Anti-TNFR2 antibody and use thereof

Abstract

The present invention belongs to the field of biomedicine, and relates to an antibody or antigen-binding fragment that binds to TNFR2 and the use thereof. The antibody or antigen-binding fragment can specifically bind to human TNFR2, has high affinity, has good ability of blocking the binding of TNFR2 and TNF-α, but does not block the binding of TNFR1 and TNF-α. The antibody or antigen-binding fragment can effectively inhibit tumor growth, and therefore can be used for treating TNFR2 signaling pathway related diseases (such as tumors).

Description

Anti-TNFR2 antibodies and their uses Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to an antibody or antigen-binding fragment binding to TNFR2 and uses thereof. Background Art

[0002] Tumor necrosis factor receptor 2 (TNFR2), also known as TNFRSF1B and CD120b, is a co-stimulatory member of the tumor necrosis factor receptor superfamily (TNFRSF), which includes proteins such as GITR, OX40, CD27, CD40, and 4-1BB (CD137). TNFR2 is a cell surface receptor expressed on T cells that has been shown to enhance the activation of effector T (Teff) cells and reduce Treg-mediated suppression. By regulating TRAF2 / 3 and NF-κB signaling, TNFR2 can mediate the transcription of genes that promote cell survival and proliferation. TNFR2 can be expressed on cancer cells, tumor-infiltrating Tregs, and effector T cells. Given the ongoing need for improved strategies against diseases such as cancer, novel agents and methods that can benefit from enhanced immune responses, particularly T cell responses, and modulate Treg activity are highly desirable.

[0003] Cancer is currently one of the diseases with the highest mortality rates in humans. Therefore, developing antibody drugs that can more effectively target the TNFR2 signaling pathway will provide potential treatments for a variety of tumors and immune system-related diseases, with enormous application potential and market value. Summary of the Invention

[0004] In some embodiments, the present invention provides an antibody or antigen-binding fragment that binds to TNFR2 and comprises one or more of the following amino acid sequences:

[0005] (a) a VH complementarity determining region 1 (VHCDR1) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 11, 17, 23, and 29;

[0006] (b) VHCDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 12, 18, 24, 30, and 36;

[0007] (c) VHCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 19, 25, 31, and 35;

[0008] (d) VLCDR1 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 20, 26, and 32;

[0009] (e) VLCDR2 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 21, 27, and 33;

[0010] (f) VLCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 16, 22, 28, and 34.

[0011] In some embodiments, the present invention provides an antibody or antigen-binding fragment that binds to TNFR2, comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), wherein the heavy chain variable region comprises a VHCDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 11, 17, 23, and 29, a VHCDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 12, 18, 24, 30, and 36, and a VHCDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 19, 25, 31, and 35; and the light chain variable region comprises a VLCDR1 amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 20, 26, and 32, a VLCDR2 amino acid sequence selected from the group consisting of SEQ ID NOs: 15, 21, 27, and 33, and a VLCDR3 amino acid sequence selected from the group consisting of SEQ ID NOs: 16, 22, 28, and 34.

[0012] In some embodiments, the present invention provides an antibody or antigen-binding fragment that binds to TNFR2, comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), wherein the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 23; a VHCDR2 amino acid sequence selected from the group consisting of SEQ ID NO: 24 or SEQ ID NO: 36; and a VHCDR3 amino acid sequence selected from the group consisting of SEQ ID NO: 25 or SEQ ID NO: 35; and the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 26, the VLCDR2 amino acid sequence of SEQ ID NO: 27, and the VLCDR3 amino acid sequence of SEQ ID NO: 28.

[0013] In some embodiments, the present invention provides an antibody or antigen-binding fragment that binds to TNFR2, comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), wherein:

[0014] (1) the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 11, the VHCDR2 amino acid sequence of SEQ ID NO: 12, and the VHCDR3 amino acid sequence of SEQ ID NO: 13; the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 14, the VLCDR2 amino acid sequence of SEQ ID NO: 15, and the VLCDR3 amino acid sequence of SEQ ID NO: 16;

[0015] (2) the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 17; the VHCDR2 amino acid sequence of SEQ ID NO: 18; and the VHCDR3 amino acid sequence of SEQ ID NO: 19; the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 20, the VLCDR2 amino acid sequence of SEQ ID NO: 21, and the VLCDR3 amino acid sequence of SEQ ID NO: 22;

[0016] (3) the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 23; the VHCDR2 amino acid sequence of SEQ ID NO: 24; and the VHCDR3 amino acid sequence of SEQ ID NO: 25; the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 26, the VLCDR2 amino acid sequence of SEQ ID NO: 27, and the VLCDR3 amino acid sequence of SEQ ID NO: 28;

[0017] (4) the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 29; the VHCDR2 amino acid sequence of SEQ ID NO: 30; and the VHCDR3 amino acid sequence of SEQ ID NO: 31; the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 32, the VLCDR2 amino acid sequence of SEQ ID NO: 33, and the VLCDR3 amino acid sequence of SEQ ID NO: 34;

[0018] (5) the heavy chain variable region comprises the VHCDR1 amino acid sequence of SEQ ID NO: 23; the VHCDR2 amino acid sequence of SEQ ID NO: 24; and the VHCDR3 amino acid sequence of SEQ ID NO: 35; the light chain variable region comprises the VLCDR1 amino acid sequence of SEQ ID NO: 26, the VLCDR2 amino acid sequence of SEQ ID NO: 27, and the VLCDR3 amino acid sequence of SEQ ID NO: 28;

[0019] (6) The heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO: 23; the VHCDR2 amino acid sequence shown in SEQ ID NO: 36; and the VHCDR3 amino acid sequence shown in SEQ ID NO: 35; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO: 26, the VLCDR2 amino acid sequence shown in SEQ ID NO: 27, and the VLCDR3 amino acid sequence shown in SEQ ID NO: 28.

[0020] In some embodiments, the antibody or antigen-binding fragment comprises a VH comprising an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46; or an amino acid sequence having one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46, or consisting of the same.

[0021] In some embodiments, the VH comprises an amino acid sequence that is at least 90% identical to the sequence set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46.

[0022] In some embodiments, the VH comprises an amino acid sequence that is at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46.

[0023] In some embodiments, the VH comprises the amino acid sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 43, 44, 45 or 46.

[0024] In some embodiments, the antibody or antigen-binding fragment comprises a VL comprising an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49; or an amino acid sequence having one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49, or consisting of the same.

[0025] In some embodiments, the VL comprises an amino acid sequence that is at least 90% identical to the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

[0026] In some embodiments, the VL comprises an amino acid sequence that is at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

[0027] In some embodiments, the VL comprises the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 47, 48 or 49.

[0028] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain comprising, or consisting of, an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56; or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56.

[0029] In some embodiments, the heavy chain comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56.

[0030] In some embodiments, the heavy chain comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56.

[0031] In some embodiments, the heavy chain comprises the amino acid sequence of SEQ ID NO: 50, 52, 54, or 56.

[0032] In some embodiments, the antibody or antigen-binding fragment comprises a light chain comprising, or consisting of, an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62, or an amino acid sequence having one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

[0033] In some embodiments, the light chain comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

[0034] In some embodiments, the light chain comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

[0035] In some embodiments, the light chain comprises the amino acid sequence shown in SEQ ID NO: 58, 60 or 62.

[0036] In some embodiments, the antibody or antigen-binding fragment comprises a VH and a VL, wherein the VH comprises an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46, and the VL comprises an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

[0037] In some embodiments, the antibody or antigen-binding fragment comprises a VH and a VL, wherein the VH comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46, and the VL comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

[0038] In some embodiments, the antibody or antigen-binding fragment comprises a VH and a VL, wherein the VH comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46, and the VL comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

[0039] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 43, 44, 45 or 46, and the VL comprises the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 47, 48 or 49.

[0040] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 1, and the VL comprises the amino acid sequence shown in SEQ ID NO: 2.

[0041] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:3, and the VL comprises the amino acid sequence shown in SEQ ID NO:4.

[0042] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:5, and the VL comprises the amino acid sequence shown in SEQ ID NO:6.

[0043] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:7, and the VL comprises the amino acid sequence shown in SEQ ID NO:8.

[0044] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:9, and the VL comprises the amino acid sequence shown in SEQ ID NO:10.

[0045] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:44, and the VL comprises the amino acid sequence shown in SEQ ID NO:48.

[0046] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:44, and the VL comprises the amino acid sequence shown in SEQ ID NO:49.

[0047] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:45, and the VL comprises the amino acid sequence shown in SEQ ID NO:48.

[0048] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:45, and the VL comprises the amino acid sequence shown in SEQ ID NO:49.

[0049] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:43, and the VL comprises the amino acid sequence shown in SEQ ID NO:47.

[0050] In some embodiments, the antibody or antigen-binding fragment comprises VH and VL, wherein the VH comprises the amino acid sequence shown in SEQ ID NO:46, and the VL comprises the amino acid sequence shown in SEQ ID NO:47.

[0051] Exemplary VH and VL are shown in Table 1, heavy chain CDRs are shown in Table 2, and light chain CDRs are shown in Table 3.

[0052] Table 1: TNFR2 Antibody VH and VL Sequences

[0053] Table 2: TNFR2 antibody heavy chain CDRs sequences

[0054] Table 3: TNFR2 Antibody Light Chain CDRs Sequences

[0055] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain and a light chain, wherein the heavy chain comprises an amino acid sequence selected from SEQ ID NOs: 50, 52, 54, and 56, and the light chain comprises an amino acid sequence selected from SEQ ID NOs: 58, 60, and 62.

[0056] In some embodiments, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:50, and the light chain comprises the amino acid sequence shown in SEQ ID NO:58; or, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:52, and the light chain comprises the amino acid sequence shown in SEQ ID NO:60; or, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:52, and the light chain comprises the amino acid sequence shown in SEQ ID NO:62; or, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:54, and the light chain comprises the amino acid sequence shown in SEQ ID NO:60; or, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:54, and the light chain comprises the amino acid sequence shown in SEQ ID NO:62; or, the heavy chain comprises the amino acid sequence shown in SEQ ID NO:56, and the light chain comprises the amino acid sequence shown in SEQ ID NO:58.

[0057] Heavy chain amino acid sequence:

[0058] Light chain amino acid sequence:

[0059] In some embodiments, the antibody or antigen-binding fragment is a Fab, F(ab')2, Fv, or single-chain Fv (scFv) fragment.

[0060] In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain constant region selected from the group consisting of IgG1, IgG2, IgG3, and IgG4.

[0061] In some embodiments, the sequence of the heavy chain constant region of IgG1 comprises the amino acid sequence shown in SEQ ID NO:42.

[0062] In some embodiments, the antibody or antigen-binding fragment comprises a light chain constant region selected from a kappa or lambda chain.

[0063] In some embodiments, the light chain constant region of the κ chain comprises the amino acid sequence shown in SEQ ID NO:41.

[0064] In some embodiments, the antibody or antigen-binding fragment binds to the extracellular region of TNFR2.

[0065] In some embodiments, the antibody or antigen-binding fragment is a humanized antibody or antigen-binding fragment.

[0066] In some embodiments, the antibody or antigen-binding fragment is an isolated antibody or antigen-binding fragment.

[0067] In some embodiments, a pharmaceutical composition is provided, comprising any of the above antibodies or antigen-binding fragments and a pharmaceutically acceptable carrier, excipient, or stabilizer.

[0068] In some embodiments, a biological material is provided, which is (1) a nucleic acid encoding part or all of the antibody or antigen-binding fragment according to any one of the above, such as the variable region of the antibody heavy chain and / or light chain;

[0069] (2) a vector comprising a nucleic acid encoding the antibody or antigen-binding fragment as described in any one of the above; or

[0070] (3) A host cell comprising a nucleic acid or a vector encoding the antibody or antigen-binding fragment as described above.

[0071] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a heavy chain, wherein the nucleic acid sequence is 85% identical to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, or SEQ ID NO:57.

[0072] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a heavy chain, wherein the nucleic acid sequence is 90% identical to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, or SEQ ID NO:57.

[0073] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a heavy chain, wherein the nucleic acid sequence is 95% identical to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, or SEQ ID NO:57.

[0074] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a heavy chain, wherein the nucleic acid sequence comprises the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55, or SEQ ID NO:57.

[0075] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a light chain, wherein the nucleic acid sequence is 85% identical to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61, or SEQ ID NO:63.

[0076] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a light chain, wherein the nucleic acid sequence is 90% identical to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61, or SEQ ID NO:63.

[0077] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a light chain, wherein the nucleic acid sequence is 95% identical to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61, or SEQ ID NO:63.

[0078] In some embodiments, the nucleic acid comprises a nucleic acid sequence encoding a light chain, wherein the nucleic acid sequence comprises the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61, or SEQ ID NO:63.

[0079] In some embodiments, the nucleic acid is an isolated nucleic acid.

[0080] In some embodiments, the present invention provides a method for producing an antibody or antigen-binding fragment thereof, comprising culturing the host cell under conditions suitable for gene expression. In some embodiments, the method further comprises purifying the antibody or antigen-binding fragment. Purification can be performed using conventional methods, such as centrifuging the cell suspension and collecting the supernatant. Filtration, protein A affinity columns, and ion exchange columns can be used to purify the antibody protein.

[0081] In some embodiments, the antigen-binding fragment is Fab, F(ab')2, Fv, or scFv.

[0082] In some embodiments, a kit comprising any of the antibodies or antigen-binding fragments described above is provided.

[0083] In some embodiments, provided is the use of any of the above antibodies or antigen-binding fragments or pharmaceutical compositions in preparing drugs for preventing and / or treating diseases, screening drugs for preventing and / or treating diseases, or preventing and / or treating diseases.

[0084] In some embodiments, a method for preventing and / or treating a disease is provided, comprising administering an effective dose of any of the above antibodies or antigen-binding fragments or pharmaceutical compositions to a patient in need of treatment.

[0085] In some embodiments, the disease is a disease associated with the TNFR2 signaling pathway.

[0086] In some embodiments, the disease is cancer or a tumor. In some embodiments, the cancer or tumor is selected from leukemia, lymphoma, ovarian cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer (e.g., non-small cell lung cancer, etc.), bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome and sarcoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0087] FIG1 is a binding curve of TNFR2 chimeric antibody and hTNFR2-Fc.

[0088] FIG2 is a binding curve of TNFR2 chimeric antibody to CHO-TNFR2 cells.

[0089] FIG3 shows the test results of the ability of TNFR2 chimeric antibodies to block the binding of TNFR2 to TNF-α.

[0090] FIG4 shows the binding curve of humanized TNFR2 antibody to hTNFR2-his.

[0091] FIG5 shows the results of the binding ability test of humanized TNFR2 antibody to CHO-TNFR2.

[0092] FIG6 shows the test results of the ability of humanized TNFR2 antibodies to block the binding of TNFR2 to TNF-α.

[0093] Figure 7 shows the results of biological activity testing of humanized TNFR2 antibodies. A) Results of testing positive clones in TNFR2-Jurkat cells. B) Results of testing sTNF-α-induced cell death in TNFR2-overexpressing Jurkat cells. C) Results of testing HC2.1 & LC2.1 and HC6 & LC2.1 antibodies blocking sTNF-α binding to TNFR2 on the membrane of TNFR2-Jurkat cells.

[0094] FIG8 shows the in vivo pharmacodynamics test results of humanized TNFR2 antibodies, wherein the vehicle is PBS. DETAILED DESCRIPTION

[0095] The following is a detailed description of the technical solution of the present invention, which does not limit the scope of protection of the present invention. Non-essential modifications and adjustments made by others based on the concept of the present invention still fall within the scope of protection of the present invention.

[0096] Unless otherwise defined herein, scientific and technical terms and abbreviations used in conjunction with the present invention shall have the meanings commonly understood by those skilled in the art to which the present invention belongs. The following lists some of the terms and abbreviations used in this article.

[0097] Antibody: antibody, Ab; Immunoglobulin: immunoglobulin, Ig; Heavy chain: heavy chain, HC; Light chain: light chain, LC; Heavy chain variable domain: heavy chain constant domain, CH; Light chain variable domain: light chain variable domain, VL; Light chain constant domain: light chain constant domain, CL; Complementarity determining region: complementarity determining region, CDR, refers to the antigen complementary binding region of an antibody; Fab fragment: antigen binding fragment, Fab; Fc fragment: fragment crystallizable region, Fc; Monoclonal antibodies: monoclonal antibodies, mAbs.

[0098] The terms "comprising" or "including" as used herein are open-ended descriptions encompassing the specified components or steps described, as well as other specified components or steps that do not materially affect the technical effect. When used in this application to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist solely of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still exhibiting the activities described herein.

[0099] As used interchangeably herein, the terms "antibody" or "immunoglobulin" include intact antibodies and any antigen-binding fragments thereof (antigen-binding portions), or single-chain homologs thereof. An "antibody" comprises at least one heavy chain (H chain) and one light chain (L chain). For example, in naturally occurring IgG, the heavy and light chains are interconnected by disulfide bonds, and there are two paired heavy and light chains, which are also interconnected by disulfide bonds. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region (CH). The heavy chain constant region comprises three domains, CH1, CH2, and CH3. Each light chain comprises a light chain variable region (abbreviated herein as VL) and a light chain constant region (CL). The light chain constant region comprises one domain, CL. The VH and VL regions can be further subdivided into hypermutable regions, or complementarity determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs) or joining (J) regions (JH or JL heavy and light chains, respectively). Each VH and VL is composed of three CDRs, three FRs, and a J domain, arranged from amino terminus to carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, J. The variable regions of the heavy and light chains bind to the antigen. The constant region of the antibody can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) or humoral factors such as the first component (C1q) of the classical complement system. It has been shown that fragments of full-length antibodies can perform the antigen-binding function of antibodies. Examples of antigen-binding fragments or binding fragments of antibody fragments include, but are not limited to: (i) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab')2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bond at the hinge region; (iii) an Fd fragment, which consists of the VH and CH1 domains; (iv) an Fv fragment, which consists of the VL and VH domains of a single arm of an antibody; (v) a dAb, which includes the VH and VL domains; (vi) a dAb fragment (Ward et al. (1989) (Nature) 341, 544-546), which consists of the VH domain; (vii) a dAb, which consists of the VH and VL domains; (viii) isolated complementarity determining regions (CDRs); or (ix) a combination of two or more isolated CDRs, which may optionally be linked by a synthetic linker. In addition, although the two domains VL and VH of the Fv fragment are encoded by separate genes, they can be connected by synthetic linkers using recombinant methods to form one protein chain in which the VL and VH regions are paired to form a monovalent molecule (such single-chain homologs of immunoglobulin fragments are called single-chain Fv (scFv)). Such single-chain antibodies are also intended to be encompassed within the term "antibody". Antibody fragments are obtained using conventional techniques known to those skilled in the art and are screened for utility in the same general manner as for intact antibodies.Antigen binding portions can be produced by enzymatic or chemical cleavage of recombinant DNA technology or complete immunoglobulins. Unless otherwise indicated, the numbering of amino acid positions in the antibodies described herein (e.g., amino acid residues in the Fc region) and identification of target regions (e.g., CDRs) uses the Kabat system (Kabat, EA. et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242).

[0100] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous antibody population, i.e., each antibody constituting the population is identical, except for naturally occurring mutations present in small amounts. Monoclonal antibodies are highly specific, directed against a single antigen. In addition, in contrast to polyclonal antibodies, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against the same single determinant on the antigen. As used herein, the term "monoclonal antibody" is not limited to antibodies produced by hybridoma technology, and can also be prepared using any art-recognized technology and technology described herein, such as transgenic animals, recombinant DNA methods (see, for example, U.S. Patent No. 4,816,567); or using a phage antibody library using the technology described in the following literature: for example, U.S. Patent No. 7,388,088 and U.S. Patent Application No. 09 / 856,907. The modifier "monoclonal antibody" should not be interpreted as requiring the production of antibodies by any particular method. The antibodies described herein can be derived from any animal, including birds and mammals. Preferably, the antibody is of human, mouse, donkey, rabbit, goat, camel, llama, horse or chicken origin.

[0101] As used herein, the term "chimeric antibody" refers to an antibody in which the variable region is derived from a non-human species (e.g., derived from a rodent) and the constant region is derived from a different species (e.g., human). Chimeric antibodies can be generated by antibody engineering. "Antibody engineering" is a term generally used for the modification of different types of antibodies, and the method for antibody engineering is well known to those skilled in the art. Therefore, chimeric antibodies can be genetic or engineered recombinant antibodies. The method for generating chimeric antibodies is well known to those skilled in the art, and therefore, the generation of chimeric antibodies can be carried out by other methods except as described herein. Chimeric monoclonal antibodies for human therapeutic applications are developed to reduce the expected antibody immunogenicity of non-human antibodies (e.g., rodent antibodies). They can generally contain non-human (e.g., mouse or rabbit) variable regions and human antibody heavy and light chain constant domains, which are specific for the antigen of interest. The term "variable region" or "variable domain" refers to the region comprising the CDRs and framework regions of both the heavy and light chains of an immunoglobulin.

[0102] As used herein, term "humanized antibody" refers to the non-human antibody of genetic engineering, which contains modified human antibody constant domains and non-human variable domains, to contain a high level of sequence homology with human variable domains. This can be achieved by transplanting six non-human antibody CDRs (which together form an antigen binding site) onto homologous human antibody framework regions (FRs). In order to fully rebuild the binding affinity and specificity of parental antibody, it may be necessary to replace framework residues from parental antibody (i.e., non-human antibody) into human framework regions (i.e., back mutations). Therefore, humanized antibody can include non-human CDR sequences, mainly human framework regions, which optionally include one or more amino acid back mutations to non-human amino acid sequences, and complete human antibody constant regions. Optionally, other amino acid modifications (which are not necessarily back mutations) can be applied to obtain humanized antibodies with preferred features, such as affinity and biochemical properties and / or other amino acid mutations can be introduced into constant regions.

[0103] As used herein with respect to cells, nucleic acids, polypeptides, and the like, the term "isolated" refers to molecules that are separated from one or more of the other components of a cell's natural environment, such as DNA or RNA. The term "isolated" also refers to nucleic acids or peptides that are substantially free of cellular material, viral material, or cell culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Furthermore, "isolated nucleic acid" is intended to include nucleic acid fragments that do not exist in their natural state and do not exist in their natural state. The term "isolated" is also used herein to refer to cells or polypeptides that have been separated from other cellular proteins or tissues. Isolated polypeptides are intended to include purified and recombinant polypeptides. Isolated polypeptides, etc., are typically prepared by at least one purification step. In one or more embodiments, the purity of the isolated nucleic acid, polypeptide, etc. is at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or a range (inclusive) between any two of these values, or any value therein.

[0104] An "isolated" antibody is one that has been separated and / or recovered from components of its natural environment. Some components of its natural environment are substances that would interfere with the diagnostic or therapeutic use of the antibody and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In some embodiments, the antibody is purified to the extent that: (1) the antibody is greater than 95%, such as greater than 99%, by weight, as measured by the Lowry method; (2) at least 15 residues of N-terminal or internal amino acid sequence are accessible by use of a spinning cup sequenator; or (3) homogeneity is determined by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or silver stain. Isolated antibodies include antibodies in situ within recombinant cells. Generally, isolated antibodies will be prepared by at least one or more purification steps. In some embodiments, the isolated antibody is at least about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 99%, or a range between any two of these values ​​(including the end values) or any value therein.

[0105] An "antigen" is an entity (eg, a protein entity or a peptide) to which an antibody binds, such as TNFR2. In the present invention, the TNFR2 antigen may be from a mammal, such as a human, rat, mouse, or monkey.

[0106] The antibodies and antigen binding fragments disclosed in the present invention include modified derivatives, i.e., modified by covalent attachment of any type of molecule to the antibody or antigen binding fragment, wherein the covalent attachment does not prevent the antibody or antigen binding fragment from binding to the epitope. The antibody or antigen binding fragment can be glycosylated, acetylated, pegylated, phosphorylated, amidated, derivatized by known protection / blocking groups, proteolytically cleaved, attached to cellular ligands or other proteins, etc. Any of the numerous chemical modifications can be carried out by existing techniques, including but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. In some embodiments, the antibody or antigen binding fragment can be conjugated to a therapeutic agent, a prodrug, a peptide, a protein, an enzyme, a virus, a lipid, a biological response modifier, a pharmaceutical agent, or PEG.

[0107] As used herein, the term "KD" is intended to refer to the dissociation equilibrium constant of a specific antibody-antigen interaction or the affinity of the antibody for the antigen, which is obtained by the ratio of kd to ka (i.e., kd / ka) and expressed as molar concentration (M). The KD value of an antibody can be determined using methods well known in the art.

[0108] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0109] The effective dose and treatment regimen for treating a particular patient will depend on various factors, including the specific antibody, antigen-binding fragment or derivative used, the patient's age and weight, general health, sex and diet, as well as the time of administration, frequency of excretion, drug combination, and the severity of the specific disease being treated. These factors are judged by a medical caregiver included within the scope of those of ordinary skill in the art. The dosage used can be determined by pharmacological and pharmacokinetic principles well known in the art. In some embodiments, the dosage of the antibody of the present invention administered to a patient is 0.01 mg / kg to 100 mg / kg patient body weight.

[0110] The "tumor" described in the present invention is selected from leukemia, lymphoma, ovarian cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, lung cancer (such as non-small cell lung cancer, etc.), bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome and sarcoma. wherein the leukemia is selected from the group consisting of acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia; the lymphoma is selected from the group consisting of Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom's macroglobulinemia; and the sarcoma is selected from the group consisting of osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, alveolar soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma.

[0111] In some embodiments, the present invention provides a composition, e.g., a pharmaceutically acceptable composition, comprising an antibody or antigen-binding fragment described herein formulated with a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, isotonic agents, and absorption delaying agents that are physiologically compatible. The carrier can be suitable for intravenous, intramuscular, subcutaneous, parenteral, rectal, spinal, or epidermal administration (e.g., by injection or infusion).

[0112] "Pharmaceutically acceptable" refers to materials listed in the pharmacopoeia for use in animals, particularly for human medicine. In addition, "pharmaceutically acceptable carriers and / or excipients" are generally any type of non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary.

[0113] The term "pharmaceutically acceptable carrier" refers to a diluent, adjuvant, excipient, or vehicle that can be administered to a patient along with the active ingredient. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including oils of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions, aqueous dextrose solutions, and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, skim milk powder, glycerol, propylene, ethylene glycol, water, ethanol, and the like. If desired, the composition may also contain a small amount of a wetting agent or emulsifier, or a pH buffer. Antibacterial agents such as benzyl alcohol or methyl paraben may also be used. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, and the like. The composition can be formulated into suppositories using conventional binders and carriers such as triglycerides. Oral formulations can include standard carriers, such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by EW Martin, which is incorporated herein by reference. Such compositions will contain clinically effective doses of antibodies or antigen-binding fragments, preferably in purified form, together with an appropriate amount of carrier and / or excipient, to provide a dosage form suitable for the patient. The preparation should be suitable for administration mode. The parent preparation can be packaged in an ampoule, disposable syringe, or a multiple dose bottle made of glass or plastic.

[0114] The compositions of the present invention can be in various forms. These forms include, for example, liquid, semisolid and solid dosage forms, such as liquid solutions (e.g., injectable solutions and infusible solutions), dispersions or suspensions, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic use. Common preferred compositions are in the form of injectable solutions or infusible solutions. The preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). In a preferred embodiment, the antibody is administered by intravenous infusion or injection. In another preferred embodiment, the antibody is administered by intramuscular or subcutaneous injection.

[0115] The compositions of the present invention can be formulated in neutral or salt form. Pharmaceutically acceptable salts include salts derived from anions such as hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, and the like, and salts derived from cations such as sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, and the like.

[0116] As used herein, the term "nucleic acid molecule" is intended to include DNA molecules and RNA molecules. Nucleic acid molecules can be single-stranded or double-stranded, such as double-stranded DNA.

[0117] As used herein, the term "vector" is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid connected thereto. A type of vector is a "plasmid," which refers to a circular double-stranded DNA loop in which other DNA fragments can be connected. Another type of vector is a viral vector in which other DNA fragments can be connected to a viral genome. Some vectors can replicate autonomously in the host cell (e.g., a bacterial vector with a bacterial replication origin and an episomal mammalian vector) into which they have been introduced. After being introduced into the host cell, other vectors (e.g., a non-episomal mammalian vector) can be incorporated into the genome of the host cell, thereby replicating together with the host genome. In addition, some vectors can guide the expression of genes operably connected thereto. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). Typically, expression vectors useful in recombinant DNA technology are typically in the form of plasmids. The terms "plasmid" and "vector" can be used interchangeably. However, other forms of expression vectors, such as viral vectors (e.g., replication-defective retroviruses, adenoviruses, and adeno-associated viruses) that play equivalent functions can also be considered.

[0118] As used herein, the term "recombinant host cell" (or simply "host cell") is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the specific subject cell, but also to the progeny of such a cell. Because certain modifications may occur in progeny due to mutations or environmental influences, such progeny may not actually be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein.

[0119] Antibodies can be prepared using conventional recombinant DNA techniques. Antibody-producing vectors and cell lines can be selected, constructed, and cultured using techniques well known to those skilled in the art. These techniques are described in various laboratory manuals and major publications, such as Recombinant DNA Technology for Production of Protein Therapeutics in Cultured Mammalian Cells, DL Hacker, FMWurm, in Reference Module in Life Sciences, 2017, the entire contents of which, including supplementary content, are incorporated by reference in their entirety.

[0120] In some embodiments, DNA encoding the antibody can be designed and synthesized according to conventional methods based on the antibody amino acid sequence described herein, inserted into an expression vector, and then transfected into host cells. The transfected host cells are then cultured in culture medium to produce monoclonal antibodies. In some embodiments, the antibody expression vector comprises at least one promoter element, an antibody coding sequence, a transcription termination signal, and a polyA tail. Other elements include enhancers, Kozak sequences, and donor and acceptor sites for RNA splicing on either side of the inserted sequence. Efficient transcription can be achieved using the early and late promoters of SV40, and the early promoters of long terminal repeats from retroviruses such as RSV, HTLV1, HIV, and cytomegalovirus. Other cellular promoters, such as the actin promoter, can also be used. Suitable expression vectors may include pIRES1neo, pRetro-Off, pRetro-On, PLXSN, or pLNCX, pcDNA3.1(+ / -), pcDNA / Zeo(+ / -), pcDNA3.1 / Hygro(+ / -), PSVL, PMSG, pRSVcat, pSV2dhfr, pBC12MI and pCS2, etc. Commonly used mammalian cells include 293 cells, Cos1 cells, Cos7 cells, CV1 cells, mouse L cells and CHO cells, etc.

[0121] In some embodiments, the inserted gene fragment needs to contain a selection marker. Common selection markers include dihydrofolate reductase, glutamine synthetase, neomycin resistance, hygromycin resistance, and other selection markers to facilitate the screening and isolation of successfully transfected cells. The constructed plasmid is transfected into host cells lacking these genes. After culture in a selective medium, the successfully transfected cells grow in large numbers and produce the desired target protein.

[0122] In the following examples, the production and purification methods of the TNFR2 antigen (hTNFR2-Fc antigen) used include:

[0123] The amino acid sequence of human TNFR2 (P20333) was found from the protein database Uniprot (https: / / www.uniprot.org / ), where the amino acid sequence of the extracellular domain (ECD) of human TNFR2 is amino acid residues from position 1 to position 257.

[0124] The amino acid sequence of human IgG1-Fc (P01857) was found from the protein database Uniprot, which contains amino acid residues from positions 104 to 330. Nucleotide sequences corresponding to the TNFR2 extracellular region and Fc (104-330) were then artificially synthesized (Genentech). TNFR2 and Fc were then linked using EcoRI and HindIII enzymes, respectively, and inserted into the pCDNA3.1 vector (purchased from Invitrogen) to generate the recombinant plasmid pCDNA-TNFR2-Fc.

[0125] The recombinant plasmid was then transiently transfected into HEK293 cells (purchased from ATCC) using PEI (polyetherimide). After 7 days of culture, the supernatant was collected and finally purified by Protein A affinity chromatography to obtain hTNFR2-Fc protein samples for use in the examples.

[0126] >TNFR2-ECD (SEQ ID NO: 37)

[0127] >human IgG1-Fc (SEQ ID NO: 38)

[0128] Example 1. Production of TNFR2 hybridoma monoclonal antibodies

[0129] TNFR2 recombinant protein (purchased from Kaixia Biotechnology, product number: TNF-HM1R2) was used to immunize 6-8 week old female Balb / c mice (purchased from Shanghai Slake Laboratory Animal Co., Ltd.). The specific process is as follows: the first immunization used complete Freund's adjuvant (CFA, purchased from SIGMA, product number: F5881) mixed with human TNFR2 recombinant protein in a 1:1 ratio. After sufficient emulsification, the mice were immunized by subcutaneous injection. Each mouse was injected with 50 μg, and the total injection volume was 100 μL.

[0130] Three weeks after the first immunization, the second and third immunizations were performed, with an interval of three weeks between the second and third immunizations. Human TNFR2 recombinant protein was mixed with incomplete Freund's adjuvant (IFA, purchased from SIGMA, product number: F5506) in a 1:1 ratio. After sufficient emulsification, the mice were immunized by subcutaneous injection. Each mouse was injected with 25 μg, and the total injection volume was 100 μL.

[0131] 7-10 days after the third immunization, blood was collected from the tail vein of mice for titer determination. 4The mouse antibodies were detected by ELISA. If the OD450 reached 1.0 or above, the cell fusion requirements were met. Before cell fusion, the mice evaluated for efficacy were given a fourth booster immunization. The TNFR2 recombinant protein was diluted with PBS (phosphate buffered saline) buffer and injected intraperitoneally. Each mouse was injected with 25 μg of the protein in a total injection volume of 100 μL. On the fourth day after the fourth immunization, the mice were euthanized and the spleens were removed aseptically. The mouse spleen lymphocytes were isolated and extracted aseptically. The spleen cells of the immunized mice (1×10 8 ) and SP2 / 0 myeloma cells (1.5×10 7 ) were fused with PEG Hybri-Max (purchased from Sigma, catalog number: 7181).

[0132] After fusion, cells were resuspended in RPMI-1640 medium (Gibco) containing 10% FBS, 10% Hybridoma Feeder Supplement (purchased from Suzhou Botelon Immunotechnology Co., Ltd., Cat. No. CM-2001), 1% Pen-Strep (double-antibody), and 1× HAT (containing hypoxanthine, aminopterin, and thymidine). 200 μL of cells were dispensed into each well of a 96-well plate, with one mouse corresponding to 10 plates. The plates were cultured at 37°C in a 5% CO2 incubator.

[0133] On days 3 and 7, 100 μL of culture medium in each well was replaced with fresh RPMI-1640 medium containing 10% FBS, 10% Hybridoma Feeder Supplement, 1% Pen-Strep, and 1× HAT (containing hypoxanthine, aminopterin, and thymidine). Screening typically occurred between days 8 and 12, and the culture supernatant from each well was tested for binding to the coated hTNFR2-Fc by ELISA.

[0134] Positive clones were subcloned to obtain hybridoma clones producing monoclonal antibodies. After a series of physical, chemical, and functional screening, a total of five positive candidate mouse antibody molecules were obtained. The CDRs of these sequences were analyzed using the IMGT / V-QUEST program (http: / / www.imgt.org / IMGT_vquest / vquest). Table 4 shows the VH and VL sequences of the candidate mouse antibody molecules and the CDR composition of the candidate mouse antibody molecules (analyzed using the Kabat numbering system).

[0135] Table 4: Sequence composition of the variable regions of TNFR2 hybridoma mouse antibodies

[0136] Example 2. Expression and Characterization of TNFR2 Chimeric Antibodies

[0137] The chimeric light chains of the five chimeric antibodies were constructed by connecting the mouse antibody VL region to the human kappa light chain constant region (SEQ ID NO: 41), and their chimeric heavy chains were constructed by connecting the mouse antibody VH region to the human IgG1 constant region (SEQ ID NO: 42). The name of the corresponding chimeric antibody is obtained by removing the initial "m" from the mouse antibody ID. PCR primers designed to add restriction sites, Kozak sequences, and mouse antibody light and heavy chain signal peptides (SEQ ID NO: 39 and SEQ ID NO: 40) to the 5' end of the mouse cDNA sequence were used to modify the light and heavy chains. The DNA encoding the light and heavy chains of each chimeric antibody was subcloned into the expression vector pcDNA3.1.

[0138] (SEQ ID NO: 39, heavy chain modified sequence)

[0139] Among them, aagctt is the HindIII restriction site, gccgccaccatgg is the Kozak sequence, and atggagcggcactggatcttcctgttcctgttctccgtgaccgccggcgtgcactcc is the mouse IgG2aHC signal peptide (or leader sequence).

[0140] (SEQ ID NO: 40, light chain modified sequence)

[0141] Among them, aagctt is the HindIII restriction site, gccgccaccatgg is the Kozak sequence, and atggagacagacacactcctgctatgggtactgctgctctgggttccaggttccactggt is the mouse kappa LC signal peptide (or leader sequence).

[0142] Freestyle 293 cells (200 mL, 1*10^6 / mL) were co-transfected with 100 μg of each chimeric heavy and light chain expression plasmid using PEI as the transfection reagent and cultured at 37°C for 6 days. The chimeric antibodies in the supernatant were then purified using a Protein A affinity chromatography column (purchased from GE Healthcare).

[0143] Example 3. Characterization of TNFR2 chimeric antibodies

[0144] 3.1 ELISA detection of binding to antigen hTNFR2-Fc Antigen hTNFR2-Fc was coated on an ELISA plate at a concentration of 2 μg / mL, 100 μL / well, one day in advance, and coated overnight at 4°C. The next day, it was blocked with 5% skim milk powder at 37°C for 2 hours before use for detection. The chimeric antibody was diluted 3-fold starting from 2 μg / mL. 100 μL of the chimeric antibody in the supernatant was added to the ELISA plate and incubated at room temperature for 1 hour. Unbound antibodies were washed with PBST (PBS + 0.05% Tween) and anti-human Kappa light chain (HRP Conjugated (purchased from Sigma, product number A7164, 1:10000 dilution), placed at room temperature for 1 hour; unbound antibody was washed with PBST, TMB colorimetric solution (Shanghai Sangon, product number E66100) was added, and the reaction was stopped by adding 0.1MH2SO4 after placing at room temperature for 15 minutes. The absorbance value was read at a wavelength of 450nm using a microplate reader. The binding curve is consistent with the EC 50 The results are shown in Figure 1 and Table 5.

[0145] Table 5: Binding of TNFR2 chimeric antibodies to the antigen hTNFR2-Fc

[0146] 3.2 Flow cytometry (FACS) detection of the binding ability of chimeric antibodies to cells overexpressing TNFR2 CHO cells were transfected with pCMV vector (Invitrogen) containing full-length human TNFR2 cDNA to overexpress human TNFR2, and the cells were named CHO-TNFR2 cells.

[0147] CHO-TNFR2 cells (0.5×10 6 Cells) were incubated with chimeric antibodies (initial concentration 100 nM, 3-fold serial dilution) in PBS buffer (containing 4% FBS, 0.2% NaN3) on ice for 60 minutes. The cells were then washed twice with PBS buffer and incubated with fluorescent secondary antibody Goat anti-Human IgG Fc Secondary Antibody, PE (eBioscience, Cat. No. 12-4998-82) diluted 1:500 in PBS buffer on ice for 30 minutes. After incubation, the cells were washed twice with PBS buffer and analyzed by flow cytometry on a CytoFLEX instrument (Beckman). The binding curve and EC 50 The results are shown in Figure 2 and Table 6.

[0148] Table 6: Binding of TNFR2 chimeric antibodies to CHO-TNFR2 cells

[0149] 3.3 ELISA Detection of Antibody Blocking Binding Ability of TNFR2 and Its Ligand TNF-α ELISA experiment was used to screen TNFR2 chimeric antibodies that block the binding of TNFR2 and TNF-α. The experimental procedure is as follows:

[0150] 1) hTNFR2-Fc (2 μg / mL), coating in PBS, overnight at 4°C;

[0151] 2) Block with 5% skim milk powder in a 37°C incubator for 2 h;

[0152] 3) Dilute TNF-α-bio (purchased from Sino Biological, cat. no. 10602-HNAE-B) with PBS to a final concentration of 25 ng / mL;

[0153] 4) Dilute the chimeric antibody and negative unrelated control antibody to a starting concentration of 15 μg / mL, perform a 3-fold serial dilution, and then mix with an equal volume of TNF-α-bio. Add 100 μL / well to the ELISA plate, incubate in a 37°C incubator for 2 h, and then wash 8 times with PBST.

[0154] 5) Add 100 μL of enzyme-labeled secondary antibody (Jackson Immuno Research Inc., catalog number: 016-030-084, 1:10,000 dilution) to each well, incubate in a 37°C incubator for 1 h, and then wash 8 times with PBST;

[0155] 6) Develop the plate with TMB colorimetric solution, 100 μL per well.

[0156] 7) Add 0.1 M H2SO4 to stop color development and read the results at 450 nm using a microplate reader.

[0157] The results are shown in Figure 3 and Table 7. Adalimumab, and chimeric antibodies 3E1E3 and 9F5G8 had strong blocking abilities, 8A6C8 had half blocking abilities, and 1H5B7 and 2E12B11 had no ability to block the binding of TNFR2 to its ligand TNF-α.

[0158] Table 7: Experimental results of TNFR2 chimeric antibodies blocking the ability of TNFR2 to bind to TNF-α

[0159] 3.4 Fortebio Detects Affinity of TNFR2 Chimeric Antibodies

[0160] ForteBio affinity determination was performed according to existing conventional methods (Estep, P et al. MAbs, 2013, 5(2): 270-8). The experimental process is as follows: First, the candidate antibody screened was bound with a protein A probe (antibody concentration: 20 μg / mL). After equilibration with PBS buffer, it was combined with different concentrations of hTNFR2-His (TNF-HM1R2, Kaika Biotechnology (Shanghai) Co., Ltd.) (concentrations: 7.41, 22.2, 66.7, 200 nM) to obtain the binding constant Kon. Then, the antibody was transferred to PBS buffer for dissociation to obtain the dissociation constant Koff. The Koff / Kon value was analyzed to calculate the affinity value KD. After testing and analysis, the affinities of the five chimeric antibodies are shown in Table 8 below.

[0161] Table 8: TNFR2 chimeric antibody affinity

[0162] Example 4. Humanized TNFR2 Antibody

[0163] 4.1 Composition and Preparation of Humanized TNFR2 Antibodies

[0164] The variable region and CDR sequences of the humanized TNFR2 antibody are shown in Table 9:

[0165] Table 9: Variable region and CDR sequence composition of heavy and light chains of humanized TNFR2 antibodies

[0166] The humanized light chain variable region or heavy chain variable region is assembled with the human IgG1 kappa light chain constant region sequence (SEQ ID NO:41) or the IgG1 heavy chain constant region sequence (SEQ ID NO:42) to form a complete light chain or heavy chain sequence. The resulting light chain expression plasmid or heavy chain expression plasmid can be paired, respectively. For example, the antibody heavy chain composed of the heavy chain variable region VH2.1 and the above-mentioned IgG1 heavy chain constant region is HC2.1, the antibody light chain composed of the light chain variable region VL2.1 and the above-mentioned kappa light chain constant region is LC2.1, and so on. The composition of the humanized TNFR2 antibody is shown in Table 10. The HC2.1 and LC2.1 expression plasmids, HC4 and LC3 expression plasmids, HC4 and LC4 expression plasmids, HC5 and LC3 expression plasmids, HC5 and LC4 expression plasmids, and HC6 and LC2.1 expression plasmids are transiently transfected into 293F host cells at a 1:1 ratio. After incubation at 37°C for 6 days, the humanized TNFR2 antibody in the supernatant was purified by Protein A affinity chromatography.

[0167] Table 10: Composition of humanized TNFR2 antibodies

[0168] The heavy and light chain nucleic acid sequences are as follows:

[0169] >HC2.1 (SEQ ID NO: 51, heavy chain nucleic acid sequence of HC2.1)

[0170] >HC4 (SEQ ID NO: 53, heavy chain nucleic acid sequence of HC4)

[0171] >HC5 (SEQ ID NO: 55, heavy chain nucleic acid sequence of HC5)

[0172] >HC6 (SEQ ID NO: 57, heavy chain nucleic acid sequence of HC6)

[0173] >LC2.1 (SEQ ID NO: 59, light chain nucleic acid sequence of LC2.1)

[0174] >LC3 (SEQ ID NO: 61, light chain nucleic acid sequence of LC3)

[0175] >LC4 (SEQ ID NO: 63, light chain nucleic acid sequence of LC4)

[0176] 4.2 ELISA detection of binding of humanized antibodies to antigen hTNFR2

[0177] The antigen hTNFR2-his (catalog number: TNF-HM1R2, Kaika Biotechnology (Shanghai) Co., Ltd.) was coated on the ELISA plate at a concentration of 1 μg / mL, 100 μL / well, and coated at 4°C overnight. The next day, it was blocked with 5% skim milk powder at 37°C for 2 hours before use for detection; the humanized antibody started at 3 μg / mL and was diluted 3 times. 100 μL per well was added to the ELISA plate and incubated in a 37°C incubator for 1 hour; after washing with PBST three times, anti-human Kappa light chain (HRP Conjugate) (purchased from Sigma, catalog number A7164, 1:5000 dilution) was added and placed at room temperature for 1 hour (h); after washing with PBST five times, TMB color development solution (Shanghai Shenggong, catalog number E66100) was added, placed at room temperature for 15 minutes (min) and then 0.1M The reaction was terminated with H2SO4 and the absorbance was read at 450nm using a microplate reader. 50 The results are shown in Figure 4 and Table 11.

[0178] Table 11: Binding of humanized TNFR2 antibodies to hTNFR2-his

[0179] 4.3 Flow cytometry (FACS) detection of the binding ability of humanized antibodies to cells overexpressing TNFR2

[0180] CHO-TNFR2 cells (0.5×10 6 Cells) were incubated with humanized antibodies (initial concentration 100 nM, 3-fold serial dilution) in PBS buffer (containing 4% FBS, 0.2% NaN3) on ice for 60 minutes. The cells were then washed twice with PBS buffer and incubated with fluorescent secondary antibody Goat anti-Human IgG Fc Secondary Antibody, PE (eBioscience, Cat. No. 12-4998-82, 1:500 dilution) diluted in PBS buffer on ice for 30 minutes. After incubation, the cells were washed twice with PBS buffer and analyzed by flow cytometry on a CytoFLEX instrument (Beckman). The binding curve and EC 50 The results are shown in Figure 5 and Table 12.

[0181] Table 12: Binding ability test results of humanized TNFR2 antibodies to CHO-TNFR2

[0182] 4.4 ELISA detection of the ability of humanized TNFR2 antibodies to block the binding of TNFR2 to its ligand TNF-α

[0183] The humanized TNFR2 antibody was used to detect the binding of TNFR2 to TNF-α by ELISA. The experimental procedure is as follows:

[0184] 1) Dilute hTNFR2-his in PBS buffer (final concentration 1 μg / mL), add 100 μl to each well, and coat overnight at 4°C;

[0185] 2) Block with 5% skim milk powder in a 37°C incubator for 2 h;

[0186] 3) Dilute TNF-α-bio (purchased from Sino Biological, Cat. No. 10602-HNAE-B) with PBS to a final concentration of 10 ng / mL, which serves as the antibody diluent.

[0187] 4) Dilute the humanized TNFR2 antibody, the negative unrelated control antibody BAT5906 (an antibody targeting VEGF, the sequence of which is from patent CN110283248B), and the positive control antibody adalimumab with the above-mentioned antibody diluent at a starting concentration of 12 μg / mL, and then dilute them in 2.5-fold gradients. After incubation in a 37°C incubator for 1 hour, wash five times with PBST.

[0188] 5) Add enzyme-labeled secondary antibody SA-HRP (Jackson Immuno Research Inc., catalog number: 016-030-084, 1:5000 dilution), add 100 μl to each well, incubate in a 37°C incubator for 1 hour, and then wash 8 times with PBST;

[0189] 6) Develop the plate with TMB colorimetric solution, 100 μL per well.

[0190] 7) Add 0.1 M H2SO4 to stop color development and read the results at 450 nm using a microplate reader.

[0191] The results are shown in Figure 6 and Table 13. Adalimumab has extremely strong blocking ability, and humanized TNFR2 antibodies all have strong blocking ability. The negative control BAT5906 does not block the binding ability of TNFR2 and its ligand TNF-α.

[0192] Table 13: Test results of the ability of humanized TNFR2 antibodies to block the binding of TNFR2 to TNF-α

[0193] 4.5 Biological activity assay of humanized TNFR2 antibody Soluble TNFα (sTNF-α) and TNFR2 signaling axis can induce the death of Jurkat cells overexpressing TNFR2 (TNFR2-Jurkat), and this is positively correlated with the amount of sTNF-α, but does not affect the viability of wild-type Jurkat cells lacking TNFR2 expression ( FXand B.Seed, Regulated Commitment of TNF Receptor Signaling: A Molecular Switch for Death or Activation. Immunity, 1999. 11(6): p. 783-793.; Chen, Y., et al., Antagonistic Antibody Targeting TNFR2 Inhibits Regulatory T Cell Function to Promote Anti-Tumor Activity. Frontiers in Immunology, 2022. 13). Humanized antibodies targeting TNFR2 can block the binding of sTNF-α to TNFR2 on the TNFR2-Jurkat cell membrane, thereby reversing the death of TNFR2-Jurkat cells induced by sTNF-α.

[0194] Preparation of sTNF-α-his protein: A cDNA sequence expressing the extracellular domain of TNF-α (Uniprot accession: positions 57-233 of P01375) fused to a 10×his (HHHHHHHHHH) tag was cloned into the pcDNA3.1 vector (Invitrogen) via the HindIII / EcoRI restriction endonuclease window. After transient expression in 293F cells, the sTNF-α-his protein was isolated by nickel affinity chromatography.

[0195] TNFR2 cDNA (TNFR2 cDNA cloning plasmid purchased from Sino Biological, catalog number: HG10417-M) was cloned into the lentiviral system vector pCDH-CMV-MCS-EF1-Puro (SBI, CD500B-1) through the XbaI / HindIII restriction window, and the TNFR2 gene was stably overexpressed in Jurkat cells (ATCC, clone E6-1) by lentiviral infection technology to obtain TNFR2-Jurkat cells, as shown in Figure 7A.

[0196] In a white 96-well cell culture plate, TNFR2-Jurkat cells were resuspended in RPMI-1640 medium containing 10% FBS, with 50,000 cells per well and a volume of 50 μL per well, with 3 replicates. sTNF-α-his was diluted with RPMI-1640 medium containing 10% FBS, and 50 μL was added to each well. The starting concentration of sTNF-α-his in the well was 1 μg / mL, and 3-fold serial dilution was performed, with 3 replicates. Incubate overnight (approximately 20-24 hours), and the cell viability detection reagent (CellCounting-Lite2.0, Novagen, DD1101) was added the next day, and the relative light units (RLU) were read using a microplate reader. As shown in Figure 7B, the results show that sTNF-α can induce the death of Jurkat cells overexpressing TNFR2 (TNFR2-Jurkat), which is positively correlated with the amount of sTNF-α.

[0197] In a white 96-well cell culture plate, TNFR2-Jurkat cells were resuspended in RPMI-1640 medium containing 10% FBS, with 50,000 cells per well in 50 μL per well, with triplicate wells. sTNF-α-his was diluted to 0.06 μg / mL (final concentration 0.03 μg / mL) in RPMI-1640 medium containing 10% FBS. HC2.1 & LC2.1 antibodies, HC6 & LC2.1 antibodies, and an irrelevant control IgG1 isotype (BAT5906) were diluted in this dilution, all starting at 27 μg / mL, and serially diluted three-fold, with replicate wells. Incubate overnight (approximately 20-24 hours). The next day, cell viability assay reagent was added and RLU was measured (Figure 7C). Both HC2.1&LC2.1 antibodies and HC6&LC2.1 antibodies can block the binding of sTNF-α to TNFR2 on the cell membrane of TNFR2-Jurkat cells, thereby reversing the death of TNFR2-Jurkat cells induced by sTNF-α.

[0198] Example 5. In vivo pharmacodynamics study of humanized TNFR2 antibodies

[0199] The humanized TNFR2 antibodies HC2.1 and LC2.1 were tested for their tumor-specific killing efficacy in a TNFR2 xenograft model of the MC38 mouse colon cancer cell line. Because human antibodies are prone to developing anti-antibody resistance in mice after repeated dosing, which can affect pharmacokinetic (PK) and, in turn, efficacy evaluation, the heavy chain constant region of the humanized TNFR2 antibody was replaced with that of mouse IgG2a (Uniprot accession: P01863·GCAA_MOUSE) for efficacy testing, resulting in the designation h9F5G8-mIgG2a.

[0200] MC38 tumor cells were subcutaneously transplanted into TNFR2 humanized mice to establish an MC38 xenograft tumor model (constructed by Shanghai Model Organisms Technology Co., Ltd.). On the 8th day after inoculation, the average tumor volume was approximately 130-134 mm 3 Tumor-bearing mice were randomly divided into two groups: control group 1 (Vehicle group) (hereinafter referred to as Group 1) and experimental group 2 (h9F5G8-mIgG2a, 7.5 mg / kg group) (hereinafter referred to as Group 2), with 8 mice in each group. All groups received the drug by intraperitoneal injection (ip) twice weekly (BIW) for 3 consecutive weeks, for a total of 6 doses.

[0201] Note: The vehicle injected in Group 1 is PBS.

[0202] At the end of the experiment, the inhibition curve of h9F5G8-mIgG2a on tumors is shown in FIG8 . h9F5G8-mIgG2a can significantly inhibit the proliferation of MC38 tumors, and the tumor inhibition rate TGI is 57.36%.

Claims

1. An antibody or antigen-binding fragment that binds to TNFR2, characterized in that: It contains one or more of the following amino acid sequences: (a) VHCDR1, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 11, 17, 23, 29; (b) VHCDR2, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 12, 18, 24, 30, 36; (c) VHCDR3, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 13, 19, 25, 31, 35; (d) VLCDR1, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 14, 20, 26, 32; (e) VLCDR2, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 15, 21, 27, 33; (f) VLCDR3 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 16, 22, 28, and 34.

2. An antibody or antigen-binding fragment that binds to TNFR2, characterized in that: It contains: VH and / or VL, the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO:23; a VHCDR2 amino acid sequence selected from the group consisting of SEQ ID NO:24 or SEQ ID NO:36; and a VHCDR3 amino acid sequence selected from the group consisting of SEQ ID NO:25 or SEQ ID NO:35; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO:26, the VLCDR2 amino acid sequence shown in SEQ ID NO:27, and the VLCDR3 amino acid sequence shown in SEQ ID NO:

28.

3. An antibody or antigen-binding fragment that binds to TNFR2, characterized in that: It contains: (1) VH and / or VL, wherein the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO: 11; the VHCDR2 amino acid sequence shown in SEQ ID NO: 12; and the VHCDR3 amino acid sequence shown in SEQ ID NO: 13; and the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO: 14, the VLCDR2 amino acid sequence shown in SEQ ID NO: 15, and the VLCDR3 amino acid sequence shown in SEQ ID NO: 16; or (2) VH and / or VL, the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO: 17; the VHCDR2 amino acid sequence shown in SEQ ID NO: 18; and the VHCDR3 amino acid sequence shown in SEQ ID NO: 19; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO: 20, the VLCDR2 amino acid sequence shown in SEQ ID NO: 21, and the VLCDR3 amino acid sequence shown in SEQ ID NO: 22; or (3) VH and / or VL, the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO:23; the VHCDR2 amino acid sequence shown in SEQ ID NO:24; and the VHCDR3 amino acid sequence shown in SEQ ID NO:25; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO:26, the VLCDR2 amino acid sequence shown in SEQ ID NO:27, and the VLCDR3 amino acid sequence shown in SEQ ID NO:28; or (4) VH and / or VL, wherein the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO:29; the VHCDR2 amino acid sequence shown in SEQ ID NO:30; and the VHCDR3 amino acid sequence shown in SEQ ID NO:31; and the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO:32, the VLCDR2 amino acid sequence shown in SEQ ID NO:33, and the VLCDR3 amino acid sequence shown in SEQ ID NO:34; or (5) VH and / or VL, the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO:23; the VHCDR2 amino acid sequence shown in SEQ ID NO:24; and the VHCDR3 amino acid sequence shown in SEQ ID NO:35; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO:26, the VLCDR2 amino acid sequence shown in SEQ ID NO:27, and the VLCDR3 amino acid sequence shown in SEQ ID NO:28; or (6) VH and / or VL, the heavy chain variable region comprises the VHCDR1 amino acid sequence shown in SEQ ID NO:23; the VHCDR2 amino acid sequence shown in SEQ ID NO:36; and the VHCDR3 amino acid sequence shown in SEQ ID NO:35; the light chain variable region comprises the VLCDR1 amino acid sequence shown in SEQ ID NO:26, the VLCDR2 amino acid sequence shown in SEQ ID NO:27, and the VLCDR3 amino acid sequence shown in SEQ ID NO:

28.

4. The antibody or antigen-binding fragment according to claims 1-3, characterized in that: It comprises a VH comprising an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45 or 46; or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45 or 46, or consists of the same.

5. The antibody or antigen-binding fragment of claim 4, wherein the VH comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46.

6. The antibody or antigen-binding fragment of claim 4, wherein the VH comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46.

7. The antibody or antigen-binding fragment of claim 4, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 43, 44, 45 or 46.

8. The antibody or antigen-binding fragment according to any one of claims 1 to 7, characterized in that It comprises a VL, wherein the VL comprises an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48 or 49; or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48 or 49, or consists of the same.

9. The antibody or antigen-binding fragment of claim 8, wherein the VL comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

10. The antibody or antigen-binding fragment of claim 8, wherein the VL comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

11. The antibody or antigen-binding fragment of claim 8, wherein the VL comprises the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 47, 48 or 49.

12. The antibody or antigen-binding fragment according to any one of claims 1 to 11, characterized in that It comprises a heavy chain comprising an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54 or 56; or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 50, 52, 54 or 56, or consists of the same.

13. The antibody or antigen-binding fragment of claim 12, wherein the heavy chain comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56.

14. The antibody or antigen-binding fragment of claim 12, wherein the heavy chain comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 50, 52, 54, or 56.

15. The antibody or antigen-binding fragment of claim 12, wherein the heavy chain comprises the amino acid sequence shown in SEQ ID NO: 50, 52, 54 or 56; 16. The antibody or antigen-binding fragment of any one of claims 1 to 15, comprising a light chain comprising, or consisting of, an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62, or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

17. The antibody or antigen-binding fragment of claim 16, wherein the light chain comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

18. The antibody or antigen-binding fragment of claim 16, wherein the light chain comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 58, 60, or 62.

19. The antibody or antigen-binding fragment of claim 16, wherein the light chain comprises the amino acid sequence shown in SEQ ID NO: 58, 60 or 62.

20. The antibody or antigen-binding fragment according to any one of claims 1 to 19, wherein: It comprises VH and VL, wherein the VH comprises an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45 or 46, or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45 or 46, or consists of; the VL comprises an amino acid sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48 or 49, or an amino acid sequence that has one or more conservative amino acid substitutions compared to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48 or 49, or consists of.

21. The antibody or antigen-binding fragment of claim 20, wherein the VH comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46; and the VL comprises an amino acid sequence that is at least 90% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

22. The antibody or antigen-binding fragment of claim 20, wherein the VH comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 1, 3, 5, 7, 9, 43, 44, 45, or 46; and the VL comprises an amino acid sequence that is at least 95% identical to the sequence shown in any one of SEQ ID NOs: 2, 4, 6, 8, 10, 47, 48, or 49.

23. The antibody or antigen-binding fragment of claim 20, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 43, 44, 45 or 46; and the VL comprises the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 47, 48 or 49.

24. The antibody or antigen-binding fragment of claim 20, wherein the VH comprises the amino acid sequence shown in SEQ ID NO: 1, and the VL comprises the amino acid sequence shown in SEQ ID NO: 2; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:3, and the VL comprises the amino acid sequence shown in SEQ ID NO:4; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:5, and the VL comprises the amino acid sequence shown in SEQ ID NO:6; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:7, and the VL comprises the amino acid sequence shown in SEQ ID NO:8; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:9, and the VL comprises the amino acid sequence shown in SEQ ID NO:10; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:44, and the VL comprises the amino acid sequence shown in SEQ ID NO:48; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:44, and the VL comprises the amino acid sequence shown in SEQ ID NO:49; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:45, and the VL comprises the amino acid sequence shown in SEQ ID NO:48; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:45, and the VL comprises the amino acid sequence shown in SEQ ID NO:49; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:43, and the VL comprises the amino acid sequence shown in SEQ ID NO:47; Alternatively, the VH comprises the amino acid sequence shown in SEQ ID NO:46, and the VL comprises the amino acid sequence shown in SEQ ID NO:

47.

25. The antibody or antigen-binding fragment according to any one of claims 1 to 24, wherein: It contains heavy chains and light chains, wherein The heavy chain comprises the amino acid sequence shown in SEQ ID NO:52, and the light chain comprises the amino acid sequence shown in SEQ ID NO:60; or, The heavy chain comprises the amino acid sequence shown in SEQ ID NO:52, and the light chain comprises the amino acid sequence shown in SEQ ID NO:62; or, The heavy chain comprises the amino acid sequence shown in SEQ ID NO:54, and the light chain comprises the amino acid sequence shown in SEQ ID NO:60; or, The heavy chain comprises the amino acid sequence shown in SEQ ID NO:54, and the light chain comprises the amino acid sequence shown in SEQ ID NO:62; or, The heavy chain comprises the amino acid sequence shown in SEQ ID NO:50, and the light chain comprises the amino acid sequence shown in SEQ ID NO:58; or, The heavy chain comprises the amino acid sequence shown in SEQ ID NO:56, and the light chain comprises the amino acid sequence shown in SEQ ID NO:

58.

26. The antibody or antigen-binding fragment according to any one of claims 1 to 25, wherein: These include Fab, F(ab')2, Fv or single-chain Fv fragments (scFv).

27. The antibody or antigen-binding fragment of any one of claims 1-25, comprising a heavy chain constant region selected from IgG1, IgG2, IgG3 and IgG4.

28. The antibody or antigen-binding fragment of claim 27, wherein the sequence of the heavy chain constant region of IgG1 comprises the amino acid sequence shown in SEQ ID NO:

42.

29. The antibody or antigen-binding fragment of any one of claims 1-28, comprising a light chain constant region selected from a kappa or lambda chain.

30. The antibody or antigen-binding fragment of claim 29, wherein the light chain constant region of the kappa chain comprises the amino acid sequence shown in SEQ ID NO:

41.

31. The antibody or antigen-binding fragment of any one of claims 1-30, which binds to the extracellular region of TNFR2.

32. The antibody or antigen-binding fragment of any one of claims 1-31, which is a humanized antibody or antigen-binding fragment.

33. A pharmaceutical composition, characterized in that Comprising the antibody or antigen-binding fragment according to any one of claims 1 to 32 and a pharmaceutically acceptable carrier, excipient or stabilizer.

34. A nucleic acid encoding the antibody or antigen-binding fragment or a portion thereof according to any one of claims 1 to 32.

35. The nucleic acid of claim 34, comprising a nucleic acid sequence encoding a heavy chain.

36. The nucleic acid of claim 35, wherein the nucleic acid sequence is 85% identical to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55 or SEQ ID NO:57; Alternatively, the nucleic acid sequence has 90% identity to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55 or SEQ ID NO:57; Alternatively, the nucleic acid sequence has 95% identity to the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55 or SEQ ID NO:57; Alternatively, the nucleic acid sequence comprises the sequence shown in any one of SEQ ID NO:51, SEQ ID NO:53, SEQ ID NO:55 or SEQ ID NO:

57.

37. A nucleic acid as described in any one of claims 34-36, wherein the nucleic acid comprises a nucleic acid sequence encoding a light chain.

38. The nucleic acid of claim 37, wherein the nucleic acid sequence has 85% identity to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61 or SEQ ID NO:63; Alternatively, the nucleic acid sequence has 90% identity to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61 or SEQ ID NO:63; Alternatively, the nucleic acid sequence has 95% identity to the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61 or SEQ ID NO:63; Alternatively, the nucleic acid sequence comprises the sequence shown in any one of SEQ ID NO:59, SEQ ID NO:61 or SEQ ID NO:

63.

39. A vector comprising the nucleic acid according to any one of claims 34 to 38.

40. A host cell comprising the nucleic acid of any one of claims 34-38 or the vector of claim 39.

41. A method for producing an antibody or antigen-binding fragment, characterized in that: The method comprises culturing the host cell of claim 40 under conditions suitable for gene expression.

42. The method of claim 41, wherein the antigen binding fragment is Fab, F(ab')2, Fv or scFv.

43. A kit comprising the antibody or antigen-binding fragment of any one of claims 1-32.

44. Use of the antibody or antigen-binding fragment of any one of claims 1 to 32 or the pharmaceutical composition of claim 33 in preparing drugs for preventing and / or treating diseases, or screening drugs for preventing and / or treating diseases.

45. The use according to claim 44, wherein the disease is a disease related to the TNFR2 signaling pathway.

46. ​​The use according to claim 44 or 45, wherein the disease is cancer or tumor.

Images