Composition for preventing, alleviating, or treating thrombus-related diseases or metabolic diseases, containing lycoramine as active ingredient

A composition containing ricoramine addresses the limitations of current treatments for thrombotic and metabolic diseases by inhibiting platelet aggregation, delaying carotid artery occlusion, and modulating fat metabolism, providing a safer and more effective solution for improving blood circulation and treating these diseases.

WO2025135930A1PCT designated stage expired Publication Date: 2025-06-26ERSTEQ CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
PCT/KR2024/020922
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-21
Filing Date
2024-12-23
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current treatments for thrombotic and metabolic diseases, such as those involving streptokinase and urokinase, have significant side effects, are expensive, and are limited to therapeutic use, while existing compositions for improving blood circulation or treating metabolic diseases lack efficacy in preventing or treating thrombosis-related diseases.

Method used

A composition containing ricoramine as an active ingredient, which inhibits platelet aggregation, delays carotid artery occlusion, inhibits neutral fat and cholesterol accumulation in hepatocytes, and modulates gene expression related to fat synthesis and oxidation, thereby improving blood circulation and treating metabolic and thrombotic diseases.

Benefits of technology

The ricoramine composition effectively inhibits platelet aggregation, delays carotid artery occlusion, reduces fat accumulation, and modulates gene expression to improve blood circulation and treat metabolic and thrombotic diseases, offering a safer and more effective alternative to existing treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2024020922_26062025_PF_FP_ABST
    Figure KR2024020922_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for preventing, alleviating, or treating thrombus-related diseases or metabolic diseases, containing lycoramine as an active ingredient. The lycoramine has: a platelet aggregation inhibitory effect; an effect of delaying time to carotid occlusion; an effect of inhibiting triglyceride accumulation and cholesterol accumulation in hepatocytes; an effect of reducing the expression level of lipogenesis-related genes or increasing the expression level of lipid oxidation-related genes; and effects of reducing lipid droplet content in preadipocytes, reducing the expression level of adipocyte differentiation-related genes and lipogenesis-related genes, and increasing the expression level of lipolysis genes. Therefore, the composition of the present invention containing lycoramine as an active ingredient can be useful as a therapeutic agent for thrombus-related diseases, a functional health food for improving blood circulation, a therapeutic agent for metabolic diseases, and a material for a functional health food for alleviating metabolic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for preventing, improving or treating thrombotic diseases or metabolic diseases containing ricoramine as an active ingredient

[0001] The present invention relates to a composition for preventing, improving or treating thrombosis-related diseases or metabolic diseases, containing ricoramine as an active ingredient.

[0002] The present invention is the result of the project "Discovery of functional food raw materials with improved blood circulation rate using natural product AI / big data" (Project ID: 1425177024, Project ID: 00225870) conducted as a "Industry-Academia-Research Collaborative R&D" project of the Small and Medium Business Administration (or affiliated with the Ministry of SMEs and Startups) under the Ministry of SMEs and Startups.

[0003] Improved blood circulation is primarily influenced by plasma and blood cells (red blood cells and platelets), which constitute blood. These maintain blood flow homeostasis and maintain normal hemostasis and protective functions at damaged or inflamed areas of blood vessels, thereby maintaining normal body functions. However, excessive activation of coagulation factors in plasma, promotion of platelet aggregation, and abnormalities in red blood cell deformability can disrupt blood flow homeostasis, leading to cardiovascular diseases such as arteriosclerosis and stroke, which are disorders of blood flow disorders.

[0004] In normal blood vessels, homeostasis is maintained by a balance between the activation and inhibition of hemostatic mechanisms. However, excessive hemostasis and clot formation can impede blood flow, leading to circulatory disorders and lesions such as thrombosis.

[0005] Thrombotic diseases, which account for approximately 39% of deaths worldwide, are on the rise in Korea due to factors such as a Westernized diet, excessive stress, and an aging population. The global market for antithrombotics and anticoagulants is projected to reach $24.4 billion in 2015, with sales expected to steadily increase through 2022. In particular, rising incidence, prevalence, and diagnoses in developing countries like China and India are expected to contribute to this growth.

[0006] Currently known thrombolytic enzyme agents in use include streptokinase, urokinase, and tissue plasminogen activator (t-PA), which primarily dissolve thrombi in an indirect manner by activating plasminogen in the body into plasmin.

[0007] Streptokinase and urokinase are exogenous enzymes that convert plasminogen to plasmin. They are not only associated with side effects such as fever, allergies, local bleeding, and hypotension, but are also extremely expensive. Therefore, their use is limited to therapeutic use and they are not currently used to prevent thrombosis. Therefore, active research is underway to develop safer agents that also exhibit superior blood flow-enhancing effects.

[0008] Meanwhile, recent economic development and changes in eating habits have led to a sharp increase in the incidence of metabolic diseases (metabolic syndromes), which include various conditions such as obesity, hyperlipidemia, hypertension, arteriosclerosis, and liver disease. While these conditions can occur independently, they are generally closely interrelated and often present with multiple symptoms.

[0009] Obesity is widely known to cause chronic diseases such as fatty liver, hypertension, diabetes, and cardiovascular disease. As of 2007, 1.7 billion people, or about 25% of the world's population, were overweight (BMI > 25), and 1 in 5 children were obese. The number of children with obesity is rapidly increasing, emerging as a serious social problem. Among the obesity treatments sold domestically and internationally, there is 'Xenical', which uses orlistat, which has been approved by the US FDA, as its main ingredient. However, Xenical, which inhibits lipase action, has gastrointestinal side effects such as steatorrhea, gas production, and reduced absorption of fat-soluble vitamins.

[0010] Dyslipidemia is a condition in which serum lipid levels are elevated or decreased compared to normal. While dyslipidemia can most often be caused by factors such as obesity, diabetes, and alcohol consumption, genetic factors can also contribute to increased levels of certain lipids in the blood. While terms like hyperlipidemia, hypercholesterolemia, and hypertriglyceridemia are often used interchangeably, dyslipidemia is a broad term encompassing all three.

[0011] Atherosclerosis is a condition in which fatty substances (plaque) containing cholesterol, phospholipids, and calcium accumulate in the inner lining of blood vessels, reducing the elasticity of the arteries and hardening them, and the narrowing of the arteries causes blood supply to be restricted or pressure to increase, leading to rupture or detachment.

[0012] Meanwhile, the liver is an organ that plays a central role in nutrient metabolism. If liver function is abnormal, it causes problems in the body's nutrient metabolism, such as converting glucose into glycogen, converting proteins into albumin, or breaking down unnecessary substances and delivering them to bile. Fatty liver disease is a disease in which fats, such as neutral fat, accumulate abnormally in hepatocytes, causing liver dysfunction. The initial stage is simple fatty liver disease, in which only fat is deposited in hepatocytes. It is known that the disease progresses to steatohepatitis, including liver fibrosis, and cirrhosis. Fatty liver is classified as alcoholic fatty liver disease and non-alcoholic fatty liver disease depending on the cause. Alcoholic fatty liver disease progresses from simple fatty liver disease in the early stage to steatohepatitis and cirrhosis, whereas non-alcoholic fatty liver disease was thought to remain simple fatty liver disease without progression. However, recent reports have shown that non-alcoholic fatty liver disease can also progress from simple fatty liver disease to steatohepatitis or cirrhosis.

[0013] Most patients with nonalcoholic fatty liver disease (NAFLD) also have underlying conditions such as insulin resistance, obesity, diabetes, and hyperlipidemia. Specifically, 69-100% of NAFLD patients are obese, and 20-40% of obese patients also have NAFLD. The prevalence of liver disease is higher in obese men than in obese women. Currently, there are two main types of treatments available for these patients: first, medications that treat and improve fatty liver disease by correcting risk factors, such as anti-obesity drugs, insulin resistance drugs, or anti-lipidemia drugs; and second, medications that function to restore damaged liver cells, such as hepatoprotectors, antioxidants, or nutritional support. However, there is currently no effective drug treatment for NAFLD, and only basic treatments such as weight loss through diet and exercise are recommended. In particular, non-alcoholic steatohepatitis has a high possibility of progressing to cirrhosis or hepatocellular carcinoma, so more active drug treatment is essential. Treatments aimed at improving oxidative stress and insulin resistance, which are thought to be important in the onset and progression of the pathology of non-alcoholic steatohepatitis, are being attempted. However, there is still no treatment with sufficient scientific evidence, so the development of highly effective treatments for non-alcoholic fatty liver disease is required. Therefore, due to the above-mentioned needs, there is a need for the production of products that can prevent, improve, or treat metabolic diseases more safely.

[0014] Meanwhile, as prior art related to the effect of improving blood circulation or metabolic diseases, Korean Patent No. 2183915 discloses a composition for improving blood circulation comprising a composite extract composed of Angelica gigas extract, Baeksu-o extract, and Ginkgo biloba leaf extract as an active ingredient, Korean Patent No. 1352591 discloses a composition for improving blood circulation containing a thistle extract, Korean Patent No. 1671248 discloses a composition for preventing or treating non-alcoholic fatty liver and metabolic diseases containing alpha mangosteen as an active ingredient, and Korean Patent No. 1523812 discloses a composition for preventing and treating metabolic diseases containing a yulcho extract as an active ingredient. However, there has been no disclosure regarding a composition for preventing, improving, or treating thrombosis-related diseases or metabolic diseases containing the licoramine of the present invention as an active ingredient.

[0015] The present invention was derived from the above needs, and provides a composition for preventing, improving or treating a thrombosis-related disease or metabolic disease containing lycoramine as an active ingredient, and has confirmed that the lycoramine has the effects of inhibiting platelet aggregation; delaying the time required for carotid artery occlusion; inhibiting the accumulation of neutral fat and cholesterol in hepatocytes; reducing the expression level of genes related to fat synthesis or increasing the expression level of genes related to fat oxidation; and reducing the content of fat droplets in preadipocytes, reducing the expression level of genes related to adipocyte differentiation and genes related to fat synthesis, and increasing the expression level of genes related to fat decomposition, thereby completing the present invention.

[0016] In order to solve the above problem, the present invention provides a pharmaceutical composition for preventing or treating a thrombotic disease or metabolic disease, containing ricoramine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0017] In addition, the present invention provides a health functional food composition for improving blood circulation or preventing or improving metabolic diseases, containing ricoramine or a food-related acceptable salt thereof as an active ingredient.

[0018] In addition, the present invention provides a feed additive for improving blood circulation or preventing or improving metabolic diseases, containing ricoramine or a food-related acceptable salt thereof as an active ingredient.

[0019] In addition, the present invention provides a veterinary composition for preventing or treating thrombotic diseases or metabolic diseases, containing ricoramine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0020] In addition, the present invention provides a platelet aggregation inhibitor containing ricoramine or an acceptable salt thereof as an active ingredient.

[0021] The present invention relates to a composition for preventing, improving or treating a thrombosis-related disease or metabolic disease, comprising lycoramine as an active ingredient, wherein lycoramine has the effects of inhibiting platelet aggregation; delaying the time required for carotid artery occlusion; inhibiting the accumulation of neutral fat and cholesterol in hepatocytes, reducing the expression level of genes related to fat synthesis or increasing the expression level of genes related to fat oxidation; and reducing the content of fat droplets in preadipocytes, reducing the expression level of genes related to adipocyte differentiation and genes related to fat synthesis, and increasing the expression level of genes related to fat decomposition. Therefore, the composition of the present invention comprising lycoramine as an active ingredient can be usefully used as a material for a treatment agent for thrombosis-related diseases, a health functional food for improving blood circulation, a treatment agent for metabolic diseases, and a health functional food for improving metabolic diseases.

[0022] Figure 1 shows the results of confirming the degree of platelet aggregation according to the lycolamine treatment of the present invention after inducing platelet aggregation by treating with collagen. *, **, *** indicate that the degree of platelet aggregation in the lycolamine treatment group was statistically significantly reduced compared to the untreated group (Vehicle) that was not treated with lycolamine. * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0023] Figure 2 shows the results confirming the effect of treating with licoramine in delaying carotid artery occlusion in an animal model of carotid artery thrombosis. (A) is the result of confirming laser Doppler flow in the carotid artery, and (B) shows the time until carotid artery occlusion according to treating with licoramine. ### indicates that the time until carotid artery occlusion was statistically significantly increased in the licoramine of the present invention or the positive control group, aspirin (ASA), compared to the untreated control group (Vehicle), p<0.001.

[0024] Figure 3 shows the results of confirming the cytotoxicity (A), neutral fat accumulation inhibitory effect (B), and cholesterol accumulation inhibitory effect (C) according to the lycolamine treatment of the present invention in Hepa1c1c cells. Intracellular lipid accumulation was induced by treatment with oleic acid and palmitic acid. ATV is a positive control group treated with atorvastatin. ### means that intracellular neutral fat and cholesterol accumulation was statistically significantly increased by oleic acid and palmitic acid treatment, and p<0.001. *, **, *** mean that intracellular neutral fat and cholesterol accumulation was statistically significantly decreased by lycolamine treatment, and * means p<0.05, ** means p<0.01, and *** means p<0.001.

[0025] Figure 4 shows the results of confirming the expression levels of FAS and SREBP1c genes, which are lipogenic factors, and PPARα and CPT1 genes, which are related to fat oxidation, according to the treatment with licoramine of the present invention in Hepa1c1c cells. ##, ### indicate that the gene expression levels of lipogenic factors (FAS and SREBP1c) in the lipid (0.5 μM oleic acid and 0.25 μM palmitic acid) treatment group (LL) were statistically significantly increased compared to the normal group, or the expression levels of genes related to fat oxidation (PPARα and CPT1) were statistically significantly decreased. ## is p<0.01, and ### is p<0.001. *, **, *** indicate that the gene expression level of the fat synthesis factor in the ricoramine treatment group of the present invention was statistically significantly decreased compared to the lipid treatment group (LL), or the expression level of the gene related to fat oxidation was statistically significantly increased. * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0026] Figure 5 shows the results of confirming the cytotoxicity of 3T3L1 cells according to the treatment with ricoramine of the present invention. ns means there is no statistically significant difference.

[0027] Figure 6 shows the results of Oil Red-O staining according to 3T3L1 cell differentiation and licoramine treatment. (A) is a photograph of Oil Red-O staining, and (B) is a quantitative graph of the results of Oil Red-O staining. ### indicates a statistically significant increase in the fat globule content of the control group in which adipocyte differentiation was induced compared to the normal group (Nor), and p<0.001. *, *** indicate a statistically significant decrease in the fat globule content of the licoramine-treated group of the present invention compared to the control group in which adipocyte differentiation was induced, and * indicates p<0.05, and *** indicates p<0.001.

[0028] Figure 7 shows the results of confirming the change in the expression level of adipocyte differentiation-related genes (PPARγ and C / EBPα), lipogenesis-related genes (FAS and ACC), and lipolysis genes (ATGL) according to treatment with licoramine. ### indicates that, compared to the normal group, the expression level of adipocyte differentiation-related genes and lipogenesis-related genes in the adipocyte differentiation-induced group increased, or the expression level of lipolysis genes decreased statistically significantly, and p<0.001. *, **, *** indicate that, compared to the adipocyte differentiation-induced group, the expression level of adipocyte differentiation-related genes and lipogenesis-related genes in the licoramine-treated group of the present invention decreased, or the expression level of lipolysis genes increased statistically significantly, and * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001.

[0029] In order to achieve the purpose of the present invention, the present invention relates to a pharmaceutical composition for preventing or treating a thrombotic disease or metabolic disease, containing ricoramine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0030] Licoramine has the following chemical formula 1.

[0031]

[0032] In one embodiment of the present invention, the composition has the characteristics of inhibiting platelet aggregation by collagen and improving blood circulation by reducing the content of neutral fat and cholesterol in the blood.

[0033] In one embodiment of the present invention, the composition has the characteristic of improving metabolic diseases by inhibiting fat accumulation and reducing blood triglyceride and cholesterol content.

[0034] The above thrombotic disease is at least one selected from the group consisting of arterial thrombosis, venous thrombosis, pulmonary embolism, chronic venous ischemia, varicose veins of the lower extremities, deep vein thrombosis, arteriosclerosis, dyslipidemia, cerebral hemorrhage, stroke, and cerebral infarction, but is not limited thereto.

[0035] The above metabolic disease is at least one selected from, but not limited to, dyslipidemia, obesity, hypertension, fatty liver disease, and arteriosclerosis.

[0036] The above fatty liver disease is non-alcoholic fatty liver disease, and non-alcoholic fatty liver disease includes, but is not limited to, simple fatty liver, nutritional fatty liver, starvation fatty liver, obesity-induced fatty liver, diabetic fatty liver, steatohepatitis, liver fibrosis, or cirrhosis.

[0037] The salts include common acid addition salts, for example, salts derived from inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, perchloric acid, and hydrobromic acid, and salts derived from organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, succinic acid, benzoic acid, citric acid, maleic acid, malonic acid, malic acid, tartaric acid, gluconic acid, lactic acid, gestic acid, fumaric acid, lactobionic acid, salicylic acid, phthalic acid, embonic acid, aspartic acid, glutamic acid, and acetylsalicylic acid. The salts also include salts derived from amino acids such as glycine, alanine, valine, isoleucine, serine, cysteine, cystine, aspartic acid, glutamine, lysine, arginine, tyrosine, and proline. Additionally, the salt includes salts of sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, and toluenesulfonic acid.

[0038] The composition of the present invention is preferably prepared in any one formulation selected from among capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols, but is not limited thereto.

[0039] The composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent in addition to the above-mentioned effective ingredient, and may be in various oral or parenteral dosage forms. When formulated, it is prepared using diluents or excipients such as commonly used fillers, bulking agents, binders, wetting agents, disintegrants, and surfactants. Solid preparations for oral administration include capsules, powders, granules, tablets, pills, etc., and these solid preparations are prepared by mixing one or more compounds with at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, emulsions, syrups, and aerosols. In addition to commonly used simple diluents such as water and liquid paraffin, they may contain various excipients such as wetting agents, sweeteners, fragrances, and preservatives. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilizers, and suppositories. Non-aqueous solvents and suspending agents can be propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases can include witepsol, macrogol, Tween 61, cacao butter, laurin butter, and glycerogelatin. For parenteral administration, it is preferable to select a method such as topical application to the skin or intraperitoneal, rectal, intravenous, intramuscular, subcutaneous, intrauterine, epidural, or intracerebrovascular injection.

[0040] The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment. The level of the effective amount may be determined based on factors including the type and severity of the patient's disease, the activity and sensitivity of the drug to the drug, the time of administration, the route of administration and excretion rate, the duration of treatment, concurrently used drugs, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to take all of the above factors into consideration and administer an amount that achieves the maximum effect with the minimum amount without causing side effects, and this can be easily determined by those skilled in the art.

[0041] The dosage of the composition of the present invention varies depending on the patient's weight, age, sex, health status, diet, administration time, administration method, excretion rate, and disease severity. The composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers.

[0042] In addition, the present invention relates to a health functional food composition for improving blood circulation or preventing or improving metabolic diseases, containing ricoramine or a food-related acceptable salt thereof as an active ingredient.

[0043] In one embodiment of the present invention, the composition has the characteristics of improving blood circulation by inhibiting excessive platelet aggregation and reducing blood triglyceride and cholesterol content.

[0044] In one embodiment of the present invention, the composition has the characteristic of improving metabolic diseases by inhibiting fat accumulation and reducing blood triglyceride and cholesterol content.

[0045] The above composition is preferably prepared in any one of the following dosage forms: powder, granules, pills, tablets, capsules, candies, syrups, and beverages, but is not limited thereto.

[0046] When the health functional food composition of the present invention is used as a food additive, the effective ingredient may be added as is or used together with other foods or food ingredients, and may be used appropriately according to a conventional method. The amount of the effective ingredient may be appropriately determined depending on the purpose of use (prevention, health, or therapeutic treatment). Generally, when manufacturing a food or beverage, the composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for the purpose of health and hygiene or health control, the amount may be below the above range, and since there is no problem in terms of safety, the effective ingredient may be used in an amount exceeding the above range. There is no particular limitation on the type of food. Examples of foods to which the effective ingredient may be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, and all health functional foods in the conventional sense are included.

[0047] When the composition of the present invention is used as a health beverage, it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in conventional beverages. The natural carbohydrates mentioned above are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. As a sweetener, a natural sweetener such as thaumatin or stevia extract, or a synthetic sweetener such as saccharin or aspartame can be used. The proportion of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g, per 100 g of the composition of the present invention. The composition of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition of the present invention may contain fruit pulp for the production of natural fruit juice, fruit juice drinks, and vegetable drinks. These components may be used independently or in mixtures. The proportion of these additives is not particularly important, but the composition of the present invention is typically selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight.

[0048] In addition, the present invention relates to a feed additive for improving blood circulation or preventing or improving metabolic diseases, containing ricoramine or a food-related acceptable salt thereof as an active ingredient.

[0049] The feed additive of the present invention corresponds to supplementary feed under the Feed Management Act. The term 'feed' in the present invention may mean any natural or artificial diet, meal, etc., or ingredients of the meal, which are suitable for or intended for animals to eat, ingest, and digest. The type of the feed is not particularly limited, and feed commonly used in the relevant technical field may be used. Non-limiting examples of the feed include plant feeds such as grains, roots, fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal, or grain by-products; and animal feeds such as proteins, inorganic substances, oils and fats, mineral substances, oils and fats, single-cell proteins, zooplankton, or food. These may be used alone or in combination of two or more.

[0050] In addition, the present invention relates to a veterinary composition for preventing or treating thrombotic diseases or metabolic diseases, containing ricoramine or a pharmaceutically acceptable salt thereof as an active ingredient.

[0051] The veterinary composition of the present invention may further comprise suitable excipients and diluents according to conventional methods. Excipients and diluents that may be included in the veterinary composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, ethanol, stearyl alcohol, liquid paraffin, sorbitan monostearate, polysorbate 60, methylparaben, propylparaben, and mineral oil.

[0052] The veterinary composition according to the present invention may further include fillers, anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, etc., and the veterinary composition according to the present invention may be formulated using methods well known in the art so as to provide rapid, sustained or delayed release of the active ingredient after administration to an animal, and the formulation may be in the form of powders, granules, tablets, capsules, suspensions, emulsions, solutions, syrups, aerosols, soft or hard gelatin capsules, suppositories, sterile injectable solutions, sterile topical preparations, etc.

[0053] The effective amount of the veterinary composition according to the present invention can be appropriately selected depending on the individual animal. This may be determined based on factors including the severity of the disease or condition, the individual's age, weight, health status, or sex, sensitivity to the active ingredient of the present invention, the route of administration, the duration of administration, other compositions combined with or used concurrently with the composition, and other factors well known in the fields of physiology and veterinary medicine.

[0054] Furthermore, the present invention relates to a platelet aggregation inhibitor comprising lycoramine or an acceptable salt thereof as an active ingredient. In one embodiment of the present invention, the active ingredient is characterized by having an effect of inhibiting platelet aggregation induced by collagen.

[0055]

[0056] Hereinafter, the present invention will be described in more detail using examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

[0057]

[0058] Example 1. Confirmation of platelet aggregation inhibition effect

[0059] Mouse platelets were treated with lycoramine (TRC, L487600, CAS No. 21133-52-8) at various concentrations at 37°C for 15 minutes, and then treated with collagen (3 μg / mL), a platelet aggregation factor, to activate platelets and induce platelet aggregation. The degree of platelet aggregation was then measured and analyzed using a 4-channel platelet lumi-aggregometer (Chronolog Corp, Havertown, PA).

[0060] As a result, as disclosed in Fig. 1, the ricoramine of the present invention inhibited platelet aggregation due to collagen treatment in a concentration-dependent manner.

[0061]

[0062] Example 2. Confirmation of antithrombotic effect in an animal model of carotid artery thrombosis.

[0063] After anesthetizing the mice with 2% isoflurane, licoramine (1 mg / kg, BW) was intravenously injected (IV) into the left jugular vein of the mice, and the right carotid artery was isolated. A filter paper (2 mm diameter) soaked with FeCl3 (10%) was placed over the carotid artery for 2 minutes to induce thrombosis. Thereafter, blood flow was measured using a blood flow meter (AD meter, blood flow meter). At this time, ASA (aspirin, 100 mg / ㎖) was administered orally.

[0064] As a result, as disclosed in Fig. 2, it was confirmed that the ricoramine of the present invention has an effect of effectively delaying carotid artery occlusion.

[0065]

[0066] Example 3. Confirmation of cytotoxicity, lipid accumulation inhibition effect, and changes in lipid metabolism-related gene expression levels following licoramine treatment in Hepa1c1c cells.

[0067] (1) Cytotoxicity evaluation

[0068] Hepa1c1c cells were seeded in 96-well cell culture plates at 5×104 After culturing for 24 h at a cell / well concentration, cells were treated with 2.5, 5, 10, and 20 μM lycolamine, respectively. After 24 h, a CCK-8 (cell counting kit-8, Dojindo Molecular Technologies Inc., Rockville, MD, USA) assay was performed. Cytotoxicity was then determined at 450 nm using a VersaMax microplate reader (Molecular Devices, Sunnyvale, CA, USA).

[0069] As a result, as disclosed in Fig. 3A, it was confirmed that the ricoramine of the present invention does not exhibit cytotoxicity in Hepa1c1c cells.

[0070]

[0071] (2) Induction of cellular lipid accumulation and measurement of lipid concentration

[0072] To induce intracellular lipid accumulation, oleic acid and palmitic acid were dissolved in ethanol to prepare stock solutions of 0.5 mM oleic acid and 0.25 mM palmitic acid, respectively, and then conjugated to bovine serum albumin (BSA). Afterwards, the culture medium was treated with lipids (0.5 μM oleic acid and 0.25 μM palmitic acid), followed by treatment with lycoramine at various concentrations, and after culturing for 24 h, the intracellular cholesterol and triglyceride contents were measured. 10 μM atorvastatin (ATV) was used as a positive control.

[0073] As a result, as disclosed in Figures 3B and 3C, it was confirmed that the ricoramine of the present invention has an excellent effect in suppressing the accumulation of neutral fat and cholesterol in liver cells.

[0074]

[0075] (3) Confirmation of changes in gene expression related to lipid metabolism

[0076] To confirm the regulation of gene expression related to lipid metabolism, real-time polymerase chain reaction (real-time PCR) was performed. Hepatocyte cells were treated with 250 μM concentrations of oleic acid and palmitic acid, respectively, conjugated to bovine serum albumin (BSA) to accumulate lipids. The cells were then treated with various concentrations of lycolamine and cultured for 24 h. After washing with PBS, RNA was extracted using the RNeasy mini kit (QIAGEN). 1 μg of the extracted RNA was quantified using a Nanodrop device, and cDNA was synthesized using the Maxima first strand cDNA synthesis kit for RT-qPCR (Thermo scientific, Waltham, USA), followed by PCR.

[0077] Primer sequences of genes related to lipogenesis and lipid oxidationGene nameDirectionSequence (5'-> 3')Sequence numberFasForwardACCTGGTAGACCACTGCATTG1ReverseCCTGATGAAACGACACATTCTCA2SREBP1cForwardGCAGATTTATTCAGCTTTGC3ReverseCCCTACCGGTCTTCTATCAA4PPARaForwardGAACAAAGACGGGATGCTGA5ForwardACAGAACGGCTTCCTCAGGT6CPT1ForwardGTGCAAGCAGCCCGTCTAG7ReverseTTGCGGCGATACATGATCAT8

[0078] As a result, it was confirmed that when treated with lycoramine, the expression levels of FAS and SREBP1c genes, which are fat synthesis factors, decreased compared to the untreated control group, and the expression levels of PPARα and CPT1 genes, which are related to fat oxidation, increased (Fig. 4).

[0079]

[0080] Example 4. Confirmation of the anti-obesity effect of licoramine in the 3T3-L1 cultured cell line.

[0081] [Cell line culture and differentiation]

[0082] 3T3-L1 preadipocytes were cultured in high-glucose DMEM containing 10% bovine calf serum (BCS) and 1% penicillin-streptomycin (PEST) at 37°C and 5% CO2. For differentiation, 1 × 10 5 Cells were seeded at a concentration of 10 cells / well, and after 4 days of 100% confluency, differentiation was induced by adding an adipogenic cocktail [3-isobutyl-1-methylxanthine (0.25 mM), insulin (1 μg / ml), dexamethasone (1 μM)] to high-glucose DMEM containing 10% FBS and 1% PEST. The same culture medium was exchanged every day for the first 3 days of differentiation, and for the middle 3 days of differentiation, the culture medium was exchanged with DMEM containing 10% FBS containing only insulin (5 μg / ml). Thereafter, for the last 3 days of differentiation, the culture medium was exchanged with DMEM containing 10% FBS and used for the experiment. At this time, lycoramine was treated at the same time as the start of differentiation induction at each concentration.

[0083]

[0084] (1) Confirm cell viability

[0085] 3T3-L1 cells were differentiated in 24-well plates, treated with various concentrations of lycorrhamine, and cultured for 48 hours. Afterwards, the absorbance was measured at 450 nm using CCK reagent.

[0086] As a result, as disclosed in Fig. 5, it was found that treating 3T3-L1 cells with lycorrhamine had little effect on cell viability.

[0087]

[0088] (2) Oil Red-O (ORO) dyeing

[0089] Differentiated 3T3-L1 cells were washed twice with PBS solution, and the PBS solution was completely removed. 10% formalin was added, fixed for 20 minutes at room temperature, and 60% isopropanol was treated and incubated for 5 minutes at room temperature to ensure good staining of the ORO reagent. After the plates were completely dried, ORO solution was added, and fat globules were stained for 30 minutes. After staining, the cells were washed several times with distilled water, and the effect of lycoramine on adipocyte differentiation was observed visually using a microscope. To quantify the stained fat globules, 100% isopropanol was added to the well-dried cells to elute the ORO staining reagent, and the absorbance was measured at a wavelength of 490 nm using a spectrophotometer (SpectraMax i3, Molecular devices, CA, USA).

[0090] As a result of performing ORO staining after treating lycolamine simultaneously with 3T3L1 cell differentiation, it was confirmed that the number of fat globules stained red was significantly reduced in the lycolamine-treated group (Fig. 6).

[0091]

[0092] (3) Gene expression measurement and analysis

[0093] To identify changes in gene expression levels related to adipogenesis and metabolism, real-time polymerase chain reaction (real-time PCR) was performed. RNA was extracted from differentiated 3T3-L1 cells using the RNeasy Mini Kit (QIAGEN). 1 μg of RNA was quantified and cDNA was synthesized using RT-qPCR (Thermo Scientific, Waltham, USA). Real-time PCR was then performed using the cDNA.

[0094] Primer sequences of genes related to fat differentiation and metabolismGene nameDirectionSequence (5'-> 3')Sequence numberPPARrForwardACCCTTGCATCCTTCACAAG9ReverseAAGAGCTGACCCAATGGTTG10C / EBPaForwardGCGCAAGAGCCGAGATAAAG11ReverseCGGTCATTGTCACTGGTCAACT12FASForwardACCTGGTAGACCACTGCATTG1ReverseCCTGATGAAACGACACATTCTCA2ACCForwardCGCTCAGGTCACCAAAAAGAATG13ReverseGGGTCCCGGCCACATAA14ATGLForwardCCTCAGGACAGCTCCACCAA15ReverseGATTGCGAAGGTTGAACTGGAT16GAPDHForwardGAAGGGTGGAGCCAAAAG17ReverseGCTGACAATCTTGAGTGAG18

[0095] As a result, treatment with lycoramine decreased the expression levels of PPARγ (peroxisome proliferator-activated receptor gamma) and C / EBPα (CCAAT / enhancer-binding protein α) genes related to adipocyte differentiation, and statistically significantly decreased the expression levels of FAS (fatty acid synthase) and ACC (acetyl-CoA carboxylase) genes, which are fat synthesis-related genes. In addition, it was confirmed that the expression level of ATGL (adipose triglyceride lipase), a fat decomposition gene, was statistically significantly increased (Fig. 7).

Claims

1. A pharmaceutical composition for preventing or treating thrombotic diseases or metabolic diseases, containing licoramine of the following chemical formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient. [Chemical Formula 1] 2. A pharmaceutical composition for preventing or treating a thrombosis-related disease or metabolic disease, characterized in that in paragraph 1, the thrombosis-related disease is any one selected from the group consisting of arterial thrombosis, venous thrombosis, pulmonary embolism, chronic venous ischemia, varicose veins of the lower extremities, deep vein thrombosis, arteriosclerosis, dyslipidemia, cerebral hemorrhage, stroke, and cerebral infarction.

3. A pharmaceutical composition for preventing or treating a thrombosis-related disease or metabolic disease, characterized in that in paragraph 1, the metabolic disease is any one selected from dyslipidemia, obesity, hypertension, fatty liver disease, and arteriosclerosis.

4. A pharmaceutical composition for preventing or treating a thrombotic disease or metabolic disease, characterized in that in accordance with paragraph 1, in addition to the effective ingredient, it further comprises a pharmaceutically acceptable carrier, excipient or diluent.

5. A pharmaceutical composition for preventing or treating a thrombotic disease or metabolic disease, characterized in that the composition in paragraph 1 is prepared in any one formulation selected from capsules, powders, granules, tablets, suspensions, emulsions, syrups, and aerosols.

6. A health functional food composition containing ricoramine or a food-scientifically acceptable salt thereof as an effective ingredient for improving blood circulation or preventing or improving metabolic diseases.

7. A health functional food composition for improving blood circulation or preventing or improving metabolic diseases, characterized in that the composition in the 6th paragraph is manufactured in any one formulation selected from powder, granules, pills, tablets, capsules, candy, syrup, and beverage.

8. A feed additive for improving blood circulation or preventing or improving metabolic diseases, containing licoramine or a food-based acceptable salt thereof as an effective ingredient.

9. A veterinary composition for the prevention or treatment of thrombotic diseases or metabolic diseases, containing licoramine or a pharmaceutically acceptable salt thereof as an active ingredient.

10. A platelet aggregation inhibitor containing licoramine or an acceptable salt thereof as an active ingredient.

Citation Information

Patent Citations

  • Combination drug therapy to treat obesity

    KR1020060109493A

  • Cholinergic enhancers with improved blood-brain barrier permeability for the treatment of diseases accompanied by cognitive impairment

    US20090253654A1

  • Methods of treatment of fatty liver disease by pharmacological activation of cholinergic pathways

    US20120322719A1