includes a PPAR agonist, nonlimiting examples of which include agonists of PPARa, PPARy, and PPAR / 8, such asThiazolidinediones (e.g., Rosiglitazone, Pioglitazone, and Lobeglitazone), Fibrates (e.g., fenofibrate, ciprofibrate, clofibrate, and gemfibrozil), Polyunsaturated fatty acids (PUFAs) (e.g., docosahexaenoic acid and eicosapentaenoic acid), luteolin, rosmarinic acid, cinnamaldehyde, cinnamic acid, and resveratrol. IN some cases, the additional active agent is a PPARy, and / or PPAR / 8 agonist, a PPARa, and / or PPAR / 8 agonist, or a PPAR / 8 agonist.
[0089] In certain embodiments, an additional active agent includes an immune suppressive agent, such as, but not limited to glucocorticoids, cytostatic agents, antibodies, and therapeutic compounds acting on immunophilins.
[0090] In certain embodiments, an additional active agent includes an antiviral agent, such as an anti-retroviral agent and / or an immunomodulatory peptide. An antiviral agent can include an antibody, such as an anti-HIV antibody, broadly neutralizing monoclonal antibodies (bNAbs), and monoclonal antibodies, 3BNC117 and 10-1074.
[0091] An additional active agent component can include one or more antiviral compounds (e.g., 2, 3, 4, 5, or more antiviral compounds), such as one or more nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, and combinations thereof. For example, the additional active agent component can include a suppressive antiretroviral therapy (ART) or highly active antiretroviral therapy (HAART) medication regimen used to manage and treat HIV-1, including several active agents in the antiretroviral classes of medications.
[0092] Anti-retroviral agents can include one or more latency-reversing agents. Nonlimiting examples include crotonylation-inducing agents, such as sodium crotonate, crotonyl- coenzyme A (crotonyl-CoA), an agent that can activate a crotonyl-CoA converting enzyme, such as acyl-CoA synthetase short chain family member 2 (ACSS2), or an acetyl transferase, such as p300 / CREB binding protein (CBP) and / or Males-absent On the First (MOF) acetyl transferase, a histone deacetylase (HDAC) inhibitor, such as suberanilohydroxamic acid (SAHA), suberoyl bis-hydroxamic acid (SBHA), trichostatin A (TSA), scriptaid, oxamflatin, givinostat (ITF2357), belinostat (PXD101), droxinostat, romidepsin, panobinostat, CG05 / CG06, valproic acid (VP A), sodium butyrate, and apicidin, a protein kinase C (PKC) agonist, such as ingenol-3-angelate (PEP005), 12-deoxyphorbol-13-acetate (prostratin), bryostatin-1, or an analog thereof. A crotonylation-inducing agent included in an additional agent component can have a different mode of action than 10-HSA, or other octadecanoid as described above. For example, 10-HSA, or other octadecanoid can target gut repair regulatorymechanisms without reversing latency, and a crotonylation-inducing agent can increase cellular crotonyl-CoA levels.
[0093] Reverse transcriptase inhibitors can include one or more nucleoside / nucleotide reverse transcriptase inhibitors. A nucleoside / nucleotide reverse transcriptase inhibitor can be a cyclic or acyclic nucleoside or nucleotide analog, non-limiting examples of which include azidothymidine and its derivatives (e.g., AZT, Zidovudine), (2R,cis)-4-amino-l-(2- hydroxymethyl-l-l-oxathiolan-5-yl)-(lH)-pyrimidine-2-one (i.e., Lamivudine), 2', 3'- dideoxyinosine (didanosine), 2', 3 '-dideoxycytidine (i.e., Zalcitabine), 2',3'-didehydro-3'- deoxythymidine (i.e., stavudine), (lS,cis)-4-[2-amino-6-(cyclopropylamino)-9H-purin-9-yl]- 2-cyclopentene-l -methanol sulfate (i.e., abacavir), (-)-beta-2',3'-dideoxy-5-fluoro-3'- thiacytidine (i.e., emtricitabine), and phosphonate 9-R-(2-phosphonomethoxypropyl)adenine (i.e., PMPA; tenofovir disoproxil fumarate; adefovir) and various derivatives thereof.
[0094] Non-limiting examples of non-nucleoside reverse transcriptase inhibitors (NNRTIs) can include l l-cyclopropyl-5,l l-dihydro-4-methyl-6H-dipyrido-[3,3-b- 2',3'-][l,4]diazepin-6-one (i.e., Nevirapine); piperazine, l-[3-[(l-methyl-ethyl)amino]-2- pyridinyl]-4-[[5-[(methylsulfonyl)amino]- lH-indol-2-yl] carbonyl]-, monomethane sulfonate (i.e., Delavirdine); (S)-6-chloro-4-(cyclopropylethynyl)-l ,4-dihydro-4-(trifluoromethyl)-2H- 3,l-benzoxazine-2-one (i.e., Efavirenz), quinazolinone and its derivatives, e.g., trifluoromethyl-containing quinazolin-2(lH)-ones; calanolide A; and 6-arylmethyl-l- (ethoxymethyl)-5 -alkyluracil (i.e., emivirine) and its analogs.
[0095] Non-limiting examples of protease inhibitors can include indinavir, saquinavir (fortovase), ritonavir, nelfmavir, amprenavir, and lopinavir.
[0096] Non-limiting examples of integrase inhibitors can include small molecule inhibitors or peptide inhibitors, integramycin; diketo derivatives; polyhydroxylated styrylquinolines; and cyclodidemniserinol trisulfate; linear peptide inhibitors; cyclic peptide inhibitors; and antibodies that bind and inhibit integrase activity.
[0097] Non-limiting examples of virus absorption inhibitors can include cosalane derivatives, pentafuside (T-20); T-1249, a derivative of T-20; betulinic acid; antagonists of viral co-receptors CXCR4 and CCR5; bicyclam derivatives; peptide inhibitors, for example ([Tyr5,12,Lys7]-polyphemusin II and its analogs, and N-a-acetyl-nona-D-arginine (Arg) amide; distamycin analogs, 2,2'[4,4'-[[aminocarbonyl]amino]bis[N,4'-di[pyrrole-2- carboxamide-l,l'-dimethyl]]-6,8 napthalenedisulfonic acid]hexasodium salt; l-[(2,4- dimethyl-3-pyridinyl)carbonyl]-4-methyl-4-[3(S)-methyl-4-[l (S)-[4-(trifluoromethyl)phenyl]ethyl]-l-piperazinyl]-piperidine Nl-oxide; SCH-C; TAK-779; and antibodies to CCR5. Non-limiting examples of transcription inhibitors include bistriazoloacridone analogs (i.e., temacrazine (l,4-bis[3-(6-oxo-6H-v-triazolo[4,5,l- de]acridin-5-yl)amino-propyl]piperazine); and cyclin dependent kinases such as flavopiridol and roscovitine.
[0098] In certain embodiments, a combination product can include one or more of the following antiviral agents, or formulations thereof: 5,6 dihydro-5-azacytidine, 5-aza 2'deoxycytidine, 5 -azacytidine, 5-yl-carbocyclic 2 '-deoxyguanosine (BMS200,475), 9 (arabino furanosyl)guanine; 9-(2' deoxyribofuranosyl)guanine, 9-(2 '-deoxy 2'fluororibofuranosyl)-2,6-diaminopurine, 9-(2'-deoxy 2'fluororibofuranosyl)guanine, 9-(2'- deoxyribofuranosyl)-2,6 diaminopurine, 9-(arabinofuranosyl)-2,6 diaminopurine, Abacavir, Ziagen ®, Acyclovir, ACV; 9-(2-hydroxyethoxylmethyl)guanine, Adefovir dipivoxil, Hepsera ®, amdoxivir, DAPD, Amprenavir, Agenerase ®, araA; 9- -D- arabinofuranosyladenine (Vidarabine), atazanivir sulfate (Reyataz ®), AZT; 3'-azido-2',3'- dideoxythymdine, Zidovudine, (Retrovir®), BHCG; (.+-. )-(la,2b,3a)-9-[2,3- bis(hydroxymethyl)cyclobutyl]guanine, BMS200,475; 5-yl-carbocyclic 2 '-deoxy guanosine, Buciclovir; (R) 9-(3,4-dihydroxybutyl)guanine, BvaraU; l-P-D-arabinofuranosyl-E-5-(2- bromovinyl)uracil (Sorivudine), Calanolide A, Capravirine, CDG; carbocyclic 2'- deoxyguanosine, Cidofovir, HPMPC; (S)-9-(3-hydroxy-2-, phosphonylmethoxypropyl)cytosine, Clevudine, L-FMAU; 2'-Fluoro-5-methyl-P-L-arabino- furanosyluracil, Combivir ® (lamivudine / zidovudine), Cytallene; [l-(4'-hydroxy-l',2'- butadienyl)cytosine], d4C; 3'-deoxy-2',3'-didehydrocytidine, DAPD; (-)-P-D-2,6- diaminopurine dioxolane, ddA; 2',3'-dideoxyadenosine, ddAPR; 2,6-diaminopurine-2',3'- dideoxyriboside, ddC; 2',3'-dideoxycytidine (Zalcitabine), ddl; 2',3'-dideoxyinosine, didanosine, (Videx ®, Videx ® EC), Delavirdine, Rescriptor ®, Didanosine, ddl, Videx ®; 2', 3 '-dideoxyinosine, DXG; dioxolane guanosine, E-5-(2-bromovinyl)-2'-deoxyuridine, Efavirenz, Sustiva ®, Enfuvirtide, Fuzeon ®, F-ara-A; fluoroarabinosyladenosine (Fludarabine), FDOC; (-)-P-D-5 -fluoro- 1 -[2-(hydroxymethyl)- 1 ,3-dioxolane]cytosine, FEAU; 2'-deoxy-2'-fluoro-l-P-D-arabinofuranosyl-5-ethyluracil, FIAC; l-(2-deoxy-2-fluoro- P-D-arabinofuranosyl)-5-iodocytosine, FIAU; 1 -(2-deoxy-2-fluoro-P-D-arabinofuranosyl)-5- iodouridine, FLG; 2',3'-dideoxy-3'-fluoro-guanosine, FLT; 3 '-deoxy-3 '-fluorothymidine, Fludarabine; F-ara-A; fluoroarabinosyl-adenosine, FMAU; 2'-Fluoro-5-methyl-P-L-arabino- furanosyluracil, FMdC, Foscamet; phosphono-formic acid, PFA, FPMPA; 9-(3-fluoro-2-phosphonylmethoxypropyl)adenine, Gancyclovir, GCV; 9-(l,3-dihydroxy-2- propoxymethyl)guanine, GS-7340; 9-[R-2-[[(S)-[[(S)-l-(isopropoxycarbonyl) ethyl]amino]- phenoxyphosphinyl]methoxy]propyl]adenine HP MPA; (S)-9-(3-hydroxy-2- phosphonylmethoxypropyl)adenine HPMPC; (S)-9-(3-hydroxy-2- phosphonylmethoxypropyl) cytosine (Cidofovir), Hydroxyurea, Droxia ®, Indinavir, Crixivan ®, Kaletra ® (lopinavir / ritonavir), Lamivudine, 3TC, Epivir™; (2R, 5S, cis)-4- amino-l-(2-hydroxymethyl-l,3-oxathiolan-5-yl)-(lH)-pyrimidin-2-oneL-d4C; L-3'-deoxy- 2', 3 '-didehydrocytidine L-ddC; L-2',3'-dideoxycytidine L-Fd4C; L-3'-deoxy-2',3'-didehydro- 5-fluorocytidine, L-FddC; L-2',3'-dideoxy-5-fluorocytidine, Lopinavir, Nelfmavir, Viracept ®, Nevirapine, Viramune ®, Oxetanocin A; 9-(2-deoxy-2-hydroxymethyl-P-D- erythro-oxetanosyl)adenine, Oxetanocin G; 9-(2-deoxy-2-hydroxymethyl-P-D-erythro- oxetanosyl)guanine, Penciclovir, PMEDAP; 9-(2-phosphonylmethoxyethyl)-2,6- diaminopurine, PMPA, tenofovir; (R)-9-(2-phosphonylmethoxypropyl)adenine, PPA; phosphonoacetic acid, Ribavirin; l-P-D-ribofuranosyl-l,2,4-triazole-3-carboxamide, Ritonavir, Norvir ®, Saquinavir, Invirase ®, Fortovase ®, Sorivudine, BvaraU; 1-P-D- arabinofuranosyl-E-5-(2-bromovinyl)uracil, Stavudine, d4T, Zerit ®; 2',3'-didehydro-3'- deoxythymidine, Trifluorothymidine, TFT; Trifluorothymidine, Trizivir ® (abacavir sulfate / lamivudine / zidovudine), Vidarabine, araA; 9-P-D-arabinofuranosyladenine, Zalcitabine, Hivid ®, ddC; 2', 3 '-dideoxycytidine, Zidovudine, AZT, Retrovir ®; 3'-azido- 2',3'-dideoxythymdine, Zonavir; and 5-propynyl-l-arabinosyluracil, for example.
[0099] An antiviral immunomodulatory peptide can be a peptide effective for inhibiting the cellular production of inflammatory cytokines including, e.g., tumor necrosis factor-a (TNF-a), interferon-y (INF-y), interleukin (IL)-l, and IL-4 as well as other cytokines, chemokines, hematopoietic growth factors, and the like. In certain embodiments, the additional active agent can include IL -22 (e.g., recombinant fusion protein consisting of human cytokine IL -22 fused to a human immunoglobulin G2 (IgG2)-Fc).
[0100] An additional active agent can include one or more probiotics, e.g., live microorganisms, such as a live bacterial culture intended to provide health benefits when ingested or applied to a subject’s body. Non-limiting examples of probiotic agents include lactobacillus species such as lactobacillus casei, lactobacillus plantarum, lactobacillus acidophilus, and lactobacillus rhamnosus, and other lactic acid-producing bacteria such as Bifidobacterium species.
[0101] An additional active agent can include one or more prebiotics, e.g., dietary fiber or complex carbohydrates that promote the growth of beneficial microorganisms in or on a subject’s body. Non-limiting examples of prebiotics are resistant starch, fructooligosaccharides, galacto-oligosaccharides, xylo-oligosaccharides, polydextrose, lactulose, inulin, soluble fiber (e.g., psyllium husk or acacia fibers), lignin, cellulose, hemicelluloses, 0- glucans, pectin, gums, and dextrin.
[0102] An additional active agent can include one or more substrates of an enzyme expressed by a probiotic bacterium, and / or a cofactor thereof. In certain embodiments, the substrate is an enzyme that hydrates an unsaturated fatty acid, such as a fatty acid hydratase. In some embodiments the enzyme is an oleate hydratase. Non-limiting examples of substrates of fatty acid hydratases include myristoleic acid, palmitoleic acid, oleic acid, ricinoleic acid, linoleic acid, alpha-linolenic acid, gamma-linoleic acid, pinolenic acid, stearidonic acid, vaccenic acid ((Z)- 11 -octadecenoic acid), aquilegic acid ((5E,9Z,12Z)-octadecatrienoic acid), (Z)l 1,14-eicosadienoic acid, mead acid ((Z)-5,8, 11 -eicosatrienoic acid), (Z)5, 11,14- eicosatrienoic acid, dihomo-y-linolenic acid ((Z)-8,l l,14)-eicosatrienoic acid), (Z)- 11 , 14, 17- eicosatrienoic acid, arachidonic acid ((Z)-5,8,l 1,14-eicosatetraenoic acid), docosahexaenoic acid ((Z)-4,7,10,13,16,19-docosahexaenoic acid).
[0103] An additional active agent can include a lipid, a fat, a fatty acid, or a derivative thereof. Non-limiting examples include fish oils, microbial oils, milk fat, plant oils (e.g., palm olein, high oleic sunflower oil, castor oil, and high oleic safflower oil), linoleic acid, alphalinolenic acid, arachidonic acid, and docosahexaenoic acid. The lipid, fat, fatty acid, or derivate thereof can be from any source (e.g., a natural source, of from semi-synthetic or synthetic sources, and mixtures of these). In certain embodiments, the additional active agent is a fatty acid or derivative thereof. As used herein, the term “fatty acid” refers to a family of carboxylic acids having a saturated or unsaturated hydrocarbon chain of about 4 to about 28 carbons in length and is intended to include carboxylic acid salt forms. A fatty acid active agent can be an odd chain or even chain fatty acid, or mixture thereof. In some cases the fatty acid or derivative thereof is a short chain fatty acid or derivative thereof selected from butyrate, isobutyrate, propionate, acetate, tributyrin, pivaloyloxymethyl butyrate, and monoacetone glucose 3-butyrate. In certain embodiments, the fatty acid or derivative thereof is a medium chain fatty acid having a saturated or unsaturated hydrocarbon chain of from about 6 to 10 carbons in length. Examples include capric acid, caprylic acid, and hexanoic acid. Derivatives can include esters (tri-, di-, monoglyceride esters). In certain embodiments, the fatty acid orderivative thereof is a long chain fatty acid between 12 and 28 carbons in length, and can be unsaturated. For example, an unsaturated fatty acid can be selected from monounsaturated fatty acids and polyunsaturated fatty acids (PUFAs), including omega-3 fatty acids, (e.g., alphalinolenic acid (octadeca-9,12,15-trienoic acid), stearidonic acid (octadeca-6,9,12,15-tetraenoic acid), eicosapentaenoic acid (eicosa-5,8,l l,14,17-pentaenoic acid; “EP A”), docosapentaenoic acid (docosa-7,10,13,16,19-pentaenoic acid), eicosatetraenoic acid (eicosa-8,11,14,17- tetraenoic acid), and docosahexaenoic acid (docosa-4,7,10,13,16,19-hexaenoic acid; “DHA”)), omega-6 fatty acids (e.g., linoleic acid (9,12-octadecadienoic acid), gamma-linolenic acid (6,9,12-octadecatrienoic acid; GLA), eicosadienoic acid (11,14-eicosadienoic acid), dihomogamma-linolenic acid (8,11,14-eicosatrienoic acid), arachidonic acid (5,8,11,14- eicosatetraenoic acid), docosadienoic acid (13,16-docosadienoic acid), adrenic acid (7,10,13,16-docosatetraenoic acid), docosapentaenoic acid (4,7,10,13,16-docosapentaenoic acid), and calendic acid (8E,10E,12Z-octadecatrienoic acid)), omega-9 fatty acids (e.g., oleic acid (cis-9-octadecenoic acid); eicosenoic acid (cis-11-eicosenoic acid); mead acid (all-cis- 5,8,11 -eicosatrienoic acid); erucic acid (cis-13-docosenoic acid); and nervonic acid (cis-15- tetracosenoic acid)).
[0104] A combination product described herein can be made in a manner well known to those skilled in the art which can be found in, among others, Remington's Pharmaceutical Sciences, 23rdEd., for example.Methods of Use
[0105] In one aspect, embodiments of the present disclosure describe a method comprising using an octadecanoid or intermediate of C- 18 fatty acid metabolism as described herein (e.g., 10-hydroxystearic acid) or a derivative or a salt thereof to supplement a human diet at a level sufficient to treat a symptom of metabolic syndrome. For example, the method can include incorporating 10-HSA into a supplement, providing 10-HSA for manufacture of the supplement, manufacturing the supplement, packaging the supplement, marketing the supplement and / or otherwise providing the supplement for use treating a symptom of metabolic syndrome in a human. The supplement can be selected from the group consisting of a food additive, food fortifier, beverage additive, beverage fortifier, or pharmaceutical. The level sufficient to treat a symptom of metabolic syndrome can be from about 0.01 mg or less to about 10000 mg or more per unit supplement, such as, from about 1 mg to about 5000 mg, from about 5 mg to about 2000 mg, from about 10 mg to about 1000 mg, or from about 50 mgto about 500 mg. The level sufficient to treat a symptom of metabolic syndrome can be based upon a single supplement or a series of two or more given in the course of one or more days, as is appropriate for the individual subject. In some embodiments, the supplement will be ingested over a period of continuous therapy, for example for about a week or more, for several weeks, for about a month or more, for about a year or more. In some embodiments, the supplement will be ingested one time per day, two times per day, three times per day, or more. Symptoms of metabolic syndrome are described below.
[0106] In certain embodiments, 10-HSA, the derivative thereof, or the salt thereof can be incorporated into a pharmaceutical that is formulated as a tablet, an encapsulated pill, a gelcap pill, a liquid suspension, a spray, or a powder. For example, the method can include incorporating 10-HSA into a pharmaceutical formulation, providing 10-HSA for manufacture of the pharmaceutical, manufacturing the pharmaceutical, packaging the pharmaceutical, marketing the pharmaceutical and / or otherwise providing the pharmaceutical for use treating a symptom of metabolic syndrome in a human. The pharmaceutical compositions disclosed herein may be manufactured by any known process, e.g., by means of conventional mixing, dissolving, granulating, dragee -making, levigating, emulsifying, encapsulating, entrapping, tableting, or extracting processes. Many of the compounds used in the pharmaceutical combinations disclosed herein may be provided as salts with pharmaceutically acceptable counterions.Methods of Treatment
[0107] Aspects of the disclosure include methods of treating mucosal dysfunction or an illness, disease, disorder, or condition associated with mucosal dysfunction by administering an octadecanoid composition, as described above, to a subject in need of such treatment. In certain embodiments, the method includes administering the octadecanoid composition as part of a combination product, as described above. Treating can include managing or alleviating one or more symptoms of an illness, disease, disorder, or condition occurring in the subject, e.g., by inhibiting the illness, disease, disorder, or condition, impeding its progress; or causing regression of the illness, disease, disorder and / or condition. Treating the illness, disease, disorder, or condition can include ameliorating at least one symptom of the particular illness, disease, disorder, condition by administering an octadecanoid composition as described above, to a subject in need thereof.
[0108] In certain embodiments, methods of treating mucosal dysfunction or an illness, disease, disorder, or condition associated with mucosal dysfunction by administering an octadecanoid composition, as described above, to a subject in need of such treatment can include prevention or inhibition of one or more symptoms of an illness, disease, disorder, or condition occurring in the subject, e.g., by preserving and / or maintaining the health of a subject at risk for developing or worsening of at least one symptom of the particular illness, disease, disorder, condition associated with mucosal dysfunction. In certain embodiments, a prophylactic method of the present disclosure includes supplementing the human diet to provide a prophylactic benefit for a subject at risk of dysbiosis, microbially-mediated mucosal dysfunction, or mucosal dysfunction mediated by a toxin (e.g., a food-bome toxin such as alflatoxin) whereby one or more of the sequelae of infection, inflammation, or poisoning on mucosa are prevented or inhibited.
[0109] Multiple techniques of administering an octadecanoid composition of the present disclosure. In certain embodiments, administering includes one or more of oral, rectal, topical, aerosol, injection and parenteral delivery, including intramuscular, subcutaneous, intravenous, intramedullary injections, intrathecal, direct intraventricular, intraperitoneal, intranasal and intraocular injections, or other methods as would be known to one of ordinary skill in the art.
[0110] In certain embodiments, administering an octadecanoid composition of the present disclosure can include[OHl] Non-limiting examples of an illness, disease, disorder, or condition associated with mucosal dysfunction can include chronic inflammatory reactions, autoimmune reactions, infections (e.g. bacterial, viral or parasitic), bowel resection, chronic diarrhea, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), viral or parasitic overgrowth (e.g., dysbiosis, short bowel syndrome (SBS), and small intestinal bacterial overgrowth (SIBO)), celiac disease, gastroenteritis, increased intestinal permeability (“leaky gut syndrome”), malabsorption syndromes, and gastrointestinal lymphoma.
[0112] Bacterial infection or overgrowth can include infection by or overgrowth of a pathogenic bacterium such as, but not limited to Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bacillus spp., or drug-resistant bacteria such as Carbapenem-resistantEnterobacteriaceae (CRE), extended spectrum beta-lactam resistant Enterococci (ESBL), and vancomycin-resistant Enterococci (VRE).
[0113] Gastroenteritis can include inflammation resulting from ingestion of one or more drugs or toxins, such as metals or plant substances (e.g., aflatoxin).
[0114] Gastrointestinal lymphomas can include, but are not limited to, primary GI tract lymphomas such as mucosa-associated lymphoid tissue (MALT) lymphoma in stomach, mantle cell lymphoma in terminal ileum, jejunum, and colon, enteropathy-associated T-cell lymphoma in jejunum, and follicular lymphoma in duodenum.
[0115] According to certain embodiments, a method of the present disclosure includes treating a mucosal dysfunction mediated by an infection, antigen, and / or toxin. An infection can be a viral infection. Non-limiting examples of viruses associated with mucosal dysfunction include norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV). An antigen can include a food antigen, for example, one or more antigens from peanuts, tree nuts, shellfish, eggs, milk proteins, and wheat.
[0116] In certain embodiments, administering a therapeutically effective amount of a composition described above can reduce or alleviate the mucosal dysfunction caused by HIV infection, such as gastrointestinal dysfunction experienced by patients suffering from AIDS. Reducing or alleviating gastrointestinal dysfunction in the context of HIV infection and AIDS includes, as non-limiting examples, reduction in clinical manifestations such as diarrhea, rectal bleeding, malabsorption, abdominal pain, weight loss, fever, anemia, fecal occult blood, fecal leukocytes, and histological indications such as crypt abscesses, leukocyte infiltration, cell apoptosis, transmural granulomatous inflammation, superficial mucosal and submucosal inflammation, changes in levels of biochemical and molecular markers associated with intestinal inflammation including, but not limited to, increase in pro-inflammatory cytokines (e.g., TNF-a, interferon-y, 11-1, IL-6, IL-12, etc.), changes in enzyme markers of leukocyte activation (e.g., myeloperoxidase, COX-2 expression, iNOS expression, etc.), cellular apoptosis (e.g., DNA fragmentation, caspase activation, etc.), and others known in the art. An indication of reduction in gastrointestinal dysfunction, can be demonstrated by one or more of clinical observations, histological indications, and molecular / biochemical markers. In certain embodiments, a patient in need of such treatment is currently undergoing treatment with one or more antiviral agents or regimens, and as such, the method improves the therapeuticoutcome of the patient, as compared to a patient who has not received an effective amount of hydroxylated fatty acid.
[0117] According to certain embodiments, a method of treatment includes treating dysbiosis in a subject in need thereof. Dysbiosis can be characterized by a decrease in microbial diversity and increase in proinflammatory species, or an imbalanced microbiota, which is unable to protect a host subject from pathogenic organisms, can trigger inflammation, and / or produce genotoxins or carcinogenic metabolites. Non-limiting examples of treating dysbiosis include promoting the growth of beneficial microbiota in a body canal (e.g., of at least one of the digestive, respiratory, and reproductive systems); inhibiting the growth of detrimental microbiota in a body canal; modifying (e.g., enhancing or restoring) microbiota biodiversity in a body canal; and reducing symptoms of dysbiosis in a subject in need thereof. The body canal can include the gastrointestinal (GI) tract or vagina of the subject. The GI tract can include the entire alimentary canal, from the oral cavity to the rectum, or a portion thereof, e.g., esophagus, stomach, small intestine, large intestine, or rectum. Symptoms of dysbiosis can include but are not limited to, abdominal distension, regular / frequent episodes of diarrhea, frequent stools, recent onset / chronic diarrhea, or diarrhea for 1-3 months, poor tolerance / intolerance of sugars, flatulence, sulfur burps, meal-related bloating, and constant fatigue.
[0118] Treating dysbiosis can be effective for reducing or managing the symptoms of various gastrointestinal (GI) diseases including bacterial infections like H. pylori and C. difficile, small intestinal bacterial overgrowth (SIBO), inflammatory bowel diseases, including ulcerative colitis and Crohn’s disease, general digestive difficulties, like diarrhea, constipation and flatus, in certain embodiments, treating dysbiosis reduces or manages one or more symptoms associated with the immune system, nervous system, and endocrine system. In certain embodiments, treating dysbiosis can be effective for reducing or managing symptoms associated with malnutrition, malabsorption, food intolerances, irritable bowel syndrome (IBS), atherosclerosis, fatty liver disease, metabolic syndrome, chronic inflammation, chronic fatigue, mood disorders, bleeding gums, tooth decay, cavities, atopic dermatitis, acne, painful urination, genital discharge and genital itching.
[0119] In certain embodiments, the present disclosure provides a method of supplementing human diet with an octadecanoid, an intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe as described above (e.g., 10-HSA), or derivative or salt thereof at a level sufficient to treat at least one symptom of metabolic syndrome.Supplementing human diet can include providing an octadecanoid composition as described above for use as a food additive, food fortifier, beverage additive, beverage fortifier, or pharmaceutical (e.g., in a form selected from the group consisting of a tablet, an encapsulated pill, a gelcap pill, a liquid suspension, a spray, and a powder). Supplementing human diet can include administering the octadecanoid or intermediate of C-18 fatty acid metabolism of a gastrointestinal microbe (e.g., 10-HSA), or derivative or salt thereof to a human with a risk factor or marker of metabolic syndrome.
[0120] As described herein, metabolic syndrome generally relates to a cluster of risk factors that are associated with a number of conditions including, but not limited to, diabetes (e.g., type 2 diabetes), hypertension, cardiovascular disease, polycystic ovary syndrome, fatty liver, cholesterol gallstones, asthma, sleep disturbances, some forms of cancer, ischemia, oxidative stress, atherosclerosis, obesity, abnormal lipid metabolism, and stroke. Risk factors of metabolic syndrome can include abdominal (central) obesity, elevated blood pressure, advanced age, and smoking.
[0121] In certain embodiments, a human in need of supplementation can have one or more indicators of metabolic syndrome such as insulin resistance, elevated fasting plasma glucose, glucose intolerance, high serum triglycerides, abnormal serum lipids, decreased high- density lipoprotein (HDL) levels, body mass index (BMI) of 30 kg / m2or higher, Acanthosis nigricans, microalbuminuria (a urinary albumin secretion rate of 20 pg / min or higher, or an albumin-to-creatinine ratio of 30 mg / g), high proinflammatory state, and prothrombotic state. While a cluster of signs and symptoms may present in an individual, in many cases only one or a few symptoms can dominate. Insulin resistance can include impaired glucose metabolism (reduced clearance of glucose and / or the failure to suppress glucose production), the inability to suppress lipolysis in tissues, defective protein synthesis, altered cell differentiation, aberrant nitric oxide synthesis affecting regional blood flow, as well as abnormal cell cycle control and proliferation. Insulin resistance may also be indicated by serum protein concentrations of, for example, fibroblast growth factor 21 (FGF21), total adiponectin, and % unmodified adiponectin. Serum lipid concentrations that may indicate metabolic syndrome and associated conditions include, for example, ceramides, and sphingolipids, for example, sphingosine, dihydrosphingosine, sphingosine- 1 -phosphate, and dihydrosphingosine- 1 -phosphate. Disease symptoms secondary to hyperglycemia or other conditions may also occur in patients with metabolic syndrome. The compounds and methods provided herein are useful for preventionor amelioration of virtually any symptom that may be due to, or exacerbated by, metabolic syndrome and related conditions.
[0122] Beneficial microbiota, e.g., the community of living microorganisms that typically inhabits a bodily organ or part, can include microorganisms of the phyla of Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Synergistetes, Verrucomicrobia, Fusobacteria, and Euryarchaeota,' at genus level the microorganisms of Bacteroides, Lactobacillus, Faecalibacterium, Bifidobacterium, Roseburia, Alistipes, Collinsella, Blautia, Coprococcus, Ruminococcus , Eubacterium and Dorea for example. In some cases, modifying the diversity of gastrointestinal microbiota, including mucosa-associated microbiota, located in or attached to the mucus layer covering the epithelium of the gastrointestinal tract, and luminal-associated microbiota, which is found in the lumen of the gastrointestinal tract eliminates / clears pathogens, changes systemic energy expenditure, restores intestinal mucus layer thickness, decreases inflammation, suppresses destructive inflammation (e.g., unbalanced macrophage inflammatory and pro-resolving functions), increases intestinal epithelium proliferation, decreases apoptosis in villi tips, and / or restores intestinal barrier function.
[0123] According to certain embodiments, a method of the present disclosure includes activating crotonylation- induced gut repair in a subject in need thereof. The subject can be a subject with a viral infection, such as retrovirus infection. Activation can be targeted to specific pathways. For example, activation by administering an octadecanoid composition can target gut repair regulatory pathways without activating pathways that induce viral replication and / or reverse virus latency.
[0124] According to certain embodiments, a method of the present disclosure includes crotonylating histones, repairing mitochondrial functions and / or restoring energy balance in a subject in need thereof. The histone crotonylation can be specific and / or selective, targeted to repair mitochondrial functions and / or restore energy balance in a subject with a retroviral infection (e.g., HIV), without activating pathways that induce viral replication and / or reverse virus latency.
[0125] An octadecanoid composition for use with any method of the present disclosure, includes a therapeutically effective amount of an octadecanoid, intermediate of C- 18 fatty acid metabolism of a gastrointestinal microbe, or hydroxylated fatty acid, such as 10-HSA, as an active agent and a vehicle, which can be formulated as one or more dosage units as described above. A therapeutically effective amount of the active agent can vary according to the subjecttreated (e.g., size, age, severity of the subject’s condition or disease, underlying health, etc.), the form of the composition, and / or the desired therapeutic outcome. In one or more embodiments of the methods described above, a subject receives one or more doses of a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, about 10 mg / kg to about 200 mg / kg, such as approximately 2 mg / kg, 5 mg / kg, 10 mg / kg, 15 mg / kg, 20 mg / kg, 25 mg / kg, 30 mg / kg, 35 mg / kg, 40 mg / kg, 45 mg / kg. , 50 mg / kg, 55 mg / kg, 58 mg / kg, 58.6 mg / kg, 60 mg / kg, 65 mg / kg, 70 mg / kg, 75 mg / kg, 78 mg / kg, 80 mg / kg, 85 mg / kg, 90 mg / kg, 95 mg / kg, 100 mg / kg, 104 mg / kg, 110 mg / kg, 120 mg / kg, 130 mg / kg, 140 mg / kg, 150 mg / kg, 160 mg / kg, 170 mg / kg, 180 mg / kg, 190 mg / kg, or 200 mg / kg. A dose administered to a subject can be, for example, at least about 1 mg / kg, at least about 5 mg / kg, at least about 10 mg / kg, at least about 12.5 mg / kg, at least about 20 mg / kg, at least about 25 mg / kg, at least about 30 mg / kg, at least about 35 mg / kg, at least about 40 mg / kg, at least about 45 mg / kg, at least about 50 mg / kg, at least about 55 mg / kg, at least about 58 mg / kg, at least about 58.6 mg / kg, at least about 60 mg / kg, at least about 75 mg / kg, at least about 78 mg / kg, at least about 100 mg / kg, at least about 104 mg / kg, at least about 125 mg / kg, at least about 150 mg / kg, at least about 175 mg / kg, at least about 200 mg / kg, at least about 300 mg / kg, or at least about 400 mg / kg.
[0126] A subject can receive a hydroxylated fatty acid, such as 10-HSA, or other octadecanoid in at least one dose per day, at least two doses per day, or at least 3 doses per day, or a single daily dose. A hydroxylated fatty acid, such as 10-HSA, or other octadecanoid can be administered in two doses per day, three doses per day, or by continuous infusion. In some cases, one or more doses are administered less frequently than daily, such as on alternating days, according to a weekly regimen, A subject can receive one or more doses per week, for at least one week, one month, or longer (e.g., at least 4 months, at least 5 months, at least 6 months, at least 12 months, or at least 18 months).
[0127] A subject in need of treatment can be any human or non-human animal subject, such as a vertebrate. A subject can be a mammal, including livestock and companion animals. A subject can be a human (e.g., a patient). A subject can be of any age, e.g., an infant, a child, a juvenile, an adolescent, or an adult. The subject can have, be suspected of having, be at risk of developing a disease or condition associated with mucosal dysfunction, or otherwise need or be in need of mucosal repair. In certain embodiments, a method of treatment can include astep of identifying a subject in need of treatment, such as a subject with dysbiosis, or an associated condition, prior to performing a step of administering the composition.
[0128] The Examples that follow are illustrative of specific aspects encompassed by the detailed description, and various uses thereof. The examples are set forth for explanatory purposes, and are not to be construed as limiting the scope of this disclosure as defined by the description and the appended claims.EXAMPLES
[0129] Example I. Bacterial fatty acid sparks mitochondrial repair by PPARa mediated histone crotonylation in the inflamed gut.
[0130] INTRODUCTION
[0131] Persistent viral infections lead to unresolved inflammation and can disrupt gut mucosal microbiota populations. This unchecked inflammation leads to disruption of the interaction between host and commensal microbiota at the mucosal interface further reducing the host’s ability to combat the virus and initiate defense and renewal processes. Suboptimal gut mucosal immune response to chronic viral infections is partially a result of microbial dysbiosis. Commensal bacteria, when present and functional, can provide anti-inflammatory compounds which quell the overactive immune response.
[0132] Viruses like the human immunodeficiency virus (HIV-1), cause of the acquired immunodeficiency syndrome (AIDS) pandemic, leads to immune dysfunction, chronic gut inflammation, and microbial dysbiosis. Gastrointestinal tissue is an early target of HIV infection which leads to rapid disruption of gut epithelial barrier integrity and function resulting in leaky gut, systemic immune activation, and impaired defense against opportunistic pathogens. Gut barrier damage from HIV, indicated by tight junction disruption, persists after successful inhibition of viral replication by antiretroviral treatment (ART) demonstrating the need for supplemental treatments.
[0133] Simian immunodeficiency virus (SIV) infected non-human primate model of AIDS has validated the early pathogenic effects of the virus on the gut epithelial barrier disruption which precedes immunodeficiency. Tight junction proteins ZO-1, Claudin, and Occludin provide a seal against gut luminal contents and antigens traversing between enterocytes and into the blood and provide a key indicator of gut mucosal health. HIV infection has been shown to damage the integrity of these proteins which leads to an increase in antigenic translocation and severe damage of normal gut function due to leaky gut. This disruption has been linked to mitochondrial and energy pathway damage incurred by thevirus. Direct localized treatment with Lactobacillus plantarum has been shown to repair gut barrier integrity in SIV through bolstering mitochondrial functionality. These results highlight the need for a combination treatment approach that includes targeting both the viral replication as well as the mucosal tissue repair pathways.
[0134] Treating HIV induced gut dysfunction is a continuous topic of research with one of the primary goals being to promote and maintain gut epithelial integrity. Cytokine and growth factor treatments have shown lackluster results, even potentially prolonging active HIV infection. Orally administered live probiotics have been used with mixed results, but overall, most treatments thus far fail to traffic directly to the site of inflammation and cause rapid local repair in vivo. Treatment of HIV induced gut damage relies on identifying key pathways and proteins that can be targeted with specific bioactive molecules. While ART has been shown to be very effective at controlling HIV viral replication, innovative approaches to promote repair pathways in patients is required to induce the required healing ART cannot provide. Metabolites produced by commensal gut bacteria play a key role in maintaining normal gut homeostasis and function. Overall gut health is influenced by the synergistic interactions between the intestinal cells and commensal microbial metabolic products. We have previously shown L. plantarum led to repair through promotion of PPARa controlled mitochondrial bioenergetics and ATP generation. It is known HIV and SIV related mucosal disruption leads to damaged host mitochondrial health through suppression of mitochondrially active genes and slows gut restoration. This mitochondrial dysfunction is not unique to HIV but is also seen in many infectious diseases such as SARS-CoV-2, causative agent of the COVID- 19 pandemic. Disrupting mitochondrial functions is a common mechanism viral pathogens use to circumvent host immunity, detection, and eradication. Recapturing the functionality of the mitochondria in inflammatory conditions is of the upmost importance to repair mucosal immunity that ART alone cannot accomplish.
[0135] The mitochondrially driven rapid restoration of gut epithelial integrity in our previous study impacted multiple repair pathways and metabolic systems in cellularly diverse tissue which led us to hypothesize the repair was occurring in part through epigenetic modifications. Gut epigenetic modification as a result of microbial metabolic postbiotics is a vastly understudied area of research that promises to yield incredible therapeutics. Short chain fatty acids (SCFAs) from Lactobacillus have been shown to positively impact gut health and epithelial integrity. These fatty acids derived from a microbial source show the ability to increase intracellular acetyl-CoA and crotonyl-CoA pools and suppress histonedeacetylases (HDACs) thereby promoting epigenetic modifications to relax chromatin and aid in transcriptional activity of reparative genes. Histone crotonylation has been identified as a potent transcriptional activator and has been shown to activate gene expression to a greater extent than acetylation. Microbiome derived fatty acid postbiotics have been shown to increase histone crotonylation in the mouse colon. Histone crotonylation remains under investigated and may hold the answer to upregulating specific restorative pathways in the virally inflamed gut. Although substantial investigations have focused on probiotic microbes for repairing the damaged gut, our knowledge remains limited on the impact individual bacterial postbiotics have in the restoration of damaged epithelium, mitochondrial function, and epigenetic modifications in the inflamed gut environment.
[0136] Microbially derived bioactive molecules may be superb candidates for combating multiple inflammatory gut diseases as they are naturally occurring and can promote a large variety of repair pathways through epigenetic modulation. One way to test candidates for repair is through determining the effect in multiple similar diseases or conditions. HIV exposure has a large geographical co-incidence with the mycotoxin, Aflatoxin Bl (AFB1), produced by Aspergillus. AFB1 is hepatocarcinogenic and damages the gut epithelial lining in a similar way to HIV. ZO- 1 and tight junction protein disruption is seen in AFB1 poisoned individuals and can exacerbate the leaky gut phenomena seen also in HIV patients with lipopolysaccharide (LPS) and other antigens traversing the mucosal barrier into the blood. AFB1 exposure has also been shown to cause a significant thinning of the gut epithelial tissue in mice and pigs. Gut lining thinning reduces nutrient uptake as well as exposes regenerative crypt cells to hazardous luminal contents, further slowing the repair of the gut lining. AFB1 exposure and HIV have a large geographical co-incidence and can have compounding effects. HIV-induced microbial dysbiosis and immune dysfunction augments the potential exposure and damage of opportunistic food borne pathogens like AFB1. Using AFB1 induced gut damage as a secondary validation for potential HIV gut therapeutics can provide a way to investigate the universality of the treatment.
[0137] Lactobacillus plantarum has the potential to reduce inflammation caused by radical oxygen species (ROS) and pro-inflammatory cytokine production. However, studies pertaining to individual effector molecules and their impact on repair through epigenetic mechanisms have never been done. In our previous study, L. plantarum showed a remarkable ability to repair the damaged gut epithelial lining in vivo through PPARa mediated mitochondrial bioenergetics. In the current study we identified an octadecanoid, 10-hydroxystearic acid (10-HSA), a highly produced microbial fatty acid metabolite of L. plantarum and investigated its effect on the inflamed gut epithelium through the under investigated mechanism of histone crotonylation and PPARa activation leading to mitochondrial repair. We hypothesized it was the primary effector molecule behind the reported therapeutic effects of L. plantarum in the SIV inflamed gut.
[0138] RESULTS
[0139] The findings in this study are supported by an integrated analysis of molecular, epigenomic, transcriptomic, microbiomic, immunohistopathologic and functional data from human gut cells ex vivo and in vitro as well as preclinical non-human primate and mouse models in vivo.
[0140] 1. Hydroxylated fatty acid 10-HSA is a potent activator of PPARa in human gut epithelial cells ex vivo and in vitro.
[0141] Several fatty acids have been reported to activate PPARa translocation to the DNA and induce gene expression. Using protein interaction modeling software, we determined 10-HSA docks with the ligand binding domain of PPARa thereby activating transcriptional activity (FIG. 2A). Two hundred and fifty-six theoretical models were generated, and the image shown represents 10-HSA binding to PPARa with the lowest free energy in the correct binding domain (FIG. 2A). This in silico modeling provides an accurate perspective on how 10-HSA docks and activates PPARa transcriptional activity. We also used in silico docking to model 10-HSA binding of PPARy as well as known PPARa agonist feno fibrate to PPARa (FIG. 8A) Fenofibrate and 10-HSA bind to PPARa in a remarkably similar location which supports the hypothesis that 10-HSA is a likely potent agonist of PPARa (FIG. 8B).
[0142] To validate our in silico findings and to functionally determine if 10-HSA is a ligand for PPAR transcription factors we utilized luciferase gene reporter assays. We found that 10-HSA is a potent activator of both PPARa and PPARy transcriptional activity (FIG. 2B, C). 10-HSA increased PPARa activity above even that of the agonist used as positive control (FIG. 2B). This confirmed that 10-HSA is a potent ligand for the PPAR family of transcription factors, especially PPARa (FIG. 2B, 2C). PPARa is known to control genes involved in regulation of fatty acid B-oxidation in the peroxisome and mitochondria. Long chain fatty acid B-oxidation in peroxisomes releases acetyl-coA and crotonyl-coA and has been directly associated with an increase in epigenetic modifications. The mechanism behind crotonyl-coA synthesis in the B-oxidation pathway is not fully understood, yet it is known to be related tokey genes controlled by PPARa transcription factor activity, namely ACADS and AC0X1-3. Because of the heightened transcriptional capability of crotonylation, due to its significantly lower natural pool in cellular availability, and because of its association with PPARa genes, we used histone crotonylation as a primary measure of determining the epigenetic impact 10- HSA has on the cell and tissue. T o determine if 10-HSA had a dose dependent effect on histone crotonylation, we tested eight concentrations and measured crotonylation on histone 3 lysine 18 (H3K18cr) by immunofluorescence (IF, FIG. 2D). We found that 500pM of 10-HSA induced the most crotonylation after 6 hours of treatment (FIG. 2D).
[0143] We then investigated the ability of 10-HSA to induce transcriptional changes in human gut epithelial cells ex vivo and in vitro. Treating both stem cell derived monolayers ex vivo and Caco2 epithelial cell cultures in vitro with 10-HSA demonstrated consistent upregulation of mRNA for tight junction protein ZO-1 and increased mRNA levels of mitochondrial B-oxidation and biogenesis transcription factors PPARa and PPARy coactivator 1 alpha (PGCla) (FIG. 2E, F). In the stem cell derived monolayers, 10-HSA showed a highly effect on targeted genes compared to sodium crotonate (NaCr), a supplier of non-metabolically derived crotonyl groups, suggesting for the first time that 10-HSA was operating in a highly specific manner, likely through PPARa activation (FIG. 2E). NaCr was used as the positive control for in vitro and ex vivo analysis because we hypothesized the changes seen previously through LP treatment in vivo were being driven by rapid epigenomic modifications and crotonylation was the likely candidate. Furthermore, in both cell models, p62 gene expression showed significant upregulation in 10-HSA treated cells (FIG. 2E, F). This protein is known to increase rates of mitophagy again suggesting a mitochondrial specific mechanism for this metabolite.
[0144] Because of the specificity and targeted ability to activate PPARa transcription factor activity, we hypothesized 10-HSA was inducing histone crotonylation through PPARa mediated upregulation of B-oxidation (FIG. 2G). Our proposed mechanism puts 10-HSA as the catalyst for relaxed chromatin causing an upregulation of mitochondrial genes and tight junction mRNA expression and protein formation (FIG. 2G).
[0145] 2. Hydroxylated fatty acid induced PPARa mediated histone crotonylation enriches mitochondrial energy pathways.
[0146] Previously, we reported repair of the SIV damaged tight junction structure after 5 hours of LP treatment in the non-human primate model of AIDS. To determine how quickly 10-HSA begins to induce crotonylation in the genome, we did time course treatments andmeasured immunofluorescence of H3K18cr given it has been reported as a high-fidelity measure for global crotonylation ex vivo and in vitro (FIG. 3A, FIG. 9A, B, C). Gpl20 + tat HIV proteins repeatedly diminished both genome-wide histone crotonylation and acetylation but after just 5 minutes of 10-HSA co-treatment, crotonylation identified by H3K18cr antibodies began to populate the nucleus in stem cell derived monolayers (FIG. 3A, D, E). Gpl20 + tat proteins are known to damage mitochondrial functionality and increase dysfunction of energy pathways which lessen the ability of the mitochondria to perform its normal B-oxidation and release epigenetically active molecules. Histone acetylation as measured by H3K14ac antibodies occurred after 25 minutes of treatment (FIG. 3D). H3K14ac antibodies were used ex vivo and in vitro to mitigate the risk of any non-specific binding or antibody competition that could result from two H3K18 antibodies being used concurrently. We showed evidence for a positive feedback loop that begins with increased PPARa activation leading to heightened genome wide acetylation and crotonylation after just 35 minutes (FIG. 3A). Histone acetylation and crotonylation in the untreated cells remained relatively constant over the time-course analysis for both Caco2 and the gut epithelial stem cell derived monolayers and reflected the expected ratio of acetyl and crotonyl groups (FIG. 3D, E). Although the role of crotonyl groups in the electron transport chain remain understudied, overall cellular levels of crotonyl-coA are known to be considerably lower than the other short chain acyl-coA groups. This led us to believe the heightened levels of crotonyl groups caused by 10-HSA treatment allowed for quicker translocation to the nucleus from the site of B- oxidation as the threshold for necessary crotonyl groups is lower than acetyl groups in the normal cell.
[0147] To determine if PPARa activation was responsible for the epigenetic changes being observed, we inhibited the transcription factor with a potent antagonist (GW6471) with and without 10- HSA (FIG. 3C, FIG. 10A). After 6 hours of co-treatment, crotonylation was reduced below the already low levels of Gpl20 + tat treatment even with 10-HSA co-treatment (FIG. 3B, C, F). This confirms the proposed mechanism of 10-HSA binding PPARa resulting in histone crotonylation. Curiously, inhibition of PPARa elevated acetylation levels over the Gp 120 + tat control in a non- 10-HSA dependent manner (FIG. 3C, F, FIG. 10A). This suggests a redundant pathway exists enabling the cell to detect inhibition of PPARa and still operate some form of B-oxidation. It is known histone crotonylation is driven largely by the ACSS2, AC ADS, and ACOX 1-3 genes which are integral in B-oxidation. PPARa directly regulates AC ADS and ACOX 1-3 gene transcription and we have shown here inhibition of PPARafunction reduces the ability for the cell to generate crotonyl groups (FIG. 3C). There is no evidence to show any other transcription factor besides PPARa regulates these genes. Genes controlling acetyl-coA production are not as intimately controlled by PPARa. Both PPARy and PPAR8 regulate PDK2, ACLY, UCP2, UPT1, and SLC16A gene expression which has been implicated in acetyl-coA generation and subsequent histone acetylation. Combining what is established with our novel data in this paper illustrate the pathway of crotonyl group generation induced by PPARa activation and how it is uniquely controlled by this transcription factor.
[0148] To conclusively determine if PPARa was responsible for 10-HSA induced histone crotonylation, we used a potent agonist (GW590735) in combination with 10-HSA in the presence of Gpl20 + tat (FIG. 3F, G, FIG. 10A). This agonist seemed to outcompete 10- HSA as there was no perceivable difference in crotonylation fluorescence intensity between cells treated with the combination of 10-HSA and the agonist, and those treated with just the agonist (FIG. 3F). Acetylation induced by the agonist was increased compared to the Gpl20 + tat control, but not significantly more than that of the antagonist (FIG. 3F). These findings are the first time PPARa activation by a bacterial postbiotic has been directly implicated in the ability to add crotonyl groups to the genome through upregulation of B-oxidation pathways. Using the trans epithelial electrical resistance (TEER) assay, we determined integrity of the tight junctions after 10-HSA treatment in a viral protein inflamed environment is significantly rescued in the Caco2 cell line (FIG. 3 J). These data support the hypothesis that increased mRNA transcription of tight junction anchor ZO- 1 is inducing a significant effect on cell-cell junction integrity. This is crucial data that offers functional support for 10-HSA as a viable treatment for tight junction dysfunction in the HIV inflamed gut. We had previously reported LP treatment increased in vitro cell-cell junction integrity as measured by TEER. These data combined indicate 10-HSA is likely the primary effector metabolite produced by Lactobacillus plantarum.
[0149] 10-HSA treatment demonstrated marked decrease in radical oxygen species (ROS) production in vitro (FIG. 3K, FIG. 10B). These data combined with the now established interaction between 10-HSA and PPARa suggest 10-HSA not only promotes mitochondrial activity, but reduces the ROS generated in a pro-inflammatory state as well. This suggests a rescue of normal mitochondrial membrane potential likely driven by a stable mitochondrial morphology even in an inflamed environment. Electron leakage from the electron transport chain (ETC) provides a major source of ROS in the cell and is exacerbated by damagedmitochondrial membranes. We hypothesize 10-HSA treatment augments the functionality of the ETC leading to diminished free radical generation from rogue electrons.
[0150] To fully understand the impact of 10-HSA induced crotonylation on a genome wide scale, ChlP-seq was performed using a pan-crotonyl lysine antibody (PTM Biolabs 501). This antibody is specific to crotonylated lysines and is not exclusive to histone lysines. Because of this, we were able to monitor mitochondrial DNA (mtDNA) for binding of crotonyl groups which influence mtDNA expression. It is known mitochondria do not contain histones, yet they do have mtDNA protein packaging called nucleoids. It is currently not well understood how these nucleoids control mtDNA transcription, but here we offer evidence to suggest they operate in part at an epigenetic level much like histones. Among the topmost enriched pathways from ChlP-seq were those relating to mitochondrial ETC and mitochondrial energy generation (FIG. 3G). Of the top 16 enriched genes, 50% of them promote ATP synthesis and overall ETC function thus increasing the available cellular energy (FIG. 3H). The top seven genes were enriched by over 800-fold each and were all members of the mitochondrial genome (FIG. 3H). Carnosine biosynthesis was also enriched in ChlP-seq analysis which has direct implications to ROS management in the cell (FIG. 3G, H). These data show for the first time that crotonyl groups derived from 10-HSA induced PPARa activity promote mtDNA, mitochondrial bioenergetics, and ROS reduction in the human nuclear and mitochondrial genome. The mitochondria has been previously implicated as a site disproportionately impacted by lysine crotonylation and here we offer novel data to support these lysine crotonylations interact with mtDNA regulation.
[0151] ChlP-seq data also showed largely different binding patterns of 10-HSA induced crotonylation compared to sodium crotonate (NaCr) and untreated cells (FIG. 12A, B, C, D). Untreated and NaCr treated cells showed no enrichment of mitochondrial pathways (FIG. 12C, D). Untreated and NaCr treated cells did not have any biological pathway enriched over roughly 330 times, unlike 10-HSA treated cells, which showed mitochondrial electron transport pathways being enriched over 900 times (FIG. 3G, FIG. 12C, D). Interestingly, 10- HSA showed a lower quantity of pathways enriched compared to NaCr and untreated cells with only four pathways being over 53 -fold enriched, suggesting a very specific binding pattern of 10-HSA generated crotonyl groups (FIG. 3G, FIG. 12C, D).
[0152] Genomic histone crotonylation has been linked to an increase in HIV viral replication and reactivation from latency. Using the J-lat 10.6 cell line model for HIV long terminal repeat (LTR) activation, we determined 10-HSA treatment in vitro suppressed HIVviral activation after pro-inflammatory stimulation with phorbol 12-myristate 13 -acetate (PMA, FIG. 3L). NaCr increased LTR activation but with combined 10-HSA treatment it was again suppressed (FIG. 11 A, B), providing further support for a hypothesis that 10-HSA is operating through specific pathways separately from NaCr induced genome crotonylation.
[0153] 3. Hydroxylated fatty acid treatment in SIV infected rhesus macaques reinforced tight junction protein structure and promoted histone crotonylation with PPARa fatty acid oxidation.
[0154] We have previously shown the therapeutic effects of Lactobacillus plantarum (LP) on the gut epithelial barrier in ligated ileal loops during SIV infection. Concurrent with this repair, histone crotonylation was significantly elevated in the LP treated animals (FIG. 4A, B). We hypothesized the crotonylation resulting from LP treatment was due to large quantity of 10-HSA within the ileal loops (FIG. 4F). In LP treated rhesus macaques, 10-HSA showed the highest fold change in ileal contents compared to untreated macaques (FIG. 4F, Table 1). This fold change was observed at higher amounts in SIV+ rhesus macaques (FIG. 4F). These data support 10-HSA as the primary effector metabolite produced by Lactobacillus plantarum.
[0155] TABLE 1 : Most abundant five metabolites produced in Lactobacillus plantarum treated Ileum (Fold change reflective of SIVpos LP+ Ileal contents divided by untreated Ileal contents as determined by Mass Spectrometry)
[0156] To test 10-HSA in vivo to determine if it was driving the repair seen in LP treated animals, we orally administered 10-HSA for 12 weeks in SIV+ rhesus macaques (FIG. 13). Fatty acid emulsification occurs in the duodenum through bile acid salts and uptake occurs primarily in the jejunum. Because of this, we focused on the jejunum for identification of treatment induced changes in vivo. Tight junction protein ZO-1 is a key marker to monitortight junction integrity in vivo given its role in anchoring junction proteins to the actin cytoskeleton. SIV infection has previously been reported to decrease mRNA and protein integrity of this crucial tight junction anchor. We had previously observed LP treatment restoring tight junction structure after just 5 hours. Through immunohistochemical (IHC) analysis we showed a recovery of ZO-1 protein structure in the jejunum of SIV+ rhesus macaques after oral 10-HSA treatment for 12 weeks (FIG. 4C). ZO-1 structure in SIV- animals shows a consistent protein lattice around the whole villus while in the SIV+ animals it appears largely broken (FIG. 4C). With 10-HSA treatment, the tip of the villus appears to still have moderate ZO-1 damage, but the crypts and lower portion of the villus show remarkable recovery of the lattice structure indicative of a functional ZO-1 protein (FIG. 4C).
[0157] The rescue of the ZO- 1 structure is directly associated with an increase in histone crotonylation (FIG. 4C, D, E). After 10-HSA treatment, the proliferative cells composing the crypt and lower villus have significant upregulation of histone crotonylation as detected by H3K18cr antibody IF (FIG. 4C). The crypts also function as a barrier for antigens traversing across the gut epithelium, and ZO-1 morphology within the crypts is robust after 10-HSA treatment (FIG. 4C). We have previously demonstrated ZO-1 protein structure can be maintained even when mRNA levels decrease in the active SIV infection. The crypt associated crotonylation is unique to 10-HSA treatment when compared with the SIV- and SIV+ groups (FIG. 4C). This suggests antigenic translocation and systemic opportunistic infections is more difficult in the 10-HSA treated animals due to reinforcement of the tight junctions in the lower villus and crypt. Mean fluorescence for H3K18cr showed significant increase in 10-HSA treated animals (FIG. 4D). ZO-1 mean fluorescence analysis showed a significant increase in protein quantity in 10-HSA animals compared to the SIV+ animals (FIG. 4E). The overall protein structure of ZO-1 appears remarkably intact compared to untreated SIV+ animals (FIG.4C).
[0158] Histone acetylation as detected by H3K18ac antibodies showed minimal difference in LP treated animals (FIG. 14A). With 10-HSA treatment, histone acetylation showed slightly increased quantities compared to the SIV+ animals (FIG. 14B). We hypothesized this difference in acetylation between the two treatments was due to treatment dependent differences. There are other metabolites produced by LP which may alter PTM levels while 10-HSA works directly through one now identified pathway. Images shown in FIG. 14A-B reflect two different studies and animals which contributed to slightly altered appearance in staining intensity for the H3K18ac antibody.
[0159] Claudin 3 structure and quantity was also analyzed for a more complete understanding of the tight junction structure between SIV+ and SIV+ 10-HSA (FIG. 15A, B). Claudin 3 structure is characterized by clear lines between cells which have sustained significant damage in large portions of the SIV+ villi and crypts (FIG. 15A, B). Furthermore, Claudin-3 mRNA showed an increase in expression in 10-HSA treated animals (FIG. 15B). 10-HSA treatment rescued Claudin 3 structure and mRNA quantity primarily in the crypt region and lower villus where the postbiotic demonstrated a large epigenetic impact (FIG. 15A). The tip of the villus for 10-HSA treated animals still showed damage to the Claudin-3 structure, much like ZO- 1 , however, this damage was attenuated compared to the untreated SIV+ group. Overall, tight junctions show robust structural rescue of key proteins with 10- HSA treatment primarily in the crypt region and lower portion of the villus. Further research into why 10-HSA treatment had the greatest impact on these sites is required.
[0160] Through RNA-sequencing of jejunal mRNA we determined genes associated with tight junction integrity, adherens junctions, as well as cytoskeleton function had significantly increased expression in the SIV+ 10-HSA animals (FIG. 4H). These data support the hypothesis that the structure and function of the cells making up the epithelium and tight junctions are bolstered with 10-HSA treatment. These animals also showed significantly increased expression of mucin and mucosal genes, again suggesting a heightened ability to generate and secrete mucous, thereby further preventing antigen translocation out of the lumen and supporting innate immune systems.
[0161] We also monitored PPARa and PPARy transcription factor activity in the jejunum compartment paying especially close attention to PPARa (FIG. 4H). PPARa is responsible for the regulation of hundreds of genes. The heatmap shown details genes associated with fatty acid metabolism as well as organelle development to monitor important trends in PPARa transcriptional regulation (FIG. 4H). We hypothesized that due to the ability of 10-HSA to bind and activate both transcription factors, we would see an increase in downstream mRNA levels in the 10-HSA treated animals. We saw significant upregulation in both the PPARa and PPARy regulated gene expression profiles in the SIV+10-HSA group (FIG. 4H). Untreated SIV infection shows a decrease in gene expression of PPARa associated genes (FIG. 4H). This is reflective of a damaged ability for SIV / HIV infected individuals to perform B-oxidation of fatty acids which results in a reduced energy metabolic profile. We have previously shown damaged mitochondrial bioenergetics is directly linked to a reduction in ZO- 1 integrity and tight junction functionality. Interestingly, PPARy controlled genes didnot show the same decrease in SIV+ animals, however, there was no significant increase in any of the genes in this group (FIG. 4H). In SIV+10-HSA animals, PPARy showed significant and higher fold changes indicating enhanced glucose metabolism capabilities (FIG. 4H). These data support our hypothesis that fatty acid B-oxidation controlled by PPARa activity is directly activated by oral administration of 10-HSA in the SIV damaged gut.
[0162] There is evidence to suggest pro-inflammatory cytokines like IL- 10 and TNFa have the capability of suppressing PPARa activity. We have previously shown an increase in IL- 10 and pro-inflammatory cytokine signaling pathways in untreated and ART treated SIV infection and a corresponding decrease in PPAR signaling. The inflamed gut environment attributes to the reduction in PPARa activity. In the current study, we detected a significant increase in pro-inflammatory cytokines IL- 10 and TNFa and NLRP3 gene expression in the untreated SIV infected monkeys (FIG. 4H). With 10-HSA treatment, there was significant reduction of IL- 10 and TNFa cytokine mRNA production (FIG. 4H). This indicates a reduction of virally induced inflammatory damage which allows for activation of PPARa signaling through 10-HSA binding.
[0163] By cross-referencing the ChlP-seq and RNA-seq data sets, we identified over 170 genes with increased expression associated with 10-HSA induced crotonylation. We performed pathway analysis on the top 50 most increased genes as determined by Log2 fold change (FIG. 4G). As expected, mitochondrial and energy pathways were significantly enriched in these genes (FIG. 4G, I). Responsible for the increase in aerobic respiration capabilities were the mitochondrial genes ATP8, ATP6, CO3, ND4, and ND4L (FIG. 41). These mitochondrial genes were the most enriched for in the 10-HSA treated ChlP-seq analysis performed and showed robust increases in the SIV+ 10-HSA treated monkeys (FIG. 4H). This supports our hypothesis that histone crotonylation is driving energy metabolism in the SIV+10- HSA treated monkeys leading to a better response to the SIV virus and allowing for maintenance of the epithelial barrier.
[0164] Expression levels of the whole mitochondrial genome comprised of 13 genes was assessed through RNA-seq (FIG. 4J). These data show a significant increase of genes associated with all four complexes encoded by the mitochondrial genome (I, III, IV, V) as a result of 10-HSA treatment in the context of SIV (FIG. 4J). There was a trend of increased mtDNA expression in complex V, but overall it appears 10-HSA treatment in SIV+ macaques return mitochondrial gene expression to normal levels (FIG. 4J). Although 10-HSA treatment showed similar quantity of genes with increased expression compared to SIV+, 10-HSAtreatment showed significant increase of pathways associated with mitochondrial morphology and energy production (FIG. 16A, B, C). This suggests 10-HSA elevates mitochondrial functionality above even that of SIV- healthy animals. These data also support the evergrowing quantity of evidence to suggest viruses like SIV / HIV damage mitochondrial functionality from a transcriptomic level.
[0165] It was crucial to discern whether ACCS2, ACADS, ACOX1-3, and ECHSl which are primarily responsible for crotonyl group generation during fatty acid metabolism, were enriched in SIV+10-HSA treated monkeys (FIG. 4K). Increased expression of these important genes between the SIV+ 10-HSA and SIV+ groups suggests a heightened ability for the monkeys treated with 10-HSA to produce crotonyl groups. Due to decreased functionality of the mitochondria and decreased functionalities of fatty acid metabolism pathways overall in SIV+ monkeys, the difference in ACSS2, ACADS, ACOX1-3, and ECHS1 gene expression with 10-HSA treatment likely promoted a large difference in crotonyl group generation in vivo.
[0166] We noticed an increase in immune related pathways in the SIV+ animals that did not appear to be as highly enriched in 10-HSA animals based on GO pathway analysis (FIG. 16B-C). To ensure 10-HSA treatment did not diminish the animal’s capability to combat SIV or any potential viral infection, we analyzed pathways pertaining to crucial innate and adaptive immune responses (FIG. 17). Although there was some slight decrease in genes associated with TLR signaling and viral regulation, there was little to no significance behind the fold changes. Neutrophil activation and degranulation showed no difference between the SIV+ 10- HSA and SIV+ animals and Class I MHC antigen presentation was also unchanged (FIG. 17). While there is no precedence to suggest stearic acids can negatively impact immune functionality, confirmation that 10-HSA does not hinder the capability of the immune response, especially in such an immuno-important organ as the gut, was crucial.
[0167] These data bridge the gap between in vitro, ex vivo, and in vivo to support our proposed mechanism of 10-HSA activation of PPARa leading to increased crotonylation of mitochondrially active genomic sites as well as leading to a restructuring and reduction of damage in the tight junctions.
[0168] 10-HSA rescued damaged mitochondrial morphology and promoted mitochondrial function in SIV infected rhesus macaques Mitochondrial quantity and morphology in the jejunum were evaluated through transmission electron microscopy (TEM). We have previously shown mitochondria typically display circular morphology in SIV which is associated with a loss of internal surface area and function. The untreated SIV infectionshowed expected results, with mitochondria being significantly more circular than those from SIV- or SIV+ 10-HSA animals (FIG. 5A, C). Furthermore, almost half of the mitochondria in the SIV+ enterocytes have an autophagosome like structure surrounding them (FIG. 5A, D). Turnover of mitochondria is crucial in maintaining a functioning energy supply and our data shows SIV+ animals have a hindered ability to clear their autophagosome engulfed mitochondria. This suggests almost half of the population of mitochondria in the SIV+ jejunal enterocytes is dysfunctional to some extent. That number is reduced to 20% in SIV+ 10-HSA and is comparable to the SIV- animals (FIG. 5A, D). There is a significantly lower total area of mitochondria in the 10-HSA treated animals compared to the SIV+ untreated animals (FIG. 5E). We posit the mitochondria from the 10-HSA treated animals are more functional and going through a greater rate of turnover than those in the SIV-or SIV+ populations. This hypothesis is supported by the superior mitochondrial morphology seen in the 10-HSA treated animals. This serves to keep a healthy and robust mitochondrial population with upregulated gene expression for ETC transportation and B-oxidation.
[0169] Cell-cell junctions were also imaged from the apical enterocytes in the jejunum (FIG. 5B). The results show a striking difference between the SIV+10-HSA treated animals and the SIV+ animals (FIG. 5B). The SIV+ animals show significant separation between the bordering cells which is known to reduce the ion sharing and signaling capabilities between cells. The weakened cell-cell junction also more readily allows antigenic translocation from the gut lumen into the peripheral blood. 10-HSA treatment restored tight cell-cell junctions similar to what is seen in SIV- animals (FIG. 5B). Combined with the data showing restored protein structure of both ZO-1 and Claudin 3, these data suggest a significant return to normal cell-cell junctions and a limited ability for antigens to traverse out from the lumen of the gut.
[0170] Using the Caco2 cell line, ATP production was measured after 10-HSA treatment in the Gpl20 + tat inflamed environment using a luminescent assay (FIG. 5F). ATP quantity increased in 10-HSA treated cells that were also subjected to Gpl20 + tat however, ATP showed no change in concentration between 10-HSA and untreated cells after 24 hours (FIG. 5F). This suggests an inflammatory dependent effect of 10-HSA on mitochondrial ATP production. These data show the rescued mitochondrial morphology leads directly to an increase in function and ATP generation.
[0171] It is known PGC-la and PGC-1 are the primary co-activators of mitochondrial biogenesis transcription. The genes TFAM, POLG2, and POLRMT are crucial for mitochondrial biogenesis to occur and are all regulated by PGC-la and 1(3. RNA-sequencinganalysis of jejunal tissue showed significantly increased expression of TFAM and POLG2 and trending expression increase of POLRMT and POLG (FIG. 5G). Of the 15 genes identified as required for mitochondrial biogenesis resulting from PCG- 1 a and 10 activity, 13 of them were upregulated (FIG. 5G). This indicated an increased capability of the monkeys treated with 10- HSA to generate new functional mitochondria and perform transcription of mitochondrially relevant genes. Monkeys with untreated SIV infection had significantly decreased expression of POLG2 and trending decrease in expression of TWNK and POLG (FIG. 5G). This indicates a decreased capacity for polymerase and helicase activity in the mitochondria in SIV infection, inhibiting functional biogenesis. Treatment with 10-HSA the decreased expression of mitochondrial biogenesis gene transcription through upregulation of PGC-la and 10 target gene transcription (FIG. 5G).
[0172] RNA-sequencing data showed significant upregulation of gene expression associated with oxidative phosphorylation as well as mitochondrial morphology / organization in the SIV+ 10-HSA treated animals (FIG. 5H, I). A rescue of genes involved in mitochondrial organization suggests a heightened membrane integrity which allows for proper maintenance of the membrane potential required for ATP production. This corroborates the findings showing significantly rescued mitochondrial morphology as viewed by the electron microscope and indicates a direct response to the 10-HSA treatment (FIG. 5A). Genes required for ATP synthesis are also dramatically and significantly increased in the 10-HSA treated animals indicating a largely heightened ability to generate energy necessary for combatting viral damage (FIG. 5K). Genes associated with promoting mitochondrial protein translation are significantly upregulated in the 10-HSA treated animals (FIG. 5J). This suggests an increased ability for the increased gene expression to actually make an impact at the protein level.
[0173] These data show rescue of the mitochondrial morphology and function as well as cell-cell junction integrity is correlated with an increase in genes responsible for driving proper energy metabolism. It is likely increased ATP production allows for quicker repair of the cellcell adhesion molecules that may become damaged by the pro-inflammatory environment. Overall, 10-HSA treatment is specifically targeting the mitochondria as a means to revive cellular bioenergetics in the SIV inflamed gut. Increased capability of generating cellular energy allows for funding of repair pathways and resistance to viral pathogenesis.
[0174] 4. Hydroxylated fatty acid treatment promoted synergistic effect ofLactobacillus and Blautia.
[0175] SIV and HIV can modify gut microbiome diversity and allow opportunistic bacterial pathogens to infect the gut lumen. When gram-negative bacteria infect the gut, the damaged tight junctions resulting from SIV infection cannot prevent LPS translocation into the blood stream resulting in systemic inflammation and immune activation. The SIV- gut microbiome population as determined by 16S rRNA sequencing showed a robust population of fermenting bacteria in the order Lactobacillales (FIG. 6A). These fermenting bacteria were primarily in the genus Lactobacillus and Streptococcus (FIG. 6A). The SIV+ gut microbiome revealed a diminished population of Lactobacillus and Streptococcus and an overwhelmingly large population of the order Helicobacter (FIG. 6A, B, C). This is likely an opportunistic infection that could not be countered due to compromised mucosal immune function. The genus Helicobacter is a gram-negative bacterium long known to have members responsible for inflammatory mucosal infection and ulcer formation. Overall, the SIV+ microbiome is characterized by a large gram-negative population with a reduction of fermenting bacteria, promoting a pro-inflammatory state in the gut.
[0176] 10-HSA treatment promoted an increase in the Streptococcus genus as well as reducing the SIV induced depletion of the Lactobacillus genus in vivo (FIG. 6A, E). Maintaining a healthy population of fermenting bacteria is crucial to tight junction integrity and overall gut mucosal immunity function. Furthermore, a robust population of the genus Blautia was present in the 10-HSA treated animals which is a direct result from treatment (FIG. 6A, D). Blautia was largely not present in the SIV+ or SIV- animals indicating 10-HSA treatment directly promoted the development of this bacterial population. Bacteria in the genus Blautia has probiotic functions with an ability to reduce gut inflammation and control growth of certain bacterial pathogens. Blautia was also present in higher quantities than the SIV+ or SIV- animals in the SIV+ART treated group (FIG. 6D). Blautia and Lactobacillus have recently been shown to have synergistic properties to suppress obesity related gut inflammation and improve tight junction protein integrity. We hypothesize that maintenance of commensal fermenting bacterial groups in SIV infection resulting from 10-HSA treatment allows for microbial metabolites to be generated to select for commensal bacteria such as Blautia and Lactobacillus. These data also confirm the direct link between commensal fermenting bacteria and tight junction stability and integrity in pro-inflammatory conditions.
[0177] Antiretroviral therapy (ART) has progressed rapidly since the beginning of the HIV pandemic and our data suggests it can partially rescue the microbiome damage induced by the immunodeficiency virus (FIG. 6A, B, C, D). ART treatment showed a healthierpopulation of fermenting gram-positive commensal bacteria compared to SIV and an increase in the Blautia population (FIG. 6A). However, there is a large population of Prevotella present which is typical of infected mucosal membranes, especially those in HIV patients. Prevotella is a gram-negative genus of bacterium which, like Plelicobacter, can result in ulcer formation and pro-inflammatory damage to the mucosal linings. These data suggest ART is unable to prevent common HIV induced opportunistic gut infections. However, because stearic acids have been shown to have antimicrobial properties, especially against gram-negative bacteria, we hypothesize 10-HSA is responsible for the significantly reduced population of noncommensal gram-negative bacteria present in the SIV+10-HSA treated group (FIG. 6A). We posit 10-HSA would be an excellent co-treatment for ART and could help mend gut epithelial integrity as well as promote a healthy probiotic rich environment that would lead to overall reduction in systemic inflammation. This would lower the overall burden on the compromised immune system and could potentially enable quicker recovery from the effects of HIV.
[0178] 5. Hydroxylated fatty acid mitigated the impact of Aflatoxin Bl induced epithelial damage in mice.
[0179] To determine if the effects of 10-HSA treatment extend to the broader context of intestinal disorders that negatively impact the gut epithelial lining and modulate PPAR signaling, we tested the metabolite in Aflatoxin (AFB1) poisoned mice. AFB1 exposure is known to damage intestinal epithelium and disrupt tight junction formation and function as well as dysregulate PPAR signaling. Treatment with 10-HSA in the AFB1 damaged mouse gut at four times the dose of the monkeys demonstrated a massive rescue of ZO-1 structural integrity (FIG. 6 A, C, D). ZO-1 structure in the 10-HSA treated group shows heightened fluorescent intensity as well as a robust lattice structure characteristic of a healthy tight junction (FIG. 6A). Areas within the jejunum of the AFB1 mice with no 10-HSA showed significant damage to the ZO-1 structure (FIG. 6A). Quantification of fluorescent signal showed significant increase in crotonylation as a result of 10-HSA treatment again confirming the mechanism of action (FIG. 6B). Even with the higher dose compared to the non-human primate model, the mice displayed no adverse effects and gained weight at a significantly higher rate than their AFB1 counterparts (FIG. 6C). This is important as one of the characteristics of sustained AFB1 poisoning is weight loss. Future research can be conducted to determine if this result is from simply increased caloric intake from the 10-HSA group consuming a fatty acid daily, or if there are other potential hormonal or metabolic changes occurring that allow for weight maintenance. Like the non-human primate model, mitochondrial genes associated withETC proteins identified from 10-HSA induced crotonylation ChlP-seq had significantly higher levels of expression in the 10-HSA treated mice (FIG. 6D). This confirms the in vivo impact 10-HSA has on mitochondrial energy upregulation in the diseased gut.
[0180] 6. Hydroxylated fatty acid treatment leads to a competitive advantage for beneficial gram positive microbes.
[0181] Mice exposed orally to Aflatoxin Bl were treated with 10-HSA at four times the dose of the monkeys to determine if the therapeutic impact of this hydroxylated fatty acid extended beyond viral infection and if the impact was dose dependent. In the SIV model of AIDS, decreased Lactobacillus populations are well documented. However, in the aflatoxin model, we saw a significant overgrowth of Lactobacillus (FIG. 18A). This is associated with bile acid dysregulation, digestion issues, and pancreatic dysfunction which are common with aflatoxin exposed animals. Simultaneously, we saw a decrease in Muribaculacae, a firmicute, as well as Blautia in the Aflatoxin exposed mice (FIGs. 18A, B and E). Aflatoxicosis has been shown in many species to generate tissue damaging calcium oxalate crystals which a healthy population of Muribaculacae has been shown to mitigate. These decreases in commensal populations were mitigated by 10-HSA treatment again showing how this hydroxylated fatty acid promotes firmicute population growth, especially in the Blautia genus. Lachnospiracae and Tericibacter also showed increased relative population size in the 10-HSA treated mice (FIG. 18A, C). Lachnospiracae have been implicated in metabolism of fatty acids and butyrate which are both processes capable of generating epigenetically active crotonyl-CoA. A healthy population of Lachnospiracae have also been shown to promote epithelial and tight junction integrity. While Lachnospiracae is capable of metabolizing butyrate, Butyricicoccus is known to generated butyrate in the gut. We observed an increase in the population of Butyricicoccus in 10-HSA treated mice which might serve to provide butyrate to the increased population of Lachnospiracae (FIGs. 18A, D).
[0182] DISCUSSION
[0183] In this study we report for the first time the role of a hydroxylated fatty acid, 10- HSA, in histone crotonylation induction through PPARa signaling. 10-HSA activation of PPARa led to upregulation of mitochondrial and peroxisome fatty acid B-oxidation which promoted histone crotonylation and gut repair pathways (FIG. 1). Historically, HIV research has struggled to find viable candidates to reduce or reverse virally induced gut dysfunction, however, the specificity of action of 10-HSA supports its use as a therapeutic. 10-HSA can traffic directly to the small intestine and emulsify with bile after oral consumption to targetand protect the most vulnerable portions of the gut and associated lymphoid tissue in HIV infection. Oral dosing provides a realistic and safe way to administer this highly active compound.
[0184] We have previously shown histone crotonylation can re-activate HIV activity in vitro and potentially promote generation of new infectious viruses, using NaCr, a supplier of non-metabolically derived free crotonyl groups, which upon entering the cell can have immediate epigenetic effects. The current study shows a difference in crotonyl group binding patterns between NaCr and 10-HSA treatment (see ChlP-seq data), with 10-HSA disproportionately effecting mitochondrial energy pathways while NaCr shows upregulation of a wide variety of pathways. Consequently, these data support 10-HSA as a promoter of a much more specific form of histone crotonylation, one that is metabolically derived through fatty acid B-oxidation which influences histone and mitochondrial nucleoid packaging of DNA in a much different way from NaCr. Much like the better studied histone acetylation, there are different pathways post transcriptional modifications (PTMs) can impact. Histone acetylation has been shown to promote HIV replication similarly to crotonylation. Histone acetylation has also been shown to be crucial in energy sensing and metabolic shifting to increase energy production. It is known microbial fatty acids can impact the epigenome, but until now, there was little known regarding isolated metabolites and their epigenetic impact on gene expression.
[0185] Mitochondrial dysfunction lies at the core of many infections and conditions which impact the mucosa. Viruses have been shown to hijack energy pathways and damage mitochondrial function to reduce energy available to the cell and evade immune detection. This is a commonly disrupted pathway in mucosal disease, and in the current study, we provide evidence to suggest 10-HSA is a viable treatment for any mucosal disease which disrupts the mitochondria. We have previously shown mitochondrial morphology becomes distorted in SIV infection which led to reduced energy metabolism and damaged the ability of the cell to fight the infection. 10-HSA treatment showed massive rescue of mitochondrial morphology and prevented reduction of internal surface area seen in SIV. This allows for a proper membrane potential to continue performing ATP synthesis and generating energy for the cell to function. 10-HSA directly promoted mitochondrial DNA expression of ETC subunits which led to increased ATP production in vitro. In the non-human primate model of AIDS, we saw significantly increased mitochondrial pathway related gene expression especially in ATP synthesis, cristae, and membrane organization genes. This shows proper function of the mitochondria is being restored through membrane morphology and energy generation with 10-HSA treatment in SIV. Increased mitochondrial function can generate more reactive oxygen species (ROS) which can have detrimental effects on the cell lipid membranes. We showed 10-HSA decreased ROS generation in vitro while simultaneously upregulating mitochondrially active gene expression. The data in this study suggest that 10-HSA not only increased mitochondrial activity, but through improving mitochondrial membrane integrity decreased electron leakage leading to reduced ROS generation. We confirmed the results of the rhesus macaque model with the Aflatoxin-Bl mouse model and showed upregulation of mitochondrial genes associated with histone crotonylation after 10-HSA treatment.
[0186] The importance of maintaining integrity in the gut epithelium during infections or inflammatory conditions cannot be overstated. The gut epithelium is responsible for many innate immune functions, serves as a barrier between the blood and luminal antigens, and communicates with the adaptive immune system to generate robust immune responses. Disruption of this cellularly diverse structure, especially during early viral infection, can lead to prolonged disease states and chronic illness. Crosstalk between the gut epithelium and intraepithelial lymphocytes is hindered and dysregulated when the epithelium becomes inflamed and disrupted. In HIV, this is particularly important, as our previous studies have shown disruption of the epithelial barrier occurs at the primary stages of infection. Early mucosal disruption increases pro-inflammatory cytokine secretions from enterocytes which promote cytokine storms and dysregulated immune responses. For the reasons above, monitoring tight junction integrity in HIV and inflammatory gut diseases is crucial. Tight junction disruption is one facet of epithelial damage that provides an excellent indication of overall epithelial health. Moreover, when the tight junctions and cell-cell junctions are disrupted, antigenic translocation from the gut lumen into the blood occurs. In HIV this is especially dangerous as the CD4+ T cell depleted adaptive immune system is not able to generate a strong response leading to systemic opportunistic infections. With 10-HSA treatment, we saw repair of the tight junction proteins ZO-1 and Claudin-3 which play key roles in maintaining a water-tight seal to prevent luminal contents from traversing into the blood. Through functional in vitro testing, we saw a rescue of trans epithelial electrical resistance (TEER) as a result of 10-HSA treatments. While the epithelium and its repair is multifaceted, reducing tight junction damage not only will reduce the potential for systemic inflammation and infection, but also serves as an indicator that overall epithelial health is increased when 10-HSA is administered. 10-HSA treatment decreased mRNA expression levels of pro-inflammatory cytokines IL- IB and TNFa as well as decreasing expression ofNLRP3. This decrease in the generation of pro-inflammatory agents seen in untreated SIV infection undoubtedly attributed to the rescue of epithelial health as determined by tight junction integrity in vivo. Using the in vivo Aflatoxin-Bl model of epithelial damage we showed the universality of 10-HSA and its ability to positively effect on the structure and resulting function of the tight junction.
[0187] 10-HSA treatment directly activated PPARa signaling and subsequent increase in fatty acid B-oxidation ex vivo, in vitro, and in vivo. B-oxidation of fatty acids has been shown to lead to an increase in epigenetic post transcriptional modifications like histone crotonylation. We showed 10-HSA is a potent ligand for PPARa both in silico and in vitro. In the monkey model, we showed significant increases in PPARa controlled gene expression responsible for fatty acid metabolism. Without being bound by theory, we hypothesize this increase in fatty acid energy metabolism generated crotonyl-CoA and released crotonyl groups which trafficked to the mitochondria and nucleus to promote gene expression. For the first time, we directly linked PPARa activation and signaling to histone crotonylation. Inhibition of the transcription factor reduced histone crotonylation significantly, even in the presence of 10- HSA. Through ChlP-seq we identified the primary site of crotonylation was in the mitochondrial genome where mitochondrial genes associated with electron transport chain function were all enriched. In vivo, these same genes had increased expression over the controls for both models. Without being bound by theory, we hypothesize an increase in mitochondrial function and available cellular energy allowed the gut epithelium in the SIV infected monkeys and the AFB1 poisoned mice to retain normal function of the machinery required for tight junction and epithelial integrity.
[0188] Maintaining a proper and functional commensal microbial community is essential to mitigating damage associated with HIV and other inflammatory gut mucosal disorders. We showed the impact a bacterial fatty acid, 10-HSA, has on supporting the gut microbiome. It reduced the capability of gram-negative bacteria such as Helicobacter to invade and colonize the gut which prevents inflammation at the source. 10-HSA also promoted the population of Lactobacillus, from which it was originally identified, and Blautia, an understudied pro-biotic. These two bacteria have been reported to have synergistic effects in inflammatory conditions and promote tight junction stability and reduce inflammation resulting from radical oxygen species generation in the inflamed gut. Lactobacillus itself has limited capacity to access the rich carbon source of mucin carbohydrates and relies on mucin-degrading bacteria such as Blautia and Streptococcus. The co-growth of mucin-associated bacteria has been shown tocontribute to the overall proper function of the gut. For these reasons, we posit a plausible interplay among Lactobacillus, Streptococcus, and Blautia to return homeostasis to the SIV inflamed gut with 10-HSA treatment inducing increased mucosal gene expression. 10-HSA has demonstrated an ability to select for commensal gut microbiota through oral administration which further strengthens its candidacy as a possible supplementary treatment to ART, which alone cannot promote tight junction integrity or a robust gut microbiome. Our findings confirm the pivotal role of a synergistic gut microbiome aiding in restoration of the gut mucosa during the inflammatory SIV infection.
[0189] Stearic acid has been shown to decrease low density lipoprotein cholesterol, a key marker for cardiovascular disease and has a United States Environmental Protection Agency (USEPA) rating of practically non-toxic upon oral administration in humans. Because of the non-toxic nature of stearic acids and low risk of cardiovascular health complications, 10-HSA shows promise as a long-term treatment or supplement for inflammatory bowel diseases. It can be orally administered and traffic directly to the site of small intestinal gut damage using normal digestive machinery. Future research into the effect of 10-HSA in reducing damage caused by combined SIV and A FBI poisoning would yield valuable insights into the therapeutic merit this postbiotic holds. Furthermore, determining if there is a difference in 10- HSA induced histone crotonylation compared to PPARa induced crotonylation will help to determine if 10-HSA operates in an even more specific manner than just through this transcription factor. Identification of this postbiotic shows therapeutic potential to those suffering from chronic bowel disorders, but it also opens the door into the bacterial postbiotic effects on the human epigenetic landscape that have been previously undescribed.
[0190] MATERIALS AND METHODS
[0191] Rhesus macaque study design and sample collection. Twelve rhesus macaques were used for this study, which was supported by supported by the NIH grant NIH / NIAID R37 Al 153025, on which grant the inventor is the Principal Investigator. Three males ages seven to ten provided SIV- controls. Three males ages seven to ten provided SIV+ controls. Three males ages seven to ten were infected with SIV and treated with 10-HSA. One female and two males were infected with SIV and treated with ART. Rhesus macaques (Macaco mulatto) were obtained from and housed at the California National Primate Research Center (CNPRC). Three animals selected at random were pre-treated with 1 Omg / kg per day of 10-HSA in powdered form hidden in half a banana daily for one-week pre-SIV infection. CNPRC staff ensured animals consumed the full dose daily. All SIV+ animals were I.V. infected with 1000 TCID50of SIVmac251 on day zero. A dosage of lOmg / kg per day of 10-HSA was given to the pretreated group in half a banana for seven weeks at which point the dosage was increased to 25mg / kg per day for the remainder of the 12-week study. Initial dosage was low to allow for potential observation of negative side effects. None were seen so dosage was increased in accordance with the IACUC protocol. Blood draws were performed weekly for each animal and complete blood count (CBC) and fluorescent activated cell sorting (FACS) were conducted. Necropsy was conducted at week 12 where gut tissue, spleen, lymph tissue, lung tissue, and rectal and buccal swabs were obtained for further processing and analysis. SIV+ART monkeys (n =3) were infected by I.V. with 1000 TCID50 of SIVmac251 and received daily subcutaneous doses (ImL / kg body weight) of 2.5mg / mL Dolutegravir (DTG) free base, 5.1mg / mL Tenofovir Disoproxil Fumarate (TDF), and 40mg / mL Emtricitabine (FTC) in 15% Kleptose water. SIV+ART monkeys were necropsied after 18 weeks of ART. Rhesus macaques treated with Lactobacillus plantarum was conducted as previously described. This study were performed in accordance with the recommendations and guidelines of the Public Health Services Policy on Humane Care and Use of Laboratory Animals. All procedures on the macaques in this study were performed in accordance to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Davis. Pre-approved sedatives, anesthetics, and analgesics were used during animal handling, surgical procedures, and at necropsy to minimize pain or discomfort to the animals. Animals were euthanized in accordance with the American Veterinary Medical Association Guidelines for the Euthanasia of Animals.
[0192] Mouse study design and sample collection. Sixteen, six-week-old, male C57BL / 6J mice (Charles River Laboratories) were randomly assigned to four cages (n = 3 per cage) with access to food and water ad libitum. All mice were trained for 2 weeks prior to initial pre-treatment of 10-HSA with vehicle strawberry Jell-O® to acclimate mice to daily feedings. Daily feedings consisted of barriers being placed in the cage to divide the mice and Jell-O® being placed on the cage wall. Barriers were removed after the mice had consumed all of the Jell-O®. At 1 week prior to Aflatoxin Bl (AFB1 Sigma- Aldrich A6636) administration, two cages of mice (n = 6 per group, n = 4 for negative control) were chosen at random to begin 10-HSA (AstaTech A10837) treatment at 100 mg / kg per day suspended in Jell-O® daily until the end of the study. The remaining cages continued to receive the vehicle Jell-O® control daily until the end of the study. At timepoint zero, 5 mg / L of AFB1 was placed into the water supply of both groups of mice and refreshed every two days. Weights were taken at day 0, 5, 10, 15,and 21. At day 21, mice were euthanized with CO2 and heart puncture in accordance with the American Veterinary Medical Association Guidelines for the Euthanasia of Animals. Tissues and blood were harvested from each animal for paraffin embedding, further cell isolation, and analysis. This study was performed in accordance with the recommendations and guidelines of the Public Health Services Policy on Humane Care and Use of Laboratory Animals. All procedures on the mice in this study were performed in accordance to the protocol approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Davis. Pre-approved sedatives, anesthetics, and analgesics were used during animal handling, surgical procedures, and at necropsy to minimize pain or discomfort to the animals.
[0193] Cells and treatments. Caco2 cells (ATCC), small-intestinal epithelial stem cell derived intestinal epithelial monolayers from human patient samples, and J-Lat cells (Cellosaurus) were used in the study. Caco2 cells were cultured in MEM (Gibco) media containing 10% FBS and 1% penicillin / streptomycin. Stem cell derived monolayers were cultured in DMEM (Gibco) with 5% mouse fibroblast LWRN conditioned media (Manufacture in-house), 1% Nicotinamide, 1% Fungizone (Fisher), 0.1% Y-27632 (Fisher), and 0.1% Gentamicin (Sigma). Caco2 (seeded 7 x 105per well) were cultured in 6 well plates and 8 well chamber slides and allowed to grow to 80% confluency for experimental purposes. Stem cell derived monolayers were seeded at E6 x 106cells per well (6 well plate) and 2 x 105cells per well (8 well chamber slides). Both cell lines were treated with gpl20 (1 pg / mL) and tat (E4 pg / mL) to induce inflammatory conditions (NIH HIV reagent program). J-Lat cells were treated with 1 pg / mL phorbol 12-myristate 13-acetate (PMA) to induce HIV LTR gene activation in ImL of RPMI supplemented with 10% FBS and 1% penicillin / streptomycin. 10- hydroxystearic acid (AstaTech) was water bath sonicated in cell culture media to emulsify and administered at 500 pM within the appropriate media for each cell line. Sodium crotonate (NaCr) was administered at 20 mM. Cells were treated with 480 nM PPARa antagonist GW6471 (Abeam) and 8 nM PPARa agonist GW590735 (Abeam) as according to the ECD50 dose for each molecule for 6 hours. PPARa agonist and antagonist were suspended in DMSO according to manufacturer guidelines and diluted in cell culture media containing 10% FBS and 1% pen / strep antibiotics. Experiment was run in duplicate.
[0194] Immunofluorescence. After described treatments for in vitro and ex vivo assays, media was removed and cells were washed with PBS and fixed in ice-cold 4% PFA for 20 minutes. Cells were permeabilized with 0.1% Triton and blocked with 15% goat serum. Immunostaining was conducted with H3K18cr (PTM Biolabs Inc.) and H3K14ac (MilliporeSigma) antibodies. Secondary antibodies Alexafluor goat-anti rabbit 488 and Alexafluor goat- anti mouse 647 (ThermoFisher) were used to visualize signal. Cells were stained with DAPI and mounted with Prolong Diamond Antifade mounting media (Invitrogen). Experiments were run in duplicate.
[0195] Gut tissue samples (n = 3 per group) were fixed in 4% paraformaldehyde immediately after removal from the animal, submerged in 80% ethanol, and paraffin- embedded. Sections were cut at 5pm thick and stained with H3K18cr (PTM Biolabs Inc.), ZO- 1 (ThermoFisher), Claudin 3 (ThermoFisher), and H3K18ac (ThermoFisher) antibodies. Nuclei were stained with DAPI and mounted with Prolong Diamond Antifade mounting media (Invitrogen). Images shown in the same figures are from the same experimental run. Secondary antibodies used were Alexafluor goat-anti rabbit 488 (ThermoFisher), Alexafluor goat-anti mouse 647 (ThermoFisher), and Alexafluor goat-anti rabbit 555 (ThermoFisher). All quantification was performed blinded to reduce bias. Experiments were run in duplicate.
[0196] Fluorescent Imaging. Imaging was performed with the Leica TCS SP8 STED 3X confocal microscope at 40x and 20x magnification. Regions of interest were selected based on consistent cell density or consistent tissue morphology. Four images were taken at random points to ensure accurate representation of the cellular or tissue response to treatment. For quantification of immunofluorescence images, raw files were analyzed for mean fluorescence intensity (MFI) using ImageJ / FIJI (version 2.3.0). For in vitro analysis, 15 random cells per image were outlined and their MFI was quantified. For in vivo analysis, 20-40 regions of interest were quantified per treatment group depending on availability in the tissue. For H3K18cr and ZO-1 rhesus macaque tissue MFI analysis, 26 regions per animal containing crypts and villi were imaged and analyzed for fluorescent signal (n=3 animals per treatment group). For ZO-1 displayed in figure 3 and 6, color was originally red and altered in ImageJ to yellow to accommodate color blind readers and prevent green and red in the same image but fluorescent.
[0197] Reactive oxygen species (ROS) fluorescent detection assay. Caco2 cells (7 x 105per well) were seeded into 8 well chamber slides and allowed to reach 80% confluency. They were then treated with the previously described reagents for 24 hours. Media was removed after treatment and cells were incubated in CellROX Green in cell culture media (1:300) (ThermoFisher) for 1 hour while live. Cells were then washed with PBS and fixed for with 4% PFA for 20 minutes. Chamber slides were covered in Prolong Diamond Antifade mounting media and imaged immediately after. Assay was run in duplicate.
[0198] Quantitative real-time PCR. Total RNA for Caco2, stem cell derived monolayers, and mouse jejunum tissue was isolated using the RNeasy mini kit (Qiagen). Coding DNA (cDNA) was synthesized using Superscript II reverse transcriptase and oligo (dT) primers (ThermoFisher Scientific). Quantitative real-time PCR (qPCR) used the synthesized cDNA as a template for amplification. TaqMan 2x Universal PCR Master Mix (ThermoFisher Scientific) and TaqMan primers were used with the ViiA 7 thermocycler (Life Technologies). The primers (ThermoFisher Scientific) used are as follows: PPARa (Hs00947536_ml), PGCla (Hs00173304_ml), NRF2 (Hs00975961_gl), BCLN1 (Hd01007018_ml), PINK1 (Hs00260868_ml), p62 / SQSTMl (Hs01061917_gl), p53 (Hs01034249_ml), p63 (Hs00978340_ml), ACSS2 (HsOl 122829), KAT2A (Hs00904943_gH), ZO-1 (Hs01551861_ml), Beta Actin (Hs03023880_gl), GAR1 (Mm01316954_gl), CD4 Mm00442754_ml), CARN1 (Mm01236521_ml), ATP5F1 (Mm05814774_gl), MT-CO3 (Rn03296820_sl), MT-ATP8 (Rn03296716_sl). All samples were run in triplicate. Quantitative real-time PCR was run for 40 cycles and all positive signals were reported as a Log2 Fold change. Baseline established by a no treatment control for cells and untreated group for mice. Delta-Delta CT method was used to determine differences in gene expression levels. Beta-Actin was used as housekeeping gene.
[0199] Electron microscopy. Gut tissue was fixed in Kamovsky’s fixative immediately after removal from the animal and submitted to the NEI microscopy core at UC Davis for resin embedding and staining. Sample preparation, imaging, and analysis was conducted as previously described.
[0200] ChlP-seq. Chromatin immunoprecipitation was performed using the ChlP-IT Express Kit(Active Motif). Caco2 cells and epithelial stem cell derived monolayers were seeded on 175 cm2flasks at a density of 3 x 106 cells. Once at 90% confluency, cells were treated with the aforementioned treatments for 6 hours, fixed with 11% formaldehyde, and manually lysed with a Dounce homogenizer. Sonication was conducted using the Covaris E220 Focused-ultrasonicator (Covaris) for 480 seconds at the UC Davis DNA Technologies Core. To precipitate chromatin associated with crotonyl binding, the ChIP validated pan anti- crotonyllysine rabbit pAb antibody was used (PTM Biolabs Inc.). 25 ng of chromatin was used per ChIP reaction. Precipitated chromatin library preparation was conducted with KAPA HyperPrep Kit (Roche Sequencing) and sequenced using the Illumina NextSeq 550 system (Illumina, Inc.). To determine significantly enriched regions of the genome in each treatment, peak calling using MACS2 was conducted with an input DNA control. The Genomic RegionsEnrichment of Annotations Tool (GREAT) web application from Stanford was used to determine genes associated with each peak. GREAT was used to determine significantly enriched biological and molecular pathways.
[0201] Flow cytometry. Flow Cytometry was performed with the aid of the UC Davis Flow Core to determine J-Lat HIV LTR activation after treatment. Cells were washed with lx PBS and dyed with DAPI to determine viability and gates were created to isolate viable GFP positive cell populations from each group. Treatments were run in triplicate. Analysis was conducted on FlowJo 10.8.2.
[0202] Fluorescent ATP assay. Relative ATP production was analyzed using Caco2 cells with the Luminescent ATP Detection Assay Kit (Abeam) and analyzed with UVP BioSpectrum Imaging System (UVP). Protocol was performed according to manufacturer specifications. Luminescent signal was quantified in FIJI 2.3.0. Each treatment consisted of 9 wells in a 96 well plate with fully confluent Caco2 cells. Experiment was run in duplicate.
[0203] TEER. Caco2 cells were seeded as previously described in the Tanswell Permeable Support 6.5mm Insert plate (Costar) and treated with previously described concentrations of Gpl20 + tat and 10-HSA for 24 and 48 hours. Treatments were removed and cell culture media was placed in to create a consistent environment to compare electric resistance. Electric resistance between was immediately tested for trans epithelial electrical resistance by use of Millicell ERS-2 Voltohmmeter with the MERSSTX01 Electrode (Millipore Sigma). Experiment was run in duplicate.
[0204] Luciferase reporter gene assay. Three concentrations of 10-HSA (5 pM, 50 pM, and 500 pM) were sent to INDIGO Biosciences to have PPARa and PPARy activation levels determined. Data is reported in Relative Luminescence based on Luciferase activation.
[0205] 10-HSA quantity in ileal contents. Mass spectrometry was performed by Metabolon using ultra high-performance liquid chromatography / tandem accurate mass spectrometry (UHPLC / MS / MS) using ileal contents of rhesus macaques treated with LP vs LP- to determine relative metabolite concentrations (n = 4 animals per treatment group). Data processing was conducted with Metabolon’ s proprietary software to identify enriched metabolites.
[0206] 16S sequencing. DNA was isolated from rhesus macaque fecal samples at preinfection and necropsy timepoints using the Qiagen DNeasy PowerSoil Pro kit (Qiagen). Primers: 341F (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG(SEQ ID NO: l)(spacerWCCTACGGGNGGCWGCAG)(SEQ ID NO: 2) and 806R(GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG(SEQ ID NO: 3)(snaccr)CCGGACTACNVGGGTWTCTAAT) (SEQ ID NO: 4) were used to amplify the V3-V4 domain of the 16S rRNA using a two-step PCR procedure. Each 25 pl PCR reaction contained 1 Unit Kapa2G Robust Hot Start Polymerase (Kapa Biosystems), 1.5 mM MgCh, 0.2 mM final concentration dNTP mix, 0.2 pM final concentration of each primer, 3 pl KAPA 5X Enhancer 1, and Ipl of DNA for each sample. PCR conditions were an initial incubation at 95°C for 3 min, followed by 25 cycles of 95°C for 45 s, 50°C for 30 s, 72°C for 30 s and a final extension of 72°C for 3 min. In step two, each sample was barcoded with a unique forward and reverse barcode combination using forward primers (AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTC) (SEQ ID NO: 5) with an Illumina P5 adapter sequence (bold), a unique 8 nt barcode (N), a partial matching sequence of the forward adapter used in step one (underlined), and reverse primers (CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG) (SEQ ID NO: 6) with an Illumina P7 adapter sequence (bold), unique 8 nt barcode (N), and a partial matching sequence of the reverse adapter used in step one (underlined sequence). The PCR reaction in step two contained 1 Unit Kapa2G Robust Hot Start Polymerase (Kapa Biosystems), 1.5 mM MgCh, 0.2 mM final concentration dNTP mix, 0.2 pM final concentration of each uniquely barcoded primer and 1 pl of the product from the PCR reaction in step one diluted at a 10: 1 ratio in water. PCR conditions were an initial incubation at 95°C for 3 min, followed by 9 cycles of 95°C for 30 s, 58°C for 30 s, 72°C for 30 s and a final extension of 72°C for 3 min.
[0207] The final product was quantified on the Qubit instrument using the Qubit High Sensitivity dsDNA kit (Invitrogen) and individual amplicons were pooled in equal concentrations. The pooled library was cleaned utilizing AMPure XP beads (Beckman Coulter) then checked for quality and proper amplicon size on an Agilent 2100 Bioanalyzer (Agilent Technologies). The library was quantified via qPCR followed by 300-bp paired-end sequencing using an Illumina MiSeq instrument (Illumina) in the Genome Center DNA Technologies Core, University of California, Davis. DNA extractions and library preparation were performed by the UC Davis Host Microbe Systems Biology Core Facility.
[0208] PPARa molecular docking. This study involved docking investigations of 10- hydroxystearic acid (10-HSA) with Peroxisome Proliferator-Activated Receptor (PPAR) alpha. The three-dimensional structure of PPARa was sourced from the Protein Data Bank (PDB) with the identifier 6KAX. Any missing residues and heavy atoms in the structure werecompleted using Modeller 10.4. The 3D structure of HSA was prepared in MOL2 format. SwissDock was then utilized to predict potential binding interactions between PPARa and 10- HSA. To select the optimal binding configuration between PPARa and 10-HSA, the following criteria were used: (1) Binding Energy (Lower binding energies were favored, suggesting stronger interactions); (2) Visual Inspection (Poses where the small molecule interacted well with the protein, considering factors such as hydrophobic cores and hydrogen bonding, were selected); (3) Consistency with Known Data (Known data about similar molecules' binding modes were used) to help select the best pose. For instance, the interactions of palmitic acid with PPARa 6KAX were considered.
[0209] 3’ RNA-Seq. RNA was extracted from rhesus jejunum tissue as previously described (n = 3 per group). RNA was cleaned and purified with the RNA Clean & Concentrator -5 DNAse I included kit according to manufacturer guidelines (Zymo Research). RNA was quantified by Bioanalyzer to ensure quality before library preparation. Library preparation and sequencing on the Element Bio Aviti were performed by the UC Davis DNA Technologies Core. Differential expression analysis was conducted using the most recent rhesus macaque genome at the time of data analysis (Mmul_10) and indexed with GCF_ 003339765. With use of the Cancer Genomics Cloud computing services (Seven Bridges), sequencing data was checked for quality with FastQC and MultiQC and mapped to the macaque genome with STAR. No trimming was performed before STAR as FastQC / MultiQC showed high quality reads for all samples. The Limma-Voom R package was used to conduct differential expression analysis between samples. SIV+ (n = 3) and SIV+10-HSA (n = 3) samples were compared against SIV- (n = 3) samples to determine differential expression based on treatment. SIV+10-HSA was compared against SIV+ to determine differential expression in the context of SIV. Differentially expressed genes were uploaded to Metascape.org to determine differentially represented pathways in the data sets. To ensure pathway analysis had sufficient depth, gene expression changes were considered significantly different when the P value was less than 0.1 and the FDR corrected P value (q value) was less than 0.25. Pathway analysis was decided based on DEGs from SIV+ 10-HSA vs SIV+ comparisons to ensure 10-HSA treatment was understood clearly in the context of SIV. Biological pathway analysis was conducted using Metascape.org using DEG input.
[0210] Statistical analysis. Data shown represents the mean ± SEM calculated by using all data points from two independent runs of experimentation unless otherwise stated. Statistical significance was determined through unpaired t-tests when comparing valuesbetween two groups. One-way ANOVA was used to determine treatment effect between multiple groups. P-values of < 0.05 were considered significant. All analysis was performed on Graphpad Prism version (9.2.0).
[0211] Example II. 10-hydroxystearic acid (10-HSA) for therapeutic restoration of gut barriers and energy metabolism during viral infection.
[0212] INTRODUCTION
[0213] Alterations to gut microbial communities accompanied by decreased microbial diversity is associated with chronic inflammation, impaired mucosal immunity, increased host susceptibility to pathogens and clinical disease progression. The current understanding of microbial dysbiosis centers on the changes in the profile of microbial communities and short chain fatty acid (SCFA) production. However, our knowledge is limited regarding the expression of other microbial bioactive molecules and their impact on host physiology and immune defense.
[0214] The gut-associated lymphoid tissue (GALT) is an early target of HIV leading to mucosal CD4+ T cell depletion and epithelial barrier disruption. The establishment of viral reservoirs and mucosal inflammation occurs early in viral infection as shown with the nonhuman primate (NHP) model of HIV / AIDS. Combination anti-retroviral therapy (ART) leads to viral suppression and decreased mortality in HIV infected individuals. However, ART fails to eradicate the virus or induce complete host gut mucosal recovery. Alterations to gut microbial communities in HIV / SIV infections impacts host mucosal immunity and impedes gut repair. Loss of Lactobacillus in HIV / SIV infections is associated with increased susceptibility to opportunistic infection and disease progression. We previously showed that administering Lactiplantibacillus (formerly Lactobacillus') plantarum directly into the SIV inflamed gut lumen in vivo promoted rapid epithelial barrier repair and dampened mucosal inflammation. These findings highlighted the critical role of Lactobacillus-hos mucosal interactions as potential therapeutic targets for activating gut repair and immune defense. Currently, clinical outcomes of probiotic supplementation to reverse microbial community disruption and improve gut health in HIV infection have been inconsistent. Utilizing bioactive microbial metabolites in place of probiotics to target and promote gut mucosal repair during HIV / SIV removes the reliance on microbial colonization in a hostile environment and promises to yield novel therapeutics for targeting the host gut mucosal compartment.
[0215] In this study, we confirm robust production of 10-hydroxystearic acid (10-HSA), which we hypothesize is microbial in origin, in the SIV-inflamed gut microenvironmentfollowing L. plantarum (LP) administration and characterize its role in activating gut barrier repair and prevention of microbial dysbiosis. 10-HSA promoted PPARa signaling that led to the induction of epigenetic modification of histone crotonylation, resulting in the activation of gene expression regulating energy metabolism and promoting gut barrier renewal. Our findings demonstrate that the repair of the virally inflamed and disrupted gut can be propelled a bioactive microbial metabolite through epigenetic regulation.
[0216] RESULTS
[0217] 1. Identification of metabolite from virally-inflamed intestine that induces epithelial repair.
[0218] Our previous study showed that within 5 hours of administration of L. plantarum (LP) into intestinal loops of chronically SIV-infected rhesus macaques resulted in rapid restoration of gut epithelial barriers compared to untreated intestinal loops mediated by PPARa. Metabolic changes were examined through untargeted metabolomic profiling of ileal luminal contents that identified the most abundantly produced metabolite, 10-hydroxystearic acid (10-HSA) in L. plantarum administered intestinal loops (FIG. 4F). An increased level of 10-HSA by 123 fold was detected in LP-treated intestinal loops compared to untreated intestinal loops from SIV infected animals (Table 1, above). Thus, we focused our investigations to discover the mechanistic linkage between 10-HSA and gut barrier repair. We hypothesized that 10-HSA may activate epithelial repair through PPARa signaling and mitochondrial restoration.
[0219] We examined the effect of 10-HSA on human gut epithelial cells of Caco2 cell line in vitro and duodenal stem cell derived epithelial monolayers (SCDM) ex vivo and analyzed changes by the transcriptomic, immunohistochemical and mitochondrial functional assays. Caco2 cells were exposed to HIV viral antigens (gpl20 + tat proteins) in combination with 10-HSA for 6 hours and monitored for epithelial morphology and function. As expected, viral antigen-exposed cells showed remarkable damage to the tight junction structure as determined by ZO-1 immunofluorescent staining (FIG. 19A). Treatment with 10-HSA showed remarkable resistance to viral antigen- induced damage (FIG. 19A). To determine whether these morphological changes translated to increased gut barrier functionality, we utilized the trans-epithelial electrical resistance (TEER) assay and found significant rescue of epithelial barrier function following 24 and 48 hours of 10-HSA treatment (FIG. 19B). Transcriptional analysis of SCDM as well as Caco2 cells showed that viral antigens led to the loss of tightjunction proteins gene expression while 10-HSA treatment induced significant increases in tight junction gene expression (FIG. 19C).
[0220] We have previously shown tight junction stability is closely linked to mitochondrial function. Utilizing the Seahorse OCR assay, we determined that viral antigens drive significant reduction in basal and maximum respiratory capacity of Caco2 cells after 6 hours of exposure (FIGs. 19D-E). The data showed that viral antigen-driven tight junction disruption was mechanistically linked to significant damage to the mitochondrial function. This was prevented by 10-HSA treatment that resulted in a significant increase in basal and maximum respiration indicating increased mitochondrial function (FIGs. 19D-E). 10-HSA treatment also showed increased ATP linked respiration in viral antigen-challenged epithelial cells (FIG. 19E). This increase in ATP linked oxygen consumption resulted in significantly elevated ATP production (FIGs. 19F). The increase in mitochondrial function coincided with a decrease in ROS production indicating that mitochondrial electron leakage associated with viral antigen exposure was reduced with 10-HSA treatment, as described above (FIG. 3K). These results show that the metabolite 10-HSA is independently capable of driving epithelial repair and promoting mitochondrial function in viral antigen-damaged cells.
[0221] 2. 10-HSA activates PPARa signaling and drives mitochondrial functionality.
[0222] Because of our previous findings with LP, we sought to determine if the mechanism of 10-HSA-induced protection of mitochondrial function was through PPARa activation. We utilized a reporter cell line assay that contains PPARa promoter-regulated luciferase reporter gene. A dose-dependent increase in the activation of PPARa-induced luciferase fluorescence was detected in 10-HSA treated reporter cells (FIG. 20A). To determine the specificity of 10-HSA activation of PPARa, we used a PPARa -specific inhibitor, NXT629 and found that almost 100% inhibition of 10-HSA-induced PPARa transcriptional activity validating a 10-HSA-PPARa specific interaction (FIG. 20B). Transcriptional analysis identified significant increase in the mRNA expression levels of PPARa regulated genes ACSS2, ACADM, ACADl'L, ACSL3, and HADHA in Caco2 and SCDM treated with HIV antigens and 10-HSA (FIG. 201). Viral antigens alone suppressed PPARa transcriptional activity (FIG. 20C). 10-HSA treatment counteracted the viral antigen effects in both Caco2 and SCDM cells. Transcription factor analysis by TRRUST of SCDM RNA sequencing data showed PPARa to be the most active transcription factor followed by EP300 and PPARy in 10-HSA treated SCDM cells compared to SCDM cells exposed only toviral antigens further supporting the hypothesis that 10-HSA drives PPARa activation (FIG. 20D).
[0223] To determine whether the 10-HSA-induced rescue of mitochondrial oxygen consumption was driven through PPARa, we inhibited the transcription factor with selective PPARa inhibitor GW6471 and performed Seahorse OCR. As expected, after 30 minutes, viral antigens caused significant reduction in basal, maximum, and ATP linked respiration (FIG. 20E-F). Inhibition of PPARa in combination with viral antigens showed significant detrimental effects on oxygen consumption and ATP linked respiration which 10-HSA treatment could not rescue (FIG. 20E-F). In contrast, cells treated with the combination of 10- HSA and viral antigens showed no significant difference compared to untreated cells demonstrating normal mitochondrial function (FIG. 20E-F). These data show that 10-HSA activates PPARa transcriptional activity leading to increased mitochondrial functionality and can counteract HIV viral antigen effects.
[0224] To understand the potential 10-HSA-PPARa binding interaction, we employed Gaussian accelerated molecular dynamics (GAMD) simulations. GaMD has successfully predicted accurate binding sites across various receptors and been shown to be capable of independently replicating x-ray crystallography data indicating its utility in discovering accurate protein-ligand interactions. Four molecules of 10-HSA were placed randomly around the PPARa protein in the solvent, 15 to 20 A away from the protein surface which revealed two separate binding sites for 10-HSA in the PPARa protein (FIG. 20L-P). Binding site 1 primarily stabilized the critical H12 (AF2) helix through canonical hydrogen bond formation (FIG. 20P). The key interactions involved hydrogen bonds formed by the carboxylic head group of 10-HSA with Y464 (AF2), Y119, and SER289, as well as the hydroxyl group of 10- HSA with T279 on helix 3. Notably, the hydrophobic tail of 10-HSA occupied Arm III of the PPARa pocket, a region where such occupancy is known to enhance coactivator recruitment (FIG. 20P). Analysis of the center of mass (COM) distance between PPARa and 10-HSA revealed that the ligand occupies the binding site from 400 to 1000 nanoseconds but subsequently appeared to move near the center of PPARa (FIG. 20N).
[0225] At binding site 2, the carboxyl group of 10-HSA formed hydrogen bonds with K266 and H274 on helix 3, while its hydroxyl group established hydrogen bonds with E251 (FIG. 20P). Additionally, a supportive salt bridge network, involving D453 from the Hl 1-H12 loop and K266 from the fl-loop, reinforced these interactions (FIG. 20L). These critical interactions closely mirror those observed with WY14643, a well-known fibrate drug thatactivates PPARa but not PPAR gamma or delta. COM distance mapping from our 2- microsecond simulations suggests that the occupancy of the ligand at this site remains stable (FIG. 20N). Furthermore, we observed that multiple molecules of 10-HSA can occupy the PPARa LBD simultaneously (FIG. 20N). Similar accommodation by natural hydroxy fatty acids, such as 9-HODE, has been noted in the PPARy LBD, which shares a comparable volume of 1440 A3with the PPARa LBD. Our data shows 10-HSA may preferentially bind and remain stable in the second site. Our GaMD simulations provide compelling insights into the binding dynamics of 10-HSA with the PPARa LBD. These findings suggest binding of 10-HSA to PPARa occurs and also elucidate its pathway and binding sites, aligning closely with known crystal structures that activate PPARa.
[0226] 3. 10-HSA-activated PPARa signaling induced epigenetic reprogramming through histone crotonylation.
[0227] To gain better insights into the rapid remodeling of the gut epithelial structure after only 5 hours of LP administration in our previous study, we performed immunohistochemical analysis of the gut mucosal tissues for epigenetic modification for histone crotonylation (e.g., representative images shown in FIG. 4A). The epigenetic modification is a strong candidate for activating rapid mucosal restoration compared to histone acetylation. A significant increase in the levels of histone crotonylation was evident in the gut epithelium of intestinal loops from SIVpos following LP treatment (FIG. 4A). To determine whether 10-HSA caused the induction of histone crotonylation modification in the gut epithelium, we examined the effects of 10-HSA in Caco2 and SCDM cells. In Caco2, HIV proteins led to marked suppression of crotonylation on histone 3 lysine 18 (H3K18cr) as well as acetylation on histone 3 lysine 14 (H3K14ac) at 6 hours as measured by semi-quantitative mean fluorescent intensity (MFI) analysis of the immunostained cells (Figure FIGs. 21A-C). The addition of 10-HSA resulted in increased H3K18cr and H3K14ac signals in HIV antigen- challenged cells (FIGs. 21A-C). To determine whether this mechanism was PPARa- dependent, we inhibited the PPARa activation using GW6471 inhibitor and found that 10- HSA was not able to recover H3K18cr levels but interestingly, was still able to promote H3K14ac modification (FIGs. 21A-C). The PPARa agonist GW590735 induced histone crotonylation modification further validating our findings (FIGs. 21A-C and J). A dose dependent response of 10-HSA for inducing histone crotonylation in Caco2 cells was noted (FIG. 21D). Genes ACOX1, ACOX3, and ACADS have been shown to drive crotonyl-CoA production and are regulated by PPARa21. Inhibition of PPARa shows a significant decreasein the expression of these genes as measured by qRT-PCR (FIG. 21C). The viral antigens alone reduced the expression of these genes suggesting the negative impact on crotonyl CoA levels (FIG. 21C). In contrast, 10-HSA led to significant increase in the expression of genes critical for crotonyl-CoA production following 6 hours of treatment (FIG. 21C).
[0228] To determine the timeline of 10-HSA-induced histone modifications, we analyzed SCDM cells and found that viral antigens suppress H3K18cr and H3K14ac signals within 25 minutes of exposure (FIGs. 21E and K). Within 25 minutes of 10-HSA treatment, a marked increased in H3K18cr signals was detected in cells exposed to viral antigens (FIG. 21A and E). The appearance of H3K14ac signal lagged by approximately 10 minutes and showed widespread positivity after 35 minutes of 10-HSA treatment (FIG. 21 A and E). This further suggests that histone crotonylation and acetylation are regulated by overlapping but distinct mechanisms. Histone crotonylation reached a saturation point after approximately 35 minutes while histone acetylation levels continued to increase up to 90 minutes (FIG. 21A and K).
[0229] To understand the potential changes in genomic transcriptional accessibility driven by histone crotonylation, we performed ChlP-seq utilizing a pan-crotonyl lysine antibody to monitor global genomic alterations in crotonyl binding sites in Caco2 cells. Pathway analysis utilizing GREAT of genes 5kb upstream and Ikb downstream of crotonyl binding sites in 10-HSA treated cells showed significant (p < 0.05) enrichment for aerobic electron transport chain (FIG. 21F). This is attributed to the unique mitochondrial genome binding sites of 10-HSA driven crotonylation not seen in untreated cells or cells treated with sodium crotonate (NaCr), a provider of non-metabolically derived crotonyl groups (FIGs. 21M-O). Of the top 16 significantly enriched genes in 10-HSA treated cells, 50% regulated ATP synthesis and overall ETC function (Extended Figure 8A). SLC25A22, a mitochondrial glutamate carrier was also significantly enriched in 10-HSA treated cells highlighting the impact on energy metabolism generated by 10-HSA treatment (FIG. 2 IM). To investigate the unique binding sites of 10-HSA treated cells, we cross-referenced enriched pathways between treatment groups (10-HSA, NaCr, No Treatment). NaCr-treated cells showed high levels of crotonylation across the genome and engagement of a broader spread of pathways than untreated cells or 10-HS A treated cells (FIGs. 12C and 21N). Untreated and NaCr-treated cells did not show enrichment of mitochondrial pathways (FIGs. 12D and 210). Utilizing HOMER to interrogate transcription factor binding sites between NaCr and 10-HSA treated cells showed remarkable differences between these two treatments. The 10-HSA treated cells showedenrichment for KLF4, RUNX1, and PAX7 motifs close to crotonyl binding sites while NaCr showed enrichment for SIX1, ETV4, and ZNF281 (FIG. 21H). We cross-referenced RNAseq data generated from 10-HSA treatment of SCDM exposed to viral antigens with the ChlP-seq data from 10-HSA treated cells. We found 54 significantly increased (FDR < 0.15, p < 0.05) genes associated with crotonyl binding sites within calcium ion transport, oxidative phosphorylation, and mitochondrial transmembrane transport pathways (FIG. 21G). Mitochondrial genes ATP8 and ND4 showed significantly heightened expression in 10-HSA treated viral antigen-exposed SCDM compared to the viral antigen exposure alone (FIG. 21P).
[0230] Histone crotonylation has been linked to reactivation of latent HIV. We investigated the effect of 10-HSA on the reactivation of HIV from latency by using the J-Lat 10.6 cell model for HIV long terminal repeat (LTR) activation. J-Lat cells were treated with NaCr for HIV LTR reactivation (FIG. 211). As expected, NaCr addition to the cells increased HIV LTR reactivation and displayed increased levels of GFP reporter levels (FIG. 211). However, 10-HSA treatment of J-Lat cells did not reactivate the HIV LTR. In fact, addition of 10-HSA to NaCr-treated cells inhibited the reactivation of HIV LTR (FIG. 211). These data further distinguished 10-HSA-induced histone crotonylation effects from those induced by NaCr- induced histone crotonylation. We also tested the effect of 10-HSA in J-Lat cells treated with phorbol 12-myristate 13-acetate (PMA). There was striking inhibition of PMA-induced HIV LTR reactivation by 10-HSA, suggesting that 10-HSA mediated dampening of the NF- KB pathway and inhibited HIV LTR reactivation. Collectively, these data uncover a novel and unique mechanism of histone crotonylation driven by a metabolite through PPARa signaling promoting energy metabolism in the virally inflamed ex vivo and in vitro environment.
[0231] 4. 10-HSA repaired gut epithelial barriers in SIV infected macaques in vivo through a PPARa signaling-histone crotonylation axis.
[0232] To determine the impact of 10-HSA treatment on gut repair and resilience, we evaluated SIV-infected rhesus macaques after 13 weeks of 10-HSA treatment (SIVpos-HSA, n = 3) and compared them to data from SIV infected untreated controls (SIVpos, n = 3), SIV infected animals receiving ART (SIVpos-ART, n = 3), and SIV-negative healthy controls (SIVneg, n = 3, FIG. 22A). SIVpos and SIVpos-HSA animals showed similar levels of plasma viremia indicating 10-HSA did not have direct anti-viral activity (FIG. 22B). As expected, a decrease in peripheral CD4+ T cell numbers occurred in these animals during SIV infection (FIG. 22C). The ART resulted in suppression of viremia and an increase in CD4+T cell numbers (FIGs. 22B-C). No significant differences were found in gut mucosal CD4+T cellpopulations of ART -naive SIVpos animals in the presence or absence of 10-HSA treatment (FIG. 22D, CD4, CD8 gating strategy FIG. 22H).
[0233] We investigated the effect of 10-HSA treatment on the gut epithelial barrier integrity and histone crotonylation in vivo. The intact gut epithelial barrier in SIVneg animals showed continual ZO-1 lattice structure while the epithelial barrier was fragmented in SIVpos animals (Figure 4E). SIVpos-HSA animals showed increased continuity of ZO-1 protein structure in the crypt and lower parts of the villus indicating increased localization to proliferating and differentiating epithelial cell compartments (FIG. 22E). Similarly, Claudin- 3 tight junction protein morphology was improved in SIVpos-HSA animals compared to SIVpos animals (FIG. 22K). The rescue of the epithelial ZO-1 structure was correlated with increased histone crotonylation in the proliferative crypts and villus structures in SIVpos-HSA animals (image not shown). The 10-HSA treatment induced marginal enhancement of histone acetylation (image not shown). We have previously reported that ART does not consistently or completely repair tight junction protein structure. Therefore, we examined the effects of 10- HSA treatment on intestinal permeability by measuring IFABP, a key marker of intestinal permeability, using ELISA and found decreased IFABP in the peripheral blood of SIVpos- HSA animals compared to SIVpos animals (FIG. 22F). Among all SIV infected animals, SIVpos-HSA animals showed the lowest amounts of IFABP in the peripheral blood (FIG. 22F). These data confirm the positive impact of 10-HSA on the gut barrier during active SIV infection.
[0234] We investigated the mucosal molecular networks of gut mucosal repair induced by 10-HSA treatment using RNAseq analysis. The principal component analysis (PCA) plot of transcriptional changes showed close clustering of SIVpos-HSA animals compared to SIVpos groups (plot not shown). SIVpos-HSA animals showed remarkably different gene expression patterns compared to SIVpos animals (FIG. 22G). SIVpos-HSA animals showed a significant upregulation of 1190 genes (FDR < 0.15, p < 0.05) compared to SIVpos animals. Pathway analysis utilizing Metascape showed significant enrichment of functional categories of mitochondrial translation and organization as well as DNA metabolism and cell cycle activation (plot not shown). Further analysis revealed significantly increased PPARa signaling in SIVpos 10-HSA animals (FIG. 22G). Expression of PPARa-regulated genes ECHS1, CPT1A, ACAD9, MRPL2, TEFM, NDUFB8 and FASN was significantly increased in SIVpos- HSA compared to SIVpos animals and are critical for fatty acid oxidation and mitochondrial function (FIG. 22H). ART promoted, but did not fully restore PPARa signaling especially forgenes FUT10, FASN, and NDUFB8 (FIG. 22H). SIVpos animals showed consistent downregulation of PPARa regulated genes (FIG. 22H) PPAR signaling has been shown to upregulate expression of IKB, the cytosolic inhibitor of NF-KB. SIVpos-HSA animals showed significant increase in NFKBIB transcripts, which encode the beta subunit of IKB, and subsequently a significant decrease in expression of several pro-inflammatory mediators (FIG. 22H). SIVpos animals showed a decrease in NFKBIB expression and a subsequent increase in pro-inflammatory cytokine expression (FIG. 22H). Although not significant, SIVpos-HSA animals showed a trend of increase for the gene expression regulating crotonyl-CoA production whereas in SIVpos animals, these genes were mostly downregulated (FIG. 22M). We also observed significant increase in KLF4 regulated genes in SIVpos-HSA animals, especially those pertaining to membrane organization. (FIG. 26A and C) KLF4 binding sites were identified as significantly enriched in 10-HSA ChlP-seq data and did not appear in the ChlP-seq data from NaCr or untreated cells. Observing an increase in KLF4 mediated gene expression in vivo supports the proposed mechanism of 10-HSA generated histone crotonylation (FIG. 26B).
[0235] We sought to understand the impact of 10-HSA treatment on gut epithelial function. Excitingly, we found a significant increase in the expression of genes previously identified to be critical for optimal epithelial function, including CLDN7, CLDN15, MUC2, and RETNLB (FIG. 22H). These genes are critical in maintaining epithelial integrity as well as innate response to infection. IL-22 driven STAT3 signaling showed significantly increased activity in 10-HSA treated animals. IL-22 induced downstream gene expression is critical in maintaining epithelial integrity and is decreased in SIVpos animals (FIG. 22H). CCR10 showed significant upregulation in SIVpos-HSA animals but not in SIVpos-ART animals compared to SIVpos animals (FIG. 22H). This protein has been shown to be present on Th22 cells and utilized for chemotaxis indicating a potentially enhanced Th22 response in SIVpos- HSA animals.
[0236] Gut function is measurable through the presence of specific metabolites in peripheral blood, especially citrulline and phosphatidylcholines. PLS-DA plot of data obtained by untargeted metabolomic profiling of serum samples showed clear separation between groups accounting for 41.1% of the data variance (FIG. 22 J). Citrulline biosynthesis occurs primarily in gut enterocytes and is a robust measurement of gut epithelial function. Metabolomic data demonstrated that animals treated with 10-HSA showed higher levels of citrulline, choline phosphate, and specific phosphatidylcholines (FIG. 22L). This indicates that10-HSA promoted gut epithelial function in the SIV-damaged mucosal environment. Serotonin levels increased in the peripheral blood of 10-HSA treated animals (FIG. 22L). Approximately 95% of serotonin is made in the gut which indicates gut function was enhanced with 10-HSA treatment. We observed a restructuring of tryptophan metabolism in 10-HSA treated animals (FIG. 22L). Not only did tryptophan betaine levels increase with 10-HSA treatment, but kynurenate levels decreased (FIG. 22L). HIV and SIV infections and disease progression are correlated with increased kynurenine metabolism and increased prevalence of Treg cells.
[0237] To determine the impact of 10-HSA treatment in the context of ART, we performed a study in which SIVpos animals were simultaneously treated with both ART and 10-HSA and effects on mucosal immune cells during early stages of treatment were evaluated (FIGs. 24N-P). Immunophenotypic analysis of mucosal cells was performed from colo-rectal biopsies from 10-HSA+ART SIVpos (n = 3) and ART treated SIVpos (n = 3) animals two weeks after starting their respective therapies at 6 weeks of post-SIV infection (FIG. 24N). 10- HSA+ART treated animals showed remarkable CD4+T cell recovery after just two weeks from the start of the treatments compared to only ART treated SIVpos animals (FIG. 240). We also found a significant decrease in CD8+T cell percentages in the colonic biopsies of 10- HSA+ART treated animals compared to only ART treated, accompanied by an increased CD4:CD8 ratio in animals receiving 10-HSA (FIG. 240).
[0238] 5. Long-term HIV infected nonprogressors have heightened mucosal PPARa signaling and histone crotonylation.
[0239] The gut mucosal landscape in LTNP consists of maintained epithelial integrity and renewal capacity with a functional gut microbiome. We sought to examine the role of energy metabolism and epigenetic modifications in the gut biopsies of LTNP individuals and compared with those from therapy-naive individuals with chronic HIV infection as well as HIVneg healthy controls. Immunohistochemical analysis of jejunal gut biopsies from LTNPs (n = 4, Undetectable viral load, >500 CD4+T cell count per pL peripheral blood, ART naive, clinically healthy), Chronically HIV infected individuals (HVL) (n = 3, >10,000 HIV RNA copies per mL plasma, 8-427 CD4+T cell count per pL blood, ART naive), and HIVneg healthy controls (n = 4) revealed an increase in histone crotonylation levels in the gut epithelium of the LTNP as compared to the HVL individuals (FIG. 22K).
[0240] The gene expression analysis of human gut biopsies from previously published datasets showed increased RNA levels of A COXI, ACOX3, and A CADS in LTNP compared to HVL and healthy controls (FIG. 22L). These genes were crucial for crotonyl generationthrough butyrate and fatty acid oxidation metabolism. Additionally, increased mucosal expression of genes responsible for mitochondrial ATP synthesis and fatty acid metabolism was detected in LTNP compared to HVL (FIG. 22L). Overall, robust PPARa signaling and increased expression of PPARa-activated genes regulating fatty acid metabolism and energy balance pathways was detected in LTNP (FIG. 22N). Collectively, our data showed the gut resilience and renewal capacity of LTNP occurs despite the presence of viral reservoirs which correlates with increased energy metabolism regulated through PPARa signaling and histone crotonylation. Our data also highlight the remarkable similarities in repair and renewal pathways of the gut immune landscape from 10-HSA treated SIV infected macaques and LTNP.
[0241] 6. 10-HSA rescued mitochondrial morphology and related gene expression in SIV inflamed gut in vivo.
[0242] To investigate the effect of 10-HSA on mitochondrial morphology in the gut epithelium during SIV infection without ART in vivo, we analyzed the mitochondria of epithelial cells in the small intestine of SIVpos-HSA animals using transmission electron microscopy. We previously reported the occurrence of circular morphology and loss of internal surface area and function of mitochondria in the gut epithelium during chronic SIV infection. As expected, SIV infected animals had more circular mitochondria compared to SlVneg controls (FIG. 23C). SIVpos-ART animals showed no significant change in mitochondrial circularity compared to SIVpos (FIG. 23C). 10-HSA treatment resulted in the restoration of tubular mitochondria but decreased overall mitochondrial area in the cell (FIG. 23A and C). We also observed increased calcium granules in the mitochondria of SIVpos-HSA animals compared to SIVpos animals (FIG. 23D). This indicates an increased capability of accumulating calcium phosphate as a result of increased membrane integrity. Transmission electron microscopy analysis confirmed that 10-HSA treatment led to restoration of the gut epithelial barrier integrity and reduced cell-cell junction disruption FIG. 23B). While ART significantly reduced the gap junction space compared to SIVpos animals, 10-HSA treatment showed the highest impact overall on cell adhesion (FIG. 23B).
[0243] Transcriptomic analysis of gut mucosal tissues revealed significant increases in mitochondrially related genes in SIVpos-HSA animals compared to SIVpos animals (FIG. 23E). Translation capabilities in the mitochondria were significantly increased during 10-HSA treatment (FIG. 23E). Mitochondrial ribosomal proteins were significantly upregulated with 10-HSA treatment indicating an increased capacity for mitochondrial translation (FIG. 23E).ART treatment did not fully restore transcription of genes pertaining to mitochondrial translation (FIG. 23E). Electron transport (ETC) genes showed significant upregulation in SIVpos-HSA animals especially those involved in complex I and IV (FIG. 23E). Expression of mitochondrial organization genes also showed a remarkable increase in SIVpos-HSA animals compared to both SIVpos and SIVpos-ART (FIG. 23E). Expression of multiple translocase of inner and outer mitochondrial membrane (TIMM, TOMM) was significantly increased indicating an enhanced capability for the mitochondria to transport proteins from the cytosol. POLG2 showed significant upregulation indicating an increased ability for the 10- HSA treated mitochondria to perform transcription of mtDNA (FIG. 23E). In addition, the significant upregulation of 6 mitochondrially encoded genes involved in ETC and ATP synthesis was observed (FIG. 23G). MT-ATP6 and MT-COX3 showed enrichment in the crotonyl ChlP-seq dataset and showed significant transcriptional upregulation compared to SIVpos animals in 10-HSA treated animals (FIG. 23G)
[0244] Metabolomic data showed promotion of mitochondrial function as a response to 10-HSA treatment (FIG. 23F). Laurate and adenosine monophosphate (AMP) showed significant decreases in SIVpos-HSA animals compared to SIVpos and SIVpos-ART while citrate showed significant increase (FIG. 23F). Increased blood laurate (dodecanoic acid) levels indicate a dysfunction in fatty acid oxidation. SIVpos animals show significantly elevated laurate levels in the blood and SIVpos-HSA animals show the lowest levels of the three groups (FIG. 23F). SIVpos animals show an increase in AMP levels in the blood likely due to an issue with their capability in converting AMP to ATP through ATP synthase (FIG. 23F). ATP synthase subunit ATP5F1D, showed decreased expression in SIVpos transcriptional data and significantly increased expression with 10-HSA treatment (FIG. 23E). Increased blood citrate levels in 10-HSA treated animals is reflective of a cellular energy surplus which allows for citrate to leave the mitochondria. Animals treated with 10-HSA show significantly higher blood citrate levels than SIVpos animals (FIG. 23F). Collectively, these data highlight the exceptional impact on mitochondrial health and functionality 10-HSA had in the SIVpos environment.
[0245] 7. 10-HSA prevented SIV induced alterations to host gut microbial communities.
[0246] SIV and HIV infections and disease progression are characterized by changes in the composition and complexity of the gut microbial communities and decreased prevalence of important probiotic microbes while increasing pathogenic bacterial expansion. We soughtto determine whether 10-HSA, which we hypothesize is microbially derived, was capable of altering the gut microbiome. The analysis of fecal microbiome using 16S sequencing, we determined the beta diversity by Bray-Curtis dissimilarity and found distinct changes in microbiome of the SIVpos, SIVpos-HSA, and SIVpos-ART animals with over 50% of the variance explained in the principal coordinate analysis (PCoA) plot (FIG. 24A). Alpha diversity as measured by Shannon index showed an increase in SIVpos-HSA animals compared to SIVpos (FIG. 24B). SIVpos-HSA treated animals showed a higher relative abundance of Firmicutes (i.e., Bacillota) compared to either SIVpos or SIVpos-ART animals (FIG. 24C). Firmicutes, in particular are known to be susceptible to SIV induced inflammation and 10-HSA treatment has demonstrated a remarkable capacity to sustain the abundance of this critical phylum.
[0247] We next performed linear discriminant analysis (LDA) effect size (LEfSe) to identify bacterial taxa enriched within each group (LDA Score > 2). SIVpos and SIVpos 10- HSA animals show clear separation in their gut microbial signatures as indicated by the LEfSe cladogram (FIG. 25A). SIVpos-HSA animals showed remarkable enrichment in Firmicute taxa, namely Streptococcus and Lactobacillus mucosae. Furthermore, SIVpos-HSA animals had enrichment of Verrucomicrobiales, Actinobacteriota (i.e., Actinomycetota), and Butyricicoccacaea taxa (FIG. 24D). Akkermansia muciniphilia, which was enriched in SIVpos- HSA animal gut microbiome, has been shown to promote PPARa signaling in the small intestine as well as promote tight junction and epithelial integrity. The Actinobacteriota phylum has been well known taxa which are crucial for gut epithelial homeostasis such as Bfidobacterium. The increased quantity of this phylum in SIVpos-HSA animals is reflective of a population of bacteria which promotes gut epithelial homeostasis (FIG. 24D). Butyricicoccacaea members, enriched in SIVpos-HSA animals, generate butyrate and have been shown to promote gut epithelial integrity in inflammatory conditions. SIVpos animals showed selective enrichment of Alphaproteobacteria, which is well documented in HIV and SIV as being an opportunistic pathogenic taxon that expands in response to the viral infection (FIG. 24D).
[0248] To gain better insight into the microbiome changes in depth, we performed metagenomic analysis of the microbial communities in the context of 10-HSA treatment in vivo. LEfSe analysis of the metagenomic sequencing data confirmed the alterations in enriched taxa between SIVpos and SIVpos-HSA animals (FIG. 24E). Phylum Proteobacteria (i.e., Pseudomonadota) showed selective enrichment in the SIVpos animals while SIVpos-HSAanimals showed increased Actinobacteria and Firmicute populations (FIG. 24E-F). Metagenomics allows for heightened species level resolution and we used this technique to discern the species of Firmicute and Actinobacteria significantly enriched (LDA > 2.0) in SIVpos-HSA animals compared to SIVpos animals. Lactobacillus species L. salivarius, L. mucosae, and L. animalis showed significant enrichment in SIVpos-HSA animals compared to SIVpos animals (FIG. 24F). Excitingly, Blautia obeum, a novel probiotic, showed significant enrichment as well (FIG. 24F). Overall, 12 species of Firmicutes and three species of Actinobacteria showed enrichment in SIVpos-HSA animals while SIVpos animals showed exclusive enrichment for the Proteobacteria phylum (FIG. 24F). The class of Bacilli and genus Lactobacillus showed increased relative abundance in 10-HSA treated animals compared to SIVpos animals (FIG. 24G). These data not only highlight the capability of 10-HSA treatment to resist the SIV induced microbial community alterations, but also show the increase in diversity of critical Firmicute and Actinobacteria species that are depleted during untreated SIV infection.
[0249] We sought to understand the differences in metabolic pathways between SIVpos and SIVpos-HSA gut microbiomes. Utilizing metagenomic sequencing we identified 135 significantly altered (FDR < 0.15, p < 0.05) bacterial enzyme genes when comparing SIVpos- HSA to SIVpos animals. PCA plot of metagenomics gene analysis showed clear clustering between SIVpos-HSA and SIVpos-ART groups, indicating a similar microbiome metabolism state (FIG. 24H). SIVpos animals showed a less distinct clustering and showed separation from the SIVpos-HSA and SIVpos-ART groups (FIG. 24H). SIVpos-HSA and SIVpos-ART showed remarkable similarities in differential gene expression compared to SIVpos animals (FIG. 25B). Genes coding for Thiamine Phosphokinase, CoA-Disulfide Reductase, and multiple carbohydrate metabolism enzymes showed significant upregulation in the SIVpos- HSA group compared to SIVpos (FIG. 25B). The majority of significantly altered genes for SIVpos-HSA and SIVpos-ART groups were downregulated compared to SIVpos (FIG. 25B). Genes encoding for Cytochrome C Nitrate Reductase, Formate Dehydrogenase, Peptidase DO, Oligopeptidase B, and Phospholipase D showed significant reduction in SIVpos-HSA animals compared to SIVpos (FIG. 25B). These enzymes have been shown to drive a pro-inflammatory state in the gut microbiome through production of ammonia, generation of pro-inflammatory cytokines, and granting competitive advantage to gram negatives in an inflamed gut microenvironment.
[0250] Further analysis of metagenomic data revealed oleate hydratase (OhyA) showed increased expression in L. johnsonii and L. mucosae as well as Blautia obeum in 10-HSA treated animals while SIVpos animals showed overall lower and mostly unclassified expression (FIG. 241). OhyA produces 10-HSA through hydration of oleic acid. Enoyl-CoA hydratase (ECUS) is critical for crotonyl-CoA production. The increased EHCS gene expression in Coprococcus catus in 10-HSA treated animals suggests the increase in observed crotonylation could be partially driven through gut microbiome activity in addition to fatty acid oxidation initiated by 10-HSA (FIG. 24 J). Acetate kinase expression, the driver of SCFA acetate production, also increased with 10-HSA treatment primarily driven by L. johnsonii and L. amylovorus (FIG. 24K). While the difference between groups was less dramatic than OhyA and ECHS these data highlight the increased prevalence and impact Lactobacillus species have in the 10-HSA treated gut environment.
[0251] LEISe analysis of significantly altered Metacyc pathways showed enrichment for metabolic pathways regulating fatty acid and carbohydrate metabolism in 10-HSA treated animals (FIG. 24L). Thiamine phosphate and Coenzyme A biosynthesis are critical for mitochondrial function and related pathways were significantly enriched in SIVpos-HSA animals compared to SIVpos (FIG. 24L).
[0252] Metagenomics data showed remarkable similarities between SIVpos-HSA and SIVpos-ART groups. To understand the differences, we conducted LEISe analysis comparing SIVpos-ART and SIVpos groups (FIG. 24M). SIVpos-ART showed increases in Lactobacillus species L. salivarus, and L. animalis but notably not L. mucosae (FIG. 24M). With the increase in other Firmicute species, ART treatment showed a significant return to a Firmicute dominant gut microbiome community composition (FIG. 24M). However, ART treated animals showed significantly increased Prevotella species P. CAG 1092 and P. AM4224 as well as Clostridium species C. CAG 167 and C. CAG 590 (FIG. 24M). HIV is characterized by the depletion of Firmicute and increase in Proteobacteria and Prevotella taxa. With the increased presence of Prevotella in SIVpos-ART animals, these data indicate ART is only partially capable of restoring the gut microbiome.
[0253] 8. Oral microbiome changes with 10-HSA treatment show consistent effect across mucosal sites.
[0254] The oral mucosa is a site of virally induced inflammation and altered microbial composition in HIV infection. We observed changes in beta diversity of oral microbiomes in SIVpos animals with and without 10-HSA treatment (FIG. 25C). Cladogram representation ofLEISe data shows marked difference in taxa enrichment between SIVpos-HSA and SIVpos animals (FIG. 25D). The SIVpos oral mucosa was highly enriched for Phocaeicola abscessus, a bacterium first identified in a brain abscess (FIG. 25E). In addition, the SIVpos oral mucosa is enriched for the order Burkholderiales, members of which include pathogenic Burkholderia, Bordatella, and Ralstonia (FIG. 25E). The SIVpos-HSA animal oral mucosal microbiome shows massive enrichment for Firmicutes (FIG. 25E). This suggests that 10-HSA promotes Firmicute abundance in the gut as well as oral mucosal sites showing remarkable consistency across mucosal sites. In SIVpos-HSA animals, Bifidobacteriales were enriched which are known to limit oral diseases by controlling growth of peridontopathogens (FIG. 25E). Overall, the oral mucosa of SIVpos and SIVpos-HSA animals shows distinct differences in taxa present and is comparable to the changes observed in the gut.
[0255] ChlP-seq (PRJNA1083621), macaque RNAseq and 16S seq (PRJNA1133740), macaque metagenomics sequencing (SRA Upload In Progress), and human stem cell derived monolayer RNAseq (PRJNA1133748) data generated for this study is available in the Sequence Read Archives (SRA) NCBI database, and are incorporated herein by reference in their entireties herein.
[0256] DISCUSSION
[0257] Our findings identify a metabolite, 10-HSA, which we hypothesize was produced during the initial microbial response to the virally inflamed gut microenvironment in vivo. It is known the oleate hydratase (OhyA) enzyme synthesizes 10-HSA from oleic acid and is present in L. plantarum and other microbes. No mammalian genome encodes OhyA thereby indicating the origin of 10-HSA is likely as a microbially-derived metabolite. 10-HSA- activated PPARa signaling and subsequently histone crotonylation lead to increased expression of genes regulating energy metabolism. Gut inflammation and epithelial disruption are major predictors of HIV related complications and hospital re-admissions and is potentially even more important than T cell related changes for disease prognosis. Suppressing inflammation and maintaining structural and functional epithelial integrity is crucial for regaining gut health and improving nutritional recovery. Our results suggest that 10-HSA treatment has great potential to reduce HIV-associated chronic inflammation and mediate gut epithelial repair as well as promote mucosal CD4+ T cell recovery as an adjunct therapy to ART.
[0258] PPARa signaling is impaired in HIV and SIV infections and is a likely therapeutic target to combat gut disruption. GaMD modeling combined with transcriptomicanalysis across multiple models showed that 10-HSA activated PPARa. We posit this activation is through direct ligand binding activity. Our findings show that 10-HSA caused a marked decrease in mucosal pro-inflammatory signaling in SIV infected macaques and inhibited PMA-induced reactivation of HIV LTR, confirming the capacity of 10-HSA to inhibit NF-KB activation. Furthermore, we show that increased PPARa signaling and downstream transcriptional impact in the gut mucosa is evident in LTNP individuals compared to therapy-naive individuals with progressive chronic HIV infection. These data strongly support the substantial role of PPARa in conferring host anti-viral defense.
[0259] We observed a significant increase in IL -22 and Th22 signatures in the transcriptome of 10-HSA treated animals with a stark increase in CCR10 levels. Th22 cells and subsequent IL -22 production are powerful regulators of gut epithelial homeostasis. Through the combination of increased energy metabolism and increased IL -22 signaling, 10- HSA promoted gut epithelial barrier repair in vivo and in vitro. Impressively, 10-HSA treatment prompted changes in mitochondrial biogenesis, gut epithelial repair and reversal of microbial dysbiosis occurred in therapy naive animals and were more pronounced than changes in SIVpos animals receiving ART. Collectively, our data show promise for combining 10-HSA treatment along with ART for accelerated mucosal recovery and dampening of inflammation by leveraging PPARa activation.
[0260] SIVpos-HSA animals showed remarkable capacity in resisting the increase of proteobacteria and the loss of Firmicute populations generated during HIV and SIV disease progression. These bacteria, namely A. muciniphilia, L. animalis, L. salivarus, and L. mucosae as well as members of the family Butyricioccaceae showed significant increase in SIVpos- HSA compared to SIVpos animals and are critical in supporting an intact and functioning gut epithelium capable of resisting the impact of the SIV infection. Through metagenomic interrogation of microbial enzyme genes, we discovered significant increase in fatty acid and carbohydrate metabolism related pathways in microbiomes of SIVpos-HSA animals. Increased microbial glycolysis related genes were detected which drives short chain fatty acids production and can promote host immune response and gut mucosal viral defense capabilities. Genes encoding oleate hydratase, enoyl-CoA hydratase and acetate kinase were upregulated in the gut microbiomes of SIVpos-HSA animals compared to SIVpos animals. This suggests increased potential for the 10-HSA treated microbiome to generated more 10-HSA and SCFA as well as enhanced histone crotonylation.
[0261] The role of novel epigenetic short chain lysine acylation and histone crotonylation remains understudied in the context of gut inflammatory diseases and infectious diseases. We demonstrate for the first time that 10-HSA induced PPARa activation regulated histone crotonylation, promoted mitochondrial gene expression and restores the capacity of cellular aerobic respiration. Because crotonyl groups are derived from fatty acid metabolism, histone crotonylation serves as a cellular marker of increased mitochondrial function and energy balance. Gut biopsies from LTNP showed heightened histone crotonylation levels and increased gene expression promoting crotonyl-CoA production. Our data show that the maintenance of energy and fatty acid metabolism is crucial in promoting the gut microenvironment landscape in which the host can successfully mitigate virally induced mucosal damage through repair and renewal pathways. This study advances knowledge of how histone crotonylation impacts energy metabolism and identifies it as a prime target for promoting host mucosal defense. Our study presents new insights on the impact of 10-HSA on gut repair through epigenetic modification and PPARa signaling in the virally inflamed gut leading to gut microbial community resilience. For the first time, we offer evidence that the novel concept of utilizing microbially derived metabolites instead of live bacteria is a viable and effective method for treating the virally inflamed gut.
[0262] MATERIALS AND METHODS
[0263] Rhesus macaque study design and sample collection. As described in Example I.
[0264] Cells and treatments. Caco2 cells (ATCC), small-intestinal epithelial stem cell derived epithelial monolayers from human patient samples, and J-Lat 10.6 cells (Cellosaurus) were used in the study. Caco2 cells were cultured as previously described. Stem cell derived monolayers (provided by Phillip Smith Lab University of Alabama at Birmingham) were cultured in DMEM (Gibco) with 5% mouse fibroblast LWRN conditioned media (Manufacture in-house), 1% Nicotinamide (Sigma), 1% Fungizone (Fisher), 0.1% Y-27632 (Fisher), and 0.1% Gentamicin (Sigma). Both cell lines were treated with gpl20 (lug / mL) and tat (1.4ug / mL) to induce inflammatory conditions (NIH HIV reagent program). 10-hydroxystearic acid (AstaTech) was water bath sonicated in cell culture media to emulsify and administered at 500pM. Sodium crotonate (NaCr) was administered at 20mM. Cells were treated with 480nM PPARa antagonist GW6471 (Abeam) and 8nM PPARa agonist GW590735 (Abeam) as according to the ECD50 dose for each molecule for 6 hours. PPARa agonist and antagonist were resuspended in DMSO according to manufacturer guidelines and diluted in cell culturemedia. J-Lat cells were cultured as previously described. J-Lat cells were treated with Ipg / mL phorbol 12-myristate 13-acetate (PMA) and 20mM NaCr in RPMI supplemented with 10% FBS and 1% penicillin / streptomycin for 18 hours to activate HIV-LTR GFP signal. Cells were co-treated with 500pM 10-HSA.
[0265] Immunofluorescence. After described treatments for in vitro and ex vivo assays, media was removed, and cells were fixed and permeabilized as previously described. Antibodies used for immunostaining can be found in Table 3. Cells were stained with DAPI and mounted with Prolong Diamond Antifade mounting media (Invitrogen). Experiments were run in duplicate. Macaque gut tissue samples (n = 3 per group) were fixed as previously described and stained with antibodies found in Table 3. Nuclei were stained with DAPI and mounted with Prolong Diamond Antifade mounting media (Invitrogen). All quantification was performed blinded to reduce bias. Experiments were run in duplicate.
[0266] Fluorescent Imaging. Imaging was performed with the Leica TCS SP8 STED 3X confocal microscope at 40x and 20x magnification. Regions of interest were selected based on consistent cell density or consistent tissue morphology. Four images were taken at random points to ensure accurate representation of the cellular or tissue response to treatment. For quantification of immunofluorescence images, raw files were analyzed for mean fluorescence intensity (MFI) using ImageJ / FIJI (version 2.3.0). For in vitro analysis, 10 random cells per image were outlined and their MFI was quantified. For in vivo analysis, 20-40 regions of interest were quantified per treatment group depending on availability in the tissue. For H3K18cr and ZO-1 rhesus macaque tissue MFI analysis, 25 random regions per animal containing crypts and villi were imaged and analyzed for fluorescent signal (n=3 animals per treatment group). For ZO-1 displayed in 6, color was originally red and altered in ImageJ to yellow to accommodate color blind readers and prevent green and red in the same image.
[0267] Reactive oxygen species (ROS) fluorescent detection assay. As described above.
[0268] Quantitative real-time PCR. Total RNA for Caco2 and stem cell derived monolayers was isolated and converted to cDNA as previously described. Primers used are contained in Table 2. RT-qPCR was conducted as previously described. Caco2 samples were run in triplicate and SCDM samples were run in duplicate. Beta Actin was used as housekeeping gene. Signals were reported as Log2 Fold change over untreated cells using AACT method.Table 2: Primers used
[0269] Electron microscopy. As described above.
[0270] ChlP-seq. Chromatin immunoprecipitation was performed using the ChlP-IT Express Kit (Active Motif). Caco2 cells were seeded on 175 cm2flasks at a density of 3 x 106cells. Once at 90% confluency, cells were treated for 6 hours with 10-HSA, NaCr, or No Treatment, fixed with 11% formaldehyde, and manually lysed with a Dounce homogenizer. Approximately 2 x 107cells were used per treatment. Sonication was conducted using the Covaris E220 Focused-ultrasonicator (Covaris) for 480 seconds at the UC Davis DNA Technologies Core. To precipitate chromatin associated with crotonyl binding, the ChIP validated pan anti-crotonyllysine rabbit pAb antibody was used (PTM-501 PTM Biolabs Inc.). 25 ng of chromatin was used per ChIP reaction. Library preparation was conducted with KAPA HyperPrep Kit (Roche Sequencing) and sequenced using the Illumina NextSeq 550 system PE40 with a Q30 > 87% (Illumina, Inc) at the UC Davis DNA Tech Core PE40 with 20 million reads per sample. Sequence was mapped to human genome hg38. To determine significantly enriched regions of the genome in each treatment, peak calling using Genrich and MACS2 was conducted against input DNA control with usegalaxy.org. The Genomic Regions Enrichment of Annotations Tool (GREAT) web application from Stanford was used to determine genes associated with each peak. GREAT was used to determine significantly enriched biological and molecular pathways. IGV was used to visualize genome wide peaks. HOMER was used to identify enriched transcription factor binding sites for each group.
[0271] Flow cytometry. Flow Cytometry was performed with the aid of the UC Davis Flow Core to determine J-Lat HIV LTR activation after treatment with 10-HSA or sodium crotonate or PMA after 18 hours. Cells were washed with lx PBS and dyed with DAPI to determine viability and gates were created to isolate live GFP positive cell populations from each group. Analysis was conducted on FlowJo 10.8.2. Treatments were run in triplicate. Flowcytometric analysis of macaque lamina propria lymphocytes was performed to determine the distribution of T cells in jejunal LPL samples at the CNPRC. Cells were isolated from LPLs at necropsy timepoint and washed with IxPBS. Cells were incubated with pre-conjugated antibody mix for 30 minutes at 4 degrees. Cells were washed and fixed with 4% PFA. Dead cells were excluded from each analysis. Gating strategy shown FIG. 22H. All antibodies used are shown in Table 3.TABLE 3: Antibodies used
[0272] Seahorse OCR. Caco2 cells were seeded at 150,000 per well in the XFe96 well cell culture plate (Agilent) in growth media. Cells were allowed to grow for 24 hours to adhere to plate. 5 hours prior to analysis, media was changed to MEM with 5mM glucose, 2mM pyruvate, and ImM glutamine containing no phenol red or sodium bicarbonate along with viral antigens, 10-HSA, and GW6471. 3-6 replicates were used per timepoint per treatment. For PPARa inhibitor assay cells were seeded at 150,000 per well in the XFe96 well cell culture plate and allowed to adhere for 24 hours. 30 minutes before analysis cells were treated with 10-HSA, viral antigens, and GW6471 PPARa. OCR (pmol / min) was recorded over 75 minutes with addition of 2.5 pM Oligomycin, 2 pM FCCP, and 0.5 pM Rotenone / Antimycin A.
[0273] Luminescent ATP assay. Relative ATP production was analyzed using Caco2 cells treated with 10-HSA and Viral antigens for 24 hours with the Luminescent ATP Detection Assay Kit (Abeam) and analyzed with UVP BioSpectrum Imaging System (UVP). Protocol was performed according to manufacturer specifications. Luminescent signal was quantified in ImageJ 2.3.0. Each treatment consisted of 9 replicates.
[0274] TEER. Caco2 cells were seeded in the Transwell Permeable Support 6.5mm Insert plate (Costar) and treated with 10-HSA and viral antigens for 24 and 48 hours. Treatments were removed and cell culture media was placed all wells. Electric resistance was immediately tested for trans epithelial electrical resistance by use of Millicell ERS-2 Voltohmmeter with the MERSSTX01 Electrode (Millipore Sigma). Experiment was run in triplicate.
[0275] Luciferase reporter gene assay. Assays for determining the activation of PPARa, were performed by Indigo Biosciences (PA, USA). Reporter Cells used is this study express either the native receptor or a receptor hybrid in which the native N-terminal DNA binding domain (DBD) has been replaced with that of the yeast Gal4 DBD. The reporter gene, firefly luciferase, is functionally linked to upstream receptor-specific genetic response elements (GRE) or the Gal4 upstream activation sequence (UAS). A suspension of Reporter Cells was prepared in INDIGO’s Cell Recovery Medium (CRM; containing 10% Charcoalstripped FBS). 100 pL of the Reporter cell suspension was dispensed into wells of a white 96- well assay plate and treated with 10-HSA (1.92 nM, 9.60 nM, 48.0 nM, 240 nM, 1.2pM, 6pM, and 30pM) for 24 hours. Following the incubation period, treatment media were discarded and100 pL / well of Luciferase Detection Reagent was added per well to determine receptor activity in terms of relative luminescence units (RLUs). Receptor agonist GW7647 was used was used as PPARa positive control. Media control (with DMSO 0.1%) served as negative control. Chinese hamster ovary cells (CHO) were the cell line used.
[0276] 10-HSA quantity in ileal contents. Mass spectrometry was performed as described above to identify enriched metabolites.
[0277] Gut microbiome 16S and metagenomic sequencing and analysis. 16S sequencing protocol was conducted as previously described. Colo-rectal swabs for 10-HSA and SIVpos animals were taken at necropsy (12 weeks post infection). ART animals necropsy samples were taken at 24 weeks post infection. SIVneg animals were derived from preinfection colo-rectal swabs of the SIVpos, 10-HSA, and ART animals. One SIVpos animal preinfection colo-rectal swab was not available therefore n = 8 for SIVneg. QIIME2 analysis was utilized to determine Bray-Curtis Beta diversity and Shannon alpha diversity data. LEISe analysis of level 7 QIIME2 taxonomic data was used to generate cladogram and LDA plots (a< 0.15, w < 0.05. LDA > 2). Metagenomic library prep and sequencing was conducted by the UC Davis DNA Technologies Core. Low quality bases, reads, and sequencing adaptors were filtered from paired end shotgun metagenomic reads using cutadapt (v 2.6, minimum-length: 50 max-n: 1 q: 30). Quality controlled reads were then aligned to the rhesus macaque genome (Mmul_10: GCA_003339765.3) with bowtie2 (v 2.5.1, sensitive end-to-end alignment) and unaligned reads were input into HUMAnN3 (v 3.0.1) for taxonomic and functional profiling. Resulting gene abundance tables were normalized, (counts per million), joined, and used for downstream analysis. LEfSe analysis was performed on metagenomic data to identify significantly (a < 0.15, w < 0.05, LDA > 2) altered taxa and pathways. Limma.voom was utilized to identify differential counts of microbial enzyme genes with significance cutoff EDR< 0.15, p < 0.05.
[0278] GaMD Simulations. The structural templates for both PPARa were retrieved from the Protein Data Bank (PDB) identifier 6KAX. Any incomplete regions, including missing residues and heavy atoms, were reconstructed using Modeller 10.4. For the ligands, interaction parameters were defined following the general AMBER force field (GAFF2), with parameters refined through CHARMM-GUI. The simulations used the OPC water model and physiological concentrations of NaCl. To balance the total system charge, two Na+ counter ions were added. Protein residues were modeled using the FF19SB force field. The PPARa- 10-HSA complexes were subjected to an initial energy minimization employing 2500 stepseach of steepest descent and conjugate gradient. Following this, each system was gradually heated from 0 to 300 K over a 30 ps interval under constant volume using a Langevin thermostat with 1 fs time step and a collision frequency of 2 ps-1. Initial velocities were assigned based on the Maxwell-Boltzmann distribution. Throughout this phase, weak restraints were maintained on the heavy atoms of both the solute and the ligand, with the restraint strength methodically reduced from 100 kcal / molA2to 10, then to 1, and finally to 0.1 kcal / molA2before being completely removed. This progressive reduction facilitated the relaxation of the system, preparing it for subsequent steps without restricted molecular movement. Following the heating phase, each system underwent equilibration in the isothermal-isobaric (NPT) ensemble at a constant temperature of 310 K and pressure of 1 atm. Pressure was regulated using an isotropic Berendsen barostat with a relaxation time of 2 ps, ensuring smooth pressure adjustments. Nonbonded interactions were handled with a 10 A cutoff, and long-range electrostatic interactions were computed using the Particle Mesh Ewald (PME) method to accurately represent electrostatic forces across the simulation box. Additionally, the SHAKE algorithm was employed to constrain all hydrogen bonds to their equilibrium lengths, maintaining structural integrity while allowing other atomic movements. We implemented GaMD simulations using the GaMD module available in the GPU-enhanced AMBER22 software. Production simulations were facilitated by integrating Newton's equations with a timestep of 2 fs. Initially, our systems were equilibrated for 100 ns within the NPT ensemble following protocols similar to those previously mentioned, albeit without applying any restraints. This phase was followed by a 65 ns period where a boost potential was introduced, serving to gather acceleration potential parameters essential for GaMD. Subsequently, five independent runs were performed in the NVT ensemble. During these production simulations, initial atomic velocities were randomized to ensure sampling. For these simulations, a dual-boost approach was employed. This involved applying one boost potential to the dihedral energy term and another to the total potential energy term, with the threshold energy set to the lower bound, E = Vmax. We recorded the average and standard deviation (SD) of the potential energies at every 200,000 steps, equivalent to 400 ps, setting the upper limit for the boost potential SD, oO, at 6.0 kcal / mol for both assessed energy terms. To visualize and analyze the trajectories from these GaMD simulations, we utilized a combination of software tools. VMD (Version 1.9.4a57) and PyMol Version 3.0 Schrodinger, LLC were employed for generating visual trajectory and interactions.
[0279] Global metabolomic profiling. Untargeted metabolomic profiling of peripheral blood was performed by Metabolon Inc. 500pL of serum isolated from peripheral blood was submitted from each animal in each group (SIVpos, SIVpos-HSA, SIVpos-ART, n = 3 per group). Data was analyzed as previously described. To evaluate the effects of 10-HSA treatment, SIVpos-HSA, SIVpos, and SIVpos-ART groups were normalized together and PLS- DA and bar charts were created based on significantly altered metabolites (p < 0.05). Normalization and analysis were performed using MetaboAnalyst online software.
[0280] 3’ RNA-Seq, Transcriptome Alignment, and Pathway Analysis. RNA extraction and sequencing were performed as previously described with minor alterations. Sequencing was performed on AVITI sequencer. Library prep performed by DNA Tech Core for 3’ TAG sequencing. 4 million reads per sample, Q30 > 95%. Pathway enrichment was done with Metascape.org. Genes were assigned significant (p < 0.05, FDR < 0.15, Log2FC + / - 0.75) and utilized for downstream pathway analysis with metascape. Pathway analysis was based on genes significantly altered between SIVpos-10-HSA vs SIVpos groups or 10-HSA+Gpl20+tat vs Gpl20+tat treated cells. Those identified genes were then compared across other relevant groups.
[0281] Human Study Subjects and Sample Collection. Five ART -naive seropositive LTNP individuals, four HIV negative, and three HIV positive high viral load patients were enrolled in this study. Parameters for each group are defined in the main text. Endoscopic jejunal biopsies were taken and cryo-preserved for immunofluorescence. The Institutional Review Board at UC, Davis approved the study, and written informed consent was obtained from the participants of the study. This study further analyzed data underlying previous publications.
[0282] Microarray Analysis. Conducted as previously described using LTNP (n = 3), HVL (n = 4), and HIV negative (n =4).
[0283] Statistical analysis. Data shown represents the mean ± SEM calculated by using all data points unless otherwise stated. Statistical significance was determined through unpaired t-tests when comparing values between two groups. One-way ANOVA was used to determine treatment effect between multiple groups. P-values of < 0.05 were considered significant. All analysis was performed on GraphPad Prism (v9.4.0).REFERENCESAl Masalma, M., Raoult, D. & Roux, V. Phocaeicola abscessus gen. nov., sp. nov., an anaerobic bacterium isolated from a human brain abscess sample. Int J Syst Evol Microbiol 59, 2232-2237, (2009). Apetrei, C. et al. T cell activation is insufficient to drive SIV disease progression. JCI Insight 8, (2023). Applegate, T.J., et al., Effect of aflatoxin culture on intestinal function and nutrient loss in laying hens. Poult Sci, 2009. 88(6): p. 1235-41. Appleton, J. The Gut-Brain Axis: Influence of Microbiota on Mood and Mental Health. Integr Med (Encinitas) 17, 28-32 (2018). Athiyyah, A.F., et al., Effect of Lactobacillus plantarum IS-10506 on blood lipopolysaccharide level and immune response in HIV-infected children. Iran J Microbiol, 2019. 11(2): p. 137-144. Baumann, K. Post-translational modifications: Crotonylation versus acetylation. Nat Rev Mol Cell Biol 16, 265, (2015). Bemardes, A. et al. Molecular mechanism of peroxisome proliferator-activated receptor alpha activation by WY 14643: a new mode of ligand recognition and receptor stabilization. J Mol Biol 425, 2878-2893, (2013). Bhat, A.A., et al., Tight Junction Proteins and Signaling Pathways in Cancer and Inflammation: A Functional Crosstalk. Front Physiol, 2018. 9: p. 1942. Binda, C. et al. Actinobacteria: A relevant minority for the maintenance of gut homeostasis. Dig Liver Dis 50, 421-428, (2018). Blazquez-Bondia, C. et al. Probiotic effects on immunity and microbiome in HIV-1 discordant patients. Front Immunol 13, 1066036, (2022). Brenchley, J.M., et al., CD4+ T cell depletion during all stages of HIV disease occurs predominantly in the gastrointestinal tract. J Exp Med, 2004. 200(6): p. 749-59. Brooks, B. R. et al. CHARMM: the biomolecular simulation program. J Comput Chem 30, 1545-1614, (2009). Capaldo, C.T., D.N. Powell, and D. Kalman, Layered defense: how mucus and tight junctions seal the intestinal barrier. J Mol Med (Berl), 2017. 95(9): p. 927-934. Chaudhary, S., et al., Mitochondrial biogenesis gene POLG correlates with outcome in pediatric acute myeloid leukemia. Leuk Lymphoma, 2022. 63(4): p. 1005-1008.Chen, X., K. Naehrer, and T.J. Applegate, Interactive effects of dietary protein concentration and aflatoxin Bl on performance, nutrient digestibility, and gut health in broiler chicks. Poult Sci, 2016. 95(6): p. 1312-25. Chen, Y, et al., Interaction Between Commensal Bacteria, Immune Response and the Intestinal Barrier in Inflammatory Bowel Disease. Front Immunol, 2021. 12: p. 761981. Chittim, C. L., Martinez Del Campo, A. & Balskus, E. P. Gut bacterial phospholipase Ds support disease-associated metabolism by generating choline. Nat Microbiol 4, 155-163, (2019). Chung, C.Y., et al., Progressive proximal-to-distal reduction in expression of the tight junction complex in colonic epithelium of virally-suppressed HIV+ individuals. PLoS Pathog, 2014. 10(6): p. 61004198. Clark, E., et al., Interferon gamma induces translocation of commensal Escherichia coli across gut epithelial cells via a lipid raft-mediated process. Gastroenterology, 2005. 128(5): p. 1258-67. Coetzer, T. H., Goldring, J. P. & Huson, L. E. Oligopeptidase B: a processing peptidase involved in pathogenesis. Biochimie 90, 336-344, (2008). Crakes, K. R. & Jiang, G. Gut Microbiome Alterations During HIV / SIV Infection: Implications for HIV Cure. Front Microbiol 10, 1104, (2019). Crakes, K.R., et al., PPARalpha-targeted mitochondrial bioenergetics mediate repair of intestinal barriers at the host-microbe intersection during SIV infection. Proc Natl Acad Sci U S A, 2019. 116(49): p. 24819-24829. Dai, Z., V. Ramesh, and J.W. Locasale, The evolving metabolic landscape of chromatin biology and epigenetics. Nat Rev Genet, 2020. 21(12): p. 737-753. Degenhardt, T., et al., Three members of the human pyruvate dehydrogenase kinase gene family are direct targets of the peroxisome proliferator-activated receptor beta / delta. J Mol Biol, 2007. 372(2): p. 341-55. Deleu, S., Machiels, K., Raes, J., Verbeke, K. & Vermeire, S. Short chain fatty acids and its producing organisms: An overlooked therapy for IBD? EBioMedicine 66, 103293, (2021). d'Ettorre, G., et al., HIV persistence in the gut mucosa of HIV- infected subjects undergoing antiretroviral therapy correlates with immune activation and increased levels of LPS. Curr HIV Res, 2011. 9(3): p. 148-53.Dey, D.K., S.N. Chang, and S.C. Kang, The inflammation response and risk associated with aflatoxin B 1 contamination was minimized by insect peptide CopA3 treatment and act towards the beneficial health outcomes. Environ Pollut, 2021. 268(Pt B): p. 115713. Dillon, S.M., et al., An altered intestinal mucosal microbiome in HIV-1 infection is associated with mucosal and systemic immune activation and endotoxemia. Mucosal Immunol, 2014. 7(4): p. 983-94. Elesela, S. and N.W. Lukacs, Role of Mitochondria in Viral Infections. Life (Basel), 2021. 11(3). Elias-Oliveira, J., et al., NLR and Intestinal Dysbiosis-Associated Inflammatory Illness: Drivers or Dampers? Front Immunol, 2020. 11: p. 1810. Fakharian, F., et al., The Role of Gut Dysbiosis in the Loss of Intestinal Immune Cell Functions and Viral Pathogenesis. Microorganisms, 2023. 11(7). Fan, J., et al., Metabolic regulation of histone post-translational modifications. ACS Chem Biol, 2015. 10(1): p. 95-108. Fang, Y, et al., Histone crotonylation promotes mesoendodermal commitment of human embryonic stem cells. Cell Stem Cell, 2021. 28(4): p. 748-763 e7. Fanning, A.S., T.Y. Ma, and J.M. Anderson, Isolation and functional characterization of the actin binding region in the tight junction protein ZO-1. FASEB J, 2002. 16(13): p. 1835-7. Fellows, R. and P. Varga- Weisz, Chromatin dynamics and histone modifications in intestinal microbiota-host crosstalk. Mol Metab, 2020. 38: p. 100925. Fellows, R., et al., Microbiota derived short chain fatty acids promote histone crotonylation in the colon through histone deacetylases. Nat Commun, 2018. 9(1): p. 105. Fragkos, K. C. & Forbes, A. Citrulline as a marker of intestinal function and absorption in clinical settings: A systematic review and meta-analysis. United European Gastroenterol J 6, 181-191, (2018). Fulcher, J. A. Is the Oral Microbiome Important in HIV-Associated Inflammation? mSphere 5, (2020). Geerlings, S. Y, Kostopoulos, I., de Vos, W. M. & Belzer, C. Akkermansia muciniphila in the Human Gastrointestinal Tract: When, Where, and How? Microorganisms 6, (2018).Geimaert, A. et al. Butyricicoccus pullicaecorum, a butyrate producer with probiotic potential, is intrinsically tolerant to stomach and small intestine conditions. Anaerobe 30, 70-74, (2014). Genovese, T. et al. Role of peroxisome proliferator-activated receptor-alpha in acute pancreatitis induced by cerulein. Immunology 118, 559-570, (2006). Glover, J.S., T.D. Ticer, and M.A. Engevik, Characterizing the mucin-degrading capacity of the human gut microbiota. Sci Rep, 2022. 12(1): p. 8456. Gootenberg, D. B., Paer, J. M., Luevano, J. M. & Kwon, D. S. HIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation. Curr Opin Infect Dis 30, 31-43, (2017). Gosmann, C. et al. Lactobacillus-Deficient Cervicovaginal Bacterial Communities Are Associated with Increased HIV Acquisition in Young South African Women. Immunity 46, 29-37, (2017). Gowans, G.J., et al., Recognition of Histone Crotonylation by Tafl4 Links Metabolic State to Gene Expression. Mol Cell, 2019. 76(6): p. 909-921 e3. Grosdidier, A., V. Zoete, and O. Michielin, Past docking using the CHARMM force field with EADock DSS. J Comput Chem, 2011. 32(10): p. 2149-59. Grosdidier, A., V. Zoete, and O. Michielin, SwissDock, a protein-small molecule docking web service based on EADock DSS. Nucleic Acids Res, 2011. 39(Web Server issue): p. W270-7. 92. Guadalupe, M. et al. Severe CD4+ T-cell depletion in gut lymphoid tissue during primary human immunodeficiency virus type 1 infection and substantial delay in restoration following highly active antiretroviral therapy. J Virol 77, 11708-11717, (2003). Guamieri, J.W., et al., Core mitochondrial genes are down-regulated during SARS- CoV-2 infection of rodent and human hosts. Sci Transl Med, 2023. 15(708): p. eabql533. Gujral, P., et al., Histone acetylation and the role of histone deacetylases in normal cyclic endometrium. Reprod Biol Endocrinol, 2020. 18(1): p. 84. Hirao, L.A., et al., Early mucosal sensing of SIV infection by paneth cells induces IL-lbeta production and initiates gut epithelial disruption. PLoS Pathog, 2014. 10(8): p. 61004311.Hong, Y.F., et al., Lipoteichoic acid isolated from Lactobacillus plantarum down- regulates UV- induced MMP-1 expression and up-regulates type I procollagen through the inhibition of reactive oxygen species generation. Mol Immunol, 2015. 67(2 Pt B): p. 248-55. Hu, M.D. and K.L. Edelblum, Sentinels at the frontline: the role of intraepithelial lymphocytes in inflammatory bowel disease. Curr Pharmacol Rep, 2017. 3(6): p. 321-334. Huang, L., et al., Reduction of Aflatoxin Bl Toxicity by Lactobacillus plantarum C88: A Potential Probiotic Strain Isolated from Chinese Traditional Fermented Food "Tofu". PLoS One, 2017. 12(1): p. e0170109. Hughes, E. R. et al. Microbial Respiration and Formate Oxidation as Metabolic Signatures of Inflammation-Associated Dysbiosis. Cell Host Microbe 21, 208-219, (2017). Hunter, J.E., J. Zhang, and P.M. Kris-Etherton, Cardiovascular disease risk of dietary stearic acid compared with trans, other saturated, and unsaturated fatty acids: a systematic review. Am J Clin Nutr, 2010. 91(1): p. 46-63. Iljazovic, A., et al., Perturbation of the gut microbiome by Prevotella spp. enhances host susceptibility to mucosal inflammation. Mucosal Immunol, 2021. 14(1): p. 113- 124. Ishihara, T., et al., Mitochondrial nucleoid trafficking regulated by the inner- membrane AAA-ATPase ATAD3A modulates respiratory complex formation. Proc Natl Acad Sci U S A, 2022. 119(47): p. e2210730119. Jha, A., et al., Protective effect of black tea infusion on aflatoxin-induced hepatotoxicity in mice. J Clin Exp Hepatol, 2013. 3(1): p. 29-36. Jiang, G., et al., HIV latency is reversed by ACS S2 -driven histone crotonylation. J Clin Invest, 2018. 128(3): p. 1190-1198. Jiang, G., Li, C., Lu, M., Lu, K. & Li, H. Protein lysine crotonylation: past, present, perspective. Cell Death Dis 12, 703, (2021). Jolly, P.E., et al., Association between high aflatoxin B(l) levels and high viral load in HIV-positive people. World Mycotoxin J, 2013. 6(3): p. 255-261. Jubie, S., et al., Synthesis, antidepressant and antimicrobial activities of some novel stearic acid analogues. Eur J Med Chem, 2012. 54: p. 931-5.Jukic, I., et al., Camosine, Small but Mighty-Prospect of Use as Functional Ingredient for Functional Food Formulation. Antioxidants (Basel), 2021. 10(7). Kamata, S. et al. PPARalpha Ligand-Binding Domain Structures with Endogenous Fatty Acids and Fibrates. iScience 23, 101727, (2020). Keir, M., Yi, Y, Lu, T. & Ghilardi, N. The role of IL-22 in intestinal health and disease. J Exp Med 217, e20192195, (2020). Kemp, P. M., Little, B. B., Bost, R. O. & Dawson, D. B. Whole blood levels of dodecanoic acid, a routinely detectable forensic marker for a genetic disease often misdiagnosed as sudden infant death syndrome (SIDS): MCAD deficiency. Am J Forensic Med Pathol 17, 79-82, (1996). Kennelly, J. P. et al. Intestinal de novo phosphatidylcholine synthesis is required for dietary lipid absorption and metabolic homeostasis. J Lipid Res 59, 1695-1708, (2018). Kim, M.S., et al., Tumor necrosis factor and interleukin 1 decrease RXRalpha, PPARalpha, PPARgamma, LXRalpha, and the coactivators SRC-1, PGC-1 alpha, and PGC-lbeta in liver cells. Metabolism, 2007. 56(2): p. 267-79. Kivisto, R., et al., Characterization of multiple Helicobacter bizzozeronii isolates from a Finnish patient with severe dyspeptic symptoms and chronic active gastritis. Helicobacter, 2010. 15(1): p. 58-66. Klase, Z. et al. Dysbiotic bacteria translocate in progressive SIV infection. Mucosal Immunol 8, (2015). Kocabas, C.N., et al., The effects of aflatoxin Bl on the development of kwashiorkor in mice. Hum Exp Toxicol, 2003. 22(3): p. 155-8. Landovitz, R. J., Scott, H. & Deeks, S. G. Prevention, treatment and cure of HIV infection. Nat Rev Microbiol 21, 657-670, (2023). Levy, M., C.A. Thaiss, and E. Elinav, Metabolites: messengers between the microbiota and the immune system. Genes Dev, 2016. 30(14): p. 1589-97. Li, X., et al., Viral Infection Modulates Mitochondrial Function. Int J Mol Sci, 2021. 22(8). Lin, J. , et al. , Lycopene alleviates multiple-mycotoxin- induced toxicity by inhibiting mitochondrial damage and ferroptosis in the mouse jejunum. Food Funct, 2022. 13(22): p. 11532-11542.Liu, S., et al., Aflatoxin Bl Induces Intestinal Barrier Dysfunction by Regulating the FXR-Mediated MLCK Signaling Pathway in Mice and in IPEC-J2 Cells. J Agric Food Chem, 2023. 71(1): p. 867-876. Liu, S.P., et al., Higher susceptibility to aflatoxin B(l)-related hepatocellular carcinoma in glycine N-methyltransferase knockout mice. Int J Cancer, 2011. 128(3): p. 511-23. Liu, Y, et al., Non-Histone Lysine Crotonylation Is Involved in the Regulation of White Fat Browning. Int J Mol Sci, 2022. 23(21). Lozupone, C. A. et al. Alterations in the gut microbiota associated with HIV-1 infection. Cell Host Microbe 14, 329-339, (2013). Mao, B., et al., Potential Probiotic Properties of Blautia producta Against Lipopolysaccharide-Induced Acute Liver Injury. Probiotics Antimicrob Proteins, 2023. 15(3): p. 785-796. Marchetti, G., et al., Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS, 2008. 22(15): p. 2035-8. Marie, S. et al. Citrulline, Biomarker of Enterocyte Functional Mass and Dietary Supplement. Metabolism, Transport, and Current Evidence for Clinical Use. Nutrients 13, (2021). Matsubara, V. H., Fakhruddin, K. S., Ngo, H. & Samaranayake, L. P. Probiotic Bifidobacteria in Managing Periodontal Disease: A Systematic Review. Int Dent J 73, 11-20, (2023). McColl, K.E., et al., A study of the pathogenesis of Helicobacter pylori negative chronic duodenal ulceration. Gut, 1993. 34(6): p. 762-8. McLean, C. Y. et al. GREAT improves functional interpretation of cis-regulatory regions. Nat Biotechnol 28, 495-501, (2010). McMullen, P.D., et al., A map of the PPARalpha transcription regulatory network for primary human hepatocytes. Chem Biol Interact, 2014. 209: p. 14-24. Mezrich, J. D. et al. An interaction between kynurenine and the aryl hydrocarbon receptor can generate regulatory T cells. J Immunol 185, 3190-3198, (2010). Miao, Y, Feher, V. A. & McCammon, J. A. Gaussian Accelerated Molecular Dynamics: Unconstrained Enhanced Sampling and Free Energy Calculation. J Chem Theory Comput 11, 3584-3595, (2015).Miyazono, Y, et al., Uncoupled mitochondria quickly shorten along their long axis to form indented spheroids, instead of rings, in a fission-independent manner. Sci Rep, 2018. 8(1): p. 350. 56. Nykky, J., M. Vuento, and L. Gilbert, Role of mitochondria in parvovirus pathology. PLoS One, 2014. 9(1): p. e86124. Moeller, A.H., et al., SIV- induced instability of the chimpanzee gut microbiome. Cell Host Microbe, 2013. 14(3): p. 340-5. Murphy, M.P., How mitochondria produce reactive oxygen species. Biochem J, 2009. 417(1): p. 1-13. Noh, K.H., et al., Ubiquitination of PPAR-gamma by pVHL inhibits ACLY expression and lipid metabolism, is implicated in tumor progression. Metabolism, 2020. 110: p. 154302. Ntorla, A. and J.R. Burgoyne, The Regulation and Function of Histone Crotonylation. Front Cell Dev Biol, 2021. 9: p. 624914. Pan, D., et al., Lack of interleukin- 10-mediated anti-inflammatory signals and upregulated interferon gamma production are linked to increased intestinal epithelial cell apoptosis in pathogenic simian immunodeficiency virus infection. J Virol, 2014. 88(22): p. 13015-28. Perez-Santiago, J. et al. Gut Lactobacillales are associated with higher CD4 and less microbial translocation during HIV infection. AIDS 27, 1921-1931, (2013). Ponte, R., et al., Acute Simian Immunodeficiency Virus Infection Triggers Early and Transient Interleukin-7 Production in the Gut, Leading to Enhanced Local Chemokine Expression and Intestinal Immune Cell Homing. Front Immunol, 2017. 8: p. 588. PubChem. Hazardous Substances Data Bank (HSDB). World Wide Web at pubchem.nbci.nlm.nih.gov / source / hsdb / 2000#selection=Human-Toxicity -Values- %28Complete%29 2023. Puertollano, E., et al., Orally administered Lactobacillus plantarum reduces pro- inflammatory interleukin secretion in sera from Listeria monocytogenes infected mice. Br J Nutr, 2008. 99(4): p. 819-25. Rahman, M. H. & Hegazy, L. Mechanism of antagonist ligand binding to REV- ERBalpha. Sci Rep 14, 8401, (2024). Rawlings, A. V. et al. Effect of regioisomers of hydroxystearic acids as peroxisomal proliferator-activated receptor agonists to boost the anti-ageing potential of retinoids. Int J Cosmet Sci 43, 619-626, (2021).Roager, H.M. and T.R. Licht, Microbial tryptophan catabolites in health and disease. Nat Commun, 2018. 9(1): p. 3294. Rousseau, R. K. et al. Randomized, Blinded, Placebo-Controlled Trial of De Simone Formulation Probiotic During HIV-Associated Suboptimal CD4+ T Cell Recovery. J Acquir Immune Defic Syndr 89, 199-207, (2022). Rudolf, M., Einsle, O., Neese, F. & Kroneck, P. M. Pentahaem cytochrome c nitrite reductase: reaction with hydroxylamine, a potential reaction intermediate and substrate. Biochem Soc Trans 30, 649-653, (2002). Sabari, B.R., et al., Intracellular crotonyl-CoA stimulates transcription through p300- catalyzed histone crotonylation. Mol Cell, 2015. 58(2): p. 203-15. Sankaran, S., et al., Gut mucosal T cell responses and gene expression correlate with protection against disease in long-term HIV- 1 -infected nonprogressors. Proc Natl Acad Sci U S A, 2005. 102(28): p. 9860-5. Sankaran, S., et al., Rapid onset of intestinal epithelial barrier dysfunction in primary human immunodeficiency virus infection is driven by an imbalance between immune response and mucosal repair and regeneration. J Virol, 2008. 82(1): p. 538-45. Santos Rocha, C. et al. Subclinical Cytomegalovirus Infection Is Associated with Altered Host Immunity, Gut Microbiota, and Vaccine Responses. J Virol 92, (2018). Schutz, R., et al., Bio-derived hydroxystearic acid ameliorates skin age spots and conspicuous pores. Int J Cosmet Sci, 2019. 41(3): p. 240-256. Serra, S., De Simeis, D., Castagna, A. & Valentino, M. The Fatty-Acid Hydratase Activity of the Most Common Probiotic Microorganisms. Catalysts 10, 154 (2020). Shao, D., et al., PGC-1 beta-regulated mitochondrial biogenesis and function in myotubes is mediated by NRF-1 and ERR alpha. Mitochondrion, 2010. 10(5): p. 516- 27. Simithy, J., et al., Characterization of histone acylations links chromatin modifications with metabolism. Nat Commun, 2017. 8(1): p. 1141. Soderholm, A.T. and VA. Pedicord, Intestinal epithelial cells: at the interface of the microbiota and mucosal immunity. Immunology, 2019. 158(4): p. 267-280. Sortino, O. et al. Impact of Acute HIV Infection and Early Antiretroviral Therapy on the Human Gut Microbiome. Open Forum Infect Dis 7, ofz367, (2020).Sturgeon, J. P. et al. Inflammation and epithelial repair predict mortality, hospital readmission, and growth recovery in complicated severe acute malnutrition. Sci Transl Med 16, eadh0673, (2024). Su, X., K.E. Wellen, and J.D. Rabinowitz, Metabolic control of methylation and acetylation. Curr Opin Chem Biol, 2016. 30: p. 52-60. Sun, H., et al., First comprehensive proteome analysis of lysine crotonylation in seedling leaves of Nicotiana tabacum. Sci Rep, 2017. 7(1): p. 3013. Sun, J. et al. Mitochondrial and Plasma Membrane Citrate Transporters: Discovery of Selective Inhibitors and Application to Structure / Function Analysis. Mol Cell Pharmacol 2, 101-110 (2010). Suzuki, T., Regulation of the intestinal barrier by nutrients: The role of tight junctions. Anim Sci J, 2020. 91(1): p. el3357. Tahri-Joutey, M., et al., Mechanisms Mediating the Regulation of Peroxisomal Fatty Acid Beta-Oxidation by PPARalpha. Int J Mol Sci, 2021. 22(16). Tan, I.L., et al., HIV-associated opportunistic infections of the CNS. Lancet Neurol, 2012. 11(7): p. 605-17. Thomson, A.B., et al., Dietary fat selectively alters transport properties of rat jejunum. J Clin Invest, 1986. 77(1): p. 279-88. Tian, C. et al. ffl9SB: Amino-Acid-Specific Protein Backbone Parameters Trained against Quantum Mechanics Energy Surfaces in Solution. J Chem Theory Comput 16, 528-552, (2020). Turner, A.W. and D.M. Margolis, Chromatin Regulation and the Histone Code in HIV Latency . Yale J Biol Med, 2017. 90(2): p. 229-243. Ulluwishewa, D. , et al. , Regulation of tight junction permeability by intestinal bacteria and dietary components. JNutr, 2011. 141(5): p. 769-76. Vandergeeten, C., et al., Interleukin-7 promotes HIV persistence during antiretroviral therapy. Blood, 2013. 121(21): p. 4321-9. Vesterbacka, J. et al. Richer gut microbiota with distinct metabolic profile in HIV infected Elite Controllers. Sci Rep 7, 6269, (2017). Vinolo, M. A., Rodrigues, H. G., Nachbar, R. T. & Curi, R. Regulation of inflammation by short chain fatty acids. Nutrients 3, 858-876, (2011).Wang, J., Wang, W, Kollman, P. A. & Case, D. A. Automatic atom type and bond type perception in molecular mechanical calculations. J Mol Graph Model 25, 247-260, (2006). Wang, J., Wolf, R. M., Caldwell, J. W, Kollman, P. A. & Case, D. A. Development and testing of a general amber force field. J Comput Chem 25, 1157-1174, (2004). Wang, W, et al., Aflatoxin B(l) exposure disrupts the intestinal immune function via a soluble epoxide hydrolase-mediated manner. Ecotoxicol Environ Saf, 2023. 249: p. 114417. Webb, B. and A. Sali, Comparative Protein Structure Modeling Using MODELLER. Curr Protoc Bioinformatics, 2016. 54: p. 5 6 1-5 6 37. Weber, M. G. et al. Gut germinal center regeneration and enhanced antiviral immunity by mesenchymal stem / stromal cells in SIV infection. JCI Insight 6, (2021). Whitney, J. B. et al. Rapid seeding of the viral reservoir prior to SIV viraemia in rhesus monkeys. Nature 512, 74-77, (2014). Yadav, D.K., et al., Molecular dynamic simulations of oxidized skin lipid bilayer and permeability of reactive oxygen species. Sci Rep, 2019. 9(1): p. 4496. Yang, L., et al., HIV-induced immunosuppression is associated with colonization of the proximal gut by environmental bacteria. AIDS, 2016. 30(1): p. 19-29. Yang, X. W. et al. Recruitment and significance of Th22 cells and Thl7 cells in malignant ascites. Oncol Lett 16, 5389-5397, (2018). Yoon, J.H., et al., Gut Microbial Metabolites on Host Immune Responses in Health and Disease. Immune Netw, 2023. 23(1): p. e6. Yu, T., et al., Protective effects of selenium-enriched peptides from Cardamine violifolia against high-fat diet induced obesity and its associated metabolic disorders in mice. RSC Adv, 2020. 10(52): p. 31411-31424. Zeng, M. Y, Inohara, N. & Nunez, G. Mechanisms of inflammation-driven bacterial dysbiosis in the gut. Mucosal Immunol 10, 18-26, (2017). Zhang, M., et al., Aflatoxin Bl disrupts the intestinal barrier integrity by reducing junction protein and promoting apoptosis in pigs and mice. Ecotoxicol Environ Saf, 2022. 247: p. 114250. Zhang, Y, et al., Acox2 is a regulator of lysine crotonylation that mediates hepatic metabolic homeostasis in mice. Cell Death Dis, 2022. 13(3): p. 279.143. Zhou, Y. et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat Commun 10, 1523, (2019).144. Ziamo, M., et al., Effect of Lactic Acid Bacteria on the Lipid Profile of Bean-Based Plant Substitute of fermented Milk. Microorganisms, 2020. 8(9).145. Zuniga, M., V. Monedero, and M.J. Yebra, Utilization of Host-Derived Glycans by Intestinal Lactobacillus and Bifidobacterium Species, front Microbiol, 2018. 9: p. 1917.
[0284] The above description presents various embodiments including a best mode for practicing the subject matter of the claims appended hereto, and of the manner and process of making and using the claimed subject matter, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains to make and use the claimed subject matter. The embodiments described herein are amenable to modifications and alternate constructions from that discussed above that are fully equivalent. Consequently, this invention is not limited to the particular embodiments disclosed, but also covers all modifications and alternate constructions coming within the spirit and scope of the subject matter as generally expressed by the following claims. While the disclosure has been illustrated and described in detail in the drawings and foregoing description, such illustration and description are to be considered illustrative or exemplary and not restrictive. .
[0285] All references cited herein are incorporated herein by reference in their entirety. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and / or take precedence over any such contradictory material.
[0286] Unless otherwise defined, all terms (including technical and scientific terms) are to be given their ordinary and customary meaning to a person of ordinary skill in the art, and are not to be limited to a special or customized meaning unless expressly so defined herein. It should be noted that the use of particular terminology when describing certain features or aspects of the disclosure should not be taken to imply that the terminology is being re-defmed herein to be restricted to include any specific characteristics of the features or aspects of the disclosure with which that terminology is associated. Terms and phrases used in this application, and variations thereof, especially in the appended claims, unless otherwise expressly stated, should be construed as open ended as opposed to limiting. A group of items linked with the conjunction ‘and’ should not be read as requiring that each and every one of those items be present in the grouping, but rather should be read as ‘and / or’ unless expresslystated otherwise. Similarly, a group of items linked with the conjunction ‘or’ should not be read as requiring mutual exclusivity among that group, but rather should be read as ‘and / or’ unless expressly stated otherwise. Where a range of values is provided, it is understood that the upper and lower limit, and each intervening value between the upper and lower limit of the range is encompassed within the embodiments. The recitation of specific elements or features in mutually different embodiments or dependent claims does not indicate that a combination of these elements or features is not within the scope of this disclosure nor that a combination cannot be used to advantage.
[0287] Those within the art will understand that if a specific number is intended, such an intent will be explicitly recited in the claim, and in the absence of such recitation no such intent is present. For example, as an aid to understanding, the following appended claims can recite introductory phrases ‘at least one’ and “one or more’ to introduce a claim element or feature. However, the use of such phrases should not be construed to imply that the indefinite articles ‘a’ or ‘an’ limits any particular claim element or feature to embodiments containing only one such claim element or feature, even when the same claim includes the introductory phrases ‘one or more’ or ‘at least one’ and indefinite articles such as ‘a’ or ‘an’ (e.g., ‘a’ and / or ‘an’ should typically be interpreted to mean ‘at least one’ or ‘one or more’); the same holds true for the use of definite articles used to introduce claim elements or features. In addition, where a specific number is explicitly recited, those skilled in the art will recognize that such number can be interpreted as encompassing at least the recited number.
[0288] In the experimental embodiments, numbers expressing quantities of reagents, materials, reaction conditions, and so forth are to be understood as being modified in all instances by the term ‘about.’ Throughout the disclosure, each numerical parameter can be construed in light of the number of significant digits and ordinary rounding approaches and not as an attempt to limit the application of the doctrine of equivalents to the scope of any claims in any application claiming priority to the present application.
[0289] Furthermore, although the foregoing has been described in some detail by way of illustrations and examples for purposes of clarity and understanding, those skilled in the art understand that certain changes and modifications may be practiced. Therefore, the description and examples should not be construed as limiting the scope of the invention to the specific embodiments and examples described herein, but rather to also cover all modification and alternatives coming with the true scope and spirit of the invention.I l l
Claims
What is claimed is:
1. A method comprising incorporating 10-hydroxystearic acid, a derivative thereof, or a salt thereof in a supplement to a human diet at a level sufficient to treat a symptom of metabolic syndrome, wherein the supplement is selected from the group consisting of a food additive, food fortifier, beverage additive, beverage fortifier, or pharmaceutical.
2. The method of claim 1, wherein the 10-hydroxystearic acid, the derivative thereof, or the salt thereof is a pharmaceutical formulated as a tablet, an encapsulated pill, a gelcap pill, a liquid suspension, a spray, or a powder.
3. An octadecanoid composition comprising a therapeutically effective amount of an intermediate of C-l 8 fatty acid metabolism of a gastrointestinal microbe, in a pharmaceutically acceptable vehicle.
4. The octadecanoid composition of claim 3, wherein the intermediate of C-l 8 fatty acid metabolism comprises a C-l 8 hydroxy fatty acid, C-l 8 oxo fatty acid, C-l 8 conjugated fatty acid, C-l 8 partially saturated trans-fatty acid, a non-natural C-l 8 fatty acid derivative lacking a free carboxylate head group, or an enantiomer or a salt thereof.
5. The octadecanoid composition of claim 3, wherein the intermediate of C-l 8 fatty acid metabolism comprises 10-hydroxystearic acid (10-HSA), 12-hydroxystearic acid, 9-oxo- octadecadienoic acid, 13-oxo-octadecadienoic acid, 10-hydroxy-cis-12-octadecenoic acid, 10- hydroxy-cis-12, cis- 15 -octadecadienoic acid, 10-hydroxy-cis-6, cis-12-octadecadienoic acid, 10-hydroxy-cis-6, cis- 12, cis- 15 -octadecatri enoic acid, 10,12-dihydroxyoctadecanoic acid, 10- hydroxy-cis-15-octadecenoic acid, 10-hydroxy-cis-6-octadecenoic acid, 10-hydroxy-cis-6, cis- 15 -octadecadienoic acid, 10-hydroxy-trans- 11 -octadecenoic acid, 10-hydroxy-trans-l l, cis- 15 -octadecadienoic acid, 10-hydroxy-cis-6, trans- 11 -octadecadienoic acid, and 10- hydroxy-cis-6, trans-11, cis- 15 -octadecatri enoic acid, 10-oxo-cis-12-octadecenoic acid, 10- oxo-cis-12, cis- 15 -octadecadienoic acid, 10-oxo-cis-6, cis-12-octadecadienoic acid, 10-oxo- cis-6, cis-12, cis- 15 -octadecatrienoic acid, 10-oxooctadecanoic acid, 10-oxo-cis-6- octadecenoic acid, 10-oxo-cis- 15 -octadecenoic acid, 10-oxo-cis-6, cis-15-octadecadienoic acid, 12-oxooctadecanoic acid, 10-oxo-trans-l 1 -octadecenoic acid, 10-oxo-cis-6, trans-11-octadecadienoic acid, 10-oxo-trans- 11 , cis- 15 -octadecadienoic acid, 10-oxo-cis-6, trans-11, cis- 15 -octadecatri enoic acid, 12-oxo-cis-9-octadecenoic acid, or an enantiomer or a salt thereof, or a combination thereof.
6. The octadecanoid composition of claim 3, wherein the intermediate of C-18 fatty acid metabolism comprises 10-hydroxystearic acid, or an enantiomer or a salt thereof.
7. The octadecanoid composition of claim 3, comprising from about 5 to about 95% of the intermediate of C-18 fatty acid metabolism (weightweight).
8. The octadecanoid composition of claim 3, wherein the amount of the intermediate of C-18 fatty acid metabolism is within a range of about 10 to 2000 mg, about 30 to 1000 mg, about 50 to 800 mg, about 100 to 600 mg, about 400 mg to about 1800 mg, or about 500 mg to about 1500 mg, or within a range of at least 10 pM to 2 mM.
9. The octadecanoid composition of claim 3, wherein the vehicle is an oral, nasal, enteral, parenteral, transdermal, transmucosal, rectal, ophthalmic, or vaginal delivery vehicle.
10. The octadecanoid composition of claim 3, wherein the vehicle comprises an liquid, solid, or semisolid carrier.
11. The octadecanoid composition of claim 10, wherein the carrier comprises water, saline, alcohol, oil, wax, polymer, sugar, starch, or a combination thereof.
12. The octadecanoid composition of claim 11, wherein the carrier comprises a polymer selected from the group consisting of poly(alpha-hydroxy acids), poly(lactide-co-glycolide) (PLGA), polylactide (PLA), polyglycolide (PG), polyethylene glycol (PEG) conjugates of poly(alpha-hydroxy acids), polyorthoesters, polyaspirins, polyphosphagenes, collagen, starch, chitosans, gelatin, alginates, dextrans, vinylpyrrolidone, polyvinyl alcohol (PVA), PVA-g- PLGA, PEGT-PBT copolymer (polyactive), methacrylates, poly(N-isopropylacrylamide), PEO-PPO-PEO (pluronics), PEO-PPO-PAA copolymers, PLGA-PEO-PLGA, polyphosphoesters, polyanhydrides, polyester-anhydrides, polyamino acids, polyurethaneesters, polyphosphazines, polycaprolactones, polytrimethylene carbonates, polydioxanones,polyamide-esters, polyketals, polyacetals, glycosaminoglycans, hyaluronic acid, hyaluronic acid esters, polyethylene-vinyl acetates, silicones, polyurethanes, polypropylene fumarates, polydesaminotyrosine carbonates, polydesaminotyrosine arylates, polydesaminotyrosine ester carbonates, polydesamnotyrosine ester arylates, polyethylene oxides, polyorthocarbonates, polycarbonates, or copolymers or physical blends thereof or combinations thereof.
13. The octadecanoid composition of claim 3, wherein the vehicle comprises one or more bactericidal agents, stabilizers, buffers, emulsifiers, dispersants, gelling agents, wetting agents, suspending agents, preservatives, sweetening agents, lubricants, binders, disintegration agents, swelling agents, plasticizers, pigments, colorants, glidants, and fillers.
14. The octadecanoid composition of claim 3, formulated as a particle, powder, granule, solution, suspension, liquid suspension, gel, paste, emulsion, aerosol, syrup, spray, pill, tablet, encapsulated pill, gelcap pill, capsule, suppository, or lozenge.
15. The octadecanoid composition of claim 3, further comprising one or more additional active agents.
16. The octadecanoid composition of claim 15, wherein the one or more additional active agents is selected from the group consisting of compounds for treating or managing irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), short bowel syndrome (SBS), celiac disease, small intestinal bacterial overgrowth (SIBO), gastroenteritis, leaky gut syndrome, gastric lymphoma, bacterial infection, viral infection, and parasitic infection.
17. The octadecanoid composition of claim 15, wherein the one or more additional active agents include an antimicrobial, a PPAR agonist, a probiotic or prebiotic agent, a butyrate or derivative or salt thereof, an immune suppressive agent, or an antiviral agent.
18. The octadecanoid composition of claim 17, comprising an antiviral agent selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viralintegrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof.
19. A combination product comprising:(1) the octadecanoid composition according to any one of claims 3 to 18; and(2) at least one additional active agent composition.
20. The combination product of claim 19, wherein the octadecanoid composition and the at least one additional agent composition is formulated as a unitary dosage form.
21. The combination product of claim 19, wherein the octadecanoid composition is formulated as a first dosage form and the at least one additional agent composition can be formulated as a second dosage form, wherein the first and the second dosage forms are copackaged.
22. The combination product of claim 19, wherein the at least one additional active agent composition includes one or more compounds for treating or managing irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), short bowel syndrome (SBS), celiac disease, small intestinal bacterial overgrowth (SIBO), gastroenteritis, leaky gut syndrome, gastric lymphoma, bacterial infection, viral infection, and parasitic infection.
23. The combination product of claim 22, wherein the one or more compounds include an antimicrobial, a PPAR agonist, a probiotic or prebiotic agent, a butyrate or derivative or salt thereof, a substrate of abacterial enzyme, a cytokine comprising IL-22, an immune suppressive agent, or an antiviral agent.
24. The combination product of claim 23, comprising an antiviral agent selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof.
25. A method of treating an illness, condition, disorder, or disease associated with mucosal dysfunction in a subject in need thereof, the method comprising administering the octadecanoid composition according to any one of claims 3 to 18 or the combination product according to any one of claims 19 to 24 to the subject.
26. The method of claim 25, wherein the illness, disease, disorder, or condition associated with mucosal dysfunction comprises one or more of chronic inflammatory reactions, autoimmune reactions, bacterial infection or overgrowth, viral infection, parasitic infection, mucosal diseases disrupting mitochondria, bowel resection, chronic diarrhea, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), dysbiosis, short bowel syndrome (SBS), and small intestinal bacterial overgrowth (SIBO)), celiac disease, gastroenteritis, increased intestinal permeability, malabsorption syndromes, and gastrointestinal lymphoma.
27. The method of claim 26, wherein the illness, disease, disorder, or condition is a mucosal disease that disrupts mitochondria.
28. The method of claim 26, wherein the mucosal dysfunction is caused by a dysbiosis, overgrowth of a pathogenic bacterium, a viral infection, a food antigen, or a toxin.
29. The method of claim 28, wherein the mucosal dysfunction is caused by a viral infection.
30. The method of claim 29, wherein the viral infection is caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV).
31. The method of claim 30, wherein the method further comprises administering one or more antiviral agents to the subject.
32. The method of any one of claims 25 to 31, wherein the subject is administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg toabout 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight.
33. The method of any one of claims 25 to 32, wherein at least one dose of the octadecanoid composition is administered per day or per week.
34. The method of any one of claims 25 to 33, wherein the octadecanoid composition is administered at least once per day or as a single daily dose.
35. The method of any one of claims 25 to 34, the octadecanoid composition and the additional active agent composition of the combination product are co-administered.
36. A method of treating a gastrointestinal symptom in a HIV-infected patient in need thereof, the method comprising administering the octadecanoid composition according to any one of claims 3 to 18 or the combination product according to any one of claims 19 to 24 to the patient.
37. The method of claim 36, wherein the gastrointestinal symptom comprises one or more of diarrhea, rectal bleeding, malabsorption, abdominal pain, weight loss, fever, anemia, fecal occult blood, fecal leukocytes, crypt abscesses, leukocyte infiltration, cell apoptosis, transmural granulomatous inflammation, superficial mucosal and submucosal inflammation, or an increase in pro-inflammatory cytokines.
38. The method of claim 36, wherein the patient has received or is receiving treatment with one or more antiviral agents.
39. The method of claim 38, wherein the one or more antiviral agents is selected from the group consisting of antibodies, immunomodulatory peptides, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, virus uptake / absorption inhibitors, virus receptor antagonists, viral fusion inhibitors, viral integrase inhibitors, transcription inhibitors, latency-reversing agents, and combinations thereof.
40. The method of any one of claims 36 to 39, wherein the patient is administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight.
41. The method of any one of claims 36 to 40, wherein the patient is administered a liquid dosage form comprising about 10 pM to about 2 mM of the intermediate of C-18 fatty acid metabolism.
42. A method of treating dysbiosis in a subject in need thereof, the method comprising administering the octadecanoid composition according to any one of claims 3 to 18 or the combination product according to any one of claims 19 to 24 to the subject.
43. The method of claim 42, further comprising identifying a subject with dysbiosis prior to administering the composition or combination product.
44. The method of claim 42 or 43, wherein the dysbiosis includes infection by or overgrowth of one or more pathogenic bacteria selected from the group consisting of Yersinia, Vibrio, Treponema, Streptococcus, Staphylococcus, Shigella, Salmonella, Rickettsia, Orientia, Pseudomonas, Neisseria, Mycoplasma, Mycobacterium, Listeria, Leptospira, Legionella, Klebsiella, Helicobacter, Haemophilus, Francisella, Escherichia, Ehrlichia, Enterococcus, Coxiella, Corynebacterium, Clostridium, Chlamydia, Chlamydophila, Campylobacter, Burkholderia, Brucella, Borrelia, Bordetella, Bacillus spp., Carbapenem-resistant Enterobacteriaceae (CRE), extended spectrum beta-lactam resistant Enterococci (ESBL), and vancomycin-resistant Enterococci (VRE).
45. The method any one of claims 42 to 44, wherein the dysbiosis comprises a reduction in one or more beneficial bacteria selected form the group consisting of Bacteroides, Lactobacillus, Faecalibacterium, Bifidobacterium, Roseburia, Alistipes, Collinsella, Blautia, Coprococcus, Ruminococcus , Eubacterium and Dorea bacteria in the microbiome of the subject.
46. The method of any one of claim 42 to 45, wherein administering includes local delivery of the intermediate of C-18 fatty acid metabolism to a lumen of the subject’s digestive, respiratory, or reproductive system.
47. The method of any one of claim 42 to 46, wherein the octadecanoid composition is formulated for delivery to one or more of the oral cavity, esophagus, stomach, small intestine, large intestine, rectum, or vagina of the subject.
48. The method of any one of claims 42 to 47, wherein the subject is administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight.
49. The method of any one of claims 42 to 48, wherein at least one dose of the octadecanoid composition is administered per day or per week.
50. The method of any one of claims 42 to 49, wherein the octadecanoid composition or the combination product is administered at least once per day or as a single daily dose.
51. The method of any one of claims 42 to 50, wherein the octadecanoid composition and the additional active agent composition are co-administered.
52. A method of repairing leaky gut syndrome in a subject in need thereof, the method comprising administering the octadecanoid composition according to any one of claims 3 to 18 or the combination product according to any one of claims 19 to 24 to the subject, wherein the subject exhibits microbially-mediated damage of the gut epithelial barrier.
53. The method of claim 52, wherein the damage of the gut epithelial barrier is mediated by pathogenic bacterial infection or overgrowth, viral infection, parasitic infection, dysbiosis, short bowel syndrome (SBS), or small intestinal bacterial overgrowth (SIBO)).
54. The method of claim 53, wherein the damage of the gut epithelial barrier is mediated by a viral infection.
55. The method of claim 54, wherein the viral infection is caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV).
56. The method of claim 52, wherein the method further comprises administering one or more antimicrobial agents to the subject.
57. The method of any one of claims 52 to 56, wherein the subject is administered a dose of the octadecanoid composition comprising the intermediate of C- 18 fatty acid metabolism within a range of about 0.5 mg / kg to about 10,000 mg / kg, about 5 mg / kg to about 5,000 mg / kg, and about 10 mg / kg to about 3,000 mg / kg, about 10 mg / kg to about 1,400 mg / kg, 10 mg / kg to about 650 mg / kg, or about 10 mg / kg to about 200 mg / kg body weight or at least 100 mg / kg body weight.
58. The method of any one of claims 52 to 57, wherein at least one dose of the octadecanoid composition is administered per day or per week.
59. The method of any one of claims 52 to 58, wherein the octadecanoid composition is administered at least once per day or as a single daily dose.
60. The method of any one of claims 52 to 59, wherein the octadecanoid composition and the additional active agent composition of the combination product are co-administered.
61. A method of increasing a relative abundance of a beneficial microorganism in a body canal of a subject in need thereof, the method comprising administering the octadecanoid composition according to any one of claims 3 to 18 or the combination product according to any one of claims 19 to 24 to the subject.
62. The method of claim 61 , where in the beneficial microorganism comprises at least one microorganism of Firmicutes, Bacteroidetes, Actinobacteria, Proteobacteria, Synergistetes, Verrucomicrobia, Fusobacteria, and Euryarchaeota; or at genus level the microorganisms of Bacteroides, Lactobacillus, Faecalibacterium, Bifidobacterium, Roseburia, Alistipes, Collinsella, Blautia, Coprococcus, Ruminococcus, Eubacterium or Dorea phylum, or a combination thereof.
63. The method of claim 61 or 62, whereby the relative abundance of one or more Blautia and Lactobacillus microorganisms is increased.
64. The method of any one of claims 61 to 63, wherein the subject has been diagnosed with an illness, disease, disorder, or condition associated with mucosal dysfunction.
65. The method of claim 64, wherein the illness, disease, disorder, or condition associated with mucosal dysfunction comprises one or more of chronic inflammatory reactions, autoimmune reactions, bacterial infection or overgrowth, viral infection, parasitic infection, mucosal diseases disrupting mitochondria, bowel resection, chronic diarrhea, irritable bowel syndrome (IBS), inflammatory bowel disease (IBD), dysbiosis, short bowel syndrome (SBS), and small intestinal bacterial overgrowth (SIBO)), celiac disease, gastroenteritis, increased intestinal permeability, malabsorption syndromes, and gastrointestinal lymphoma.
66. The method of claim 64, wherein the mucosal dysfunction is caused by a dysbiosis, overgrowth of a pathogenic bacterium, a viral infection, a food antigen, or a toxin.
67. The method of claim 64, wherein the mucosal dysfunction is caused by a food borne pathogen.
68. The method of claim 64, wherein the mucosal dysfunction is aflatoxicosis.
69. The method of claim 64, wherein the mucosal dysfunction is caused by a viral infection.
70. The method of claim 69, wherein the viral infection is caused by a virus selected from the group consisting of norovirus, rotavirus, transmissible gastroenteritis virus, SARS-CoV-2, influenza, Human immunodeficiency virus (HIV), and Simian immunodeficiency virus (SIV).
71. The method of claim 69, wherein the method further comprises administering one or more antiviral agents to the subject.
72. The method of any one of claims 62 to 71, wherein the octadecanoid composition comprises 10-HSA.
73. The method of any one of claims 62 to 72, wherein the octadecanoid composition is administered to the subject by an oral, nasal, enteral, parenteral, topical, transdermal, transmucosal, rectal, ophthalmic, or vaginal route.
Citation Information
Patent Citations
Fat accumulation inhibitor and blood lipid level improving agent
US20210369662A1
Methods and compounds for treatment of metabolic disease
US20220339168A1
Metabolism-improving agent comprising rare fatty acid
US9707200B2