METHODS OF DETECTING DSBs AND MUTATIONS
The method enhances the detection of DSBs and mutations by associating findings through shared locations and using error-corrected duplex sequencing, thereby reducing false positives and increasing confidence in the results.
Patent Information
- Application Number
- PCT/EP2024/087961
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-22
- Filing Date
- 2024-12-20
- Publication Date
- 2025-06-26
AI Technical Summary
Existing methods for detecting double-strand breaks (DSBs) and mutations in nucleic acid samples suffer from high false positive rates, especially in samples with diverse sequences like genomic DNA.
A method that involves identifying DSBs using a PCR-free DSB-detection method and associating mutations with DSBs if they share the same location, using error-corrected duplex sequencing to confirm the presence of mutations.
This approach increases the confidence in identifying DSBs and mutations by reducing false positives and providing reciprocal validation between DSB and mutation detection methods.
Smart Images

Figure IMGF000054_0001 
Figure IMGF000056_0001 
Figure IMGF000063_0001
Abstract
Description
[0001] METHODS OF DETECTING DSBs AND MUTATIONS FIELD OF THE INVENTION Provided herein are methods and kits for the analysis of nucleic acids. In particular, provided herein are methods that are relevant to the identification of double strand breaks (DSBs) and mutations. BACKGROUND OF THE INVENTION Methods of detecting features within nucleic acids, such as DSBs or mutations, can suffer from false positives. This is particularly relevant to samples that contain a large amount of diverse sequence, such as genomic DNA (gDNA). It can be challenging to filter out ostensible DSBs that have been introduced or overrepresented due to the method used to identify them. Similarly, when detecting rare mutations, it can be challenging to identity whether a mutation is present in the sample or whether it has been introduced by the method of detection. Thus, there is a need for improved methods for identifying DSBs and / or mutations with a higher degree of confidence. SUMMARY OF THE INVENTION In an aspect, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by analysis of information obtained by a method of sequencing applied to said nucleic acid sample; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. The method of DSB-detection may be a PCR-free method of DSB detection. The method may involve the preparation of a nucleic acid library wherein only DSB-associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate. The method may be INDUCE-Seq. The method of sequencing may be a method of error-corrected sequencing and / or a method of duplex sequencing. The method of sequencing may comprise: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. Steps ii) and iv) may be performed separately. The fragmentation of the plurality of nucleic acids may take place after the first adapter ligation step and before, or as a part of, the second adapter ligation step. The method of DSB-detection may comprise a PCR-free method of library preparation followed by direct binding of DSB-associated nucleic acids to a substrate without prior enrichment and / or the method of sequencing may comprise error-corrected duplex sequencing of a library comprising a hairpin adapter ligated to one end of nucleic acid fragments and a non-hairpin adapter ligated to the other end of the nucleic acid fragments. The method of DSB-detection may comprise a PCR-free method of library preparation followed by direct binding of DSB-associated nucleic acids to a substrate without prior enrichment and the method of sequencing may be a method of error-corrected duplex sequencing and comprising: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. The method of DSB-detection may involve a PCR-free preparation of a nucleic acid library, wherein only DSB- associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate and the method of sequencing may be a method of error-corrected duplex sequencing and comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. The method of DSB-detection may involve a PCR-free preparation of a nucleic acid library, wherein the method comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation and comprising a sequence identical to a region of a second primer, and wherein the second adapter does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; and the method of sequencing may be a method of error-corrected duplex sequencing that comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. The method of DSB-detection may involve PCR-free preparation of a nucleic acid library, wherein the method comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a first adapter pair under conditions conducive to ligation, wherein the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and wherein the first adapter pair comprises first and second oligonucleotides that are at least partially complementary, and the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a second adapter pair under conditions conducive to ligation, wherein the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides, wherein the first oligonucleotide is ligatable to a 5’ terminus and comprises a sequence identical to a region of the second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer; and the method of sequencing may be a method of error-corrected duplex sequencing that comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. The steps of the method of sequencing may be: performed sequentially and in the order i), ii), iii), iv); or performed sequentially and in the order i), iv), iii), ii); or performed in the order step i), step ii), and combined steps iii) and iv); or performed in the order step i), step iv), and combined steps iii) and ii). The method of DSB-detection may be INDUCE-Seq and the method of sequencing may be DEDUCE-Seq. The nucleic acid sample may comprise DNA, optionally genomic DNA (gDNA). The nucleic acid sample may be obtained from a mammal, optionally a human. The method may be implemented on a computer. In an aspect, there is provided a system for analysing nucleic acid information, the system comprising: a processor; and one or more computer-readable storage media having stored thereon instructions for execution on said processor to perform any method disclosed herein. In an aspect, there is provided a computer program product comprising a non-transitory machine readable medium storing program code that, when executed by one or more processors of a computer system, causes the computer system to implement any method disclosed herein. In an aspect, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by performing the steps of a method of error-corrected duplex sequencing followed by analysis of the information obtained; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. The steps of the method of error-corrected duplex sequencing may be: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; v) contacting the plurality of nucleic acids to a substrate comprising a first immobilised primer under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilised primer; and vi) obtaining sequence information for any nucleic acids that hybridised to the substrate in step v); optionally wherein step ii) is performed before step iv) or step iv) is performed before step ii). In an aspect, there is provided a kit comprising: i) a first adapter comprising a sequence suitable for hybridising to an immobilised primer on a substrate for sequencing; ii) a second adapter that comprises a sequence that enables amplification in combination with the first adapter, but wherein the second adapter does not comprise a sequence that can hybridise to a substrate for sequencing; iii) a hairpin adapter; and iv) a non-hairpin adapter that enables amplification and sequencing of ligated fragments. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Exemplary illustration of an embodiment of “DEDUCE-seq” (DuplEx Determination by Unbiased flow Cell Enrichment and sequencing). Figure 2. Exemplary illustration of sequencing. Mutations are read twice due to the linking of the DNA duplex. Figure 3. Exemplary illustration of binding to the substrate (in this case, a flow cell). DNA from Y-adaptor ligated fragments bind to the flow cell and hairpin-only ligated fragments are washed away. Figure 4. Exemplary overview of an embodiment of the methods of the present disclosure. Figure 5. DEDUCE-seq library preparation for Pilot-1; DNA size distribution and quantification.1) Left Panel - Genomic DNA was size selected to ~100-500bp (black trace) by removing DNA >300bp (gray trace).2) Middle panel - Ligated (black trace) and resonicated DNA (grey trace) were tested by gel electrophoresis.3) Right-panel - Post-sonication (black trace) and final library DNA of a DEDUCE-seq library is shown here. Figure 6. Distribution of HP sequences throughout the length of 9.5M Forward Reads (Left Panel) and Reverse Reads (Right Panel) from Pilot-1. Figure 7. DEDUCE-seq library discordant read pairs. Shown here are 3 examples of discordant, parallel reads pairs derived from a DEDUCE-seq library. The leftmost read pair (F1F2, reads are stacked) consists of left alignment (read F1, SAM flag 67) and right alignment (read F2, SAM flag 131) both mapped to the forward stand. The right read pair (R2R1) consists of left alignment (read R2, SAM flag 115) and right 2 (read R1, SAM flag 179). Read details for the second reverse alignment on the right are not shown. Figure 8. DEDUCE-seq library preparation for Pilot-2; DNA size distribution and quantification.1) Left Panel - Genomic DNA was size selected to ~100-500bp (black trace) by removing DNA >300bp (gray trace).2) Middle panel – Y-adapter ligated (black trace) and resonicated DNA (grey trace) were tested by gel electrophoresis.3) Right-panel - Final library DNA of a DEDUCE-seq sample is shown here. Figure 9. Distribution of hairpin sequence in reads R1 and R2 of DEDUCE-seq library molecules sequenced in Pilot-2. Figure 10. Illustration of combining the output of a method of DSB-detection with the output of a method of identifying mutations. DETAILED DESCRIPTION Nucleic acid samples, such as samples comprising gDNA, contain locations that are prone to DSBs. Such locations can be challenging to detect with a high degree of accuracy because they may be rare events within a large sample; thus, false positives are difficult to avoid. Similarly, the detection of rare or ultra-rare mutations within nucleic acid samples, such as gDNA samples, can be challenging due to confounding false positives. The inventors have noted that the results of DSB-detection methods and the results of mutation-detection methods may be used to inform each other. Without being bound to theory, this is because DSBs can lead to mutations and hence locations that are prone to DSBs are also prone to mutation. Methods of DSB-detection and methods of mutation-detection operate differently and so are prone to different errors and biases. As such, the detection of rare mutations at sites that are linked to DSBs may be used to confirm that both results are accurate and hence increase the certainty that the results are not false positives. The inventors provide methods of reciprocal analysis of data derived from methods of DSB-detection and mutations data derived from methods of sequencing. Thus, in a first aspect, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by analysis of information obtained by a method of sequencing applied to said nucleic acid sample; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. As discussed herein, the location of a DSB, for instance within a human genome, can be determined by alignment to a reference sequence. Similarly, the location of mutations can also be determined by alignment to a reference sequence. This allows DSBs and mutations to be associated with each other if they are located in the same place within the reference sequence. For instance, the repair of DSBs can introduce mutations at the site of the DSB. Thus, the present method provides information that confirms the presence of a DSB via the additional presence of mutations and confirms the effect of the DSB on the sample. The methods of DSB detection can define a break as single nucleotide position in the sample. This can be achieved by aligning reads to each side of the break, hence enabling the precise location to be determined. A mutation and a DSB are in the same location if the mutation is within a defined distance of the break. The defined distance may be less than about 50bp, less than about 100bp, less than about 200bp, less than about 300bp, or less than about 400bp. These distances are on either side of the break and so define a window within which mutations may fall if they are in the same location. In a particular embodiment, the distance is 300bp or about 300bp on either side of the break position. Thus, in an embodiment, the break may define an about 600bp window and any mutations within said window may be defined as having the same location within the nucleic acid sample. Mutations and DSBs that are associated with each other are assigned a higher degree of confidence. They may then be bioinformatically annotated such that they can be identified within the data set. The higher degree of confidence means that both the mutation(s) and the DSB are viewed to have a lower probability of being a false positive. The higher degree of confidence is in comparison to a DSB that is located in a region that does not also contain mutations. Because mutations are expected in said regions, DSBs that are not associated with mutations are not assigned a higher degree of confidence and are associated with the error-rate of the method used to detect the DSB. Thus, the DSBs may be viewed to have been bioinformatically separated into two groups linked to with different levels of confidence: those associated with at least one mutation and those not associated with at least one mutation. In an embodiment, therefore, the method may comprise assigning DSBs into one of two groups, a first group comprising DSBs associated with at least one mutation, and a second group comprising DSBs not associated with at least one mutation. The first group is assigned a higher degree of confidence (i.e. the DSBs are viewed to be less likely to be false positives) in comparison to the second group. The method of the first aspect may be implemented on a computer. For instance, step (a) may comprise bioinformatic alignment of nucleic acid sequences. In particular embodiments, steps (a), (b), and (c) are implemented on a computer. In an aspect of the invention, there is provided a system for analysing nucleic acid information, the system comprising: a processor; and one or more computer-readable storage media having stored thereon instructions for execution on said processor to perform any computer-implemented method disclosed herein. In an aspect of the invention, there is provided a computer program product comprising a non-transitory machine readable medium storing program code that, when executed by one or more processors of a computer system, causes the computer system to implement any computer-implemented method disclosed herein. The method may also include the upstream steps for the method of DSB detection and / or for the method of sequencing. These steps are discussed further herein. Steps further as the obtention of samples and the preparation of nucleic acid libraries require physical steps that are not computer-implemented (referred to as “wet work”). The obtention of sequencing information may include the use of a computer, but also features “wet work” and so is not entirely computer implemented. Methods of identifying of the location one or more DSBs The method of DSB-detection may be a method that can detect the presence of low-level sporadic DSBs caused by physiological transcription and DNA replication. The method may also be able to detect higher-level recurrent breaks induced by endonucleases such as restriction enzymes or genome editing nucleases such as CRISPR-Cas9. The method of method of DSB-detection may be a method that comprises the generation of a nucleic acid library of fragments obtained from the nucleic acid sample. The method may allow the obtention of nucleic acid sequence information for fragments within the library that are associated with a DSB. In particular, any DSBs in the nucleic acid sample may be labelled such that they can later be associated with sequence information. The methods may comprise the generation of ready-to-sequence libraries in an amplification-free and / or enrichment-free manner. For example, some sequencing methods require the hybridisation of nucleic acid libraries to a substrate, such as a flow cell. Amplification-free and / or enrichment-free library preparation methods do not involve the amplification or enrichment of the library prior to contact with the substrate. The only enrichment to take place may be by virtue of binding to the substrate, e.g. binding to the flow cell. The only amplification to take place may be amplification in association with the substrate, for instance bridge amplification on the flow cell. The method of identifying the location of one or more DSBs within the nucleic acid sample may be a PCR-free and / or enrichment-free method. The avoidance of amplification and / or enrichment in the manner described above avoids the introduction of bias due to amplification / enrichment. As such, it is desirable to use such method for the detection of DSBs, particularly when they are low frequency within a sample and false positives would be problematic. Such methods are relevant to tasks such as the detection of endonuclease off-target sites within genomic DNA. Methods of labelling DSBs in the nucleic acid sample may comprise the ligation of a nucleic acid, such as an adapter, to nucleic acid termini before fragmentation of the nucleic acid sample. For instance, the sample may be a plurality of DNA molecules, such as genomic DNA, and an adapter may be ligated to termini of the DNA molecules before fragmentation, hence labelling breaks within the sample. An example of such a method is provided in Figure 12 of WO2022 / 038291 A1. The ligation may take place in vitro. The ligation may take place in situ, e.g. the ligation may be within a cell or tissue sample. The cell or tissue sample may be permeabilised and / or fixed. Permeabilising the cell or tissue may comprise chemical, electronic, mechanic, or physiological methods whereby the said adapter-to-be-ligated can gain access to a DSB. In an example, cells are permeabilised by incubation in lysis buffer. The nucleic acid sample may be treated to enable ligation. For instance, the nucleic acid sample may be end repaired. In a particular example, the nucleic acid sample may be blunt-end repaired and then A-tailed. The treatment may be such so that the nucleic acid sample is ready for ligation with an adapter with a T-base overhang. These steps may take place in vitro or in situ. In other embodiments, the nucleic acid sample may be fragmented before generation or induction of DSBs. For instance, a nucleic acid sample containing sites of interest (e.g. potential targets for endonucleases) may be fragmented. After fragmentation, the sample may be treated in a manner associated with, or suspected to be associated with, the generation of DSBs. The DSBs may then be labelled by the ligation of an adapter. As described above, the sample may be treated to enable ligation (e.g. end-repair and A-tailing). An example of such a method is provided in Figure 17 of WO2022 / 038291 A1. Nucleic acid libraries that contain adapters ligated to breaks associated with DSBs may be treated to ligate an adapter to the opposite end of such fragments. For example, in embodiments where an adapter is ligated to DSBs before fragmentation, the sample may then be fragmented and another adapter may be ligated to termini generated by fragmentation. In embodiments where the nucleic acid sample is fragmented before generation or induction of DSBs, an adapter may be ligated after the fragmentation and before treatment in a manner associated with, or suspected to be associated with, the generation of DSBs. The adapter that is ligated to the termini associated with DSBs may comprise a sequence that allows the binding of the adapter to a substrate, for instance a flow cell or bead for sequencing. The adapter may comprise a sequence that is complementary to at least a portion of a primer that is immobilised to the substrate. In some embodiments, the adapter comprises a sequence that is sufficiently complementary to a primer immobilised to a flow cell to allow binding of the adapter-ligated nucleic acid to the flow cell. The adapter that is ligated to the termini associated with fragmentation, and so not directly associated with a DBS, may be a half-functional adapter. Half-functional adapters do not comprise a sequence that is complementary to a sequence that is immobilised to the substrate, and hence nucleic acids ligated by this adapter cannot bind to the substrate (e.g. flow cell for sequencing) by virtue of this adapter. The adapter may comprise a sequence that is identical to at least a portion of a primer that is immobilised to the substrate. In some embodiments, the adapter comprises a sequence that is sufficiently identical to a primer immobilised to a flow cell to allow bridge amplification. The methods of DSB-detection may comprise contacting the library of nucleic acids with a substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids. The methods may further comprise obtaining sequence information for any nucleic acids that hybridised to the substrate. The sequence information may contain sequence reads from nucleic acids that were associated with DSBs. The reads may be compared to, or aligned with, a reference sequence in order to determine the location of the reads within a sample. For instance, sequence reads may be obtained for a sample comprising human genomic DNA and the sequence reads may be aligned to a reference human genome in order to determine the location of DSBs within the human genome. Reads may be aligned to each side of a DSB, hence providing more information on the location. The method of method of DSB-detection may be INDUCE-Seq. INDUCE-Seq is disclosed in WO2022 / 038291 A1 and Dobbs et al. (Precision digital mapping of endogenous and induced genomic DNA breaks by INDUCE- seq. Nat Commun 13, 3989 (2022). https: / / doi.org / 10.1038 / s41467-022-31702-9), both of which are herein incorporated by reference. The first aspect of the invention requires the bioinformatic analysis of information obtained by a method of DSB- detection. In some embodiments, the steps of the method of DSB-detection are performed as a part of the method of the first aspect. In some embodiments, a suitable library is provided, as disclosed herein, and the method involves acquiring sequence information from said library. In some embodiments, a nucleic acid sample is provided and the method involves the preparation of a nucleic acid library as disclosed herein and acquiring sequence information from said library. In some embodiments, a sample is provided and the method comprises the obtention of the nucleic acids from said sample. Methods of identifying mutations The methods of identifying mutations comprise the sequencing of a nucleic acid sample. This provides sequence reads that may be compared to, or aligned with, a reference sequence in order to determine whether the sample contains mutations in comparison to the reference. For instance, sequence reads may be obtained for a sample comprising human genomic DNA and the sequence reads may be aligned to a reference human genome in order to determine the presence of mutations. An issue with such techniques is that methods of sequencing, particularly when applied to large samples such as genomic DNA, can introduce errors. Errors can also be introduced during library preparation, particularly if the library preparation involves the use of PCR. Such errors can then be falsely reported as mutations. To overcome such issues, the methods of identifying mutations for use of the present invention may be error-corrected methods of sequencing. Error-corrected methods are those that provide redundant information for nucleic acid sequences within a sample and this redundant information is used to identify artefacts introduced by the sequencing process. An example of error-corrected sequencing is duplex sequencing. Such techniques provide sequence information for both strands of a DNA molecule that can then be compared. A mutation detected in both strands has a much higher probability of being a real event, a mutation detected in a single strand has a much higher probability of being an artefact introduced by sequencing. Thus, the methods of identifying mutations for use of the present invention may be methods of duplex sequencing. There are various techniques known in the art that enable sequence reads from two strands of a nucleic acid fragment to be identified. For instance, some techniques rely on library preparation that introduces unique sequences, such as index sequences, that are associated with both strands of DNA fragments. Reads that comprise the same unique sequences can then be identified as arising from the same nucleic acid fragment (i.e. the two strands can be identified due to a shared index). An example of such a technique is “Duplex-seq”, which relies on Unique Molecular Identifiers (UMI’s) (Kennedy, S.R., et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014.9(11): p.2586-606). Duplex sequencing may also be achieved by physically linking the two strands of the DNA duplex. For instance, during library preparation a hairpin adapter may be ligated to one end of the DNA fragments. When denatured, these fragments then form single-stranded DNA that comprises both strands of the original molecule. As such, the methods of identifying mutations for use of the present invention may be methods of duplex sequencing that comprise the ligation of a hairpin adapter to DNA fragments during library preparation. The methods of library preparation may comprise the ligation of a non-hairpin adapter, such as a Y-adapter, as well as the ligation of the hairpin adapter. The non-hairpin adapter may comprise sequences required for sequencing, such as sequences required for substrate binding (e.g. sequences complementary to flow-cell- immobilised primers) and sequences that act as binding sites for sequencing primers. Ideally, the methods of library preparation produce fragments wherein a hairpin adapter is ligated to one end and a non-hairpin adapter, such as a Y-adapter, is ligated to the other end. One problematic species that can be produced is where the non-hairpin adapter is ligated to both ends of the fragment. For instance, in embodiments that include a Y-adapter capable of hybridising to a flow cell, species that feature a Y-adapter at both ends can be sequenced but not error-corrected. So the minimisation of these sequences is important. The present inventors have discovered that such species can be reduced by the introduction of a fragmentation step after the ligation of a first adapter (which may be the hairpin adapter or non-hairpin adapter). For instance, a Y-adapter may be ligated to both ends of fragments within a library, the library may then be fragmented, hence cleaving the fragments in between the Y-adapters. The hairpin adapter may then be ligated to said fragments. Notably, the fragmentation step may be a second fragmentation step. Ordinarily, the nucleic acid sample, for instance if it is a gDNA sample, will have been fragmented before the first adapter ligation step. Hence, in some embodiments, the nucleic acid sample is fragmented after the first adapter ligation step and before, or as a part of, the second adapter ligation step. The hairpin adapter may be ligated as the first ligation or the second ligation but, whichever way around, the sample is fragmented in between ligations. The methods may comprise the generation of ready-to-sequence libraries in an amplification-free and / or enrichment-free manner. For example, some sequencing methods require the hybridisation of nucleic acid libraries to a substrate, such as a flow cell. Amplification-free and / or enrichment-free library preparation methods do not involve the amplification or enrichment of the library prior to contact with the substrate. The only enrichment to take place may be by virtue of binding to the substrate, e.g. binding to the flow cell. The only amplification to take place may be amplification in association with the substrate, for instance bridge amplification on the flow cell. Thus, the library preparation prior to sequencing may be a PCR-free and / or enrichment-free method. The methods comprise contacting the library of nucleic acids with a substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids. The methods may further comprise obtaining sequence information for any nucleic acids that hybridised to the substrate. The sequence information may comprise one or more reads for each side of a hairpin adapter, i.e. information for each strand of the duplex. The sequence information may comprise at least one read for one strand of the duplex and at least one read for the other side of the duplex. The sequence information may comprise a long read that provides information for both sides of the duplex. The reads may be compared to, or aligned with, a reference sequence in order to determine the location of the reads within a sample and to identify mutations. For instance, sequence reads may be obtained for a sample comprising human genomic DNA and the sequence reads may be aligned to a reference human genome / The method of method of identifying mutations may be DEDUCE-Seq. DEDUCE-Seq is disclosed in PCT / EP2023 / 066881, which is herein incorporated by reference. DEDUCE-Seq is also disclosed herein in a following section. The first aspect of the invention requires the bioinformatic analysis of information obtained by a method of sequencing. In some embodiments, the steps of the method disclosed in this section are performed as a part of the method of the first aspect. In some embodiments, a suitable library is provided, as disclosed herein, and the method involves acquiring sequence information from said library. In some embodiments, a nucleic acid sample is provided and the method involves the preparation of a nucleic acid library as disclosed herein and acquiring sequence information from said library. In some embodiments, a sample is provided and the method comprises the obtention of the nucleic acids from said sample. The use of INDUCE-Seq for identifying DSBs Specific details of a method of detecting DSBs are provided in this section. This section describes a method known as “INDUCE-Seq”. In an embodiment, the method of DSB-detection comprises: i) exposing a sample of nucleic acid suspected of containing DSBs, under ligation conditions, to a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a strand of said DSB, and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is at least in part complementary to said first oligonucleotide of the first pair; optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; ii) fragmenting the nucleic acid sample, for instance gDNA, into fragments; iii) exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which is in part complementary to a second oligonucleotide of the second pair; and a second oligonucleotide that comprises a 3’ binding feature for binding to a strand of said fragments, and a binding sequence optionally suitable for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; iv) denaturing the fragments to provide single nucleic acids; v) separating the strands of part iv) into two groups: group A those fragments that have ligated at a first end the binding sequence provided by the oligonucleotide of part i) and optionally at another end the binding sequence for enabling bridge amplification provided by the oligonucleotide of part iii) and group B those fragments that do not have ligated at a first end the binding sequence provided by the oligonucleotide of part i) and optionally at another end the binding sequence for enabling bridge amplification provided by the oligonucleotide of part iii); and vi) sequencing the strands of group A, where each sequence is equivalent to a break, typically one DSB, and optionally further wherein the number and nature of base pair deletions can be determined by comparing each sequence with a genome representative of said species from which the sample was taken. The steps of the method of DSB-detection need not be performed at one time or in one location. For instance, the sample may be prepared in one location, the library may be created in a second location, the sequencing may be performed in a third location, and the bioinformatic analysis may be performed in fourth location. In an embodiment, the method of DSB-detection comprises: i) exposing a sample of nucleic acid containing or suspected of containing DSBs, under ligation conditions, to a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB, a hybridization site (RD1 SP) to which a first sequencing primer can bind, and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is at least partly complementary to said first oligonucleotide of the first pair and optionally comprises a 3’ binding feature that enables ligation of said oligonucleotide to a second strand of said DSBs; optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; ii) fragmenting the nucleic acid sample, for instance gDNA, into fragments; iii) exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which optionally comprises a 5’ binding feature, that enables ligation of said oligonucleotide to a first strand of said fragment, preferably at a site remote from the binding of said oligonucleotide of said first pair, and a hybridization site (RD2 SP) to which a second sequencing primer can bind; and a second oligonucleotide that is in part complementary to said first oligonucleotide of the second pair and comprises a 3’ binding feature for binding to a second strand of said fragments or said DSBs, a sequence complimentary to said hybridization site, and a sequence optionally suitable for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; iv) denaturing the fragments to provide single nucleic acids; v) separating the strands of part iv) into two groups: group A those fragments that have ligated at a first end the first hybridization site and binding sequence provided by the oligonucleotide of part i) and at another end the second hybridization site and further sequence provided by the oligonucleotide of part iii) and group B those fragments that do not have ligated at a first end the hybridization site and binding sequence provided by the oligonucleotide of part i) and at another end the second hybridization site and further sequence provided by the oligonucleotide of part iii); and vi) sequencing the strands of group A using primers that bind to the first and / or second hydridization sites where each sequence is equivalent to a break, typically one DSB. Optionally further wherein the number and nature of base pair deletions can be determined by comparing each sequence with a genome representative of said species from which the sample was taken. As discussed above, any one party may perform only steps i), ii), and iii); i), ii), iii), and iv); or all steps. In particular embodiments, the oligonucleotide of the second pair that comprises a 5’ binding feature does not comprise a binding sequence for separating said fragmented nucleic acid. In particular, it does not comprise a sequence that is complementary to the sequence for enabling bridge amplification. In embodiments, the oligonucleotides of part i) and part iii) may be interchanged whereby the nucleic acid is first exposed to the oligonucleotides of part iii) and are then exposed to the oligonucleotides of part i). In an embodiment, the oligonucleotides of part i) and part iii) may be interchanged whereby the nucleic acid is first exposed to the oligonucleotides of part iii) and after fragmenting, the nucleic acid fragments are then exposed to the oligonucleotides of part i). Embodiments involving the interchange of part i) and part iii) are particularly relevant to methods for the detection of DSBs that have been induced. In such embodiments, the sample may be fragmented and step iii) may be then performed. Subsequently, the sample may be treated to potentially induce a DSB and, following the induction, step i) may be performed. Embodiments wherein a DSB is introduced are further discussed herein, and include embodiments for the detection of off-target effects of nucleases, and the like. Figures 13, 17, and 18 of WO2022 / 038291 A1 illustrate particular embodiments. In the methods of the present disclosure either of said pair of oligonucleotides may be, or may be known as, adapters. Reference herein to adapters is reference to a linker in genetic engineering and it is an oligonucleotide that can be ligated to the ends of other DNA molecules. Adapters may be double-stranded. Double-stranded adapters can be synthesized to have blunt ends to both terminals or to be sticky ended at one end and blunt end at the other. The adapter may be short and may be chemically synthesized. The first pair of oligonucleotides may be configured to allow binding to a substrate via hybridisation to an oligonucleotide immobilised to said substrate, wherein the immobilised oligonucleotide is oriented such that the 5’ end is proximal and the 3’ end is distal to the point of immobilisation. For instance, the oligonucleotide of the first pair that is ligated to the 3’ terminus of a strand of a DSB (i.e. the oligonucleotide that comprised a 5’ binding feature) may be at least partially complementary to an immobilised oligonucleotide. The extent of the complementarity may allow binding to the immobilised oligonucleotide via hybridisation. The second pair of oligonucleotides may be configured to not allow binding to a substrate via hybridisation to an oligonucleotide immobilised to said substrate, wherein the immobilised oligonucleotide is oriented such that the 5’ end is proximal and the 3’ end is distal to the point of immobilisation. For instance, the oligonucleotide of the second pair that is ligated to the 3’ terminus of a strand of a fragmented site (i.e. the oligonucleotide that comprised a 5’ binding feature) may be insufficiently complementary to any immobilised oligonucleotide to be able to bind via hybridisation. In some embodiments, for instance to allow subsequent bridge amplification, the oligonucleotide of the second pair that is bound to the 5’ terminus of a strand of a fragmented site (i.e. the oligonucleotide that comprises a 3’ binding feature) may be at least partially identical sequence to an immobilised oligonucleotide. In another embodiments, for instance to allow bead-emulsion amplification, the other arrangements may be used (for example, see Figure 14 of WO2022 / 038291 A1). In an embodiment, the method of DSB-detection comprises a method of sample preparation for identifying DNA double-strand breaks (DSBs) in a nucleic acid sample, wherein the preparation comprises modifying DSB- associated nucleic acids to be suitable for binding to a substrate comprising immobilised oligonucleotides, the method comprising i) exposing a sample of nucleic acid suspected of containing DSBs, under ligation conditions, to a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB and a binding sequence for separating said DSB from a pool of DSBs, wherein the binding sequence is at least partially complementary to an immobilised oligonucleotide; and a second oligonucleotide that is at least in part complementary to said first oligonucleotide of the first pair; optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; ii) fragmenting the nucleic acid sample, for instance gDNA, into fragments; and iii) exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which is in part complementary to a second oligonucleotide, and wherein the first oligonucleotide does not comprise a sequence capable of hybridising to an immobilised oligonucleotide; and a second oligonucleotide that comprises a 3’ binding feature for binding to a strand of said fragment and a binding sequence for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature. A DSB-associated nucleic acid is a nucleic acid positioned on one side of a DSB. Hence the sequencing of a DSB-associated nucleic acid enables the location of a DSB, for instance in a genome, to be identified. In an embodiment, the methods of the invention are designed for use with the Illumina P5 and P7 adapters. Thus, in a particular embodiment, the second oligonucleotide pair does not comprise a sequence of more than 5, 6, 7, 8, 9, 10, 15, or 20 bases, or does not comprise all 24 bases, of the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30). The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 30. In another embodiment, the second oligonucleotide pair does not comprise a sequence of more than 5, 10, or 15 bases, or does not comprise all 20 bases, of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31). The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 31. Thus, in a particular embodiment, step iii) is: exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which is in part complementary to a second oligonucleotide of the second pair; and a second oligonucleotide that comprises a 3’ binding feature for binding to a strand of said fragments, and a binding sequence optionally suitable for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature; and wherein the second pair of oligonucleotides do not comprise a sequence of more than 5, 10, 15, 20, or 24 bases of SEQ ID NO: 30 and / or do not comprise a sequence of more than 5, 10, 15, or 20 bases of SEQ ID NO: 31. The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 30 and / or SEQ ID NO: 31. In particular embodiments of the method of DSB-detection, said 5’ or 3’ binding feature of said pair of oligonucleotides comprises one of the following: a phosphate group; a triphosphate ‘T-tail’, preferably a deoxythymidine triphosphate ‘T-tail’; a triphosphate ‘A-tail’, preferably a deoxyadenosine triphosphate ‘A-tail’; at least one random N nucleotide, preferably a plurality of N nucleotides, or any other known binding group to allow linkage of said adapter to said DSB. In an example, the 5’ binding feature of said first oligonucleotide of part i) is a phosphate group and said 3’ binding feature of said second oligonucleotide of part i) is a triphosphate tail. In examples, said 5’ and / or 3’ protective feature of said first pair of oligonucleotides comprises a feature that provides resistance to any one or more of the following: phosphorylation activity, phosphatase activity, terminal transferase activity, nucleic acid hybridization, endonuclease activity, exonuclease activity, ligase activity, polymerase activity, and protein binding. This can be achieved by any means known to those skilled in the art such as, but not limited to, phosphorothioate linkages, phosphoroamidite spacers, phosphate groups, 2’-O-Methyl groups, inverted deoxy and dideoxy-T modifications, locked nucleic acid bases, dideoxynucleotides, or the like. The 5’ end of the adapter may be dephosphorylated. Said first oligonucleotide of part i) may comprise a 3’ protective feature that provides resistance to exonuclease activity such as a phosphorothioate linkage. Additionally or alternatively said 3’ protective feature also provides resistance to ligase activity and / or polymerase activity, such as 5'>3' polymerase activity, and is for example a dideoxynucleotide or a physical block, for instance in the form of a phosphoramidite, in particular a C3 Spacer phosphoramidite (3SpC3), or any other protective feature known to those skilled in the art such that provides resistance to exonuclease activity and / or ligase activity and / or polymerase activity. In a particular embodiment, the first oligonucleotide of part i) comprises a 3’ protective feature, such as 3SpC3, that prevents ligation to this oligonucleotide. For instance, it will prevent ligation to this strand during further adapter ligation steps. The first and second oligonucleotides of part i) may comprise an index feature which is a particular sequence of nucleotides (e.g. GATCT) that enables the origin of pooled sequencing libraries to be determined, in other words, it enables demultiplexing of pooled sequencing libraries. The index feature may be located between said hybridization site and said binding sequence. In an embodiment, said first oligonucleotide of part i), reading 5’ to 3’, comprises a 5’ binding feature and then, optionally, a protective feature, ideally the binding feature is a phosphate group, a hybridization site (RD1 SP) to which a first sequencing primer can bind, an index sequence, a binding sequence for separating said DSB from a pool of DSBs, and a 3’ binding and / or protective feature. Said protective feature may provide resistance to any one or more of the following: exonuclease activity, ligase activity and / or polymerase activity. In an embodiment, said second oligonucleotide of part i), reading 3’ to 5’ comprises a 3’ binding and then, optionally, a protective feature, a hybridization sequence (RD1 SP) to which a first sequencing primer can bind, an index sequence, a binding sequence for separating said DSB from a pool of DSBs and a 5’ binding and / or protective feature. Said protective features may provide resistance to any one or more of the following: exonuclease activity, ligase activity and / or polymerase activity. Ideally the binding feature is 3’. In an embodiment, said first oligonucleotide of part i) is one of a first oligonucleotide pair and the second oligonucleotide of this first oligonucleotide pair is complementary to said first oligonucleotide and comprises a 5’ and a 3’ protective feature, preferably, providing resistance to any one or more of the following: exonuclease activity, ligase activity and / or polymerase activity. Thus, in certain embodiments a 5’ or 3’ phosphate group is missing from the oligonucleotide used to work the invention. In examples, said first oligonucleotide of part i) contains both the hybridization site( / sequence) that is used to sequence the ligated DSB and the binding sequence that is used to separate said DSB from a pool of DSBs. However, those skilled in the art will appreciate that it is possible for the second oligonucleotide of part i) to contain both the hybridization site( / sequence) that is used to sequence the ligated DSB and the binding sequence that is used to separate said DSB from a pool of DSBs. This is because both the sequencing and separating will be determined by the nature of the primer used to sequence and the nature of the oligonucleotide used to separate. Most typically the orientation of all the oligonucleotides i.e. the orientation of the hybridization sites (RD1 SP & RD2 SP) to which at least a first, and / or second, sequencing primers can bind, and the binding sequence for separating said DSB from a pool of DSBs, and the further sequence, optionally, for enabling bridge amplification is such that when the separating of part v) is undertaken only Group A strands can be extracted using the binding sequence for separating said DSB from a pool of DSBs. Furthermore, this orientation is also such that when the sequencing of part vi) is undertaken only Group A strands can be bridged (when the bridge amplification sequence is present). In particular, either the first or second oligonucleotide of the first oligonucleotide pair of part i) may comprise two different terminal protective features. For instance, the second oligonucleotide of this first oligonucleotide pair of part i) comprises a 3’ deoxythymidine triphosphate ‘T-tail', to provide a substrate for ligation to 'A-tailed' DNA fragments, and ideally also a phosphorothioate linkage whereby resistance to exonuclease activity is conferred. In an example, said 5’ binding feature of said first oligonucleotide of the second oligonucleotide pair of part iii) is a phosphate group and said 3’ binding feature of said second oligonucleotide of the second oligonucleotide pair of part iii) is a triphosphate tail. In a preferred embodiment of the invention, said 5’ and / or 3’ protective feature of said second pair of oligonucleotides comprises a feature that provides resistance to any one or more of the following: phosphorylation activity, phosphatase activity, terminal transferase activity, nucleic acid hybridization, endonuclease activity, exonuclease activity, ligase activity, polymerase activity, and protein binding. This can be achieved by any means known to those skilled in the art such as, but not limited to, phosphorothioate linkages, phosphoroamidite spacers, phosphate groups, 2’-O-Methyl groups, inverted deoxy and dideoxy-T modifications, locked nucleic acid bases, dideoxynucleotides, or the like. The 5’ end of the adapter may be dephosphorylated. In an example, said first oligonucleotide of part iii) also comprises a 3’ protective feature that provides resistance to exonuclease activity such as a phosphoramidite spacer. Additionally or alternatively said 3’ protective feature also provides resistance to ligase activity and / or polymerase activity, such as 5'>3' polymerase activity, and is for example a dideoxynucleotide or a physical block, for example in the form of a phosphoramidite, in particular a C3 Spacer phosphoramidite (3SpC3), or any other protective feature known to those skilled in the art that provides resistance to exonuclease activity and / or ligase activity and / or polymerase activity. The first and second oligonucleotides of part iii) may comprise an index feature which is a particular sequence of nucleotides (e.g. GATCT) that enables the origin of pooled sequencing libraries to be determined, in other words, it enables demultiplexing of pooled sequencing libraries. The index feature may be located between said hybridization site and, where present, said further sequence. In a particular example, either the first or second oligonucleotide of this second oligonucleotide pair of part iii) may comprise two different terminal protective features. In an embodiment, said second oligonucleotide of part iii), reading 5’ to 3’, comprises a 5’ binding and / or protective feature, a further sequence for, optionally, enabling bridge amplification, an index sequence, a hybridization site (RD2 SP) to which a sequencing primer can bind, and a 3’ binding and / or protective feature. Either or both protective features may provide resistance to any one or more of the following: exonuclease activity, ligase activity and / or polymerase activity. In an embodiment, said second oligonucleotide of part iii) is complementary to said first oligonucleotide of this oligonucleotide pair and comprises a 5’ and a 3’ protective feature, preferably, providing resistance to any one or more of the following: exonuclease activity, ligase activity and / or polymerase activity. Thus, in certain embodiments the oligonucleotide has a missing 5’ or 3’ phosphate group. In a particular example, this second oligonucleotide of part iii) comprises a 3’ deoxythymidine triphosphate ‘T- tail', to provide a substrate for ligation to 'A-tailed' DNA fragments, ideally with a phosphorothioate linkage whereby resistance to exonuclease activity is conferred. The ligation in part i) may occur in situ or in vitro using a cell or tissue suspension and so occurs in the intact cell. This step may be facilitated by permeabilizing the cell or tissue, chemically, electronically, mechanically or physiologically, whereby the said oligonucleotide to be ligated can gain access to a DSB site and via its terminal binding feature, e.g. phosphate, it is ligated to the DSB site. The cells may be permeabilized by incubation in lysis buffer. The DSB site may be arginine tail repaired prior to ligation with said oligonucleotide. As will be appreciated, ligating said first pair of oligonucleotides / adapter to the DSB prior to further processing ensures the DSB identified is a true event and not a consequence of the subsequent processing steps and thus representing an artefact of the processing. Part i) may also include extracting gDNA from said cells using any conventional means such as an extraction buffer or the like, prior to performing the subsequent steps. Step ii) may comprise fragmenting the gDNA into smaller fragments by any means known in the art, such as sonication or tagmentation. The method of DSB-detection may further comprise an optional step, after part ii) and / or part iv), of removing fragments whose size is less than about 100bp, more preferably less than about 150bp, and retaining fragments whose size is greater than about 150bp. As will be appreciated by those skilled in the art, this step advantageously removes any oligonucleotide strands / dimers that may have formed that would otherwise subsequently contribute to sequence artefacts. This ideally can be undertaken using conventional means such as using a Bioruptor Sonicator, and size selecting using SPRI beads (GC Biotech, CNGS-0005) to remove fragments <150bp. Or select for fragments in a preferred range such as, without limitation 150-1000bp, ideally 200-800bp, more ideally 250- 750bp and yet most preferred 300-500bp. The separating of part v) may involve using said binding sequence provided by the oligonucleotide of part i) to bind a partner and so separate the Group A strands of part iv) from any other strands. Typically, a complementary binding strand to said binding sequence provided by the oligonucleotide of part i) is anchored to a substrate and said single strands of nucleic acids flow by, or over, the anchored complementary binding strand. Part vi) may involve bridge amplification where the single strands separated under part v) are clonally amplified on a substrate that has anchored thereon oligonucleotides / binding sites for the binding sequence of the first oligonucleotide of part i) and the further sequence of the second oligonucleotide of part iii). In this way a single strand of the Group A fragments can be bound at both ends on the said substrate to facilitate bridge amplification. Said sequencing may be undertaken by synthesis sequencing employing the use of labelled nucleotides each one emitting a characteristic signal that is read as the sequence extends to provide a readout of the sequence information. Typically, a number of strands are sequenced in a parallel process. If preferred the index sequence may be sequenced separately from the DSB, thus providing an indication of the source of the nucleic acid before the DSB is sequenced. Alternatively, the two indices may be sequenced and so read together. In a particular embodiment, the first pair of oligonucleotides of part i) comprises a first oligonucleotide comprising a sequence according to TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31), and a second oligonucleotide comprising a sequence according to AATGATACGGCGACCACCGA (SEQ ID NO: 34). In another embodiment, which may be combined with the subject matter of the preceding paragraph, the second pair of oligonucleotides comprises a first oligonucleotide of a sequence that does not comprise a sequence of more than 5, 10, 15, or 20 bases, or does not comprise all 24 bases, of the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30), and a second oligonucleotide comprising a sequence according to CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32). The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 30. In a particular embodiment, the first pair of oligonucleotides of part i) comprises a first oligonucleotide comprising a sequence according to ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30), and a second oligonucleotide comprising a sequence according to CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32). In another embodiment, which may be combined with the subject matter of the preceding paragraph, the second pair of oligonucleotides may comprise a first oligonucleotide that does not comprise a sequence of more than 5, 10, or 15 bases, or does not comprise all 20 bases, of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31), and a second oligonucleotide comprising a sequence according to AATGATACGGCGACCACCGA (SEQ ID NO: 34). The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 31. SEQ ID NOs: 30, 31, 32, and 34 may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a further embodiment, said first pair of oligonucleotides of part i) comprises a first oligonucleotide having SEQ ID NO.1 and a second oligonucleotide having SEQ ID NO.2 or an oligonucleotide that shares at least 80% identity or homology therewith and more preferably, in increasing order of preference, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity or homology therewith. The oligonucleotides according to SEQ ID NO: 1 and SEQ ID NO: 2 may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. Homology, as used herein, may be referred to as similarity. In a further embodiment, said first pair of oligonucleotides of part i) comprises a first oligonucleotide of the sequence GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT[INDEX]TCGGTGGTCGCCGTATCATTC, or comprising 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. The first pair of oligonucleotides of part i) may further comprise a second oligonucleotide of the sequence AATGATACGGCGACCACCGA[INDEX]ACACTCTTTCCCTACACGACGCTCTTCCGATCT, or comprising 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In a further embodiment, said first pair of oligonucleotides of part i) comprises a first oligonucleotide of the sequence GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 37), an index, and TCGGTGGTCGCCGTATCATTC (SEQ ID NO: 38). The first pair of oligonucleotides of part i) may further comprise a second oligonucleotide of the sequence AATGATACGGCGACCACCGA (SEQ ID NO: 34), an index, ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 39). The index may be any base (n) and may, for instance, be from to 5 to 15 or 6 to 10 base pairs long. SEQ ID NOs: 34, 37, 38, and 39 may comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a further embodiment, said first pair of oligonucleotides of part i) comprises a first oligonucleotide comprising SEQ ID NO.3, an index, and the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30). The first pair of oligonucleotides of part i) may further comprise a second oligonucleotide comprising, in 5’ to 3’ order, the sequence of CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32), an index, and the sequence GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 33). The index may be any base (n) and may, for instance, be from to 5 to 15 or 6 to 10 base pairs long. SEQ ID NOs: 3, 30, 32, and 33 may comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a further embodiment, said second pair of oligonucleotides of part iii) comprises a first oligonucleotide having SEQ ID NO.3 and a second oligonucleotide of the sequence CAAGCAGAAGACGGCATACGAGAT[INDEX]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT or an oligonucleotide that shares at least 80% identity or homology therewith and more preferably, in increasing order of preference, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity or homology therewith. The oligonucleotide according to SEQ ID NO: 3 may comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. The oligonucleotide according to CAAGCAGAAGACGGCATACGAGAT[INDEX]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a further embodiment, said second pair of oligonucleotides of part iii) comprises a first oligonucleotide having SEQ ID NO.3 and a second oligonucleotide having, in 5’ to 3’ order, the sequence of CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32), an index, and the sequence GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 33). The index may be any base (n) and may, for instance, be from to 5 to 15 or 6 to 10 base pairs long. The oligonucleotides may have comprise sequences having 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity or homology with any of SEQ ID NOs: 3, 32, or 33. SEQ ID NOs: 3, 32, or 33 may comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In yet a further embodiment of the invention said second oligonucleotide of said second pair of oligonucleotides of part iii) comprises any one of the following sequences SEQ ID NOs: 4–28, 30-34, 37-39, or 41-42 or an oligonucleotide that shares at least 80% identity or homology therewith and more preferably, in increasing order of preference, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% identity or homology therewith. SEQ ID NOs: 4–28, 30-34, 37-39, or 41-42 may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. The method of DSB-detection may comprise a method of sample preparation for identifying DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising immobilised primers, the method comprising: a) providing a sample comprising a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation and which does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation. The oligonucleotide of the second adapter capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation may comprise a sequence identical to a region of a second primer. The second adapter may not be capable of being ligated to the oligonucleotide of the first adapter. In some embodiments, the nucleic acids within the sample comprising a plurality of nucleic acids are double stranded during steps b) to d). In other embodiments, the nucleic acids may be single stranded during steps b) to d). In yet further embodiments, the nucleic acids may be double stranded for some steps, and single stranded for others (e.g. see Figure 16 of WO2022 / 038291 A1). In embodiments involving the ligation of a double-stranded adapter to a single-stranded nucleic acid, the adapter may comprise a “splint oligo”. The splint oligo may comprise random nucleotides, such as 6-8 random nucleotides, and be positioned at the 3’ end of the oligonucleotide of the adapter that does not ligate to the nucleic acid sample. Splint oligos may aid in the ligation process. The method of DSB-detection may comprise a method of sample preparation for identifying DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising a first immobilised primer and to be suitable for amplification comprising the use of said first immobilised primer and a second primer, the method comprising: a) providing a sample comprising a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation and which comprises a sequence identical to a region of the second primer. The second adapter may not be capable of being ligated to the oligonucleotide of the first adapter. A nucleic acid sample suitable for amplification comprising the use of a first immobilised primer and a second primer, is a sample capable of being amplified by a primer of the same sequence as the first immobilised primer and a primer of the same sequence as the second primer. Suitability for amplification may be determined in solution. In some embodiments, the second primer is not immobilised to the substrate. For instance, the substrate may be a bead and amplification may take place via bead-emulsion amplification. In other embodiments, the second primer is immobilised to the substrate. For example, the substrate may be a flow cell and amplification may take place via bridge amplification. In some embodiments, the adapters are single-stranded oligonucleotides. In other embodiments, the adapters comprise a first and a second oligonucleotide that are at least partially complementary. In such embodiments, the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and the first adapter pair comprises first and second oligonucleotides that are at least partially complementary, wherein the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of binding, by hybridisation, to a primer immobilised to the substrate. In addition, in such embodiments the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides, wherein the first oligonucleotide is ligatable to a 5’ terminus and comprises a sequence identical to a region of the second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer. Thus, in an embodiment, the method of DSB-detection may comprise a method of sample preparation for identifying DNA DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids, or nucleic acids suspected of containing DSBs, to be suitable for binding to a substrate comprising a first immobilised primer and to be suitable for amplification comprising the use of said first immobilised primer and a second primer, the method comprising, the method comprising: a) providing a sample comprising a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a first adapter pair under conditions conducive to ligation, wherein the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and wherein the first adapter pair comprises first and second oligonucleotides that are at least partially complementary, and the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter pair under conditions conducive to ligation, wherein the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides, wherein the first oligonucleotide is ligatable to a 5’ terminus and comprises a sequence identical to a region of the second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer. In some embodiments, the substrate comprises a first immobilised primer and a second immobilised primer. The immobilised primers may, in some embodiments, be suitable for acting as primers during bridge amplification. Thus, in an embodiment, the method of DSB-detection may comprise a method of sample preparation for identifying DNA DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising a first and a second immobilised primer, the method comprising: a) providing a sample comprising a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a hybridization site (RD1 SP) to which a first sequencing primer can bind and a sequence that is capable of binding to the first immobilised primer by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation and which comprises a sequence complimentary to hybridization site (RD2 SP) to which a second sequencing primer can bind and a sequence identical to a region of the second immobilised primer. As discussed herein, the second adapter may not be ligatable to the first adapter in the manner illustrated in Figure 12 of WO2022 / 038291 A1. In other embodiments, the adapters are adapter pairs comprising a first and a second oligonucleotide that are at least partially complementary. Thus, the method of DSB-detection may comprise a method of sample preparation for identifying DNA DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB- associated nucleic acids to be suitable for binding to a substrate comprising a first and a second immobilised primer, the method comprising: a) providing a sample comprising a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a first adapter pair under conditions conducive to ligation, wherein the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and wherein the first adapter pair comprises first and second oligonucleotides that are at least partially complementary, and wherein the first oligonucleotide is ligatable to a 3’ terminus and comprises a hybridization site (RD1 SP) to which a first sequencing primer can bind and a sequence that is capable of binding to the first immobilised primer by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter pair under conditions conducive to ligation, wherein the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides and the oligonucleotide that is ligatable to a 5’ terminus is a first oligonucleotide that comprises a sequence complimentary to hybridization site (RD2 SP) to which a second sequencing primer can bind and a sequence identical to a region of the second immobilised primer, and wherein the other oligonucleotide is a second oligonucleotide and does not comprise a sequence that is complementary to said sequence identical to a region of the second immobilised primer. The first oligonucleotide of the first adapter pair may comprise a 3’ protective feature and / or the second oligonucleotide of the second adapter pair may comprise a 3’ protective feature. As discussed herein, in some embodiments the nucleic acids within the sample may be maintained as double- stranded molecules during steps a) to d). As such, in particular embodiments, the methods may further comprise: denaturing the plurality of double-stranded nucleic acids to form a plurality of single-stranded nucleic acids. This may be “step e)” in some embodiments. In a particular embodiment, the methods may further comprise: contacting the plurality of single-stranded nucleic acids with the substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids. This may be “step f)” in some embodiments. The features disclosed in connection with step i) of the methods of DSB-detection disclosed herein are also appliable to step b). The features disclosed in connection with step ii) of the methods of DSB-detection disclosed herein are also appliable to step c). The features disclosed in connection with step iii) of the methods of DSB- detection disclosed herein are also appliable to step d). The features disclosed in connection with step iv) of the methods of DSB-detection disclosed herein are also appliable to step e). The features disclosed in connection with step v) of the methods of DSB-detection disclosed herein are also appliable to step f). The substrate may be a solid surface such as a surface of a flow cell, a bead, a slide, or a membrane. In particular, the substrate may be a flow cell. The substrate may be a patterned or a non-patterned flow cell. The substrate may comprise glass, quartz, silica, metal, ceramic, or plastic. The substrate surface may comprise a polyacrylamide matrix or coating. As used herein, the term “flow cell” is intended to have the ordinary meaning in the art, in particular in the field of sequencing by synthesis. Exemplary flow cells include, but are not limited to, those used in a nucleic acid sequencing apparatus such as flow cells for the Genome Analyzer®, MiSeq®, NextSeq®, HiSeq®, or NovaSeq® platforms commercialised by Illumina, Inc. (San Diego, Calif.); or for the SOLiD™ or Ion Torrent™ sequencing platform commercialized by Life Technologies (Carlsbad, Calif.). Exemplary flow cells and methods for their manufacture and use are also described, for example, in WO2014 / 142841A1; U.S. Pat. App. Pub, No. 2010 / 0111768 A1 and U.S. Pat. No.8,951,781. The substrate may comprise immobilised primers, for instance two types of primer which together can act as forward and reverse primers for bridge amplification. Immobilisation to a substrate means that the primer is bound to the substrate even under conditions that would denature double-stranded nucleic acids. For instance, the primer may be covalently bound to the substrate. The primers are oriented such that the 5’ end is proximal and the 3’ end is distal to the point of immobilisation. Such arrangements are standard in the art. The steps may be performed in the order: step c), step d), and then step b). This order is particularly relevant to embodiments where a DSB is potentially induced in the sample, as opposed to embodiments for the detection of a pre-existing DSB. With reference to statements of the invention featuring steps defined by roman numerals, the steps may be performed in the order: step ii), step iii), and then step i). In such embodiments, the DSB may be induced after the ligation of the second adapter and before ligation of the first adapter. For example, see Figure 13 of WO2022 / 038291 A1. The induction of the DSB may comprise exposing the sample to conditions capable of causing or suspected of being capable of causing a DSB. In embodiments wherein step d) is performed before step b), the adapters of step d) may comprise 3’ and / or 5’ protective features to prevent ligation of the adapters of step b) to those of step d). The protective features may render the first adapter to be not capable of being ligated to the second adapter. In such embodiments, the second adapter remains incapable of being ligated to the first adapter because the ligation takes place before the first adapter is present. In some embodiments, the steps are performed in the order step b), step c), and step d), wherein the step b) is performed in a cell or in situ. In other embodiments, the steps are performed in the order step c), step d), and then step b), wherein step c) is performed in vitro after isolation of the nucleic acid sample. Thus, in an embodiment, the method of DSB-detection may comprise a method of sample preparation for identifying DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising immobilised primers, the method comprising, in order: a) providing a sample comprising a plurality of nucleic acids; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation, and which does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; optionally comprising a sequence identical to a region of a second primer; and b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation. As discussed herein, the first adapter may not be ligatable to the second adapter, for instance not ligatable to the oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation. In step a), the sample comprising a plurality of double-stranded nucleic acids may be any DNA sample capable of comprising DSBs, such as gDNA. Other suitable samples are discussed above. For any of the methods disclosed herein, the sample may contain DSBs or may have been treated in a manner that might or does introduce DSBs. For instance, the methods disclosed herein may be used to detect DNA damage or changes that are confined to a single strand. Thus, the methods disclosed herein may be for the detection and / or quantification of a feature of interest within a nucleic acid sample. As an example, a lesion in one strand of double-stranded DNA may be enzymatically converted into a DSB, which can then be detected by the methods disclosed herein. In some examples, the lesion may be a single-strand break. In other examples, the lesion is a base change in a nucleic acid sample. For instance, the methods disclosed herein may be for the detection of CRISPR / Cas induced base editing, such as a cytosine base editor or an adenosine base editor. Such edits may be converted into DSBs and detected as disclosed herein. Figure 17 and Figure 18 of WO2022 / 038291 A1 illustrate exemplary embodiments. Thus, in an embodiment, the method of DSB-detection comprises providing a sample comprising a plurality of nucleic acids comprising or suspected of comprising a feature of interest or a lesion; and exposing the sample to conditions capable of converting the feature of interest or lesion into a DSB. For such embodiments, the method may be in the order: conversion of the lesion into a DSB, b), c), and d); or may be in the order: c), d), conversion of the lesion into a DSB, and b). In other embodiments, the sample may have been treated with a nuclease, such as a transcription activator-like effector nuclease (TALEN), a CRISPR / Cas endonuclease, a zinc finger nuclease, a meganuclease, or any restriction endonuclease, and the methods may be for the detection of off-target effects. The sample may have been treated with an agent, such as a potential therapeutic agent, to determine if said agent is capable of causing DSBs or off-target DSBs. The methods disclosed herein may be used to identify sites of protein binding to a nucleic acid. For instance, a sample may be contacted with a protein-binding agent, such as an antibody, specific for a protein-of-interest, wherein the protein-of-interest is potentially bound to DNA. The DNA may be a sample that has been contacted with the protein-of-interest. The protein-binding agent may be directly or indirectly associated with a nuclease, hence forming a DSB at any site at which the protein of interest is bound. Any DSBs may then be detected by the methods disclosed herein. The methodology may be Cleavage Under Targets and Release Using Nuclease (CUT&RUN) methods. As such, the method may comprise: step a); contacting the sample with a protein-of- interest; contacting the sample with an nuclease capable of directly or indirectly associating with the protein-of- interest to form a DSB in nucleic acids to which the protein is bound; step b), step c), and then step d). This order is particularly useful for embodiments wherein the method up to step b) is performed in a cell. Alternatively, the method may comprise: step a); step c); step d); contacting the sample with a protein-of-interest; contacting the sample with an nuclease capable of directly or indirectly associating with the protein-of-interest to form a DSB in nucleic acids to which the protein is bound; and then step b). This order is particularly useful for in vitro embodiments. In other embodiments, the DSB may be deliberately induced in a known or target site. For instance, a targeted nuclease, such as a CRIPSR / Cas or a TALEN, may be used to induce a DSB in a sequence of interest such that the methods of the invention can be used to isolate said sequence of interest for further analysis. The sequence of interest may be specific genes, the whole exome, or a specific locus in the genome. As such, in an embodiment the methods comprise contacting the sample with a nuclease capable of the targeted induction of a DSB in a sequence of interest. The methods may be for the detection of viral or bacterial insertion events or DNA damage caused by viral or bacterial insertion events. These events are measurable by virtue of the unique genetic sequences associated with bacteria and viruses that would be inserted into the genome. The methods of the invention can therefore reveal these sites of foreign DNA insertion, which can occur via a DSB intermediate structure. In other embodiment, the methods disclosed herein may be used to assess risks associated with a therapeutic agent, such as a gene therapy. For instance, the methods disclosed herein may be applied to a sample taken from a patient, wherein the sample has been treated with the therapeutic agent, in order to determine the risk, nature, or frequency of off-target effects for said patient. Thus, the methods disclosed herein may be useful for personalised medicine by providing a patient-specific pattern of DSBs, and their frequency, as induced by an agent of interest. As such, in an embodiment the methods may comprise obtaining a sample from a subject and exposing said sample to an agent, such as a therapeutic agent. The method may comprise determining the nature and / or frequency of any lesions or DSBs in the sample after the exposure. The order of the steps of the invention may be any as described herein. The methods disclosed herein may be used for detecting contamination of a sample by any agent capable of causing DSBs. The methods disclosed herein may be used to measure the stability of artificially assembled or synthetic genomes. The methods disclosed herein may be used for Next-Generation Risk Assessment (NGRA) in genetic toxicology. NGRA is defined as an exposure-led, hypothesis-driven risk assessment approach that integrates new approach methodologies (NAMs) to assure safety without the use of animal testing. DSBs are a direct measurement of genotoxic exposure and can quantified by the methods of then invention. Hence, the methods of the invention may be used for risk assessments requiring the quantification of genotoxic exposure. In summary, the sample of nucleic acid suspected of containing DSBs may contain said DSBs due to naturally occurring DNA damage, due to treatment with a potentially DSB causing agent, due to deliberate induction of a DSB at a site of interest, or for any other reason. In step b) the conditions enable the ligation of the first adapter to a DSB. The first adapter comprises an oligonucleotide capable of ligating to the 3’ terminus of a stand of a DSB and may also comprise another oligonucleotide capable of ligating to the 5’ terminus of a strand of a DSB. As such, the first adapter is covalently linked to the DSB. The ligation may be direct or indirect. For instance, the ligation may be to additional nucleotides introduced at the DSB. Alternatively, an oligonucleotide or pair of oligonucleotides may be ligated to the DSB and the first adapter may be ligated to the said oligonucleotide or oligonucleotides. The methods of ligation may be any as disclosed herein. The two oligonucleotides of the first adapter pair may be completely complementary. The first and / or second oligonucleotides of the first adapter pair may comprise a 3’ and / or a 5’ protective feature. These protective features may be any as disclosed herein, particularly any disclosed in connection with the first pair of oligonucleotides discussed in relation to step i) of the methods disclosed herein. The first and / or second oligonucleotides of the first adapter pair may comprise any features disclosed in connection with the first pair of oligonucleotides discussed in relation to step i) of the methods disclosed herein. In particular, the first adapter pair may include or not include the sequences disclosed in connection with the first pair of oligonucleotides discussed in relation to step i). The first adapter includes an oligonucleotide that is ligatable to a 3’ terminus and comprises a sequence that is capable of binding to an immobilised primer by hybridisation. This means that, when a ligated first adapter pair is denatured into single strands, one strand is complementary to a primer immobilised to the substrate. The adapter includes a sufficient length of complementary sequence to enable binding that is not released during washing or polymerisation steps. The length of the complementary region may be 5, 10, 15, 20, 21, 24, or more bases. Alternatively, the complementary region may include 5, 10, 15, 20, 21, 24, or more complementary bases. Step c) may comprise any method of fragmentation as discussed herein. In step d) the conditions enable the ligation of the nucleic acids to a second adapter. The second adapter comprises an oligonucleotide capable of ligating to a 5’ terminus at a fragmentation site and may comprise an oligonucleotide capable of ligating to a 3’ terminus at a fragmentation site. The methods of ligation may be any as disclosed herein. The second adapter may be restricted from ligating to the oligonucleotide first adapter. In a particular embodiment, this is due to the inclusion of a 3’ protective feature on the first adapter. In relevant embodiments, this prevention is due to the inclusion of 5’ and / or 3’ protective features on the first adapter pair. In particular, the first oligonucleotide of the first adapter (i.e. the oligonucleotide capable of binding to a 3’ terminus) may comprise a 3’ protective feature, such as a spacer C33’ chain terminator, to prevent adapter ligation to this strand (see Figure 12 of WO2022 / 038291 A1). The first and / or second oligonucleotides of the second adapter pair may comprise a 3’ and / or a 5’ protective feature. These protective features may be any as disclosed herein, particularly any disclosed in connection with the second pair of oligonucleotides discussed in relation to step iii) of the methods disclosed herein. In embodiments wherein step d) is performed before step b), the first and / or second oligonucleotides of the second adapter pair may comprise a 3’ and / or a 5’ protective feature, and at least one protective feature may to prevent ligation of the adapters of step b) to those of step d). For instance, the oligonucleotide of the second adapter capable of binding to a 3’ terminus may comprise a 3’ protective feature, such as a spacer C33’ chain terminator. The first and / or second oligonucleotides of the second adapter pair may comprise any features disclosed in connection with the second pair of oligonucleotides discussed in relation to step iii) of the methods disclosed herein. In particular, the second adapter pair may include or not include the sequences disclosed in connection with the second pair of oligonucleotides discussed in relation to step iii). The second adapter pair may be introduced by tagmentation. As such, the fragmentation and ligation of the second adapter may be the same step. For instance, steps c) and d) may be combined. The second adapter includes an oligonucleotide that is ligatable to a 5’ terminus and which comprises a sequence identical to at least part of a primer immobilised to the substrate. Hence, when this oligonucleotide acts as a template during polymerisation, the new strand will include a sequence which is capable of hybridising to said primer. Thus, the length of the relevant region of the adapter sequence and the relevant region of the primer should be adequate for this function. The length of the identical region may be 5, 10, 15, 20, 21, 24, or more bases. The other oligonucleotide within the second adapter does not include a sequence complementary to this so- called identical region. As such, the second adapter is not capable of binding to the substrate via hybridisation. After step f), the methods may further comprise contacting any hybridised nucleic acid with a polymerase under conditions suitable for the extension of the immobilised primer to synthesise a nucleic acid which is a chain of nucleotides that are complementary to the hybridised nucleic acid. The newly formed nucleic acid may then be amplified. In some embodiments, the primer for amplification is also immobilised to the substrate and may, for instance, be suitable for bridge amplification. This process is known in the art and forms clonal clusters of nucleic acids. In other embodiments, the primer for implication may be in solution, for instance for some embodiments wherein the substrate is bead. The amplified nucleic acids may then be sequenced in the usual way, for instance by sequencing-by-synthesis. The adapters may comprise a site for the binding of a sequencing primer to assist this process. The adapters may also comprise an index as disclosed herein. Thus, in an embodiment, the methods may further comprise: g) obtaining sequence information for any nucleic acids that hybridised to the substrate in step f). Methods including step g) may be referred to as methods for identifying DNA DSBs in a nucleic acid sample. The features disclosed in connection with step vi) of the methods disclosed herein are also appliable to step g). In any embodiments of products or methods comprising an oligonucleotide comprising AATGATACGGCGACCACCGA (SEQ ID NO: 34), or variants thereof, the oligonucleotide may comprise AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 41), or variants as defined for SEQ ID NO: 34. In any embodiments of products or methods comprising an oligonucleotide comprising SEQ ID NO: 31 or comprising no more than 5, 10, 15, or 20 bases of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31), the oligonucleotide may comprise SEQ ID NO: 38 or 42, or may comprise no more than 5, 10, 15, 20, 25, or 29 bases of the sequence GTGTAGATCTCGGTGGTCGCCGTATCATT (SEQ ID NO: 42), or no more than 5, 10, 15, or 19 bases of the sequence TCGGTGGTCGCCGTATCATTC (SEQ ID NO: 38). The second pair may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 30, SEQ ID NO: 31, and / or SEQ ID NO: 42. Figure 16 of WO2022 / 038291 A1 discloses an embodiment wherein a feature of interest, such as a lesion in a single strand of double-stranded DNA, is identified by the methods of the invention. The feature of interest may be any feature capable of being specifically cleaved. For instance, any feature which would result in the cleavage of a single strand of double-stranded DNA at the site of the feature of interest. The feature of interest may be, for instance, a cyclobutane pyrimidine dimer (CPD), 8-oxoguanine, an abasic site, and any combination thereof. In embodiments, the strand of DNA comprising the feature of interest may be cleaved, and the double-stranded sample denatured, to result in a 3’ terminus to which an adapter may be ligated. Thus, in an aspect of the invention, the method of DSB-detection comprises a method of sample preparation for identifying a feature of interest in a nucleic acid sample, wherein the preparation comprises modifying nucleic acids associated with a feature of interest to be suitable for binding to a substrate comprising immobilised primers, the method comprising: a) providing a sample comprising a plurality of nucleic acids, exposing the plurality of nucleic acids to conditions capable of cleaving at least one strand of a nucleic acid at a feature of interest, and denaturing the plurality of nucleic acids into single-stranded nucleic acids; b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a cleavage site and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation, but optionally is not capable of being ligated to the first adapter, and which does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation. The oligonucleotide of the second adapter capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation may comprise a sequence identical to a region of a second primer. All features disclosed in connection with the methods of identifying DNA DSBs are also relevant to the methods for identifying a feature of interest. In particular, steps b), c) and d) of the method of sample preparation for identifying a feature of interest in a nucleic acid sample may be the same as steps b), c), and d) as disclosed for the method of sample preparation for identifying DNA DSBs in a nucleic acid sample. The adapters may be the same as disclosed for identifying DSBs and the methods may be for preparing a library suitable for hybridising to any substrate disclosed herein. For embodiments comprising the ligation of a double-stranded adapter to a single- stranded nucleic acid, a splint oligo, as disclosed herein, may be included. In some embodiments, the steps may be performed in the order: c), d), a), and then b). This is the order shown in Figure 16 of WO2022 / 038291 A1. Thus, in an embodiment, the method of DSB-detection may comprise a method of sample preparation for identifying a feature of interest in a nucleic acid sample, wherein the preparation comprises modifying nucleic acids associated with a feature of interest to be suitable for binding to a substrate comprising immobilised primers, the method comprising, in order: c) fragmenting a sample comprising a plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation, and which does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; optionally comprising a sequence identical to a region of a second primer; a) exposing the plurality of nucleic acids to conditions capable of cleaving at least one strand of a nucleic acid at a feature of interest, and denaturing the plurality of nucleic acids into single-stranded nucleic acids; b) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a cleavage site, but optionally is not capable of being ligated to the second adapter, and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation. All downstream steps and features disclosed in connection with the methods of identifying DNA DSBs are also relevant to the methods for identifying a feature of interest. In particular, the method may comprise denaturing the sample into single-stranded nucleic acids, for instance to denature any double-stranded adapters. The method may further comprise contacting the plurality of nucleic acids with the substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids. In addition, the method may further comprise obtaining sequence information for any nucleic acids hybridised to the substrate. In another embodiment, the method of DSB-detection comprises a method of sample preparation for identifying a feature of interest in a nucleic acid sample, wherein the preparation comprises modifying nucleic acids associated with a feature of interest to be suitable for binding to a substrate comprising immobilised primers, the method comprising: α) exposing a sample comprising a plurality of nucleic acids to conditions capable of cleaving at least one strand of a nucleic acid at a feature of interest, and denaturing the plurality of nucleic acids into single- stranded nucleic acids; β) exposing the sample, under ligation conditions, to a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB, a hybridization site (RD1 SP) to which a first sequencing primer can bind and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is complementary to said first oligonucleotide of the first pair; wherein either or both of said oligonucleotides comprise, a 3’ and / or 5’ protective feature; γ) fragmenting the nucleic acid of said sample into fragments; and δ) exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which comprises a hybridization site (RD2 SP) to which a second sequencing primer can bind; and a second longer oligonucleotide that is in part complementary to said first oligonucleotide of the second pair and comprises a 3’ binding feature for binding to a second strand of said fragmented nucleic acid, a sequence complimentary to said hybridization site, and a further sequence that is, optionally, a binding sequence for enabling bridge amplification; and wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature. In some embodiments, the order of steps may be step γ), step δ), step α), and then step β). Thus, in another embodiment, there is provided a method of sample preparation for identifying a feature of interest in a nucleic acid sample, wherein the preparation comprises modifying nucleic acids associated with a feature of interest to be suitable for binding to a substrate comprising immobilised primers, the method comprising, in order: γ) fragmenting a nucleic acid sample into nucleic acid fragments; δ) exposing said fragments, under ligation conditions, to a second pair of oligonucleotides a first one of which comprises a hybridization site (RD2 SP) to which a second sequencing primer can bind; and a second longer oligonucleotide that is in part complementary to said first oligonucleotide of the second pair and comprises a 3’ binding feature for binding to a second strand of said fragmented nucleic acid, a sequence complimentary to said hybridization site, and a further sequence that is, optionally, a binding sequence for enabling bridge amplification; and wherein either or both of said oligonucleotides comprise a 3’ and / or 5’ protective feature. α) exposing the sample to conditions capable of cleaving at least one strand of a nucleic acid at a feature of interest, and denaturing the plurality of nucleic acids into single-stranded nucleic acids; and β) exposing the sample, under ligation conditions, to a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB, a hybridization site (RD1 SP) to which a first sequencing primer can bind and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is complementary to said first oligonucleotide of the first pair; wherein either or both of said oligonucleotides comprise, a 3’ and / or 5’ protective feature. The method may further comprise: ε) denaturing the fragments to provide single strand nucleic acids. The method may further comprise: ζ) separating the strands of part ε) into two groups: group A those fragments that have ligated at a first end the first hybridization site and binding sequence provided by the oligonucleotide of part β) and at another end the second hybridization site and further sequence provided by the oligonucleotide of part δ) and group B those fragments that do not have ligated at a first end the hybridization site and binding sequence provided by the oligonucleotide of part β) and at another end the second hybridization site and further sequence provided by the oligonucleotide of part δ). The method may further comprise: η) sequencing the strands of group A using primers that bind to the first and / or second hydridization sites. In further aspect, the methods may be adapted to be particularly suitable for use with bead-based systems. For instance, Ion Torrent sequencing. A particular embodiment is exemplified in Figures 14 and 15 of WO2022 / 038291 A1. As such, the method of DSB-detection may comprise a method of sample preparation for identifying DNA DSBs in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising an immobilised first primer, the method comprising: 1) providing a sample comprising a plurality of nucleic acids; 2) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of hybridising to a second primer; 3) fragmenting the plurality of nucleic acids; 4) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation, but optionally is not capable of being ligated to the first adapter, and which comprises a sequence identical to a region of the immobilised first primer; and 5) contacting the plurality of nucleic acids with the second primer under conditions suitable for extension of the primer. In a particular embodiment, step 2) is: exposing the plurality of nucleic acids to a first adapter pair under conditions conducive to ligation, wherein the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and wherein the first adapter pair comprises first and second oligonucleotides that are at least partially complementary, and the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of hybridising to a second primer; and wherein step 4) is: exposing the plurality of nucleic acids to a second adapter pair under conditions conducive to ligation, wherein the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides, and the first oligonucleotide is ligatable to a 5’ terminus and comprises a sequence identical to a region of the immobilised first primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the immobilised first primer. In particular embodiments, the oligonucleotide of the second adapter pair that is ligatable to a 5’ terminus comprises 5, 10, 15, 20, or all 23 bases of the sequence according to AACCCACTACGCCTCCGCTTTCC (SEQ ID NO: 40). The other oligonucleotide is of a sequence that does not comprise a sequence of more than 5, 10, 15, 20 bases, or does not comprise all 22 bases, of the sequence GGAAAGCGGAGGCGTAGTGGTT (SEQ ID NO: 36). The other oligonucleotide may comprise less than 6, 5, 4, 3, 2, or 1 bases of SEQ ID NO: 36. The oligonucleotides according to SEQ ID NO: 36 and SEQ ID NO: 40 may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. The first and / or second oligonucleotides of the first adapter pair may comprise a 3’ and / or a 5’ protective feature. These protective features may be any as disclosed herein, particularly any disclosed in connection with the first pair of oligonucleotides discussed in relation to step i) of the methods disclosed herein. The first and / or second oligonucleotides of the second adapter pair may comprise a 3’ and / or a 5’ protective feature. These protective features may be any as disclosed herein, particularly any disclosed in connection with the second pair of oligonucleotides discussed in relation to step iii) of the methods disclosed herein. In particular embodiments, the second adapter is not capable of being ligated to the first adapter due to the presence of a 3’ modification of the first adapter. For instance, a C33’ chain terminator. The oligonucleotide of the second adapter that is ligatable to a 5’ terminus comprises a sequence identical to a region of a second primer such that, when a complementary strand is generated, the complementary strand comprises a region to which the primer can bind by hybridisation. This sequence identical to a region of a second primer may be identical to 5, 10, 15, 20, 21, 24, or more bases of an immobilised primer. The method may further comprise denaturing the plurality of nucleic acids to form a plurality of single-stranded nucleic acids. The features of this step may be any as disclosed herein in connection with other embodiments of the invention. The method may further comprise contacting the plurality of nucleic acids with the substrate comprising the immobilised first primer under conditions suitable for hybridisation of the immobilised first primer to complementary nucleic acids. For instance, the sample of nucleic acids with ligated adapters may then be bound to the substrate, such as a bead comprising immobilised primers. The primers may be immobilised to the bead such that the 5’ end is proximal and the 3’ end is distal to the point of immobilisation. Routine techniques may be used such that the substrate, such as the bead, displays multiple copies of a nucleic acid with the same sequence. The methods may further comprise obtaining sequence information for any nucleic acids hybridised to the substrate. The adapters may comprise sites for the binding of sequencing primers, to assist with this process. The adapters may comprise index sequences to assist with this process. Any features disclosed in connection with embodiments featuring steps i), ii), iii), etc may be combined with features disclosed in connection with embodiments featuring steps a), b), c) etc. Any features disclosed in connection with embodiments featuring steps a), b), c), etc may be combined with features disclosed in connection with the embodiments featuring steps i), ii), iii) etc The use of DEDUCE-Seq for identifying mutations The inventors provide herein techniques for preparing nucleic acid libraries that are suitable for generating error- corrected sequencing data. When the nucleic acid libraries of the present disclosure are sequenced, sequencing information is provided for both strands of a nucleic acid duplex. This allows the correction of errors, including those that have been introduced via library preparation or that arise as a result of the sequencing. Specific details of a method of error-corrected duplex sequencing are provided in this section. This section describes a method known as “DEDUCE-Seq”. The method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; wherein steps b) and d) are performed separately. Steps b), and d) of the above method are performed separately, and so the non-hairpin adapter and the hairpin adapter are not ligated to the nucleic acids as a part of the same reaction. In other words, steps b) and d) are not performed simultaneously. However, as discussed further herein, adapter ligation and fragmentation steps may be performed simultaneously, in combination, or concurrently. For instance a tagmentation step may be used to both ligate an adapter and to fragment the plurality of nucleic acids. As such, steps b) and c), or steps d) and c), may be performed simultaneously, in combination, or concurrently. In all of these examples, the plurality of nucleic acids is fragmented after the first adapter ligation step and before, or as a part of, the second adapter ligation step. Steps b), c), and d) may be performed sequentially. The steps of the method may be, but need not be, performed in the order a), b), c), and then d). In particular, steps b) and d) may be swapped such that the order may be a), d), c), and then b). The fragmenting step (step c) may be performed in-between the ligation of one type of adapter and the ligation of the other type of adapter. The fragmenting step is performed at the time of, or before, the second ligation of an adapter. As used herein, the term “sequentially” means that the steps are not simultaneous. However, sequential steps need not be consecutive and additional steps may be performed in-between explicitly recited steps. In other embodiments, the steps may be in the order: step b) and then steps c) and d) concurrently, in combination, or simultaneously. The steps may be in the order: step d) and then steps c) and b) concurrently, in combination, or simultaneously. Due to the fact that steps b) and d) are performed separately, the non-hairpin adapter and the hairpin adapter are not ligated to the nucleic acids at the same time or as part of the same step. For embodiments where a hairpin is formed, this process does not take place at the same time or as part of the same step as the ligation of the non- hairpin adapter. Thus, the method of identifying mutations for use with the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation to generate a first library; c) fragmenting the first library; and d) exposing the fragmented first library to a hairpin adapter under conditions conducive to ligation to generate a second library, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule to generate a second library. The fragmentation of the first library and the generation of the second library may be sequential or simultaneous steps. In an alternative embodiment, the method comprises: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation to generate a first library, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule to generate a first library; c) fragmenting the first library; and d) exposing the fragmented first library to a non-hairpin adapter under conditions conducive to ligation to generate a second library. The fragmentation of the first library and the generation of the second library may be sequential or simultaneous steps. A nucleic acid library is a collection or plurality of nucleic acids to which at least one type of adapter has been ligated. The libraries provided by the methods disclosed herein have a reduced amount of sequencable nucleic acids that would generate un-error-correctable sequence information associated only with one strand of a duplex. Such undesired nucleic acids include those comprising, for instance, a non-hairpin adapter ligated to both ends of the nucleic acid. This is advantageous because it eliminates the need for enrichment and / or amplification prior to sequencing or prior to substrate-based steps. In addition, the quality of the library is improved. The ability to derive sequence information from a library without the need for an amplification step prior to sequencing, for instance prior to contacting the library with a substrate such as a flow cell, is advantageous because such steps can, themselves, introduce mutations and bias. In some embodiments, the libraries provided have a significantly reduced presence of sequencable nucleic acids that would generate un-error-correctable sequence information associated only with one strand of a duplex, for instance a reduction that is sufficient for the library to be sequenced on a substrate without the need for enrichment or amplification prior to application to the substrate. In some embodiments, it is desirable to generate libraries of that do not comprise sequencable nucleic acids that would generate un-error-correctable sequence information associated only with one strand of a duplex. However, any reduction in their presence, for instance such that amplification is no longer required, is advantageous. Prior art methods leading to libraries containing undesired products are disclosed in, for instance, WO 2013 / 142389 A1. The provision of a plurality of nucleic acids may be performed as the first step of the method. This step may comprise the purification of nucleic acids, such as DNA, from any sample disclosed herein. The DNA molecules to be sequenced may be referred to as target nucleic acids. If necessary due to nature of the isolated nucleic acids, the nucleic acids may be sheared or fragmented as a part of step a). Methods of fragmenting nucleic acids are known in the art and may be, for instance, mechanical shearing or enzymatic shearing. The fragmentation may comprise sonication, for instance with a Bioruptor sonicator or a Covaris sonicator. The fragmentation may be enzyme based and may make use of an enzyme-based reagent that shears DNA to produce fragments of desired sizes in a time-dependent manner. Suitable commercially available reagents include NEBNext dsDNA Fragmentase (NEB). The fragmentation may be a performed simultaneously with the first adapter ligation step, for instance via tagmentation. The fragmentation may comprise the use of a nuclease, for instance an endonuclease, endonucleases, a restriction enzyme, or restriction enzymes. The fragmentation may comprise the use of a nucleic acid-guided endonuclease, such as an RNA-guided DNA endonuclease. The fragmentation may comprise the use of Cas protein or a derivative or variant. The fragmentation may comprise the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, a retron, a prokaryotic argonaute, a TALEN, or a meganuclease. Fragmentation as a part of step a) may not be required for all embodiments. For instance, some nucleic acid sources do not require fragmentation. For example, samples that have been obtained from plasma may not require fragmentation. Alternatively, the nucleic acids may contain double strand breaks (DSBs), which may be naturally occurring or induced, and such samples may not need to be fragmented in step a). In some examples, an adapter may be ligated directly to a DSB. The fragmentation may generate nucleic acid fragments of a particular size or with a particular size distribution, and may be followed by a size selection step. Methods wherein step a) does not comprise fragmentation may also comprise a size selection step. Many systems or reagents for size selection and / or clean-up steps are known in the art. For instance, size selection using beads to remove or select fragments of a certain size. The beads may be Solid Phase Reversible Immobilisation (SPRI) beads. Commercially available beads include “SPRIselect” (Beckman Coulter) or SPRI beads (GC Biotech, CNGS-0005). Capillary DNA electrophoresis may be used for size selection. Capillary DNA electrophoresis may also be used to assess successful ligation and the removal of excess adapters. Other alternatives include gel-based electrophoresis size-selection steps or systems, for instance comprising the use of agarose gels or polyacrylamide gels. Suitable systems are commercially available, such as the BluePippin system (Sage Science). Yet further examples of systems for size selection and / or clean-up include DNA extraction column-based systems. The method may comprise removing fragments whose size is less than about 100bp, or less than about 150bp, and / or retaining fragments whose size is greater than about 150bp. In some embodiments, the resultant fragments are 100 to 1500 bp, 200 to 1300 bp, 300 to 1100 bp, 400 to 1000 bp, 500 to 900 bp, or 600 to 800 bp. In a particular embodiment, the nucleic acids are fragments of a size of approximately 600 to 800 bp. Hence, in an embodiment, step a) may be as follows: a) providing a plurality of nucleic acids; wherein the providing comprises: i) isolating a plurality of nucleic acids from a sample; ii) fragmenting said plurality of nucleic acids; and iii) selecting the fragments of the plurality of nucleic acids based on size. The fragmented nucleic acids may be treated to be suitable for adapter ligation. For instance, a binding feature or binding features may be added to the nucleic acids. The binding features may comprise a 5’ feature and / or a 3’ feature. The binding feature may be any suitable for facilitating the ligation of an adapter. For example, the 5’ or 3’ binding feature may comprise one of the following: a phosphate group; a triphosphate ‘T-tail', such as a deoxythymidine triphosphate ‘T-tail'; a triphosphate ‘A-tail’, such as a deoxyadenosine triphosphate ‘A-tail’; at least one random N nucleotide, such as a plurality of N nucleotides, or any other known binding group to allow linkage of an adapter to a nucleic acid. In a particular embodiment, the fragmented nucleic acids are end blunted and A-tailed. Thus, a 5’ phosphate and / or a 3’ A tail may be added to the fragmented nucleic acids. Hence, in an embodiment, step a) may be as follows: a) providing a plurality of nucleic acids; wherein the providing comprises: i) isolating a plurality of nucleic acids from a sample; optionally ii) fragmenting said plurality of nucleic acids; optionally iii) selecting the fragments of the plurality of nucleic acids based on size; and iv) adding a 5’ and / or a 3’ binding feature to said plurality of nucleic acids. Steps i), ii), iii), and iv) may be performed in the order i), ii), iii), and then iv). However, any order may be followed that allows the preparation of a plurality of nucleic acids that are suitable for the downstream steps disclosed herein. For instance, the order may be i), ii), iv), and then iii). In a particular non-limiting embodiment, step a) may be as follows: a) providing a plurality of nucleic acids; wherein the providing comprises: i) isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids is gDNA; ii) fragmenting said isolated plurality of nucleic acids; iii) selecting the fragments of the plurality of nucleic acids based on size; iii) end blunting said selected nucleic acids; and iv) adding an A-tail to said end blunted nucleic acids. In another non-limiting embodiment, step a) may be as follows: a) providing a plurality of nucleic acids; wherein the providing comprises: i) isolating a plurality of nucleic acids from a sample, wherein the plurality of nucleic acids is gDNA; ii) fragmenting said isolated plurality of nucleic acids; iii) selecting the fragments of the plurality of nucleic acids based on size; iii) end blunting and 5’ phosphorylating said selected nucleic acids; and iv) adding an A-tail to said end blunted nucleic acids. In other embodiments, step a) comprises both fragmentation of the nucleic acids and the ligation of an adapter. For instance, a tagmentation step. The ligated adapter may be the non-hairpin adapter or the hairpin adapter, depending on the order in which the steps are performed. Step a) and step b) may be combined as follows: i) isolating a plurality of nucleic acids from a sample; and ii) fragmenting and ligating a non-hairpin adapter to said plurality of nucleic acids; and optionally iii) selecting the fragments of the plurality of nucleic acids based on size. Alternatively, step a) and step d) may be combined as follows: i) isolating a plurality of nucleic acids from a sample; and ii) fragmenting and ligating a hairpin adapter to said plurality of nucleic acids; and optionally iii) selecting the fragments of the plurality of nucleic acids based on size. In one embodiment, step a) and step b) are combined as follows: 1) providing a plurality of nucleic acids; and 2) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation and fragmentation. In another embodiment, step a) and step d) are combined as follows: 1) providing a plurality of nucleic acids; and 2) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation and fragmentation. In some embodiments, at least one type of adapter is ligated in situ. In this situation, step a) may comprise the permeabilization of a cell or tissue sample. For instance, step a) may comprise exposing a sample to a permeabilizing agent. Nucleic acids, such as DNA or gDNA, may be isolated from the sample after the ligation of an adapter. In these embodiments, the adapter may be ligated to a DSB. The DSB may be naturally occurring or induced. Step b) comprises exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation. Hence, in some embodiments the non-hairpin adapter will be ligated to the available, or unprotected, ends of the nucleic acids. In embodiments where step b) is performed before step d), this will result in ligation of non-hairpin adapters to both ends of at least a portion of the plurality of nucleic acids. In embodiments where step b) is performed after step d), this will result in ligation of non-hairpin adapters to the end of the nucleic acid at which a hairpin is not present. As discussed, step b) may be performed separately from or simultaneously with fragmentation. In embodiments where step b) is simultaneous with fragmentation, this may either be the fragmentation of step a) and so as a part of the initial library preparation or, if step b) is performed after step d), then step b) may be combined with step c) (i.e. the fragmentation that takes place after the first adapter ligation step). A “non-hairpin adapter” is an adapter that does not comprise a hairpin loop. For instance, the non-hairpin adapter will not comprise a single nucleic acid strand forming a duplex by virtue of a portion of the single nucleic acid strand hybridising to another portion of the same single nucleic acid strand. A double-stranded non-hairpin adapter may comprise two separate nucleic acid strands, which may form a duplex due to hybridisation between at least a portion of one strand and at least a portion of the other strand. In some embodiments a non-hairpin adapter is or comprises nucleic acid. In some embodiments, the non-hairpin adapter is or comprises DNA, RNA, and / or xeno nucleic acid (XNA). The non-hairpin adapter may comprise modified and / or un-modified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In a particular embodiment, the non-hairpin adapter comprises double-stranded DNA. The non-hairpin adapter may comprise a sequence that is capable of binding by hybridisation to a primer immobilised to a substrate. For instance, the non-hairpin adapter may comprise a sequence that is at least partially complementary to a primer that is immobilised to a substrate. In some examples, the sequence may be referred to as a site for the hybridisation of a flow cell primer or a bead-bound primer. In such embodiments, the method may be a method of library preparation for nucleic acid sequencing, wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising immobilised primers. The length of the complementary region may be 5, 10, 15, 20, 21, 22, 23, 24, or more bases. Alternatively, the complementary region may include 5, 10, 15, 20, 21, 22, 23, 24, or more complementary bases. The non-hairpin adapter may comprise a sequence that is identical to at least a portion of, or all of, a second primer. The second primer may be immobilised to the substrate or may be in solution. The length of the identical region may be 5, 10, 15, 20, 21, 22, 23, 24, or more bases. The first and the second primer may be configured to allow the amplification of nucleic acids on the substrate. In particular embodiments, the non-hairpin adapter is ligated as a complete adapter. As such, in these embodiments, no further steps need to be performed in order to add features of the adapter. Thus, the non-hairpin adapter can be ligated to the plurality of nucleic acids as a full adapter without the need for a polymerase step or steps to add or fill in any nucleic acid sequences. In particular, the non-hairpin adapter may be ligated to the plurality of nucleic acids as a molecule that comprises both the sequence that can hybridise to the substrate and the sequence that enables amplification on the substrate. In a preferred embodiment, the non-hairpin adapter is a Y-adapter. A “Y-adapter” comprises two strands which are only partly complementary, such that the Y-adapter comprises a portion including two non-complementary single strands and a double-stranded complementary portion (e.g. to form a “Y” shape). The terminus of the double-stranded portion may ligate to another nucleic acid and, by virtue of the single-stranded portion, this may result in one sequence being ligated to the 5’ end of a nucleic acid and a different sequence being ligated to the 3’ end of the nucleic acid. For instance, the Y-adapter may comprise a first nucleic acid (e.g. DNA) strand and a second nucleic acid (e.g. DNA) strand. In an embodiment, the first strand comprises, in the 5’ to 3’ direction, a portion that is complementary to the second strand and a portion that is not complementary to the second strand; and the second strand comprises, in the 5’ to 3’ direction, a portion that is not complementary to the first strand and a portion that is complementary to the first strand. In particular embodiments, the Y-adapter is ligated as a complete adapter. As such, in these embodiments, no further steps need to be performed in order to add features of the Y-adapter. Thus, the Y-adapter can be ligated to the plurality of nucleic acids as a full adapter without the need for a polymerase step or steps to add or fill in any nucleic acid sequences. In particular, the Y-adapter may be ligated to the plurality of nucleic acids as a molecule that comprises both the sequence that can hybridise to the substrate and the sequence that enables amplification on the substrate. Y-adapters are known in the art. For instance, the Y-adapter may be an Illumina Y-adapter comprising a P5 binding sequence and a P7 binding sequence. In an embodiment, the Y-adapter comprises the sequence GTGTAGATCTCGGTGGTCGCCGTATCATT (SEQ ID NO: 42) and / or the sequence CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32). In another embodiment, the Y-adapter comprises the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30) and / or AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 41). In an embodiment, the Y-adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, or all 21 bases of SEQ ID NO: 42. In an embodiment, the Y-adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 32. In an embodiment, the Y-adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 30. In an embodiment, the Y-adapter comprises at least 5, 10, 15, 16, 1718, 19, or all 20 bases of SEQ ID NO: 41. In an embodiment, the Y-adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, or all 21 bases of SEQ ID NO: 42 and at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 32. In an embodiment, the Y- adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 30 and at least 5, 10, 15, 16, 1718, 19, or all 20 bases of SEQ ID NO: 41. The Y-adapters may comprise sufficient bases of any of SEQ ID NOs: 30, 32, 41, or 42 to allow hybridisation to a complementary primer. The Y-adapter may comprise a sequence that is capable of binding by hybridisation to a first primer and optionally a sequence that is capable of binding by hybridisation to a second primer. The first and the second primer may be for clonal amplification of the nucleic acid, for instance via bridge amplification. The Y-adapter may comprise a sequence that is capable of binding by hybridisation to a first primer immobilised to a substrate, and a sequence that is identical to at least a portion of, or all of, a second primer immobilised to the substrate. For instance, the Y-adapter may comprise a sequence that is at least partially complementary to a first primer that is immobilised to a substrate. The sequence that is at least partially complementary to a first immobilised primer and the sequence that is identical to at least a portion of a second immobilised primer may be present on different strands of the Y-adapter such that they form at least part of the non-complementary portion of the Y-adapter. In these embodiments, the method may be a method of library preparation for nucleic acid sequencing, wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising a first type of immobilised primer and a second type of immobilised primer. In such embodiments, the first immobilised primer and complementary portion of the Y-adapter and the second immobilised primer and identical portion of the Y- adapter may be suitable for performing bridge amplification of the target nucleic acids. Thus, in an embodiment, the Y-adapter comprises a first strand comprising a sequence that is at least partially complementary to a first primer immobilised to a substrate; and a second strand comprising a sequence that is identical to at least a region of a second primer immobilised to the substrate. In an embodiment, the Y-adapter comprises a first strand comprising at least 5, 10, 15, 16, 1718, 19, 20, or all 21 bases of SEQ ID NO: 42 and a second strand comprising at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 32. In an embodiment, the Y-adapter comprises a first strand comprising at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 30 and a second strand comprising at least 5, 10, 15, 16, 1718, 19, or all 20 bases of SEQ ID NO: 41. In an embodiment, the Y-adapter comprises a first strand comprising a sequence according to SEQ ID NO: 42 and a second strand comprising a sequence according to SEQ ID NO: 32. In an embodiment, the Y-adapter comprises a first strand comprising a sequence according to SEQ ID NO: 30 and a second strand comprising a sequence according to SEQ ID NO: 41. In other embodiments, the Y-adapter may comprise a sequence that is capable of binding by hybridisation to a first primer immobilised to a substrate, and a sequence that is identical to at least a portion of a second primer that is not immobilised to the substrate. In an embodiment, the substrate may be a bead. The non-hairpin adapter may comprise a hybridization site to which a sequencing primer can bind. The non- hairpin adapter may comprise a first hybridisation site to which a first sequencing primer can bind and a second hybridisation site to which a second sequencing primer can bind. The first hybridisation site and the second hybridisation side may be present on different strands of the non-hairpin adapter. The first and second hybridisation sites may be at least partially complementary. Thus, in an embodiment, the non-hairpin adapter, e.g. Y-adapter, may comprise a first strand comprising a first hybridisation site to which a first sequencing primer can bind; and a second strand comprising a second hybridisation site to which a second sequencing primer can bind. Examples of suitable hybridisation sites are provided herein as SEQ ID NOs: 3, 33, 37, and 39. These sequences are purely exemplary. SEQ ID NOs: 3, 33, 37, and 39 may each comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. However, the skilled person would appreciate that any modification is acceptable as long as a complementary modification can be made to a cognate primer for sequencing, or as long as the modification does not affect the hybridisation and function of the cognate primer. In embodiments wherein the non-hairpin adapter comprises both a sequence that is capable of binding by hybridisation to a primer immobilised to a substrate and a hybridisation site to which a sequencing primer can bind, after ligation the adapter may be oriented such that the sequence that is capable of binding by hybridisation to a primer immobilised to a substrate is located nearer to the terminus and the hybridisation site to which a sequencing primer can bind is located nearer to the ligation site. In a particular embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5’ to 3’ direction, a first hybridisation site to which a first sequencing primer can bind, and a sequence that is at least partially complementary to a first immobilised primer; and a second strand comprising, in the 5’ to 3’ direction, a sequence that is identical to a second immobilised primer and a second hybridisation site to which a second sequencing primer can bind. The first and the second hybridisation site may be at least partially complementary. The non-hairpin adapter may comprise a 5’ and / or 3’ binding feature or binding features. The binding feature may be any suitable for facilitating the ligation of an adapter. For example, the 5’ or 3’ binding feature may comprise one of the following: a phosphate group; a triphosphate ‘T-tail', such as a deoxythymidine triphosphate ‘T-tail'; a triphosphate ‘A-tail’, such as a deoxyadenosine triphosphate ‘A-tail’; at least one random N nucleotide, such as a plurality of N nucleotides, or any other known binding group to allow linkage of an adapter to a nucleic acid. In a particular embodiment, the 5’ binding feature is a phosphate group and the 3’ binding feature is a T-tail. In a particular embodiment, the non-hairpin adapter, e.g. Y-adapter, comprises a first strand comprising a 5’ binding feature, e.g. a phosphate group; and a second strand comprising a 3’ binding feature, e.g. a T-tail. The non-hairpin adapter may comprise a 5’ and / or 3’ protective feature or protective features, particularly in embodiments where step b) is performed before step d). The protective features may be any that would prevent the ligation of another adapter to the protected adapter. For instance, the protective feature or protective features may prevent the ligation of the hairpin adapter to the non-hairpin adaptor. The non-hairpin adapter may comprise two different terminal protective features. Protective features may not be required for all embodiments, for instance embodiments featuring tagmentation may not require the presence of protective features. In a particular embodiment, the non-hairpin adapter (e.g. Y-adapter) comprises a first strand comprising a sequence that is at least partially complementary to a first primer immobilised to a substrate and a 3’ protective feature, and a second strand comprising a sequence that is identical to at least a region of a second primer immobilised to the substrate and a 5’ protective feature. The 5’ and / or 3’ protective features may comprise a feature that provides resistance to any one or more of the following: phosphorylation activity, phosphatase activity, terminal transferase activity, nucleic acid hybridization, endonuclease activity, exonuclease activity, ligase activity, polymerase activity, and protein binding. This can be achieved by any means known to those skilled in the art such as, but not limited to, phosphorothioate linkages, phosphoroamidite spacers, phosphate groups, 2’-O-Methyl groups, inverted deoxy and dideoxy-T modifications, locked nucleic acid bases, dideoxynucleotides, or the like. The protective feature may be a C3 Spacer phosphoramidite (3SpC3). Examples of the activity these features provide are shown in table 1. In a particular embodiment, the non-hairpin adapter comprises a 5’ inverted ddT and a 3’ C3 Spacer phosphoramidite. In an embodiment, the non-hairpin adapter is a Y-adapter comprising a 5’ inverted ddT and a 3’ C3 Spacer phosphoramidite. In a particular embodiment, the non-hairpin adapter, e.g. Y-adapter, comprises a first strand comprising a 3’ protective feature, e.g. a C3 Spacer phosphoramidite; and a second strand comprising a 5’ protective feature, e.g. an inverted ddT. In a particular embodiment, the non-hairpin adapter is a Y-adapter that comprises a first strand comprising, in the 5’ to 3’ direction, a first hybridisation site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilised primer, and a 3’ protective feature (e.g. a C3 Spacer phosphoramidite); and a second strand comprising, in the 5’ to 3’ direction, a 5’ protective feature (e.g. an inverted ddT), a sequence that is identical to at least a region of a second immobilised primer, and a second hybridisation site to which a second sequencing primer can bind. Optionally the first and second hybridisation sites are at least partially complementary. In a particular embodiment, the non-hairpin adapter is a Y-adapter that comprises a first strand comprising, in the 5’ to 3’ direction, a 5’ binding feature (e.g. a phosphate group), a first hybridisation site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilised primer, and a 3’ protective feature (e.g. a C3 Spacer phosphoramidite); and a second strand comprising, in the 5’ to 3’ direction, a 5’ protective feature (e.g. an inverted ddT), a sequence that is identical to at least a region of a second immobilised primer, a second hybridisation site to which a second sequencing primer can bind, and a 3’ binding feature (e.g. a T-tail). Optionally the first and second hybridisation sites are at least partially complementary. The non-hairpin adapter may optionally comprise an index sequence, which may be referred to as a barcode. The index sequence may allow the identification of sequences from a particular sample. For instance, different samples may be pooled before sequencing and the index may allow the later identification of the sample from which a sequence was derived. This may be referred to as de-multiplexing after sequencing. An index sequence may be positioned such that it is read during sequencing, for instance it may be positioned 3’ to a hybridisation site for a sequencing primer. The index sequence may be a sequence that is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more nucleotides long. The index sequence may be a known sequence that is at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 13, 14, 15, 20 or more nucleotides long. The index sequence may be a random sequence that is at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20 or more nucleotides long. The index sequence may be a degenerate or semi-degenerate sequence. The index sequence may be from 5 to 10 base pairs in length. The index may be 5 or 7 nucleotides long. The index sequence may be present on both strands of a double-stranded portion of an adapter and may be complementary. The non-hairpin adapter may comprise two indexes for dual- indexed sequencing. The non-hairpin adapter may optionally comprise a Single Molecule Identifier (SMI). Examples of SMIs are disclosed in WO2013 / 142389, herein incorporated by reference. The SMI may allow the identification of post- amplification nucleic acid molecules that have been derived from a single parent molecule. The SMI sequence may be a double-stranded, complementary SMI sequence or a single-stranded SMI sequence. The SMI sequence may be degenerate or semi-degenerate and may be a random degenerate sequence. A double-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-mer sequence and a second n-mer sequence that is complementary to the first degenerate or semi-degenerate nucleotide n-mer sequence, while a single-stranded SMI sequence may include a first degenerate or semi-degenerate nucleotide n-mer sequence. The first and / or second degenerate or semi-degenerate nucleotide n-mer sequences may be any suitable length to produce a sufficiently large number of unique tags to label a set of sheared DNA fragments from a segment of DNA. Each n-mer sequence may be between approximately 3 to 20 nucleotides in length. Therefore, each n-mer sequence may be approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides in length. In one embodiment, the SMI sequence is a random degenerate nucleotide n-mer sequence which is 12 nucleotides in length. With regards to the present invention, it is not essential to include an SMI sequence because no nucleic amplification step is required prior to binding to the substrate. Thus, in some embodiments, the non-hairpin adapter does not comprise an SMI sequence. The Y-adapter may comprise the sequence GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (SEQ ID NO: 37), an index, and SEQ ID NO: 42, and these features may in the recited order from 5’ to 3’. The index may be seven bases long. The Y-adapter may comprise the sequence SEQ ID NO: 32, an index, and the sequence GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 33), and these features may in the recited order from 5’ to 3’. The index may be five bases long. The Y-adapter may comprise the sequence GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO: 3), an index, and SEQ ID NO: 30, and these features may in the recited order from 5’ to 3’. The index may be seven bases long. The Y-adapter may comprise SEQ ID NO: 41, an index, and ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 39), and these features may in the recited order from 5’ to 3’. The index may be five bases long. In a particular embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 37, optionally an index, and SEQ ID NO: 42; and a second strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 32, optionally an index, and SEQ ID NO: 33. SEQ ID NOs: 42, 32, 37, and 33 may each comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a particular embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 3, optionally an index, and SEQ ID NO: 30; and a second strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 41, optionally an index, and SEQ ID NO: 39. SEQ ID NOs: 30, 41, 3, and 39 may each comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. The non-hairpin adapter is provided to the plurality of nucleic acids under conditions conductive to ligation of an adapter to a nucleic acid within the plurality of nucleic acids. The conditions may be varied depending on the nature of the ligation reaction and the binding features of the non-hairpin adapter and the binding features of the plurality of nucleic acids. For instance, the conditions may facilitate the ligation between two double-stranded nucleic acids, wherein each comprise a 5’ phosphate, and wherein one comprises a 3’ A-tail and the other comprises a 3’ T-tail. Other suitable ways of ligating an adapter to a nucleic acid, and the necessary conditions, are known in the art. A purification step may be included after adapter ligation. This step may remove excess adapter molecules. The adapter ligation may be via a technique that also comprises fragmentation, for instance tagmentation. In embodiments where step b) is performed before step d), the ligation reaction results in the ligation of the non- hairpin adapter to both ends of at least a portion of the plurality of nucleic acids. This may be referred to as a first library. In embodiments where the non-hairpin adapter is a Y-adapter, the first library comprises fragments of nucleic acids to be sequenced, wherein a Y-adapter is ligated to each end of at least a portion of the fragments. Hence, a first nucleic acid sequence may be ligated to the 5’ ends of the strands within the fragments and a second nucleic acid sequence may be ligated to the 3’ ends of the strands within the fragments. In embodiments where step b) is performed after step d), the ligation reaction results in ligation of a non-hairpin adapter to the end of the nucleic acid at which a hairpin is not present. Hence, at least a portion of the nucleic acids to be sequenced comprise a hairpin at one end and a non-hairpin adapter at the other end. This may be referred to as a second library. In embodiments where the non-hairpin adapter is a Y-adapter, the second library comprises fragments of nucleic acids to be sequenced, wherein at least a portion of the fragments comprise a Y- adapter ligated to one end and a hairpin at the other end. Step c) comprises fragmenting the plurality of nucleic acids, and may follow either step b) or step d). Step c) is applied to the first library and is performed before or during the formation of the second library. Methods of fragmenting nucleic acids are known in the art and may be, for instance, mechanical shearing or enzymatic shearing. The fragmentation may comprise sonication, for instance with a Bioruptor sonicator or a Covaris sonicator. The fragmentation may be enzyme based and may make use of an enzyme-based reagent that shears DNA to produce fragments of desired sizes in a time-dependent manner. Suitable commercially available reagents include NEBNext dsDNA Fragmentase (NEB). The fragmentation may be a performed simultaneously with the second adapter ligation step, for instance via tagmentation. The fragmentation may lead to double-strand breaks in the plurality of nucleic acids. The fragmentation might not be site specific and so may induce random breaks, such as random double-strand breaks. The fragmentation leads to double-strand breaks to which an adapter can be ligated, optionally after end repair or similar steps. The fragmentation may lead to double-strand breaks to which an adapter can be ligated without the need for prior polymerase-based steps that make use of one strand as a template. In some embodiments, the fragmentation does not comprise the use of a site-specific nickase. In some embodiments, the fragmentation does not comprise the use of a site-specific nickase to result in a single-stranded portion, which is then repaired using a template-based polymerase. The fragmentation may comprise the use of a nuclease, for instance an endonuclease, endonucleases, a restriction enzyme, or restriction enzymes. The fragmentation may comprise the use of a nucleic acid-guided endonuclease, such as an RNA-guided DNA endonuclease. The fragmentation may comprise the use of Cas protein or a derivative or variant. The fragmentation may comprise the use of Cas9, Cpf1, C2c2, C2c1, CasM, CasMini, a retron, a prokaryotic argonaute, a TALEN, or a meganuclease. The fragmentation may generate nucleic acid fragments of a particular size or with a particular size distribution, and may be followed by a size selection step. Many systems or reagents for size selection and / or clean-up steps are known in the art. For instance, size selection using beads to remove or select fragments of a certain size. The beads may be Solid Phase Reversible Immobilisation (SPRI) beads. Commercially available beads include “SPRIselect” (Beckman Coulter) or SPRI beads (GC Biotech, CNGS-0005). Capillary DNA electrophoresis may be used for size selection. Capillary DNA electrophoresis may also be used to assess successful ligation and the removal of excess adapters. Other alternatives include gel-based electrophoresis size-selection steps or systems, for instance comprising the use of agarose gels or polyacrylamide gels. Suitable systems are commercially available, such as the BluePippin system (Sage Science). Yet further examples of systems for size selection and / or clean-up include DNA extraction column-based systems. If the sample was fragmented before or during the ligation of the first adapter, step c) may comprise selecting for fragments that are approximately half the size of the preceding fragmentation step. Step c) may comprise removing fragments whose size is less than about 100bp, or less than about 150bp, and / or retaining fragments whose size is greater than about 150bp. In some embodiments, the resultant fragments are 100 to 700 bp, 150 to 650 bp, 200 to 600 bp, 250 to 550 bp, 300 to 500 bp, or 350 to 450 bp. In some embodiments, the resultant fragments are 150 to 600 bp, 200 to 550 bp, 250 to 500 bp, 275 to 450 bp, or 300 to 400 bp. The fragmented nucleic acids may be treated to be suitable for adapter ligation. For instance, a binding feature or binding features may be added to the nucleic acids. The binding features may comprise a 5’feature and / or a 3’ feature. The binding feature may be any suitable for facilitating the ligation of an adapter, including any binding feature disclosed herein. If step b) was performed to generate the first library, the binding features may not be added to the non-hairpin adapter due to the presence of the protective features on the non-hairpin adapter. In a particular embodiment, the fragmented nucleic acids are end blunted and A-tailed. Thus, a 5’ phosphate and / or a 3’ A-tail may be added to the fragmented nucleic acids. Hence, in an embodiment, step c) may be as follows: c) fragmenting the plurality of nucleic acids; and further comprising: optionally i) selecting the fragments of the plurality of nucleic acids based on size; and ii) adding a 5’ and / or a 3’ binding feature to said plurality of nucleic acids. Steps i) and ii) may be performed in the order i) and then ii). However, any order may be followed that allows the preparation of a plurality of nucleic acids that are suitable for the downstream steps disclosed herein. In a particular non-limiting embodiment, step c) may be as follows: c) fragmenting the plurality of nucleic acids; and further comprising: i) selecting the fragments of the plurality of nucleic acids based on size; ii) end blunting said selected nucleic acids; and iii) adding an A-tail to said end blunted nucleic acids. In other embodiments, step c) comprises a step that both fragments the nucleic acids and ligates an adapter. For instance, a tagmentation step. The ligated adapter may be the non-hairpin adapter or the hairpin adapter, depending on the order in which the steps are performed. Thus, step c) and step b) may be combined as follows: i) fragmenting and ligating a non-hairpin adapter to said plurality of nucleic acids; and optionally ii) selecting the fragments of the plurality of nucleic acids based on size. Alternatively, step c) and step d) may be combined as follows: i) fragmenting and ligating a hairpin adapter to said plurality of nucleic acids; and optionally ii) selecting the fragments of the plurality of nucleic acids based on size. In other embodiments, step c) may comprise a tagmentation step that inserts a recognition site into the fragmented nucleic acids. For instance, a recognition site for an enzyme capable of forming a hairpin, such as protelomerase. The protelomerase may be TelN. In some examples, step d) comprises exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation. Hence, the hairpin adapter will be ligated to the available, or unprotected, ends of the nucleic acids. In embodiments where step d) is performed before step b), this will result in ligation of hairpin adapters to both ends of at least a portion of the plurality of nucleic acids. In embodiments where step d) is performed after step b), this will result in ligation of non-hairpin adapters to the end of the nucleic acid to which a hairpin adapter is not ligated. In other examples, step d) comprises exposing the plurality of nucleic acids to conditions capable of capable of forming a hairpin at an end of a nucleic acid molecule. For instance, step d) may comprise the use of conditions or an enzyme capable of generating covalently closed ends in double stranded nucleic acid molecule. An example of a suitable enzyme is a protelomerase, such as TelN. A TelN recognition sequence may be present in, or may have been introduced into, the plurality of nucleic acids. For instance, a TelN recognition sequence may be introduced as part of a fragmentation via tagmentation. As discussed, step d) may be performed separately from or simultaneously with fragmentation. In embodiments where step d) is simultaneous with fragmentation, this may either be the fragmentation of step a) and so as a part of the initial library preparation or, if step d) is performed after step b), then step d) may be combined with step c) (i.e. the fragmentation that takes place after the first adapter ligation step). A “hairpin” adapter comprises a hairpin loop. Hairpin adapters can comprise a single nucleic acid strand forming a duplex by virtue of a portion of the single nucleic acid strand hybridising to another portion of the same single nucleic acid strand. Hairpin adapters are known in the art. A hairpin adapter may be referred to as a “U-adapter”. A double-stranded nucleic acid that has a hairpin present at only one end is capable of being denatured to form a unitary single-stranded molecule including both strands of the original double-stranded nucleic acid. In some embodiments a hairpin adapter is or comprises nucleic acid. In some embodiments, the hairpin adapter is or comprises DNA, RNA, and / or XNA. The hairpin adapter may comprise modified and / or un-modified nucleotides. In a particular embodiment, the hairpin adapter comprises DNA. A non-limiting example of a hairpin adapter is: GGGCCTADDDDDDDDTAGGCCCT (SEQ ID NO: 112), where D is G, A or T (but not C). The hairpin adapter may be provided to the plurality of nucleic acids under conditions conductive to ligation of an adapter to a nucleic acid within the plurality of nucleic acids. The conditions may be varied depending on the nature of the ligation reaction and the binding features of the hairpin adapter and the binding features of the plurality of nucleic acids. For instance, the conditions may facilitate the ligation between two double-stranded nucleic acids, wherein each comprise a 5’ phosphate, and wherein one comprises a 3’ A-tail and the other comprises a 3’ T-tail. Other suitable ways of ligating an adapter to a nucleic acid, and the necessary conditions, are known in the art. A purification step may be included after adapter ligation. This step may remove excess adapter molecules. In embodiments where step d) is performed before step b), step d) results in the ligation of the hairpin adapter to both ends of at least a portion of the plurality of nucleic acids, or the formation of a hairpin at both ends of at least a portion of the plurality of nucleic acids. This may be referred to as a first library. In such embodiments, the method may comprise a step of removing any linear nucleic acids. This step may result in only the nucleic acids with a hairpin present at both ends, which are essentially nucleic acid circles, being retained. In embodiments where step d) is performed after step b), step d) results in ligation of a hairpin adapter to the end of the nucleic acid to which a non-hairpin adapter is not ligated, or the formation of a hairpin at the end of the nucleic acid to which a non-hairpin adapter is not ligated. Hence, at least a portion of the nucleic acids to be sequenced comprise a hairpin at one end and a non-hairpin adapter at the other end. This may be referred to as a second library. As discussed, step d) may be performed separately from or simultaneously with fragmentation. In embodiments where step d) is simultaneous with fragmentation, this may either be the fragmentation of step a) and so as a part of the initial library preparation or, if step d) is performed after step b), then step d) may be combined with step c) (i.e. the fragmentation that takes place after the first adapter ligation step). In an embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; fragmenting the plurality of nucleic acids; and exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation. In an embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; fragmenting the plurality of nucleic acids; and exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. In another embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; and exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation and fragmentation. In an embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation; fragmenting the plurality of nucleic acids; and exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation. In an embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; fragmenting the plurality of nucleic acids; and exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation. In another embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising the following sequential steps in the recited order: providing a plurality of nucleic acids; exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation; and exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation and fragmentation. In some embodiments, the method may further comprise contacting the plurality of nucleic acids, which may be referred to as a second library at this stage, to a substrate comprising immobilised primers, under conditions suitable for the hybridisation of a portion of the non-hairpin adapter at least a portion of an immobilised primer. Any nucleic acids lacking a ligated non-hairpin adapter will not hybridise to the flow cell. For instance, any nucleic acids that include a hairpin adapter at both ends. The substrate may be a solid surface such as a surface of a flow cell, a bead, a slide, or a membrane. In particular, the substrate may be a flow cell. The substrate may be a patterned or a non-patterned flow cell. The substrate may comprise glass, quartz, silica, metal, ceramic, or plastic. The substrate surface may comprise a polyacrylamide matrix or coating. As used herein, the term “flow cell” is intended to have the ordinary meaning in the art, in particular in the field of sequencing by synthesis. Exemplary flow cells include, but are not limited to, those used in a nucleic acid sequencing apparatus such as flow cells for the Genome Analyzer®, MiSeq®, NextSeq®, HiSeq®, or NovaSeq® platforms commercialised by Illumina, Inc. (San Diego, Calif.); or for the SOLiD™ or Ion Torrent™ sequencing platform commercialized by Life Technologies (Carlsbad, Calif.). Exemplary flow cells and methods for their manufacture and use are also described, for example, in WO2014 / 142841A1; U.S. Pat. App. Pub, No. 2010 / 0111768 A1 and U.S. Pat. No.8,951,781. The substrate may comprise immobilised primers, for instance two types of primer which together can act as forward and reverse primers for bridge amplification. Immobilisation to a substrate means that the primer is bound to the substrate even under conditions that would denature double-stranded nucleic acids. For instance, the primer may be covalently bound to the substrate. The primers are oriented such that the 5’ end is proximal and the 3’ end is distal to the point of immobilisation. Such arrangements are standard in the art. In a particular embodiment, the substrate may comprise a first and a second immobilised primer. The immobilised primers may, in some embodiments, be suitable for acting as primers during bridge amplification. Bridge amplification may result in clonal amplification of nucleic acids immobilised to a substrate. The non- hairpin adapter may be a Y-adapter comprising a sequence that is complementary to the first immobilised primer and a sequence that is identical to the second immobilised primer. Thus, in such embodiments the second library comprises nucleic acids that include a hairpin adapter at one end and, at the other end, a sequence complementary to the first immobilised primer ligated to one strand and a sequence that is identical to the second immobilised primer ligated to the other strand. The sequence complementary to the first immobilised primer may be ligated to the 3’ end of the nucleic acid and the sequence that is identical to the second immobilised primer may be ligated to the 5’ end of the nucleic acid. In some embodiments, the second library may be denatured before being contacted to the substrate, such that the nucleic acids of the second library are single stranded. In some embodiments, the second library may be contacted to the substrate under denaturing conditions such that nucleic acids within the library are single-stranded at the time of contact. In a particular embodiment, there is disclosed a method of library preparation for nucleic acid sequencing, wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising a first immobilised primer, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilised primer; c) fragmenting the plurality of nucleic acids; and d) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. In one embodiment, the steps may be performed in the order a), b), c), and then d). These steps may be sequential or steps c) and d) may be combined, for instance as a tagmentation step. Step b) may be combined with an earlier fragmentation step. In another embodiment, the steps may be performed in the order a), d), c), and then b). These steps may be sequential or steps c) and b) may be combined, for instance as a tagmentation step. Step d) may be combined with an earlier fragmentation step. Following the above-mentioned steps, the method may further comprise: e) contacting the plurality of nucleic acids to the substrate under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids. As an example, the substrate may be a flow cell suitable for nucleic acid sequencing. In particular embodiments, no nucleic acid amplification step, such as PCR, is performed before step e). For instance, the method may be performed starting with a tissue sample and ending with fragments of the gDNA from the sample bound to a sequencing flow cell via ligated adapters that are hybridised to immobilised primers; wherein no nucleic acid amplification step, such as a PCR step, was performed during this process. While a PCR step could be included in order to amplify targets, the inventors have surprising found that this is not a requirement of the methods of the invention. The exclusion of an amplification step may advantageously avoid the introduction of bias or the introduction of sequence errors as a result of the amplification. Thus, methods of the present invention that exclude an amplification step may be used for whole-genome error-corrected sequencing. Hence, in an embodiment, there is disclosed a method of library preparation for nucleic acid sequencing, wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising a first immobilised primer, the method comprising the following steps in the recited order, wherein steps c) and d) may be combined: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilised primer; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; and e) contacting the plurality of nucleic acids to the substrate under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein no nucleic acid amplification step, e.g. PCR, is performed before step e). The non-hairpin adapter may be any disclosed herein, such as a Y-adapter. The substrate may be any disclosed herein, such as a flow cell. In an alternative embodiment, there is disclosed a method of library preparation for nucleic acid sequencing, wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising a first immobilised primer, the method comprising the following steps in the recited order, wherein steps c) and d) may be combined: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; c) fragmenting the plurality of nucleic acids; d) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation, wherein the non-hairpin adapter comprises a sequence complementary to the first immobilised primer; and e) contacting the plurality of nucleic acids to the substrate under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein no nucleic acid amplification step, e.g. PCR, is performed before step e). The non-hairpin adapter may be any disclosed herein, such as a Y-adapter. The substrate may be any disclosed herein, such as a flow cell. After step e), the methods may further comprise contacting any hybridised nucleic acid with a polymerase under conditions suitable for the extension of the immobilised primer to synthesise a nucleic acid which is a chain of nucleotides that are complementary to the hybridised nucleic acid. The newly formed nucleic acid may then be amplified. In some embodiments, the primer for amplification is also immobilised to the substrate and may, for instance, be suitable for bridge amplification. This process is known in the art and forms clonal clusters of nucleic acids. In other examples, the primer for amplification may be in solution, for instance for embodiments wherein the substrate is a bead. The amplified nucleic acids may then be sequenced in the usual way, for instance by sequencing-by-synthesis. The non-hairpin adaptor may comprise a site for the binding of a sequencing primer to assist this process. The non-hairpin adaptor may also comprise an index. Thus, in an embodiment, the methods may further comprise: f) obtaining sequence information for any nucleic acids that hybridised to the substrate in step e). In embodiments where step e) is not carried out, sequence information may be obtained by sequencing the second library. Methods including a step of obtaining sequence information may be referred to as a method for nucleic acid sequencing or as a method for error-corrected nucleic acid sequencing. Such methods are “error-corrected” because sequence information is derived from both strands of a portion of a double-stranded nucleic acid and hence any errors that have been introduced after provision of the nucleic acids for sequencing may be corrected by comparing the sequence obtained for one strand to the sequence obtained for the other strand. In essence, each portion of the original nucleic acid sample is read twice, and each read is of an independent sequence, hence allowing error correction of any discrepancies that are only present in a single read. The method is for the identification of mutations and includes identifying as mutations any changes in the expected sequence that are consistent on both strands of a DNA molecule, and not identifying any changes in the expected sequence as a mutation if the change is not consistent on both strands of the DNA molecule. Such methods may include the bioinformatic alignment of the sequence reads to a reference sequence, in order to identify deviations from the expected sequence. The reference sequence may be a known sequence for example the human genome, such as the human genome reference sequence Human Build 38 patch release 14 (GRCh38.p14; Genome Reference Consortium) in the NCBI database. In particular embodiments, the methods may be applied to gDNA obtained from a sample and may be for unbiased genome-wide error-corrected sequencing. In some embodiments, the methods may be employed to detect off-target effects of gene editing techniques. For instance, the methods may be used to detect off-target effects of CRISPR-Cas9 editing, TALEN editing, or any other method of altering the sequence of a nucleic acid. Methods of sequencing nucleic acids, such as immobilised nucleic acid clusters, are known in the art. In some embodiments, the sequencing may involve the use of a sequencing primer or sequencing primers. For instance, embodiments of the non-hairpin adapter described herein may comprise a first hybridisation site to which a first sequencing primer can bind, and step f) may comprise the use of the first sequencing primer. In some embodiments, the non-hairpin adapter described herein may also comprise a second hybridisation site to which a second sequencing primer can bind, and step f) may also comprise the use of the second sequencing primer. The sequencing may be next-generation sequencing or may be massively parallel sequencing. In a particular embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising immobilised primers, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a Y-adapter under conditions conducive to ligation to generate a first library; wherein the Y-adapter comprises: a first strand comprising a sequence that is at least partially complementary to a first primer immobilised to a substrate and optionally a 3’ protective feature, and a second strand comprising a sequence that is identical to at least a region of a second primer immobilised to the substrate and optionally a 5’ protective feature; c) fragmenting the first library, and further comprising: i) selecting the fragments of the plurality of nucleic acids based on size; and d) exposing the selected fragments to a hairpin adapter under conditions conducive to ligation to generate a second library, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule. In another embodiment, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing wherein the preparation comprises modifying nucleic acids to be suitable for binding to a substrate comprising immobilised primers, the method comprising: a) providing a plurality of nucleic acids; b) exposing the plurality of nucleic acids to a Y-adapter under conditions conducive to ligation to generate a first library; wherein the Y-adapter comprises: a first strand comprising a sequence that is at least partially complementary to a first primer immobilised to a substrate and optionally a 3’ protective feature, and a second strand comprising a sequence that is identical to at least a region of a second primer immobilised to the substrate and optionally a 5’ protective feature; and (combined steps) c) and d) exposing the first library to a hairpin adapter under conditions conducive to ligation and fragmentation to generate a second library; optionally wherein tagmentation is performed. The above two embodiments may be methods of obtaining sequence information from nucleic acids, where the method further comprises: e) denaturing the second library to produce single-stranded nucleic acids and contacting the single- stranded nucleic acids to the substrate under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids, and optionally generating clusters of immobilised nucleic acids via bridge amplification, wherein the first and second immobilised primers act as primers for bridge amplification; and f) obtaining sequence information for any nucleic acids that hybridised to the substrate in step e). As disclosed herein, the inventors have surprisingly discovered that found that amplification of the nucleic acids from the sample, prior to binding to the substrate, is not a requirement of the methods of identifying mutations. Thus, the method of identifying mutations for use of the present invention may comprise a method of library preparation for nucleic acid sequencing, the method comprising: i) providing a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; and iii) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; wherein the nucleic acids are not amplified during preparation of the library. The features disclosed in connection with step a) of methods of identifying mutations for use of the present invention may comprise are also applicable to step i). The non-hairpin adapter of the any as disclosed herein in association with a method of identifying mutations. The non-hairpin adapter may include protective features and / or binding features as disclosed herein. The hairpin adapter may be any as disclosed herein in association with a method of identifying mutations. The conditions capable of forming a hairpin at an end of a nucleic acid molecule may be any as disclosed herein in association with a method of identifying mutations. The nucleic acids are not amplified during preparation of the library according to this embodiment of the method of identifying mutations. For instance, no PCR step is performed. In a particular embodiment, the steps are performed in the order i), ii), and then iii). In another embodiment, the steps are performed in the order i), iii), and then ii). In a particular embodiment, steps ii) and iii) are performed separately and a fragmentation step is included between the steps. In another embodiment, the second ligation step may comprise fragmentation, for instance it may be a tagmentation step. The features disclosed in connection with step c) of the above-discussed methods of identifying mutations are also applicable to the fragmenting step of these PCR-free embodiments. The nucleic acid library generated by steps i), ii), and iii) may be referred to as a second library. Sequence information may be obtained from the second library. In an embodiment, the non-hairpin adapter comprises a sequence that is at least partially complementary to a first primer that is immobilised to a substrate, and the method comprises step iv), contacting the second library to a substrate comprising a first immobilised primer under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids. The features disclosed in connection with step e) of the above-discussed methods of identifying mutations are also applicable to step iv) of the PCR-free embodiments. The features disclosed in connection with obtaining sequence information for the above-discussed methods of identifying mutations are also applicable to these PCR-free embodiments. In such embodiments, no nucleic acid amplification step is performed prior to step iv). Methods including wet work The methods of the invention are, in some embodiments, not purely bioinformatic. The methods may include the wet work. Thus, in an embodiment, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by performing the steps of any method of sequencing disclosed herein followed by analysis of the information obtained; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. In an embodiment, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by performing the steps of any method of DSB-detection disclosed herein followed by analysis of the information obtained, and identifying the location one or more mutations within the nucleic acid sample by performing the steps of any method of error-corrected duplex sequencing disclosed herein followed by analysis of the information obtained; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. The method of DSB-detection may be any as disclosed herein. In particular, the method is a PCR-free method of DSB detection. The method of DSB-detection may involve the preparation of a nucleic acid library wherein only DSB-associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate. The method of DSB-detection may be INDUCE-Seq. The method of identifying the location one or more mutations may be any as disclosed herein. In particular, the method is a PCR-free method of error-corrected duplex sequencing. The method may be DEDUCE-Seq. In a more specific embodiment, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by performing the following steps of a method of error-corrected duplex sequencing followed by analysis of the information obtained: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids; wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule, v) contacting the plurality of nucleic acids to a substrate comprising a first immobilised primer under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilised primer; and vi) obtaining sequence information for any nucleic acids that hybridised to the substrate in step v); (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. The steps of the method of error-corrected duplex sequencing may be performed sequentially and in the order i), ii), iii), iv), v), vi); or performed sequentially and in the order i), iv), iii), ii), v), vii); or performed in the order step i), step ii), combined steps iii) and iv), step v), and step vii); or performed in the order step i), step iv), combined steps iii) and ii), step v), and step vi). In an embodiment, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by performing the steps of any method of DSB-detection disclosed herein followed by analysis of the information obtained, wherein method of DSB detection is a PCR-free method that comprises the preparation of a nucleic acid library wherein only DSB-associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate , and identifying the location one or more mutations within the nucleic acid sample by performing the following steps of a method of error-corrected duplex sequencing followed by analysis of the information obtained: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; v) contacting the plurality of nucleic acids to a substrate comprising a first immobilised primer under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilised primer; and vi) obtaining sequence information for any nucleic acids that hybridised to the substrate in step v); (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. In an embodiment, there is provided a method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by performing the steps of INDUCE-Seq followed by analysis of the information obtained, and identifying the location one or more mutations within the nucleic acid sample by performing the steps of DEDUCE-Seq followed by analysis of the information obtained; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated. Nucleic acid samples The nucleic acid sample to which the methods of DSB-detection and methods of sequencing are applied may be any suitable nucleic acid sample. For instance, any DNA sample capable of comprising DSBs. In an embodiment, said sample is a mammalian, for instance human, sample. Other suitable samples include plants such as soybean, sunflower, cotton, alfalfa, canola, tobacco, potato, Arabidopsis, safflower, maize, rice, sorghum, barley, wheat, millet, oats, sugarcane, turfgrass, and switch grass. The sample from any of these sources may be gDNA. In a preferred embodiment, said nucleic acid sample is a large DNA sample, such as gDNA. The methods are particularly relevant to gDNA due to the need to detect DSBs in gDNA and due to the large amount of sequence that could provide false positives. The sample may be human, for instance human gDNA. The sample from which the nucleic acids are obtained may be a biological sample, such as a sample obtained from a patient or a sample obtained from biological cells. The sample may be a tissue sample, a sample of a biological fluid, a cell line, or any other suitable sample. The sample may comprise normal, neoplastic, malignant, or cancerous cells. The sample may comprise nucleic acids from normal, neoplastic, malignant, or cancerous cells. The sample may be a tumour sample or a sample of a tissue comprising neoplastic or cancerous cells. The sample may be blood or a blood fraction, such as a plasma fraction. The sample may be blood or a blood fraction, such as plasma, comprising circulating tumour DNA or suspected of comprising circulating tumour DNA. The sample may comprise circulating tumour DNA or be suspected of comprising circulating tumour DNA. The sample may be blood or a blood fraction, such as plasma, comprising circulating foetal DNA or suspected of comprising circulating foetal DNA. The sample may comprise circulating foetal DNA or be suspected of comprising circulating foetal DNA. The sample may have been subject to genetic modification or gene editing. For instance, the sample may have been subjected to editing techniques capable of inducing a DSB, for example CRISPR-Cas9, TALEN, or other nucleases. Thus, the sample may be treated to allow the detection of off-target mutations induced by an editing technique. Kits According to a further aspect of the invention there is provided a kit of parts comprising adapters suitable for performing methods of DSB-detection relevant to the present invention and adapters suitable for performing methods of sequencing relevant to the present invention. Thus, there is provided a kit comprising: i) an adapter comprising a sequence suitable for hybridising to an immobilised primer on a substrate for sequencing (e.g. the first adapter in the INDUCE-Seq workflow); ii) an adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing (e.g. the half-functional adapter in the INDUCE-Seq workflow); iii) a hairpin adapter (e.g. the hairpin adapter in the DEDUCE-Seq workflow); and iv) a non-hairpin adapter (e.g. the Y-adapter in the DEDUCE-Seq workflow). The adapter configured to be suitable for ligating to DSBs may be as described herein or in WO2022 / 038291 A1. The adapter configured to be suitable for ligating to DSBs may a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is complementary to said first oligonucleotide of this first pair; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature The adapter configured to be suitable for ligating to DSBs may be a first pair of oligonucleotides a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a first strand of said DSB, a hybridization site (RD1 SP) to which a first sequencing primer can bind and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide that is complementary to said first oligonucleotide of this first pair and comprises a 3’ binding feature for binding to a second strand of said DSBs; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The adapter configured to be suitable for ligating to DSBs may be a first pair of oligonucleotides, a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a strand of a double-stranded nucleic acid, and comprises a sequence according to TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31); and a second oligonucleotide that is complementary to said first oligonucleotide of the first pair; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The adapter configured to be suitable for ligating to DSBs may be a first pair of oligonucleotides, a first one of which comprises a 5’ binding feature that enables ligation of said oligonucleotide to a strand of a double-stranded nucleic acid, and comprises a sequence according to ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30); and a second oligonucleotide that is complementary to said first oligonucleotide of the first pair and optionally comprises a 3’ binding feature; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing may be as described herein as suitable for DSB-detection or in WO2022 / 038291 A1. The adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing may be a second pair of oligonucleotides a first one of which is in part complementary to a second oligonucleotide of the second pair; and a second oligonucleotide that comprises a 3’ binding feature for binding to a second strand of said DSBs, and a sequence for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing may be a second pair of oligonucleotides a first one of which comprises a 5’ binding feature, that enables ligation of said oligonucleotide to a first strand of said DSB, and a hybridization site (RD2 SP) to which a second sequencing primer can bind; and a second longer oligonucleotide that is in part complementary to said first oligonucleotide of this second pair and comprises a 3’ binding feature for binding to a second strand of said DSBs, a sequence complimentary to said hybridization site, and a further sequence which is a sequence for enabling bridge amplification; and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing may be a second pair of oligonucleotides, a first one of which does not comprise a sequence of more than 5, 10, 15, or 20 bases, or does not comprise all 24 bases, of the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30); and a second oligonucleotide that comprises a 3’ binding feature that enables ligation of said oligonucleotide to a strand of a double-stranded nucleic acid and comprises a sequence according to CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32); and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The first oligonucleotide may comprise a 5’ binding feature. The first oligonucleotide may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 30. The adapter that comprises a sequence that enables amplification but does not comprise a sequence that can hybridise to a substrate for sequencing may be a second pair of oligonucleotides, a first one of which does not comprise a sequence of more than 5, 10, or 15 bases, or does not comprise all 20 bases, of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31), and optionally comprises a 5’ binding feature; and a second oligonucleotide that comprises a 3’ binding feature that enables ligation of said oligonucleotide to a strand of a double-stranded nucleic acid and comprises a sequence according to AATGATACGGCGACCACCGA (SEQ ID NO: 34); and optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The first oligonucleotide may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 31. SEQ ID NOs: 30, 31, 32, and 34 may comprise from 1 to 12, 1 to 10, 1 to 8, 1 to 5, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. The second oligonucleotide of part i) may comprise a 3’ binding feature and the first oligonucleotide of part ii) may comprise a 5’ binding feature. The first oligonucleotides of the first and second pairs of oligonucleotides may include hybridization sites (RD1 SP) to which sequencing primers can bind. In some embodiments, the kit comprises primers allowing DSB-detection according to the Ion Torrent workflow. Thus, there is provided a kit comprising: i) an adapter suitable for the ion torrent workflow (e.g. the Ion Barcode adapter in Figure 14 of WO2022 / 038291 A1); ii) a half-functional adapter suitable for the ion torrent workflow (e.g. the half-functional adapter in Figure 14 of WO2022 / 038291 A1); iii) a hairpin adapter (e.g. the hairpin adapter in the DEDUCE-Seq workflow); and iv) a non-hairpin adapter (e.g. the Y-adapter in the DEDUCE-Seq workflow). Thus, the kit may comprise a double strand adapter comprising: a first oligonucleotide that comprises a sequence according to AACCCACTACGCCTCCGCTTTCC (SEQ ID NO: 40); and a second oligonucleotide of a sequence that does not comprise a sequence of more than 5, 10, 15, 20 bases, or does not comprise all 22 bases, of the sequence GGAAAGCGGAGGCGTAGTGGTT (SEQ ID NO: 36); optionally wherein either or both of said oligonucleotides comprise, respectively, a 3’ and / or 5’ protective feature. The second oligonucleotide may comprise less than 6, 5, 4, 3, 2 or 1 bases of SEQ ID NO: 36. The hairpin adapter may be as disclosed herein as suitable for use in duplex sequencing. The non-hairpin adapter may be any as disclosed herein as suitable for use in duplex sequencing. The non-hairpin adapter may comprise: a first strand comprising, in the 5’ to 3’ direction, a sequence that is at least partially complementary to a first immobilised primer, and optionally a 3’ protective feature; and a second strand comprising, in the 5’ to 3’ direction, optionally a 5’ protective feature, and a sequence that is identical to at least a region of a second primer. The non-hairpin adapter may comprise any sequence that is at least partially complementary to a first immobilised primer as disclosed herein. The non-hairpin adapter may comprise any sequence that is identical to at least a region of a second primer as disclosed herein. The sequence that is at least partially complementary to a first immobilised primer may be SEQ ID NO: 42 or SEQ ID NO: 30. The sequence that is identical to at least a region of a second immobilised primer may be SEQ ID NO: 32 or SEQ ID NO: 41. In an embodiment, the non-hairpin adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, or all 21 bases of SEQ ID NO: 42 and / or comprises at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 32. In an embodiment, the non-hairpin adapter comprises at least 5, 10, 15, 16, 1718, 19, 20, 21, 22, 23, or all 24 bases of SEQ ID NO: 30 and / or comprises at least 5, 10, 15, 16, 1718, 19, or all 20 bases of SEQ ID NO: 41. The non-hairpin adapter may comprise sufficient bases of any of SEQ ID NOs: 30, 32, 41, and 42 to allow hybridisation to a complementary primer. In a particular embodiment, the non-hairpin adapter is a Y-adapter comprising: A first strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 37, optionally an index, SEQ ID NO: 42, and 3SpC3; and a second strand comprising, in the 5’ to 3’ direction, a 5’ block, SEQ ID NO: 32, optionally an index, and SEQ ID NO: 33. SEQ ID NOs: 42, 32, 37, and 33 may each comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. In a particular embodiment, the non-hairpin adapter is a Y-adapter comprising: a first strand comprising, in the 5’ to 3’ direction, SEQ ID NO: 3, optionally an index, SEQ ID NO: 30, and 3SpC3; and a second strand comprising, in the 5’ to 3’ direction, a 5’ block, SEQ ID NO: 41, optionally an index, and SEQ ID NO: 39. SEQ ID NOs: 30, 41, 3, and 39 may each comprise from 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 modifications such as substitutions, deletions, or insertions. In an embodiment, the modifications are substitutions. The 5’ and 3’ protective features may be any as disclosed herein. In some embodiments a non-hairpin adapter is or comprises nucleic acid. In some embodiments, the non-hairpin adapter is or comprises DNA, RNA, and / or XNA. The non-hairpin adapter may comprise modified and / or un- modified nucleotides. In some embodiments, the non-hairpin adapter is double-stranded. In a particular embodiment, the non-hairpin adapter comprises double-stranded DNA. The non-hairpin adapter may be a Y- adapter. The non-hairpin adapter may comprise or may not comprise any index as disclosed for the first aspect of the present disclosure. In a particular embodiment, the non-hairpin adapter is a Y-adapter that comprises: a first strand comprising, in the 5’ to 3’ direction, a first hybridisation site to which a first sequencing primer can bind, a sequence that is at least partially complementary to a first immobilised primer, and a 3’ protective feature; and a second strand comprising, in the 5’ to 3’ direction, a 5’ protective feature, a sequence that is identical to at least a region of a second immobilised primer, and a second hybridisation site to which a second sequencing primer can bind. Optionally the first and second hybridisation sites are at least partially complementary. In an embodiment, there is provided a kit comprising: i) an adapter comprising a sequence suitable for hybridising to an immobilised primer in the Illumina P5 / P7 workflow; ii) an adapter that does not provide a sequence suitable for hybridising to an immobilised primer in the Illumina P5 / P7 workflow but does provide a sequence to enable bridge amplification in the Illumina P5 / P7 workflow; iii) a hairpin adapter; and iv) the Y-adapter suitable for use in the Illumina P5 / P7 workflow. The kit may further comprise at least one primer that binds to a hybridization site within an adapter for the purpose of sequencing. The kit may further comprise fragmenting agents for fragmenting the nucleic acids and / or the kit may further comprise denaturing agents for denaturing the nucleic acids.
[0002] Oligo modification (P5 or P7 adaptor) Activity Phosphorothioate linkages (5' and 3' ends of oligo)Resist 5'>3' and 3'>5' exonuclease activity.Phosphorothioate linkages (throughout oligo)Resist endonuclease activity.C3 Spacer phosphoramidite (3')Resist exonuclease, ligase, terminal transferase,5'>3' polymerase activity.Inhibit degradation by some 3’-exonucleases, can 3' Phosphate group be used to block extension by DNA polymerases, and resist ligation. DNA oligonucleotides that include this modification 2'-O-Methyl (2'oMe) are typically 5- to 10-fold less susceptible to dNases than unmodified DNA. Inverted dT at 3′ end of an oligonucleotide leads to Inverted dT (3') a 3'-3' linkage that will inhibit degradation by 3' exonucleases and extension by DNA polymerases. 5' Inverted ddT at the 5′ end of an oligonucleotide 5' Inverted ddT resists ligation and may provide resistance to some forms of exonuclease. Increases melting temperature of oligo and Locked nucleic acid bases prevents spurious hybridisation, increases binding specificity. Dideoxycytidine (ddC) (3')3' chain terminator that prevents 3' extension bypolymerases.Table 1
[0003] r r e e t D D t D D p D D p D D a D D a D D d D D d D D a A T a A T T A T A n C G n C G i C G i C G p G C p G C r G C r G C i G C i G C a - * a - * H P T H P T ' ' ' ' 3 5 3 5 T P T P * - * - C G C G T A T A A T A T d G C d G C n C G C G e C G n e C G T A T A ' T A ' T A 3 C G C G T A 3 T A t C G t C G a G C a G C C A T G l r A C G T G A l l e l T C e t C C G G A G e c p C T a C T c A G w d A C w G T o a T T A A l C G o l C G f Y C A T G C A f T G o f T C o G A t o T T A A T C t G A s n C C s G G e o T A T A C G e z i z C G i g A T A T C C i d e G G i r A A d T T ] i r C G ] b y 5 ] r b ] 5 y r i 7 7 i h a [ i y h i [ t C [ [ G 7 n A A T T C T 5 P e A G m A C P G T - e T T - A A l C C G G 1 p T G C A A T 2 m A T n o G A T C o C A T n o A T i G G C C s : C C i s G G r e C C G G e c A G r e C T V n C T A G C C V e G G : u A T A T s q G T : A C e C s r C G G G T r e s e A C t G G C C p d C C t p G G a e A T A T T T a d n d A A a i A G * T G / a l C C q r T 3 / A e e r A C q e k T s d e * p r s c T - n t A S e - o / E u p / 3 t E l 3 C a k / p C a B C U d d c ' p o U d D l a 5 S E o - l D a / 3 B Y B E - D / ' D Y ' ' ' ' ' ' ' ' ' C p C T T S C T C 3 G / C G A T G T C C A G C T G C A C T G T T G C C T C T C C A G C T G G T G A T T C C G T C T G C G T C d T T d G T n C A n A C e A T e G T C G G A ' A C ' T G 3 ] T 3 C A 5 C A T t i T t G G a [ A a T T C ] G G l A 7 l ] ] l C i l 7 5 e A [ e i i c T C c [ [ C A T T w T C w A G o A T o G T ) l G G l A G ' f A A f G A 3 G C C G - o C C o A A ' t C T t T A 5 A C A A T s C A s C G * l e C A e G G C l z A G z G G C a i G T i C A C ( d C C d A T G i G T i G G G s r G G r A T A r b C C b A G T e y A A y G C D t h T C h A T D p A A C G D a 7 G C 5 G C D d P T G P A G D a A A A A D - * G - * G D q A A C A D e 1 / A 2 / A A s k G k G T - n c G n c G n C E o o C o o C i C C i l T i l T p G U s B A s B A r G D r ' G r ' G i G E e 5 - e 5 - a - D V / P V / P H P ' ' ' ' 'Stem Full Sequence + potential derivatives7 bp 5' P-GGGCCTADDDDDDDDTAGGCCC*T 3'Loop STEM Loop STEM T-tail8 bpDDD 5' GGGCCTA D 3' T*CCCGGAT D DDD D = G, A or T (not C) * Phosphorothioate linkage Resistance to exonuclease activity / 3SpC3 / C3 Spacer phosphoramidite (covalent block) Resistance to exonuclease, ligase, and 5'>3' polymerase activity -P 5' Phosphate group Facillitate 5' ligation INDEX Illumina sequencing index sequence Enable demultiplexing of pooled sequencing libraries *T 3’ deoxythymidine triphosphate ‘T-tail' with phosphorothioate linkage Provide substrate for ligation to 'A-tailed' DNA fragments The sequences in the preceding tables are: Y-adapter version 1 (in order): SEQ ID NOs: 41, 39, 112, 3, and 30. Y-adapter version 2 (in order): SEQ ID NOs: 32, 33, 112, 37, and 42. Hairpin: SEQ ID NO: 112 Further information All of the features described herein (including any accompanying claims, abstract and drawings), and / or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and / or steps are mutually exclusive. For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made to the Examples, which are not intended to limit the invention in any way. Sequence Listing SEQ ID NO: 1 - gatcggaaga gcgtcgtgta gggaaagagt gtagatctcg gtggtcgccg tatcattc SEQ ID NO: 2 - aatgatacgg cgaccaccga gatctacact ctttccctac acgacgctct tccgatct SEQ ID NO: 3 - gatcggaaga gcacacgtct gaactccagt cac SEQ ID NO: 4 - caagcagaag acggcatacg agatnnnnnn gtgactggag ttcagacgtg tgctcttccg atct - n is a, c, g, or t SEQ ID NO: 5 - caagcagaag acggcatacg agatcgtgat gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 6 - caagcagaag acggcatacg agatacatcg gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 7- caagcagaag acggcatacg agatgcctaa gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 8 - caagcagaag acggcatacg agattggtca gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 9 - caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 10 - caagcagaag acggcatacg agatattggc gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 11 - caagcagaag acggcatacg agatgatctg gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 12 - caagcagaag acggcatacg agattcaagt gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 13 - caagcagaag acggcatacg agatctgatc gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 14 - caagcagaag acggcatacg agataagcta gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 15 - caagcagaag acggcatacg agatgtagcc gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 16 - caagcagaag acggcatacg agattacaag gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 17 - caagcagaag acggcatacg agattgttga ctgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 18 - caagcagaag acggcatacg agatacggaa ctgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 19 - caagcagaag acggcatacg agattctgac atgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 20 - caagcagaag acggcatacg agatcgggac gggtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 21 - caagcagaag acggcatacg agatgtgcgg acgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 22 - caagcagaag acggcatacg agatcgtttc acgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 23 - caagcagaag acggcatacg agataaggcc acgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 24 - caagcagaag acggcatacg agattccgaa acgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 25 - caagcagaag acggcatacg agattacgta cggtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 26 - caagcagaag acggcatacg agatatccac tcgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 27 - caagcagaag acggcatacg agatatatca gtgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 28 - caagcagaag acggcatacg agataaagga atgtgactgg agttcagacg tgtgctcttc cgatct SEQ ID NO: 29 - gagtccgagc agaagaagaa SEQ ID NO: 30 - atctcgtatg ccgtcttctg cttg SEQ ID NO: 31 - tcggtggtcg ccgtatcatt SEQ ID NO: 32 - caagcagaag acggcatacg agat SEQ ID NO: 33 - gtgactggag ttcagacgtg tgctcttccg atct SEQ ID NO: 34 - aatgatacgg cgaccaccga SEQ ID NO: 35 - tactcaagct taccccta SEQ ID NO: 36 - ggaaagcgga ggcgtagtgg tt SEQ ID NO: 37 - gatcggaaga gcgtcgtgta gggaaagagt gt SEQ ID NO: 38 - tcggtggtcg ccgtatcatt c SEQ ID NO: 39 - acactctttc cctacacgac gctcttccga tct SEQ ID NO: 40 - aacccactac gcctccgctt tcc SEQ ID NO: 41 - aatgatacgg cgaccaccga gatctacac SEQ ID NO: 42 - gtgtagatct cggtggtcgc cgtatcatt SEQ ID NO: 43 to SEQ ID NO: 111 (see electronic listing) SEQ ID NO: 112 - GGGCCTADDDDDDDDTAGGCCCT, where D is G, A or T (but not C). EXAMPLES Example 1 – DEDUCE-Seq DuplEx Determination by Unbiased flow Cell Enrichment and sequencing (DEDUCE-seq) uses a full-length Y-adapter to build in all the necessary DNA elements required for Illumina sequencing, while a second hairpin adapter will lock the oligo and link both strands thus retaining duplex information a linear molecule (Figure 1). As with the Duplex-seq method [Kennedy, S.R., et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014.9(11): p.2586-606], which retains duplex information using a tag-based system, DEDUCE-seq exploits the complementary nature of DNA to discriminate between genuine mutations and sequencing errors. However, DEDUCE-seq achieves this by physically linking both strands of the DNA duplex into a single sequencable DNA molecule. Moreover, general base-calling accuracy of current sequencers has increased by at least an order of magnitude in the last decade (to 1 in 103), improving the theoretical limit at which variants can be called. By using the redundant information from both DNA strands, only true mutations or variants will be called on both strands of the duplex, whereas technical errors can be eliminated as they will exist in only one of the two reads (Figure 1). This strategy has been shown to greatly enhance the accurate detection of ultra- rare mutations (down to 1x10-6) [Salk, J.J. and S.R. Kennedy, Next-Generation Genotoxicology: Using Modern Sequencing Technologies to Assess Somatic Mutagenesis and Cancer Risk. Environ Mol Mutagen, 2020.61(1): p. 135-151]. However, Duplex-seq relies on Unique Molecular Identifiers (UMI’s) and PCR amplification to achieve this [Kennedy, S.R., et al., Detecting ultralow-frequency mutations by Duplex Sequencing. Nat Protoc, 2014. 9(11): p.2586-606]. This method is therefore not PCR-free, greatly increasing the cost of sequencing, and limiting its application to targeted sequencing. DEDUCE-seq, however, is PCR-free by design and instead uses the Illumina flow cell for DNA enrichment and is designed to be able to cost-effectively detect rare mutations genome-wide. In the first instance, the inventors will use DEDUCE-seq to detect mutations from an isogenic yeast experiment previously conducted. In this project, a mutational survey was performed of multiple yeast strains that were treated with UV irradiation, after which cells were propagated for ~1,200 generations to accumulate mutations. The mutations acquired during these experiments were measured using traditional WGS and variant calling. This legacy data of the small-sized, yeast genome, therefore, allows DEDUCE-seq to be benchmarked for in vivo mutation detection. Next, DEDUCE-seq will be applied for the detection of mutations at novel off-target sites discovered by INDUCE-seq (WO2022 / 038291 A1). CRISPR genome editing projects are available for the detection of mutations in human cells. Using INDUCE-seq the inventors have discovered novel off-targets for very strict guide RNAs and very poorly targeting ones, allowing DEDUCE-seq to assay both ends of this spectrum to evaluate mutation induction at high- and low-frequency off-target break sites in human cells. Methods – Initial Design The inventors will make use of genomic DNA from a mutation survey performed in yeast (see above). To establish a library preparation, genomic DNA will be fragmented to a size of ~600-800bp. The first ligation uses a full-length Y-adapter to build in all the adapter components required for sequencing (Figure 1). Next, the DNA is purified to remove excess adapter DNA and subjected to a second round of fragmentation to ~200-300bp. DNA size selection, successful ligation and removal of adapter DNA will all be assessed using capillary DNA electrophoresis. For the second ligation the inventors will use a hairpin adapter to physically link the complementary strands of DNA and lock the duplex information into a single sequencable molecule (see Figure 1). Size-selection and purification of this library DNA will also remove excess hairpin adapter DNA. To validate the successful ligations, qPCR will be used to quantify the sequencable DNA fraction of the sample. This will reveal that the design of the adapters shown in Figure 1 results in functional, sequencable molecules. These pilot experiments will first be paired-end sequenced on a small scale. This will confirm the successful ligation strategy and reveal the general quality of the library. For this the inventors will initially sequence DNA from untreated cells (low mutation rate) and highly mutagenic cells (high mutation rate). The preliminary data from these experiments will be used to start the development of a data analysis pipeline that exploits duplex information. Next, the pilot DEDUCE-seq experiments will be scaled up to more samples and higher coverage (~100x) using a high-capacity sequencing platform (MiSeq v3 or NextSeq 550) to detect mutations in early- and late-generation yeast from (i) untreated wildtype cells, (ii) UV irradiated wildtype cells and (iii) cells with a known mutator phenotype. Finally, after these pilot experiments the inventors will apply DEDUCE-seq for the detection of mutations from a large cohort of yeast samples of the above-described mutagenesis project previously conducted. Data generated from this can now be used to assess the performance of DEDUCE-seq compared to original WGS performed at ~10- 25x coverage. Once established, the method will be used to detect genome-wide mutations from CRISPR-Cas9 edited genomic DNA with low- and high frequency off-targets as measured by INDUCE-seq. Methods – for Pilot 1 and Pilot 2 Genomic DNA input To generate DEDUCE-seq libraries, fragmented genomic yeast DNA was used as input. The genomic DNA samples were defrosted and run on an automated electrophoresis system (Agilent TapeStation 2100, High Sensitivity D1000 screentape) to assess size-distribution and quality. Next, the DNA was quantified using a Qubit-2 (ThermoFisher) using the high sensitivity kit (Qubit™ dsDNA HS Assay Kit) and normalised to 200-250ng per 50µL in nuclease free water (NFW). DEDUCE-seq Library Preparation Genomic DNA was prepared using a 1-sided size-selection. First, 0.6× (v / v) SPRI beads (CleanNGS, GCBiotech) removes fragments larger than 300bp, maintaining the DNA of interest from 100 to 500bp in solution. In the second purification step, SPRI beads were added to a final concentration of 1.8× (v / v) and DNA was eluted to a final volume of 25µL NFW. Next, the DNA was blunt ended and A-tailed using the NEBNext® Ultra™ II End Repair / dA-Tailing Module (E7546L, New England Biolabs) in an end volume of 30µL, ready for ligation using the NEBNext® Ultra™ II Ligation Module (E7595L, New England Biolabs). For the first ligation, Pilot-1 used 1.25µL 7.5µM full length Y-adapter (P5-P7), while Pilot-2 used 1.25µL 7.5µM of hairpin adapter. Total DNA was purified, and remaining adapter removed using 1.8× (v / v) SPRI beads, after which the DNA was eluted in 100µL NFW ready for sonication. The ligated DNA was subjected to resonication using a Bioruptor (Diagenode) for 60 cycles (30 seconds on / off, high output). To prepare for the second round of end-prep and ligation, the DNA was purified using 1.8× (v / v) SPRI beads and eluted in 25µL NFW to reduce the volume suitable for the NEBNext Ultra II modules. The resonicated DNA was blunt-ended and A-tailed using the NEBNext® Ultra™ II End Repair / dA-Tailing Module (E7546L, New England Biolabs) and ligated using the NEBNext® Ultra™ II Ligation Module (E7595L, New England Biolabs), as described above. In Pilot-11.25µL 7.5µM hairpin adapter was used, in Pilot-2, 1.25µL 7.5µM of full-length Y- adapter (P5-P7) was used in the second ligation. After the second and final ligation, DNA was purified using 1.8× (v / v) SPRI beads and eluted in 28µL NFW. The final libraries were quantified using qPCR and tested on an automated electrophoresis system (Agilent TapeStation 2100, high sensitivity D1000 screentape) to assess size- distribution and quality. Throughout the protocol, the size and quality of the library DNA was measured using electrophoresis to assess adapter removal, resonication and final library. DEDUCE-seq Library Quantification Final DEDUCE-seq library DNA was diluted 50-fold in dilution buffer (10 mM Tris-HCl, pH 8.0, 0.05% Tween- 20) and 4µL of diluted library DNA was subjected to qPCR in triplicate using a final PCR reaction volume of 20µL (KAPA Library Quantification Kit Illumina® Platforms). The library DNA was amplified using the cycling protocol as recommended by the supplier's guidelines and quantified using the supplied tools to obtain the undiluted library concentration (µM). Sequencing of DEDUCE-seq Libraries Final DNA libraries were pooled where relevant and the final volume reduced to 40µL using a SpeedVac. Before loading onto the sequencing flow cell, the DEDUCE-seq libraries are prepared according to the following modified denaturing protocol: the final library (40μL) is combined with 40μL of freshly diluted 0.2 N NaOH at room temperature for 5 minutes to denature the DNA. Next, 40μL of 200 mM Tris-HCl (pH 7) is used to neutralise the solution. The resulting denatured library (120μL) is complemented with 1179μL of prechilled HT1 and 1μL of denatured and diluted PhiX control (20pM). This mixture of 1.3mL is loaded onto the NextSeq cartridge for sequencing in its entirety. Sequencing Data Processing Sequencing runs were assessed using the Illumina’s online basespace utility or offline Sequence Analysis Viewer (SAV, Illumina). Reads pass filter, base-call quality (Q30) and cluster density are used as a first pass quality control. Demultiplexed data is then retrieved, ready for downstream analysis, described blow. Secondary Data Analysis Demultiplexed sequencing data was downloaded from basespace as FASTQ files. Using trim_galore (v0.6.7) reads were quality and adapter trimmed with standard parameters. FASTQC was used to quality check the trimmed and untrimmed data. To retrieve HP containing reads standard command-line tools GNU grep (3.7) and AWK (1.3.4) were used to interrogate the data. Seqkitfq2fa was first used to convert the FASTQ files to FASTA format, before locate was applied for calculating the exact position of hairpin sequence in Reads 1 and 2 using the following commands: seqkit fq2fa -j $threads $Read1 -o $Read1.fa.gz seqkit locate -j $threads -i -d -P -p AGGGCCTANNNNNNNNTAGGCCC $Read1.fa.gz > $Reads1_HP-locate.tsv Alignment of DEDUCE-seq data was performed using bowtie2 (2.5.1) using default parameters for exploratory analysis aligning concordant read pairs and for discordant DEDUCE-seq reads in the following ways: # default concordant alignment bowtie2 -p $threads -x $refseq -1 $mate1 -2 $mate2 # DEDUCE-seq discordant alignment bowtie2 -p $threads --ff --no-mix --dovetail -x $refseq -1 $mate1 -2 $mate2 Where relevant unmapped reads and secondary alignments were removed using samtools (1.6): samtools view -Shu -f 3 -F 256 -@ $threads $input Aligned data was converted to BAM files using samtools (1.6) and visualised using the Intergrated Genomics Viewer (2.14.1) (Robinson et al.2011). Example 2 – DEDUCE-Seq Pilot 1 and Pilot 2 The pilot studies described here were designed to establish the core elements of the DEDUCE-seq library and determine the most efficient ligation strategy. Therefore, we generated DEDUCE-seq libraries with the hairpin ligated first and the Y-adapter second (Pilot-1) and vice versa (Pilot-2). In these studies, genomic yeast DNA was used to generate DEDUCE-seq libraries. This DNA was previously used to measure mutations in a study designed to detect UV irradiation-induced mutations in isogenic yeast strains (Nandi et al. 2018) and provides a suitable source of genomic DNA of known origin with a known mutation burden. These samples are stored as fragmented DNA of ~200-300bp and normalised to 4-5 ng / µL. First, for Pilot-1 2 samples were processed in parallel and subjected to a right-sided size-selection to remove larger DNA fragments >300bp (data for one representative sample shown). The starting DNA ranges from 100 to 500bp (Figure 5, left panel). Pilot 1 - DEDUCE-seq Hairpin ligated first and the Y-adapter second - Library Construction Next, the DNA was blunted, A-tailed, and the hairpin adapter was ligated using the NEBNext Ultra II kits. The ligated DNA was purified and checked on TapeStation to confirm removal of the hairpin adapter DNA (Figure 5, middle panel, black trace). Resonicating the DNA results in a shift of the size distribution centred on ~200bp ranging from 75 to 500bp (Figure 5, middle panel, grey trace). The end-prep and ligation process were repeated for the second Y-adapter, resulting in a final purified library shown in Figure 5 (right panel, grey trace). The final ligation does not result in a major shift of the size distribution. Residual Y-adapter can be detected at 50bp, and high molecular weight fragments are detected after Y-adapter ligation around 900bp (Figure 5, right panel). Importantly, this is a known artifact of Y-adapter ligation shown previously as part of the Duplex-seq methodology manuscript using a stubby Y-adapter (Kennedy et al.2014). This large fraction can be safely ignored. The final library contains a mixture of molecules of which one fraction is made up of functional DEDUCE-seq HP-Y-adapter ligated fragments. Due to the presence of the full-length P5-P7 hybrid Y-adapter, DEDUCE-seq library molecules contain the constituent primer binding sites required for quantification. We therefore applied qPCR to quantify the sequencable molecules in the final library prep and measured 1.1 and 2.0nM library concentrations for samples 1 and 2, respectively. Importantly, the high molecular weight artifacts shown in Figure 5 (right panel) do not contribute to the qPCR readout. No molecules with an exceedingly high melting temperature can be detected in these samples (data not shown). The final libraries are predicted to contain between 190 and 355 million sequencable molecules per 1µL of undiluted library for sample 1 and 2, respectively, at these concentrations. Therefore, 1µL of the library from sample 2 was sequenced on a NextSeq 500 High output 2x150bp flow cell resulting in 240 million reads of which 96% passed filter with a Q30 score of 93%. Successful sequencing demonstrated that the HP-Y-adapter ligation strategy of Pilot-1 resulted in functional, sequencable molecules that can be quantified by qPCR and loaded onto a sequencer to generate clusters and reads proportional to the qPCR readout. Pilot 1 - DEDUCE-seq Hairpin ligated first and the Y-adapter second – Data Analysis The design of the DEDUCE-seq library is non-standard and is predicted to result in discordant read pairs in the Forward-Forward (F1F2) or Reverse-Reverse (R2R1) orientation that not all aligners accept as legitimate output. Similarly, dovetailed reads can result from this library depending on insert length and trimming and are not accepted by all aligners. Furthermore, we found from preliminary alignments experiments that most reads aligned as concordant pairs (F1R2 or R1F2) and surmised that these were derived from double Y-adapter ligated product, which was predicted as a minority DEDUCE-seq output (data not shown). Therefore, we first assessed the composition of the DEDUCE-seq sequencing reads by searching for hairpin containing reads in an unbiased way. Programmatically retrieving hairpin containing reads from read 1 and read 2 returned 33 and 44M reads (14- 18.4%) from a total of 237M reads, respectively (Table 2). Not every duplex molecule is expected to contain HP sequence in the reads if the genomic DNA insert size is larger than 150bp. Interestingly, basic positional information from this search revealed that most reads contain HP sequence at the start of the read, whereas around 7.5M reads contain HP sequence somewhere in the middle of the read. However, rarely do we find HP sequence at the extreme end of a read (Table 2). Table 2 Read 1 Read 2Reads with no Hairpin 204,467,929 193,705,101 Reads with Hairpin 33,297,970 44,060,798 @Read Start25,611,951 36,501,713@Read Middle7,648,190 7,523,125@Read End37,829 35,960Total237,765,899 237,765,899With this information we extracted all read pairs that contain the HP sequence in both R1 and R2 to elucidate the conformation of these molecules. Using this list of 9.5M read pairs we calculated the exact position of the hairpin sequence in each read and plotted the distribution of hairpin position as a function of read length (<151bp). We find that for this class of reads, about half contain hairpin DNA towards the start of the read, as shown in Table 2. In the remaining reads, the HP sequence is distributed evenly across the read length. Next, we collected the 9.5M read pairs (4%) containing HP sequence and aligned them to the reference genome using bowtie2. Bowtie2 can accommodate discordant read pairs enabling us to align about 200-800 reads and inspect them in a genome browser (Figure 7). This revealed the correct double parallel orientation (F1F2 and R1R2) for all of these reads as expected from the DEDUCE-seq library design. This confirmed that HP containing reads can be aligned using bowtie2 and are in the correct orientation, further revealing the associated SAM flags that define these read pairs (F1F2, SAM flag 67-133 and R2R1, SAM flag 115-179). With this information we aligned the entire dataset of 230M reads using the specific configuration of bowtie2 described above, and used the corresponding SAM flags to filter out the correctly aligned DEDUCE-seq reads. This resulted in ~120K reads with the expected DEDUCE-seq-specific orientation (Figure 7 and Table 3), indicating that the combination of a hairpin and Y-adapter ligation results in a functional library. The results of this alignment are summarised in Table 4. Table 3: DEDUCE-seq Library Discordant Read Pairs Left alignment Right alignment Left alignment Right alignmentFlags 67 131 115 179 Mapping Quality 40 40 42 42 CIGAR92M 133M 79M 79MMate is Mappedyes yes yes yesPositionFirst in Pair Second in Pair First in Pair Second in PairPair OrientationF1F2 F1F2 R2R1 R1R2 Table 4 Reads Flag Description 197,911,359 197,8520,805 77 paired | unmapped | mate unmapped |1st Read 2197,911,359 197,8520,805 141 paired | unmapped | mateunmapped |2nd properly paired with 181,108 38,869 67 paired | fwd | mapped in proper pair itself and mate |1st mapped 38,869 131 paired | fwd | mapped in proper pair |2nd 43,857 115 paired | rev | mapped in proper pair | 1st 43,857 179 paired | rev | mapped in proper pair |2nd3,555 65paired | fwd |1st3,555 129paired | fwd |2nd4,273 113paired | rev |1st4,273 177paired | rev |2ndForcing the alignment of DEDUCE-seq data through bowtie2 in this way results in >190M read pairs as unmapped, which would normally (based on the SAM flags) result in concordant pairs (data not shown). Conversely, the properly paired and mapped reads fall into the correct classes of discordant, parallel reads (F1F2 & R2R1) adding up to 180K (Table 2). Pilot-2 DEDUCE-seq ligating Y-adapter first, hairpin second: Library Construction Similar to Pilot-1, the DEDUCE-seq library for Pilot-2 was derived from the same genomic DNA. In this instance a total of 250ng of DNA from 4 independent samples was size selected to remove large fragments of DNA (>500bp) and prepared for ligation. In the first round the full-length Y-adapter was ligated onto the DNA. After purification and removal of unligated Y-adapter, the DNA was resonicated for 60 cycles and purified. The DNA was processed through another round of end-prep and ligation to attach the hairpin adapter after which the DNA was purified and quantified using qPCR. The final library concentration of these samples ranged between 2.8 to 8.3 pM. Thus, preparing a DEDUCE-seq library by ligating the Y-adapter first and hairpin adapter second, results in a yield of sequencable molecules that is about 3 orders of magnitude lower than the reverse order performed in Pilot-1. This demonstrates that the efficiency of ligation between Y- or hairpin adapter is distinct, and that the order of ligation affects the yield of the DEDUCE-seq library. The estimated sequencing reads from the samples prepared in Pilot-2 range from 11 to 35M. Therefore, we pooled the 4 samples together for a total of 73M predicted reads and sequenced the pool on a NextSeq 500 High output 2x150bp flow cell. This sequencing run resulted in 38 million reads of which 91% passed filter with a Q30 score of 91%. Importantly, the DEDUCE-seq library generated here, resulted in a lower sequencing output than expected from the qPCR quantification. The original design of a DEDUCE-seq library constructed in this way, facilitates the flow cell enrichment of correctly ligated Y-DNA-Hairpin products, while simultaneously locking unligated fragments into a double hairpin-ligated circle rendering these molecular inert. This would theoretically improve the selective enrichment of sequencable molecules on the flow cell. Pilot-2 DEDUCE-seq ligating Y-adapter first, hairpin second: Data analysis Based on the findings derived from Pilot-1, we used the same approach described above and collated the hairpin containing reads to calculate the position of hairpin sequence in each read. Table 5 Read 1 Read 2Reads with no Hairpin 38,737,660 38,750,812 Reads with Hairpin 474,893 422,286 @Read Start64 70@Read Middle466,201 414,949@Read End8,628 7,267Total38,856,384 38,856,384Taken together this returned between 420-470K reads from both R1 and R2 containing hairpin sequence from a total of 38M read pairs (1.1-1.2%). Combining pairs where both reads contain HP sequence leaves 200K read pairs (~0.5%) of which 23K align to the reference genome (~0.05%). The distribution of hairpin positions is shown in Figure 9. Ligating hairpin adapter second results in the majority of HP sequence to be positioned towards the 3’ or end of read 1 or read 2 as expected. Importantly, this alignment was performed in the presence of non-coding hairpin sequence within Reads 1 and 2 that does not exist in the yeast reference genome interfering with the aligner. Trimming the hairpin DNA from these reads improves the alignment (data not shown). Conclusion Taken together both orientations of Y- and HP-adapter ligation of DEDUCE-seq result in parallel, duplex molecules as per the DEDUCE-seq design. Ligating the Y-adapter first and hairpin second, as done in Pilot-2, may be the preferred option to fully exploit flow cell enrichment of properly formed Y-HP molecules from double hairpin molecules that are inert. However, this library strategy is less efficient compared to that applied in Pilot-1. In Pilot-1 the total yield of the library is higher (nM) compared to Pilot-2 (pM). Example 3 – Reciprocal analysis of INDUCE-Seq and DEDUCE-Seq data INDUCE-Seq data identifies the positions of DSBs within the genome, whereas DEDUCE-Seq provides unbiased genome-wide sequencing data identifying mutations with a high degree of accuracy. Reciprocal analysis of these data can reveal: cell-type specific variants, editing-associated mutations events that are not at the breaks, and sensitively detect mutations in line with INDUCE-Seq data.
Claims
CLAIMS 1. A method of analysis of a nucleic acid sample, the method comprising: (a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by analysis of information obtained by a method of sequencing applied to said nucleic acid sample; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated.
2. The method of claim 1, wherein the method of DSB-detection is a PCR-free method of DSB detection.
3. The method of claim 2, wherein the method of DSB-detection involves the preparation of a nucleic acid library wherein only DSB-associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate.
4. The method of claim 3, wherein the method of DSB-detection is INDUCE-Seq.
5. The method of any preceding claim, wherein the method of sequencing is a method of error-corrected sequencing.
6. The method of any preceding claim, wherein the method of sequencing is a method of duplex sequencing.
7. The method of any preceding claim, wherein the method of sequencing comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule.
8. The method of claim 7, wherein steps ii) and iv) of the method of sequencing are performed separately.
9. The method of claim 8, wherein the method of sequencing comprises the fragmentation of the plurality of nucleic acids after the first adapter ligation step and before, or as a part of, the second adapter ligation step.
10. The method of any preceding claim, wherein the method of DSB-detection comprises a PCR-free method of library preparation followed by direct binding of DSB-associated nucleic acids to a substrate without prior enrichment; and the method of sequencing comprises error-corrected duplex sequencing of a library comprising a hairpin adapter ligated to one end of nucleic acid fragments and a non-hairpin adapter ligated to the other end of the nucleic acid fragments.
11. The method of any preceding claim, wherein the method of DSB-detection comprises a PCR-free method of library preparation followed by direct binding of DSB-associated nucleic acids to a substrate without prior enrichment; and the method of sequencing is a method of error-corrected duplex sequencing and comprises:i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule.
12. The method of any preceding claim, wherein the method of DSB-detection involves a PCR-free preparation of a nucleic acid library, wherein only DSB- associated nucleic acid fragments are capable of binding by hybridisation to primers immobilised to a substrate, and wherein the nucleic acid library is contacted with said substrate; and the method of sequencing is a method of error-corrected duplex sequencing and comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule.
13. The method of any preceding claim, wherein the method of DSB-detection involves a PCR-free preparation of a nucleic acid library, wherein the method comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a first adapter under conditions conducive to ligation, wherein the first adapter comprises an oligonucleotide capable of being ligated to a 3’ terminus of a strand of a DSB and which comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a second adapter under conditions conducive to ligation, wherein the second adapter comprises an oligonucleotide capable of being ligated to a 5’ terminus of a strand at a break induced by fragmentation and comprising a sequence identical to a region of a second primer, and wherein the second adapter does not comprise a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; and the method of sequencing is a method of error-corrected duplex sequencing and comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule.
14. The method of any preceding claim, wherein the method of DSB-detection involves PCR-free preparation of a nucleic acid library, wherein the method comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a first adapter pair under conditions conducive to ligation, wherein the first adapter pair is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and whereinthe first adapter pair comprises first and second oligonucleotides that are at least partially complementary, and the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; iii) fragmenting the plurality of nucleic acids; and iv) exposing the plurality of nucleic acids to a second adapter pair under conditions conducive to ligation, wherein the second adapter pair is capable of being ligated to at least a 5’ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adapter pair, wherein the second adapter comprises first and second partially complementary oligonucleotides, wherein the first oligonucleotide is ligatable to a 5’ terminus and comprises a sequence identical to a region of the second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer; and the method of sequencing is a method of error-corrected duplex sequencing and comprises: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; and iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule.
15. The method of any preceding claim, wherein the method of DSB-detection is INDUCE-Seq; and the method of sequencing is DEDUCE-Seq:
16. The method of any one of claims 7 to 15, wherein the steps of the method of sequencing are: performed sequentially and in the order i), ii), iii), iv); or performed sequentially and in the order i), iv), iii), ii); or performed in the order step i), step ii), and combined steps iii) and iv); or performed in the order step i), step iv), and combined steps iii) and ii).
17. The method of any preceding claim, wherein the nucleic acid sample comprises DNA.
18. The method of any preceding claim, wherein the nucleic acid sample comprises genomic DNA (gDNA) 19. The method of any preceding claim, wherein the nucleic acid sample is obtained from a mammal; optionally a human.
20. The method of any one of claims 1 to 19, wherein the method is implemented on a computer.
21. A system for analysing nucleic acid information, the system comprising: a processor; and one or more computer-readable storage media having stored thereon instructions for execution on said processor to perform the method of any one of claims 1 to 20.
22. A computer program product comprising a non-transitory machine readable medium storing program code that, when executed by one or more processors of a computer system, causes the computer system to implement the method of any one of claims 1 to 20.
23. A method of analysis of a nucleic acid sample, the method comprising:(a) identifying of the location one or more double-strand breaks (DSBs) within the nucleic acid sample by analysis of information obtained by a method of DSB-detection applied to said nucleic acid sample, and identifying the location one or more mutations within the nucleic acid sample by performing the steps of a method of error-corrected duplex sequencing followed by analysis of the information obtained; (b) associating the mutation(s) with the DBS(s) if they have the same location in the nucleic acid sample; and (c) assigning the mutation(s) and the DSB(s) a higher degree of confidence if said mutation(s) or DSB(s) are associated.
24. The method of claim 23, wherein the steps of the method of error-corrected duplex sequencing are: i) providing the nucleic acid sample, which is a plurality of nucleic acids; ii) exposing the plurality of nucleic acids to a non-hairpin adapter under conditions conducive to ligation; iii) fragmenting the plurality of nucleic acids, wherein the fragmentation of the plurality of nucleic acids takes place after the first adapter ligation step and before, or as a part of, the second adapter ligation step; iv) exposing the plurality of nucleic acids to a hairpin adapter under conditions conducive to ligation, or exposing the plurality of nucleic acids to conditions capable of forming a hairpin at an end of a nucleic acid molecule; v) contacting the plurality of nucleic acids to a substrate comprising a first immobilised primer under conditions suitable for hybridisation of the first immobilised primer to complementary nucleic acids; wherein the non-hairpin adapter comprises a sequence that is at least partially complementary to the first immobilised primer; and vi) obtaining sequence information for any nucleic acids that hybridised to the substrate in step v); optionally wherein step ii) is performed before step iv) or step iv) is performed before step ii).
25. A kit comprising: i) a first adapter comprising a sequence suitable for hybridising to an immobilised primer on a substrate for sequencing; ii) a second adapter that comprises a sequence that enables amplification in combination with the first adapter, but wherein the second adapter does not comprise a sequence that can hybridise to a substrate for sequencing; iii) a hairpin adapter; and iv) a non-hairpin adapter that enables amplification and sequencing of ligated fragments.
Citation Information
Patent Citations
Systems and devices for sequence by synthesis analysis
US20100111768A1
Systems, methods, and apparatuses to image a sample for biological or chemical analysis
US8951781B2
Methods of lowering the error rate of massively parallel DNA sequencing using duplex consensus sequencing
WO2013142389A1
Multilayer fluidic devices and methods for their fabrication
WO2014142841A1
Methods and compositions for nucleic acid sequencing
WO2023247658A1