Mutant microorganism having improved ability to produce 1,4-butanediol and method for producing 1,4-butanediol using same

Abstract

The present invention relates to a mutant microorganism having an improved ability to produce 1,4-butanediol, and a method for producing 1,4-butanediol using same. The mutant microorganism can efficiently produce 1,4-butanediol without intracellular glutamic acid accumulation by expressing 4-aminobutyrate-pyruvate transaminase derived from Arabidopsis thaliana.

Description

Mutant microorganism with improved 1,4-butanediol production ability and method for producing 1,4-butanediol using the same

[0001] The present invention relates to a mutant microorganism having improved 1,4-butanediol production ability and a method for producing 1,4-butanediol using the same.

[0002] 1,4-Butanediol is used across the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. It is primarily produced by reacting acetylene and formaldehyde, followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide. However, the use of fossil fuels leads to global warming gases and waste generation, as well as problems such as disruptions in raw material supply and increased production costs due to volatile international oil prices.

[0003] To complement these chemical production processes, low-cost and environmentally friendly processes for biologically producing 1,4-butanediol using biomass as a raw material have recently been developed. Typically, 1,4-butanediol is produced through microbial metabolism via α-ketoglutarate or succinyl-CoA. However, microbial 1,4-butanediol production processes have limitations, including the production of unnecessary byproducts in addition to 1,4-butanediol during microbial metabolism and the relatively low production yield. Therefore, continuous efforts are being made to develop microorganisms capable of producing high-yield 1,4-butanediol using genetic engineering techniques to overcome these limitations.

[0004] [Prior Art Literature]

[0005] [Patent Document]

[0006] European Patent No. 3050970

[0007] European Patent No. 2782893

[0008] The purpose of the present invention is to provide a mutant microorganism having improved 1,4-butanediol production ability.

[0009] In addition, the present invention aims to provide a method for producing the mutant microorganism.

[0010] In addition, the present invention aims to provide a method for producing 1,4-butanediol using the mutant microorganism.

[0011] One aspect of the present invention provides a mutant microorganism having improved 1,4-butanediol production ability, which expresses 4-aminobutyrate-pyruvate transaminase derived from Arabidopsis thaliana.

[0012] In the 1,4-butanediol biosynthetic pathway from glutamic acid using microorganisms, the enzyme reaction converting glutamic acid into 4-aminobutyric acid (gadB gene), the enzyme reaction converting 4-aminobutyric acid into succinate semialdehyde (gabT gene), the enzyme reaction converting succinate semialdehyde into 4-hydroxybutyric acid (yqhD gene), and the enzyme reaction converting 4-hydroxybutyric acid into 1,4-butanediol (car gene) are performed step by step. The gamma-aminobutyrate aminotransferase involved in the process of converting 4-aminobutyric acid into succinate semialdehyde uses α-ketoglutarate as a substrate. Because it produces glutamic acid, it accumulates glutamic acid within cells and inhibits 1,4-butanediol production.

[0013] However, the 4-aminobutyrate-pyruvate transaminase according to the present invention is an enzyme that converts 4-aminobutyric acid into succinate semialdehyde while producing alanine using pyruvate as a co-substrate, and is used instead of gamma-aminobutyrate aminotransferase of the existing glutamate-1,4-butanediol pathway, thereby preventing the accumulation of intracellular glutamate and enabling continuous production of 1,4-butanediol. The 4-aminobutyrate-pyruvate transaminase may be a polypeptide encoded by the pop2 gene and having 4-aminobutyrate-pyruvate transaminase activity, but is not limited thereto.

[0014] According to one specific example of the present invention, the 4-aminobutyrate-pyruvate aminotransferase may be composed of an amino acid sequence of SEQ ID NO: 2.

[0015] The amino acid sequence of the 4-aminobutyrate-pyruvate aminotransferase according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with the amino acid sequence of SEQ ID NO: 2, and may have an original function. Here, “homology” or “identity” means the rate of identity (%) between a reference amino acid sequence and any other amino acid sequence when they are aligned and analyzed to correspond as much as possible.

[0016] In the present invention, the 1,4-butanediol production ability can be improved by expressing an exogenous 4-aminobutyrate-pyruvate aminotransferase derived from a different species of microorganism in a microorganism that does not originally have 4-aminobutyrate-pyruvate aminotransferase, or by expressing an exogenous 4-aminobutyrate-pyruvate aminotransferase having a higher activity than the endogenous 4-aminobutyrate-pyruvate aminotransferase inherent in the microorganism.

[0017] In addition, the present invention can enhance the activity or increase the expression level of an endogenous 4-aminobutyrate-pyruvate aminotransferase or an exogenous 4-aminobutyrate-pyruvate aminotransferase, specifically, it can include a case where the activity of the protein itself is increased compared to the activity of the original protein through nucleotide substitution, insertion, deletion or a combination thereof of a gene encoding 4-aminobutyrate-pyruvate aminotransferase, a case where the copy number of the gene encoding 4-aminobutyrate-pyruvate aminotransferase is increased, a case where the expression level of the gene is increased through modification of a regulatory factor that controls the expression of the gene encoding 4-aminobutyrate-pyruvate aminotransferase (e.g., promoter sequence mutation, replacement with a strong promoter), or a combination thereof.

[0018] As used herein, “improved 1,4-butanediol productivity” means increased productivity of 1,4-butanediol compared to a microorganism before mutation (parent strain). The parent strain refers to a wild type or mutant microorganism that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have 1,4-butanediol productivity or has 1,4-butanediol productivity, for example, a wild type Corynebacterium or a Corynebacterium genus mutant from the wild type.

[0019] According to one specific example of the present invention, the mutant microorganism may be of the genus Corynebacterium.

[0020] Specifically, the mutant microorganism belongs to the genus Corynebacterium, including Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be at least one selected from the group consisting of, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, and Corynebacterium flavescens.

[0021] According to one specific example of the present invention, the mutant microorganism may be Corynebacterium glutamicum.

[0022] The mutant microorganism having improved 1,4-butanediol production ability according to the present invention exhibits increased 1,4-butanediol production ability compared to the microorganism before mutation (parent strain), and in particular, the 1,4-butanediol production ability is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, The production may be increased by, but is not limited to, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times. For example, the mutant microorganism expressing the 4-aminobutyrate-pyruvate aminotransferase may have a 0.5-fold or greater increase in 1,4-butanediol production, specifically, 0.5 to 30 times (preferably 1 to 20 times) compared to the parent strain.

[0023] A composition comprising a mutant microorganism according to the present invention can be used as a composition for producing 1,4-butanediol.

[0024]

[0025] Another aspect of the present invention provides a method for producing the mutant microorganism, comprising the step of introducing a gene encoding 4-aminobutyrate-pyruvate aminotransferase derived from Arabidopsis thaliana.

[0026] The above step is a process of transforming a vector containing a polynucleotide of a gene encoding 4-aminobutyrate-pyruvate aminotransferase into a parent strain.

[0027] According to one specific example of the present invention, the gene encoding the 4-aminobutyrate-pyruvate aminotransferase may include the base sequence of SEQ ID NO: 1.

[0028] The term “vector” as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene, i.e., a gene encoding 4-aminobutyrate-pyruvate aminotransferase, to a microorganism (host cell) to be mutated. Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences that are operably linked to allow the gene insert to be expressed, and “operably linked” means that the target gene and its regulatory sequence are functionally linked to each other to enable gene expression, and a “regulatory sequence” includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates the termination of transcription and translation.

[0029] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0030] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0031] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0032] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0033] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0034] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of the genus Corynebacterium, strains of the genus Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas.

[0035] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0036] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0037] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0038] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0039] The transformant of the present invention may be other than a human.

[0040] Genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0041] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0042]

[0043] In addition, another aspect of the present invention provides a method for producing 1,4-butanediol, comprising the steps of culturing the mutant microorganism in a medium; and recovering 1,4-butanediol from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0044] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0045] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0046] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0047] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0048] According to one specific example of the present invention, the step of recovering 1,4-butanediol from the cultured mutant microorganism or the culture medium containing the same may be performed by collecting or recovering the 1,4-butanediol produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0049] According to one specific example of the present invention, the step of recovering the 1,4-butanediol may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0050] According to one specific example of the present invention, the step of recovering 1,4-butanediol may include a process of purifying 1,4-butanediol.

[0051] The mutant microorganism according to the present invention can efficiently produce 1,4-butanediol without intracellular glutamic acid accumulation by expressing 4-aminobutyrate-pyruvate transaminase derived from Arabidopsis thaliana.

[0052] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0053]

[0054] Example 1. Production of a mutant Corynebacterium glutamicum with an established 1,4-BDO production pathway.

[0055] 1-1. Construction of vectors for introducing gadB, gabT, yqhD, car, and sfp genes

[0056] A pathway for biosynthesizing 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032.

[0057] The gadB fragment was obtained by PCR using primers 1 and 2 with gadB synthesized from Lactobacillus senmaizukei as a template. The pop2 fragment was obtained by PCR using primers 3 and 4 with gDNA of Arabidopsis thaliana as a template. The yqhD fragment was obtained by PCR using primers 5 and 6 with gDNA of Escherichia coli as a template. The gene fragments obtained by infusion cloning were inserted into the PCR product of the pBL712-H30 vector amplified using primers 7 and 8 to construct the pBL712-H30-gadBpop2yqhD expression vector. pBL712-H30-gadBgabTyqhD, used as a control, was constructed in the same manner as pBL712-H30-gadBpop2yqhD, but gabT was amplified and inserted using gDNA of Escherichia coli as a template using primers 15 and 16 instead of primers 3 and 4.

[0058] To express the remaining genes, the car gene (derived from Mycobacterium abscessus) was first amplified using primers 9 and 10. The sfp gene (derived from Bacillus subtilis), which encodes phosphopantetheinyl transferase (PPTase) required to activate the enzymatic activity of carboxylic acid reductase encoded by the car gene, was amplified using primers 11 and 12. The Psod promoter (derived from Corynebacterium glutamicum) was amplified using primers 13 and 14. The yqhD gene (derived from Escherichia coli) was amplified using primers 15 and 16. The amplified gene fragments were integrated into the pA vector treated with restriction enzymes HindIII and XbaI by infusion cloning to construct the pA-Psod-CARsfpyqhD vector. At this time, pA vector digestion was prepared by mixing 1 μg of pA vector with 1 μl of HindIII, 1 μl of XbaI, and 5 μl of Cut Smart buffer to make a reaction solution with a total volume of 50 μl, and then reacting at 37°C for more than 1 hour.

[0059] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract chromosomal DNA from each fungus, and the primers in Table 1 below were used for PCR. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) in a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM of oligonucleotide, and 10 ng of template DNA.

[0060] For infusion cloning, 1 unit of In-Fusion® HD Cloning Kit (TakaRa, Japan) was used, with a total DNA amount of 200 ng and a molar ratio of 1:2 between vector and template, and the reaction was performed at 50°C for 15 minutes.

[0061] pBL712-H30-gadBpop2(At)yqhD, pA-Psod-CARsfpyqhD, and pBL712-H30-gadBgabTyqhD vectors were each transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), plated on LB-agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was exactly present in the vector. The vectors were isolated and used to produce Corynebacterium glutamicum strains introduced with the glutamate-1,4-butanediol pathway.

[0062] 서열번호유전자 및 염기서열 (5'-3')3Lactobacillus senmaizukei유래, gadB 유전자aatactacaacttcttacgctttggtttagctggttacaaggctatcatgaacaacgtacggaaggtttcattgaagttgactgacgaattacgtaagtttggtatctttgacatccttgttgatggtaaagaattaccaatcaactgctggaagttgtctgacaacgccaacgtaagttggagtttgtacgacatggaagatgctctggctaagtacggctggcaagtacctgcttacccacttccaaagaaccgtgaagaaactatcaccagccggattgttgttcgtcctggtatgactatggccattgccgacgacttcatcgatgacttgaagttagctattgctgacttgaaccacagcttcggtgacgttaaggatgttaacgacaagaacaagacgactgttcgttaa1Arabidopsis thaliana유래,pop2 유전자TGAGCCAAGAAGTGGCAGATGTGATAAACTCGCACAGCAGCAAGCTGGGCGTTTTCTCCCATGGATTTACTTATTCTGGTCATCCCGTTTCGTGTGCTGTCGCAATCGAAGCGCTGAAGATCTACAAAGAGAGGAACATCCCAGAGTATGTCGCCAAGGTTGCCCCAAGGTTTCAGGACGGCGTTAAAGCGTTCGCCTCTGGTAGTCCGATCATTGGCGAGACACGTGGAACCGGTTTAATTCTGGGCACCGAATTCGTAGATAACAAGTCTCCGAACGAACCGTTTCCTCCAGAATGGGGTGTGGGCGCTTTCTTTGGAGCCGAGTGCCAGAAGCACGGGATGTTAGTCCGTGTTGCTGGTGACGGCATTCTGATGTCCCCACCGCTCATCATCTCACCTGAGGAAATCGACGAGTTGATTTCGATCTACGGGAAAGCATTGAAGGCAACGGAAGAGAAGGTCAAAGAACTCAAGGCTCAGCACAAGAAGTAA4Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa5Escherichia coli유래, gabT 유전자aacacccggagatcggcgacgtacgcgggctgggggcgatgatcgccattgagctgtttgaagacggcgatcacaacaagccggacgccaaactcaccgccgagatcgtggctcgcgcccgcgataaaggcctgattcttctctcctgcggcccgtattacaacgtgctgcgcatccttgtaccgctcaccattgaagacgctcagatccgtcagggtctggagatcatcagccagtgttttgatgaggcgaagcagtaa6Mycobacterium abscessus유래,car 유전자TTCTATGAATTGGATGCCGACGGCAATCGGCAGCGCGCTCACTATGACGGTGTGCCCGGCGATTTCACCGCCGCATCGATCACCGCCATCGGCGGTGTGAACGTGGTAGACGGTTACCGCAGCTTCGACGTGTTCAACCCGCACCATGACGGTGTCTCGATGGATACCTTCGTCGACTGGCTGATCGACGCAGGCTACAAGATCGCGCGGATCGACGATTACGACCAGTGGCTCGCCCGGTTCGAGCTGGCCCTCAAGGGATTGCCCGAGCAGCAGCGGCAACAGTCGGTGTTGCCACTTCTCAAGATGTACGAGAAGCCGCAACCGGCGATCGACGGAAGTGCACTTCCGACCGCAGAATTCAGTCGCGCCGTGCACGAGGCGAAGGTCGGAGACAGCGGTGAGATACCGCACGTCACCAAGGAGCTGATCCTCAAGTACGCCAGCGATATTCAGCTGTTGGGCCTGGTGTAG7Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGACTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACGCAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGCCGCTGGGTCATTGGTGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGCCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGCTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCATCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATGGTCTCGTACGAAGAGCTTTTATAA8Corynebacterium glutamicum유래, Psod 프로모터accctacttagctgccaattattccgggcttgtgacccgctacccGataaataggtCggctgaaaaatttcgttgcaatatcaacaaaaaggcctatcattgggaggtgtcgcaccaagtacttttgcgaagcgccatctgacggattttcaaaagatgtatatgctcggtgcggaaacctacgaaaggattttttaccc,

[0063] Sequence number Primer name Primer sequence (5'-3') 9 Primer 1 GAGTATATTGgaattatgagtaaaaacgatcaggaaacgc 10 Primer 2 atgtatatctcctttaacgaacagtcgtcttg 11 Primer 3 aaaggagatatacatATGGTCGTTATCAACTCCCTCCG 12 Primer 4 atatgtatatctcctTTACTTCTTGTGCTGAGCCTTGAG 13 Primer 5 aggagatatacatatgAACAACTTTAATCTGCACAC 14 Primer 6 gcaggtcgactctagttaGCGGGCGGCTTCGTATATAC 15 Primer 7 ctagagtcgacctgcaggc 16 Primer 8 aattcCAATATACTCCTGCCCAACC 17 Primer 9AttttttacccATGACTGAAACGATCTCCACAGC18 Primer 10atgtatatctcctctacaccaggcccaacagc19 Primer 11aggagatatacatATGAAGATTTACGGAATTTATATGGACCGCC20 Primer 12CCAAAACAGCCAAGCtctagaTTATAAAAGCTCTTCGTACGAGACC21 Primer 13acttgatcagcttgcatgcctgcagaccctacttagctgccaattattcc22 Primer 14GTTTCAGTCATGGGTAAAAAATCCTTTCGTAGG23 Primer 15aggagatatacatatgAACAGCAATAAAGAGTTAATGCAGCG24 Primer 16atgtatatctcctctaCTGCTTCGCCTCATCAAAACACT

[0064]

[0065] 1-2. Creation of a mutant strain with a 1,4-BDO production pathway

[0066] Using an electroporator (BIO-RAD, USA), the pBL712-H30-gadBpop2(At)yqhD and pA-Psod-CARsfpyqhD vectors or the pBL712-H30-gadBgabTyqhD and pA-Psod-CARsfpyqhD vectors constructed in Example 1-1 were transformed into Corynebacterium glutamicum ATCC13032, and spread on a CM-agar plate (see Table 3 below) containing 30 μg / ml of kanamycin and 200 μg / ml of spectinomycin, followed by incubation at 30°C for 72 hours. The grown colonies were cultured for 24 hours at 30°C and 200 rpm in 5 ml of CM medium (excluding agar in the medium in Table 3 below) containing 30 μg / ml of kanamycin and 200 μg / ml of glycerin, and then mixed with 60% glycerol solution at a ratio of 3:2 to make stock.

[0067] CM-Agar Medium (1 L) Ingredients: Glucose 10 g, Polypeptone 10 g, Yeast extract 10 g, NaCl 2 g, Urea 2 g, Agar 20 g, pH: 6.68

[0068]

[0069] Example 2. Productivity evaluation of 1,4-butanediol producing strains

[0070] The 1,4-butanediol productivity of a strain expressing gamma-aminobutyrate aminotransferase (gabT gene) and a strain expressing 4-aminobutyrate-pyruvate aminotransferase (pop2 gene) was compared.

[0071] The strain stock produced in Example 1 was spread on Active-agar medium (see Table 4 below) in a size of 2 cm X 2 cm and cultured for 48 hours to prepare strain seeds. The seeds were inoculated into 20 ml of BDO medium (see Table 5 below) in a 250 ml flask, and 1,4-butanediol production was confirmed for 48 hours in a shaking incubator at 30°C and 200 rpm.

[0072] After completion of cultivation, the culture medium was filtered through a 0.45 μm filter and the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). 0.1 M phosphate buffer was used as the mobile phase, and the analysis was performed using an RI detector at 40°C and a flow rate of 0.8 mL / min for 15 minutes. The results are shown in Table 6 below.

[0073] Active-agar medium (1 L) Ingredients: Glucose 5 g, Urea 3 g, KH2PO4 1 g, Iotin 10 μg, Succinate (SS-50) 0.5 g, Yeast extract 10 g, HVP 1 ml, Agar 20 g, pH: 7.4

[0074] BDO medium (1 L) Ingredients (NH4)2SO4 10 g KH2PO4 2 g MgSO4 7H2O 1 g FeSO4 20 mg MnSO4 5H2O 20 mg Thiamine 20 mg CAPA (Vitamine B5) 20 mg Biotin 100 ug Yeast extract 5 g Succinate (SS-50) 7 g Glucose 50 g pH: 7.2

[0075] Number of replicates 1,4-butanediol (g / L) gabT expression 10.0 20.0 30.0 pop2 expression 10.8 21.0 30.9

[0076] As shown in Table 6 above, 1,4-butanediol was not produced in the mutant microorganism expressing gamma-aminobutyrate aminotransferase (gabT gene), but 1,4-butanediol was produced in the mutant microorganism expressing 4-aminobutyrate-pyruvate aminotransferase (pop2 gene).

[0077]

[0078] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A mutant microorganism with improved 1,4-butanediol production ability that expresses 4-aminobutyrate-pyruvate transaminase derived from Arabidopsis thaliana.

2. In claim 1, A mutant microorganism wherein the above 4-aminobutyrate-pyruvate aminotransferase is composed of an amino acid sequence of sequence number 2.

3. In claim 1, The above mutant microorganism is a mutant microorganism belonging to the genus Corynebacterium.

4. A method for producing a mutant microorganism of claim 1, comprising the step of introducing a gene encoding 4-aminobutyrate-pyruvate transaminase derived from Arabidopsis thaliana.

5. In claim 4, A method for producing a mutant microorganism, wherein the gene encoding the above 4-aminobutyrate-pyruvate aminotransferase comprises the base sequence of sequence number 1.

6. A step of culturing the mutant microorganism of claim 1 in a medium; and A method for producing 1,4-butanediol, comprising a step of recovering 1,4-butanediol from the mutant microorganism or a medium in which the mutant microorganism is cultured.