Mutant microorganism having improved ability to produce 1,4-butanediol and method for producing 1,4-butanediol using same
A mutant microorganism engineered to express a high-reactivity phosphopantetheinyl transferase from specific Mycobacterium species addresses the limitations of current 1,4-butanediol production methods by achieving enhanced yields and reduced byproduct formation, thus offering an efficient and eco-friendly production process.
Patent Information
- Application Number
- PCT/KR2024/097026
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-21
- Filing Date
- 2024-12-16
- Publication Date
- 2025-06-26
AI Technical Summary
Current methods for producing 1,4-butanediol face challenges such as low yield, generation of unnecessary byproducts, and increased production costs due to unstable raw material supplies and environmental concerns associated with fossil fuel use.
Development of a mutant microorganism expressing a phosphopantetheinyl transferase derived from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, or Mycobacterium conceptionense, which enhances the reactivity toward carboxylic acid reductase, thereby improving 1,4-butanediol production efficiency.
The mutant microorganism exhibits significantly increased 1,4-butanediol production, with yields up to several times higher than those of the parent strain, while minimizing byproduct formation and reducing environmental impact.
Abstract
Description
Mutant microorganism with improved 1,4-butanediol production ability and method for producing 1,4-butanediol using the same
[0001] The present invention relates to a mutant microorganism having improved 1,4-butanediol production ability and a method for producing 1,4-butanediol using the same.
[0002] 1,4-Butanediol is used across the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. It is primarily produced by reacting acetylene and formaldehyde, followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide. However, the use of fossil fuels leads to global warming gases and waste generation, as well as problems such as disruptions in raw material supply and increased production costs due to volatile international oil prices.
[0003] To complement these chemical production processes, low-cost and environmentally friendly processes for biologically producing 1,4-butanediol using biomass as a raw material have recently been developed. Typically, 1,4-butanediol is produced through microbial metabolism via α-ketoglutarate or succinyl-CoA. However, microbial 1,4-butanediol production processes have limitations, including the production of unnecessary byproducts in addition to 1,4-butanediol during microbial metabolism and the relatively low production yield. Therefore, continuous efforts are being made to develop microorganisms capable of producing high-yield 1,4-butanediol using genetic engineering techniques to overcome these limitations.
[0004] [Prior Art Literature]
[0005] [Patent Document]
[0006] European Patent No. 3050970
[0007] European Patent No. 2782893
[0008] The purpose of the present invention is to provide a mutant microorganism having improved 1,4-butanediol production ability.
[0009] In addition, the present invention aims to provide a method for producing the mutant microorganism.
[0010] In addition, the present invention aims to provide a method for producing 1,4-butanediol using the mutant microorganism.
[0011] One aspect of the present invention provides a mutant microorganism having improved 1,4-butanediol production ability, which expresses a phosphopantetheinyl transferase derived from at least one selected from the group consisting of Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense.
[0012] The previously known 1,4-butanediol production pathway in microorganisms is as follows: pyruvate produced from glucose in the glycolysis process is oxidized to acetyl-CoA, which is then synthesized into α-ketoglutarate and succinyl-CoA in the TCA cycle. Here, 4-hydroxybutyric acid is produced through a decarboxylation reaction of α-ketoglutarate or a reduction reaction of succinyl-CoA, and 1,4-butanediol is ultimately produced from 4-hydroxybutyric acid by carboxylic acid reductase (CAR).
[0013] The “phosphopantetheinyl transferase (PPTase)” used in the present invention is an enzyme that acts to activate carboxylic acid reductase. The reaction of phosphopantetheinyl transferase must be preceded so that the reactant can bind to carboxylic acid reductase and produce 1,4-butanediol through reduction of the carboxyl group of 4-hydroxybutyric acid. The phosphopantetheinyl transferase may be a polypeptide encoded by the pptase gene and having phosphopantetheinyl transferase activity, but is not limited thereto.
[0014] Although general phosphopantetheinyl transferases have low reactivity with carboxylate reductase, phosphopantetheinyl transferases derived from Bacillus subtilis and encoded by the sfp gene are known to have relatively good reactivity. Therefore, in the present invention, phosphopantetheinyl transferases were classified using bioinformatics, and a new phosphopantetheinyl transferase having higher activity against carboxylate reductase was discovered compared to phosphopantetheinyl transferases derived from Bacillus subtilis.
[0015] According to one specific example of the present invention, the phosphopantetheinyl transferase may be composed of one or more selected from the group consisting of amino acid sequences of SEQ ID NOs: 2, 4, and 6.
[0016] Specifically, the phosphopantetheinyl transferase may be composed of an amino acid sequence of SEQ ID NO: 2 when derived from Mycobacteroides abscessus subsp. Massiliense, may be composed of an amino acid sequence of SEQ ID NO: 4 when derived from Mycobacterium canariasense, and may be composed of an amino acid sequence of SEQ ID NO: 6 when derived from Mycobacterium conceptionense.
[0017] The amino acid sequence of the phosphopantetheinyl transferase according to the present invention may be composed of or essentially include a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with respect to each amino acid sequence of SEQ ID NOs: 2, 4 and 6, and may have an original function. Here, “homology” or “identity” means the rate of identity (%) between a reference amino acid sequence and any other amino acid sequence when they are aligned and analyzed to correspond as much as possible.
[0018] The phosphopantetheinyl transferases derived from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense and Mycobacterium conceptionense of the present invention have higher reactivity toward carboxylate transferase than conventionally known phosphopantetheinyl transferases (e.g., derived from Bacillus subtilis).
[0019] In the present invention, the 1,4-butanediol production ability can be improved by expressing an exogenous phosphopantetheinyl transferase derived from a different species of microorganism in a microorganism that does not originally have phosphopantetheinyl transferase, or by expressing an exogenous phosphopantetheinyl transferase having a higher reactivity toward carboxylic acid reductase than the endogenous phosphopantetheinyl transferase inherent in the microorganism.
[0020] In addition, the present invention can enhance the activity or increase the expression level of an endogenous phosphopantetheinyl transferase or an exogenous phosphopantetheinyl transferase, specifically, it can include a case where the activity of the protein itself is increased compared to the activity of the original protein through nucleotide substitution, insertion, deletion or a combination thereof of a gene encoding a phosphopantetheinyl transferase, a case where the copy number of the gene encoding a phosphopantetheinyl transferase is increased, a case where the expression level of the gene is increased through modification of a regulatory factor that controls the expression of the gene encoding a phosphopantetheinyl transferase (e.g., promoter sequence mutation, replacement with a strong promoter), or a combination thereof.
[0021] As used herein, “improved 1,4-butanediol productivity” means increased productivity of 1,4-butanediol compared to a microorganism before mutation (parent strain). The parent strain refers to a wild type or mutant microorganism that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have 1,4-butanediol productivity or has 1,4-butanediol productivity, for example, a wild type Corynebacterium or a Corynebacterium genus mutant from the wild type.
[0022] According to one specific example of the present invention, the mutant microorganism may be of the genus Corynebacterium.
[0023] Specifically, the mutant microorganism belongs to the genus Corynebacterium, including Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be at least one selected from the group consisting of, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, and Corynebacterium flavescens.
[0024] According to one specific example of the present invention, the mutant microorganism may be Corynebacterium glutamicum.
[0025] The mutant microorganism having improved 1,4-butanediol production ability according to the present invention exhibits increased 1,4-butanediol production ability compared to the microorganism before mutation (parent strain), and in particular, the 1,4-butanediol production ability is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, The amount may be increased by, but is not limited to, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times. For example, the mutant microorganism expressing the phosphopantetheinyl transferase may have an increased amount of 1,4-butanediol production of 0.5 times or more, specifically, 0.5 to 20 times (preferably 1 to 10 times) compared to the parent strain.
[0026] A composition comprising a mutant microorganism according to the present invention can be used as a composition for producing 1,4-butanediol.
[0027]
[0028] Another aspect of the present invention provides a method for producing the mutant microorganism, comprising the step of introducing a gene encoding a phosphopantetheinyl transferase derived from at least one selected from the group consisting of Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense.
[0029] The above step is a process of transforming a vector containing a polynucleotide of a gene encoding phosphopantetheinyl transferase into a parent strain.
[0030] According to one specific example of the present invention, the gene encoding the phosphopantetheinyl transferase may include at least one selected from the group consisting of base sequences of SEQ ID NOs: 1, 3, and 5.
[0031] Specifically, the gene encoding the phosphopantetheinyl transferase may include the base sequence of SEQ ID NO: 1 when derived from Mycobacteroides abscessus subsp. Massiliense, may include the base sequence of SEQ ID NO: 3 when derived from Mycobacterium canariasense, and may include the base sequence of SEQ ID NO: 5 when derived from Mycobacterium conceptionense.
[0032] The term “vector” as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene, i.e., a gene encoding phosphopantetheinyl transferase, to a microorganism to be mutated (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences operably linked to allow the gene insert to be expressed, and “operably linked” means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and a “regulatory sequence” includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates the termination of transcription and translation.
[0033] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.
[0034] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.
[0035] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.
[0036] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.
[0037] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.
[0038] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of Corynebacterium, strains of Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.
[0039] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.
[0040] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.
[0041] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.
[0042] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.
[0043] The transformant of the present invention may be other than a human.
[0044] Genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.
[0045] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.
[0046]
[0047] In addition, another aspect of the present invention provides a method for producing 1,4-butanediol, comprising the steps of culturing the mutant microorganism in a medium; and recovering 1,4-butanediol from the mutant microorganism or the medium in which the mutant microorganism is cultured.
[0048] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.
[0049] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.
[0050] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.
[0051] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.
[0052] According to one specific example of the present invention, the step of recovering 1,4-butanediol from the cultured mutant microorganism or the culture medium containing the same may be performed by collecting or recovering the 1,4-butanediol produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.
[0053] According to one specific example of the present invention, the step of recovering the 1,4-butanediol may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.
[0054] According to one specific example of the present invention, the step of recovering 1,4-butanediol may include a process of purifying 1,4-butanediol.
[0055] The mutant microorganism according to the present invention is derived from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense and Mycobacterium conceptionense and can efficiently produce 1,4-butanediol by expressing phosphopantetheinyl transferase having excellent reactivity with carboxylic acid reductase.
[0056] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.
[0057]
[0058] Example 1. Overexpression of phosphopantetheinyl transferase (PPTase) and evaluation of enzyme activity.
[0059] 1-1. Production of sfp or pptase gene overexpression vector
[0060] The chromosomal DNA of Bacillus subtilis strain 168, which contains the sfp gene encoding phosphopantetheinyl transferase, was amplified by PCR using primers 1 and 2 as a template. The resulting PCR product was inserted into the NdeI and XhoI sites of the pET30a vector (Merck Millipore, Novagen 69909). This vector was designated pET21b-BsPPTase.
[0061] The chromosomal DNA of Mycobacteroides abscessus subsp. Massiliense was used as a template and amplified by PCR using primers 3 and 4. The resulting PCR product was inserted into the NdeI and XhoI sites of the pET21b vector (Merck Millipore, Novagen 69741). This vector was designated pET21b-MaPPTase.
[0062] The chromosomal DNA of Mycobacterium canariasense was amplified by PCR using primers 5 and 6 as a template. The resulting PCR product was inserted into the NdeI and XhoI restriction enzyme sites of the pET21b vector. This vector was named pET21b-McaPPTase.
[0063] The chromosomal DNA of Mycobacterium conceptionense was used as a template and amplified by PCR using primers 7 and 8. The resulting PCR product was inserted into the NdeI and XhoI restriction enzyme sites of the pET21b vector. This vector was named pET21b-McoPPTase.
[0064] To overexpress carboxylate reductase (CAR), whose enzymatic activity is activated by phosphopantetheinyl transferase, the chromosomal DNA of Mycobacterium abscessus ATCC 19977, which contains the car gene encoding it, was amplified by PCR using primers 9 and 10 as a template. The obtained PCR product was inserted into the NdeI and HindIII restriction enzyme sites of the pET30a vector. This vector was designated pET30a-MabCAR.
[0065] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract chromosomal DNA from each fungus, and the base sequences of the amplified sfp / pptase gene and car gene are shown in Table 1 below, and the primers used for PCR are shown in Table 2 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) in which 1 pM of oligonucleotides and 10 ng of template DNA were added to a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP).
[0066] pET21b-BsPPTase, pET21a-MaPPTase, pET21a-McaPPTase, pET21a-McoPPTase, and pET30a-MabCAR vectors were constructed using PrimeSTAR MAX Polymerase (Takara, Japan) and NEBuilder HiFi DNA Assembly Master Mix (NEB, USA) and restriction enzymes NdeI (NEB, USA), HindIII (NEB, USA), and XhoI (NEB, USA). Each vector was transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), and plated on LB-agar plates containing 50 μg / mL kanamycin and 100 μg / mL ampicillin, respectively, and cultured at 37°C for 24 h. The resulting colonies were isolated to confirm that the insert was present in the vector, and the vector was isolated using the DokDo-Prep Plasmid Mini-Prep Kit (ELPIS-biotech, Korea).
[0067] 서열번호유전자 및 염기서열 (5'-3')1Mycobacteroides abscessussubsp.Massiliense유래, pptase 유전자TTGATCGCTTCGGTAGTTCCCGAGCTGTTGTCGTCGGCCGAGTTGTATGACGACCCACCCGGTCTGGAGCCGCTGCCCGAAGAGGAACCGTTGATCGCCAAGTCGGTGGCCAAGCGGCGCAACGAATTCATCACCGTGCGGTACTGCGCCCGGCAGGCGCTATCCGTGCTTGGCGTTCCAGAGGCGCCGATCCTCAAGGGAGACAAGGGGCAACCGCTGTGGCCCGATGGGATCGTGGGCAGCATGACGCATACCGAGGGCTTCCGGGGGGCCGTGGTGGGGCGGACGGGCGAGGTGCGTTCGGTGGGCATCGACGCCGAACCGCACGATGTGTTGCCCAATGGCGTGCTCAAGTCGATTGCCCTGCCCGTCGAGCGTGACGAGCTGGACGCGTTGCCTGCTGGCACCCACTGGGACAGATTGTTGTTCTGTGCCAAGGAAACCACGTACAAGGCATGGTTTCCGTTGACTGCCCGCTGGCTTGGTTTCGAGGACGCTCACATCACGATCGACCCGGATGGAACGTTTACTTCGCGAATCTTGGTTGACGGCAGGGCCAACGATGGCACCGTGTTATCGGCCTTTGACGGCCGATGGATCATCGACAAGGGTTTGATCTTGACCGCGATTGTGGTGCCGTGA3Mycobacterium canariasense유래,pptase 유전자GTGGCCCTGTTGCGTGCCCTGGTGCCCGAGGTCGTGGTGTCGGCCGAGACCTACGACGACCCGCCCGGTCTGGCGCCGCTGCCGGAGGAGGAACCGCTGGTGGCGCGTTCGGTGGCCAAGCGGCGCAACGAGTTCGTCACCGTTCGGTACTGCGCCCGGCAGGCGCTCGGTGAGCTGGGTGTGCCGCCGGCACCGATCCTCAAGGGCGACAAGGGCGAACCGTGCTGGCCCGACGGTGTCGTCGGCAGCCTGACGCACTGCGACGGTTTCCGCGGTGCGGTGGTGGGGCGCAGCTCCGATGTCCGCTCGCTGGGCATCGACGCCGAACCGCACGATGTGCTGCCCAAGGGGGTGCTCGACGCGATCAGCCTGCCCGCCGAACGGGCACACCTGTCCGGCCTGCCGGGTGGCCTGCACTGGGACCGAATCCTGTTCTGCGCCAAAGAGGCCACTTACAAGGCCTGGTTCCCGCTGACGCACCGGTGGCTCGGCTTCGAGGATGCCCACATCACGTTCACCCCCGACTCGTCAGGTGCGGCAGGGACGTTCGAGTCCCGGATCCTGATCGACCCGGCCGCCGAGTCCGGTCCGCCGCTGACCGCGCTGGCCGGGCGCTGGTCGGTGGCCGACGGAATCGCGCTGACGGCGATCACGCTGTGA5Mycobacterium conceptionense 유래,pptase 유전자ATGAACGACACGTTGCTGGGGCAGGTGCTGCCCGACCTGCCGGGCAAGCTGGCCGCGGCGGAGATGTACGACGACCCGCCGGGCTTGCCAACGCTGCCCGAGGAGGAAGCGCTCGTGGCTCGCGCGGTGGCCAAGCGGCGCAACGAGTTCACCACTGTGCGCTACTGCGCCCGCCAGGCGTTGAGTGAGCTGGGCGTGAGTCCGGTGCCGATTCTCAAGGGGGACAAGGGCGAACCGTGCTGGCCGGACGGGATCGTCGGCAGCCTGACGCACACCCAGGGGTTTCGCGGCGCGGTGGTGGGCCGGGCCGGCGGGGTGCGCTCGGTCGGCATCGACGCCGAACCGCACGACGTGCTGCCCGACGGGGTTCTGGGTGCCATCTCGCTACCGTTGGAGCGCTCCGAAATCGGCGCTTTGCCCGACGGCCTGCATTGGGATCGAATCCTGTTCTGCGCCAAGGAGGCCACCTACAAGGTCTGGTATCCGCTGACGCACCGCTGGCTCGGGTTCGAGGATGCCCACATCACCTTCGGGGTGGATGCGTCCGGTGCCGCCGGAACCTTCCGGTCCCAGATCCTCATCGACCCCGCCGCCGAACACGGCCCACCGTTGACCGCGCTGGACGGCCGCTGGTCGGTCCGTGACGGTGTGACGCTGACGGCGATCGTGCTGTGA7Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGTCTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACACAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGCCGCTGGGTCATTGGTGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGTCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGTTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCATCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATAGTCTCGTACGAAGAGCTTTTATAA9Mycobacterium abscessus유래,car genettctatgaattggatgccgacggcaatcggcagcgcgctcactatgacggtgtgcccggcgatttcaccgccgcatcgatcaccgccatcggcggtgtgaacgtggtagacggtta ccgcagcttcgacgtgttcaacccgcaccatgacggtgtctcgatggataccttcgtcgactggctgatcgacgcaggctacaagatcgcgcggatcgacgattacgaccagtggctcgc ccggttcgagctggccctcaagggattgcccgagcagcagcggcaacagtcggtgttgccacttctcaagatgtacgagaagccgcaaccggcgatcgacggaagtgcacttccgaccg cagaattcagtcgcgccgtgcacgaggcgaaggtcggagacagcggtgagataccgcacgtcaccaagggagctgatcctcaagtacgccagcgatattcagctgttgggcctggtgtag,
[0068] Sequence number Primer name Primer sequence (5'-3') 10 Primer 1 CGCGCATATGAAGATTTACGGAATTTATATGGAC 11 Primer 2 TATACTCGAGTTATAAAAGCTCTTCGTACGAGAC 12 Primer 3 GCGCCATATGTTGATCGCTTCGGTAGTTCCCGAG 13 Primer 4 GCGCCTCGAGTCACGGCACCACAATCGC 14 Primer 5 GCGCCATATGGTGGCCCTGTTGCGTGCCC 15 Primer 6 GCGCCTCGAGTCACAGCGTGATCGCCGTCAGC 16 Primer 7 GCGCCATATGAACGACACGTTGCTGGGGCAGG 17 Primer 8 GCGCCTCGAGTCACAGCACGATCGCCGTCAGC 18 Primer 9 GCGCCATATGACTGAAACGATCTCCACAGC 19 Primer 10ATATAAGCTTCACCAGGCCCAACAGCTGA
[0069]
[0070] 1-2. Overexpression of PPTase and evaluation of enzyme activity
[0071] pET30a-MabCAR vector and pET21b-BsPPTase vector, pET30a-MabCAR vector and pET21b-MaPPTase vector, pET30a-MabCAR vector and pET21b-McaPPTase vector, and pET30a-MabCAR vector and pET21b-McoPPTase vector were each transformed into E. coliBL21(DE3) (HIT Competent cells™, Cat No. RH217), spread on LB-agar plates containing 50 μg / mL kanamycin and 100 μg / mL ampicillin, and cultured at 37°C for 24 hours. Each finally formed strain was inoculated into 10 ml of LB medium for seed culture and primary cultured at 37°C for 18 hours. Afterwards, 10 ml of the seed culture was inoculated into 1 L of LB medium for main culture. The main culture was incubated at 37°C and 120 rpm for 2 to 2.5 hours to obtain an OD 60 When the 0 value was 0.5 to 0.6, 0.5 mM IPTG was added, and the culture was cultured at 18°C and 120 rpm for 18 hours. The culture was centrifuged at 4°C and 4000 rpm for 10 minutes, the supernatant was discarded, and the precipitated strain was suspended in 30 ml of 40 mM Tris-HCl buffer solution. The suspension was centrifuged at 4°C and 13500 rpm for 30 minutes after disrupting the cells using an ultrasonic disruptor. The supernatant was subjected to protein separation and purification through affinity chromatography, and overexpression was confirmed by SDS-PAGE.
[0072] Phosphopantetheinyl transferase (BsPPTase) from Bacillus subtilis strain 168 was used as a control for phosphopantetheinyl transferases (MaPPTase, McaPPTase, and McoPPTase) from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense, and the activities of PPTases were compared by measuring the activity of CAR, whose enzyme activity is activated by PPTase. The enzyme activity was analyzed using a UV / Vis spectrophotometer (Shimadzu, UV-1800), and the activity of CAR was measured by measuring the amount of NADPH decrease when the reaction occurred using succinic acid as a substrate. The reaction solution volume was 500 μl, and the composition of the reaction solution was 100 mM phosphate buffer (phosphate, pH 7.0), 10 mM magnesium chloride (MgCl2), 2.5 mM ATP, 0.2 mM NADPH, 200 mM succinic acid, to which 1 μM of CAR was added. The enzyme reaction was carried out at room temperature (25°C), and the absorbance was measured at a wavelength of 340 nm. The results are shown in Table 3 below.
[0073] Enzyme Enzyme activity (uM / min) MabCAR+BsPPTase56.6MabCAR+MaPPTase123.4MabCAR+McaPPTase96.0MabCAR+McoPPTase104.6
[0074] As shown in Table 3 above, the activities of carboxylic acid reductases (MaPPTase, McaPPTase, and McoPPTase) derived from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense were increased by approximately 2.2-fold, 1.7-fold, and 1.8-fold, respectively, compared to the activity of phosphopantetheinyl transferase (BsPPTase) derived from Bacillus subtilis.
[0075]
[0076] Example 2. Production of a mutant Corynebacterium glutamicum with an established 1,4-BDO production pathway.
[0077] 2-1. Construction of vectors for introducing gadB, gabT, yqhD, car, and sfp genes
[0078] A pathway for biosynthesizing 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032. The glutamic acid-1,4-butanediol pathway is comprised of the following steps: an enzymatic reaction that converts glutamic acid to 4-aminobutyric acid (gadB gene), an enzymatic reaction that converts 4-aminobutyric acid to succinate semialdehyde (gabT gene), an enzymatic reaction that converts succinate semialdehyde to 4-hydroxybutyric acid (yqhD gene), and an enzymatic reaction that converts 4-hydroxybutyric acid to 1,4-butanediol (car / yqhD genes).
[0079] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 1 and 2, 3 and 4, 7 and 8, 41 and 42, 43 and 44, and 45 and 8, respectively, as a template. pCES208H36EcGADmut (ACS Omega. 2022 Aug 23; 7(33): 29106-29115.) DNA containing the gadB gene was amplified by PCR using primers 5 and 6 as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-gadB(E89Q,△452-466)gabT.
[0080] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 9 and 10, 11 and 12, and 15 and 16, respectively, as a template. The chromosomal DNA of Escherichia coli K-12 MG1655 containing the yqhD gene (derived from Escherichia coli) was amplified by PCR using primers 13 and 14, as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-yqhD.
[0081] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 17 and 18, 19 and 20, and 23 and 24, respectively. The Escherichia coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184) containing the car gene (derived from Mycobacterium abscessus) was used as a template and amplified by PCR using primers 21 and 22. The obtained PCR products were amplified by crossover PCR and inserted into the restriction enzymes HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-car.
[0082] To insert the sfp gene required for activating the enzymatic activity of the car gene, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 25 and 26, 27 and 28, and 31 and 32 as a template, respectively. The Escherichia coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184) containing the sfp gene (derived from Bacillus subtilis) was amplified by PCR using primers 29 and 30 as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the restriction enzymes HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-sfp.
[0083] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract chromosomal DNA from each fungus. The base sequences of the amplified gadB, gabT, yqhD, car, and sfp genes are shown in Table 4 below, and the primers used for PCR are shown in Table 5 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan). 1 pM of oligonucleotides and 10 ng of template DNA were added to a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), and 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) was added.
[0084] pk19mobsacB-gadB(E89Q,△452-466)gabT, pk19mobsacB-yqhD, pk19mobsacB-car and pk19mobsacB-sfp vectors constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB, USA) and restriction enzymes HindIII (NEB, USA) and XbaI (NEB, USA) were transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), plated on LB-agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was correctly present in the vector. The vector was then isolated and used to produce a mutant strain of Corynebacterium glutamicum with the glutamate-1,4-butanediol pathway introduced.
[0085] 서열번호유전자 및 염기서열 (5'-3')20Escherichia coli유래, gadB 유전자AAGTACAGAACGCCTCTTACCAGGTTGCCGCTTATCTGGCGGATGAAATCGCCAAACTGGGGCCGTATGAGTTCATCTGTACGGGTCGCCCGGACGAAGGCATCCCGGCGGTTTGCTTCAAACTGAAAGATGGTGAAGATCCGGGATACACCCTGTATGACCTCTCTGAACGTCTGCGTCTGCGCGGCTGGCAGGTTCCGGCCTTCACTCTCGGCGGTGAAGCCACCGACATCGTGGTGATGCGCATTATGTGTCGTCGCGGCTTCGAAATGGACTTTGCTGAACTGTTGCTGGAAGACTACAAAGCCTCCCTGAAATATCTCAGCGATCACTGA21Corynebacterium glutamicum유래, gabT 유전자AGACCCGCGCGCAAGAAATCGAGACCATCATCCGCGATGAATTCGCGCAGCTGAGTGCCTTCCCGGAGGTCGCCGAAATCCGCGGCCGCGGAGCAATGATGGCCATTGAGCTTATCGACGCTACCGGCCGCCCGAACGCAGCTTTAACCGCCGCAGTGGCTGCGCGCGCAAAAGCTGAAGGTGTGCTGCTGCTGACTTGCGGCACCGATGGCAACGTCATCCGCCTGCTGCCACCACTGGTCATTGCAGAGGACACTCTCCGTGATGGTCTTCAGGTGTTAGTCGCAGCCCTAGAGCGCGAAACCGCGCACCAGAAGGTGGGCTAA22Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa
[0086] Sequence number Primer name Primer sequence (5'-3') 23 Primer 1 aacagctatgaccatgattacgccaCAAGGATTACGAGCTCGTTGGTGAG 24 Primer 2 CTTCGGATCTAAACGATCTGGGCTTTTACCTTCGTTTCGC 25 Primer 3 CGAAGGTAAAAGCCCAGATCGTTTAGATCCGAAGGAAAAC 26 Primer 4 ACTTGCTTCTTATCCATTGTATGTCCTCCTGGACTTCGTG 27 Primer 5 AGTCCAGGAGGACATACAATGGATAAGAAGCAAGTAACGG 28 Primer 6 gcagctaagtagggtTCAGTGATCGCTGAGATATTTCAGG 29 Primer 7 CTCAGCGATCACTGACAAAAAGCCGGACCCTTGCTTTAAG 30 Primer 8ggtacccggggatcctctagTGCTCATGCAGTACCTGC31 Primer 9TGATTACGCCAAGCTGGGCGATGGCGGCGAATCCG32 Primer 10CCTTCGGATCTAAACGATCTTTCCTTAAGTGCTGATTCGC33 Primer 11GCGAATCAGCACTTAAGGAAAGATCGTTTAGATCCGAAGG34 Primer 12CAGATTAAAGTTGTTcatTGTATGTCCTCCTGGACTTCG35 Primer 13GTCCAGGAGGACATACAatgAACAACTTTAATCTGCACAC36 Primer 14TCAGAACCTGTAGGTCttaGCGGGCGGCTTCGTATATACG37 Primer 15CGAAGCCGCCCGCtaaGACCTACAGGTTCTGACAATTTAAATCTC38 Primer 16CCGGGGATCCTCTAGCTGGGACTTCAGCAACATCG39 Primer 17aacagctatgaccatgattacgccaTCCGACCTGGCCGGTGATGG40 Primer 18agctaagtagggtGAGCCAAGATTAGCGCTGAAAAGTAGC41 Primer 19GCGCTAATCTTGGCTCaccctacttagctgccaattattc42 Primer20ggagatcgtttcagtcatgggtaaaaaatcctttcgtagg43 Primer 21aaggattttttacccatgactgaaacgatctccacagcgg44 Primer 22GTCTGTAATCAGCGTCCTActacaccaggcccaacagctg45 Primer 23ttgggcctggtgtagTAGGACGCTGATTACAGACGTGTCC46 Primer 24ggtacccggggatcctctagTCTGCTCTAAAGAGCGGCGGGTGG47 Primer 25gaccaTGATTACGCCAAGCTCGACGCAGAAGGTGTGATCC48 Primer 26aattggcagctaagtagggtTTAGCCCACCTTCTGGTGCG49 Primer 27CAGAAGGTGGGCTAAaccctacttagctgccaattattcc50 Primer 28TAAATTCCGTAAATCTTCATgggtaaaaaatcctttcgta51 Primer 29aaggattttttacccATGAAGATTTACGGAATTTATATGG52 Primer 30TCACGGCAAAGCGAGGTACTTATAAAAGCTCTTCGTACG53 Primer 31CGTACGAAGAGCTTTTATAAGTACCTCGCTTTGCCGTGAC54 Primer 32ggtacCCGGGGATCCTCTAGCGAAGCTTGCCGTGTGCAGG55 Primer 33GGTTGGGCAGGAGTATATTGggatccATGAAGATTTACGGAATTTATATG56 Primer 34atatggacgggcctgcaggtTTATAAAAGCTCTTCGTACG57 Primer 35GTTGGGCAGGAGTATATTGggatccTTGATCGCTTCGGTAGTTCCCGAGC58 Primer 36ggtccatatggacgggcctgcaggtTCACGGCACCACAATCGCGGTCAAG59primer 37GTTGGCAGGAGTATATTGggatccGTGGCCCTGTTGCGTGCCCTGGTGC60primer 38ggtccatatggacgggcctgcaggtTCACAGCGTGATCGCCGTCAGCGCG61primer39GTTGGGCAGGAGTATATTGggatccATGAACGACACGTTGCTGGGGCAGG62 Primer 40ggtccatatggacgggcctgcaggtTCACAGCACGATCGCCGTCAGCGTC63 Primer 41TCTCAGCGATCACTGAaccctacttagctgccaattattc64 Primer 42GTATGAGAGATCTTCCACgggtaaaaaatcctttcgtagg65 Primer 43aaggattttttacccGTGGAAGATCTCTCATACCGCATCC66 Primer 44CAAGGGTCCGGCTTTTTGTTAGCCCACCTTCTGGTGCGCG67 Primer 45CAGAAGGTGGGCTAACAAAAAGCCGGACCCTTGCTTTAAG
[0087]
[0088] 2-2. Creation of a mutant strain with a 1,4-BDO production pathway
[0089] Using an electroporator (BIO-RAD, USA), the pk19mobsacB-gadB(E89Q,△452-466)gabT vector produced in Example 2-1 was introduced into the Corynebacterium glutamicum ATCC13032 strain produced as a competent cell by electroporation, and then spread on 2YT KM AGAR medium (containing 2YT AGAR and 30 mg / L kanamycin) and cultured in a 30°C incubator for 2 days to obtain colonies. Among the colonies in which the first homologous recombination was induced, the colonies confirmed by PCR were cultured in 2YT liquid medium (containing 16 g / L tryptophan, 10 g / L yeast extract, and 5 g / L NaCl) for 12 hours and then plated on 2YT Sucrose AGAR medium (containing 2YT AGAR and 100 g / L sucrose) to remove the antibiotic marker through the second homologous recombination. The selected colonies were finally confirmed through PCR and sequence analysis to determine whether the gadB and gabT genes had been introduced as intended.
[0090] Thereafter, the above process was sequentially performed using the pk19mobsacB-yqhD, pk19mobsacB-car and pk19mobsacB-sfp vectors produced in Example 2-1 to produce a Corynebacterium glutamicum mutant strain in which the gadB, gabT, yqhD, car and sfp genes were introduced and a pathway for producing 1,4-butanediol from glutamic acid was constructed, and this strain was named WB04-P001.
[0091]
[0092] Example 3. Production of mutant Corynebacterium glutamicum expressing BsPPTase, MaPPTase, McaPPTase, or McoPPTase.
[0093] 3-1. Construction of BsPPTase, MaPPTase, McaPPTase, or McoPPTase expression vectors
[0094] PCR was performed using the pET21b-BsPPTase vector as a template and primers 33 and 34. The PCR product obtained above was ligated to the pCES208H30 vector (Microbial Cell Factories volume 15, Article number: 174 (2016)) treated with restriction enzymes BamHI and XbaI, and the plasmid obtained here was named pCES208H30-BsPPTase.
[0095] PCR was performed using primers 35 and 36 with the pET21b-MaPPTase vector as a template. The PCR product obtained above was ligated to the pCES208H30 vector treated with restriction enzymes BamHI and XbaI, and the plasmid obtained here was named pCES208H30-MaPPTase.
[0096] PCR was performed using the pET21b-McaPPTase vector as a template and primers 37 and 38. The PCR product obtained above was ligated to the pCES208H30 vector treated with restriction enzymes BamHI and XbaI, and the plasmid obtained here was named pCES208H30-McaPPTase.
[0097] PCR was performed using the pET21b-McoPPTase vector as a template and primers 39 and 40. The PCR product obtained above was ligated to the pCES208H30 vector treated with restriction enzymes BamHI and XbaI, and the plasmid obtained here was named pCES208H30-McoPPTase.
[0098] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract DNA from each vector. The primers used for PCR are as shown in Table 5 above. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) in a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP) and 1 pM of oligonucleotide and 10 ng of template DNA. Each plasmid was constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB, USA) and restriction enzymes HindIII (NEB, USA) and XbaI (NEB, USA).
[0099]
[0100] 3-2. Introduction of BsPPTase, MaPPTase, McaPPTase, or McoPPTase expression vectors
[0101] The 1,4-butanediol-producing strain WB04-P001 of Corynebacterium glutamicum produced in Example 2 was used as a parent strain for introducing each of the four plasmids produced in Example 3-1. An electrocompetent cell production method modified based on the method of van der Rest et al. was used for the transformation of the WB04-P001 strain. First, the WB04-P001 strain was primary cultured in 10 ml of a medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol) to prepare a seed culture solution. Afterwards, OD was added to 100 ㎖ of medium (containing Beef Extract 10 g / ℓ, Brain Heart infusion 40 g / ℓ and sorbitol 30 g / ℓ, glycine 2.5 g / L, Isoniazid 400 mg / L, Tween80 100 ㎕ / L). 610 After inoculating the seed culture so that the value becomes 0.3, culture it at 30℃, 200 rpm for 1.5 to 2 hours to determine the OD 610The value was set to 0.5 to 0.6. The culture medium was left on ice for 30 minutes and centrifuged at 4°C and 3500 rpm for 5 minutes. The supernatant was then discarded, and the precipitated strain was washed three times with a 10% glycerol solution, and finally resuspended in 0.5 ml of a 10% glycerol solution to prepare competent cells. Electroporation was performed using an electroporator from Bio-Rad. The plasmid was added to the competent cells prepared in an electroporation cuvette (0.2 mm), and then electroporated under the conditions of 2.5 kV, 200 Ω, and 12.5 μF. Immediately after the electric shock, 1 ml of regeneration medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol) was added and heat-treated at 46°C for 6 minutes. After cooling the tube on ice, it was incubated at 30°C for 2 hours and plated on selection medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol, 20 g / ℓ of agar, and 30 μg / ℓ of kanamycin). Colonies were obtained by incubating in an incubator at 30°C for 2 days. Finally, the strain into which pCES208H30-BsPPTase was introduced was named WB04-P003, the strain into which pCES208H30-MaPPTase was introduced was named WB04-P010, the strain into which pCES208H30-McaPPTase was introduced was named WB04-P011, and the strain into which pCES208H30-McoPPTase was introduced was named WB04-P012.
[0102]
[0103] Example 4. Productivity evaluation of 1,4-butanediol producing strains introduced with BsPPTase, MaPPTase, McaPPTase, or McoPPTase expression vectors.
[0104] The 1,4-butanediol productivity of the strain introducing the BsPPTase MabCAR expression vector (WB04-P003) and the strain introducing the MaPPTase, McaPPTase, or McoPPTase expression vector (WB04-P010, WB04-P011, or WB04-P012) was compared.
[0105] Each strain was inoculated into a flask medium (containing 10% glucose, 0.25% MgSO4, 2.5% yeast extract, 0.25% KH2PO4, 2.5% (NH4)2SO4, 100 ppm FeSO4, 2.5% peptone, 100 μg / L biotin, 25 ppm nicotinamide, and 25 ppm CPN) and cultured at 30°C for 48 h. After incubation, the culture medium was filtered through a 0.45 μm filter, and the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). A 0.1 M phosphate buffer was used as the mobile phase, and analysis was performed using an RI detector at a temperature of 40°C and a flow rate of 0.8 mL / min for 15 minutes. The results are shown in Table 6 below.
[0106] Strain 1,4-butanediol (g / L) WB04-P0030.6WB04-P0101.65WB04-P0110.85WB04-P0121.6
[0107] As shown in Table 6 above, mutant microorganisms expressing phosphopantetheinyl transferases (MaPPTase, McaPPTase, and McoPPTase) derived from Mycobacteroides abscessus subsp. Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense showed approximately 2.8-fold, 1.4-fold, and 2.7-fold increases in 1,4-butanediol production, respectively, compared to the case of expressing carboxylic acid reductase (BsPPTase) derived from Bacillus subtilis due to the high reactivity of phosphopantetheinyl transferases toward CAR.
[0108]
[0109] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.
Claims
1. A mutant microorganism having improved 1,4-butanediol production ability, which expresses phosphopantetheinyl transferase derived from at least one selected from the group consisting of Mycobacteroides abscessussubsp.Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense.
2. In claim 1, A mutant microorganism wherein the above phosphopantetheinyl transferase is composed of at least one amino acid sequence selected from the group consisting of sequence numbers 2, 4 and 6.
3. In claim 1, The above mutant microorganism is a mutant microorganism belonging to the genus Corynebacterium.
4. A method for producing a mutant microorganism of claim 1, comprising the step of introducing a gene encoding a phosphopantetheinyl transferase derived from at least one selected from the group consisting of Mycobacteroides abscessussubsp.Massiliense, Mycobacterium canariasense, and Mycobacterium conceptionense.
5. In claim 4, A method for producing a mutant microorganism, wherein the gene encoding the above phosphopantetheinyl transferase comprises at least one selected from the group consisting of base sequences of sequence numbers 1, 3 and 5.
6. A step of culturing the mutant microorganism of claim 1 in a medium; and A method for producing 1,4-butanediol, comprising a step of recovering 1,4-butanediol from the mutant microorganism or a medium in which the mutant microorganism is cultured.
Citation Information
Patent Citations
Genetically engineered bacterium for synthesizing vanillin and application of genetically engineered bacterium
CN114181877A
Method for producing gamma-butyrolactone or 1, 4-butanediol through fermentation
CN116083329A
Method for producing 1, 4-butanediol through whole-cell catalysis and application thereof
CN116445390A
Microorganisms and methods for production of specific length fatty alcohols and related compounds
KR1020150069015A
Method for diagnosing a vehicle based on variable weighted values of sensed elements for a motor in the vehicle and system therfor
KR1020250031787A