Mutant microorganism with improved 1,4-butanediol productivity, and method for producing 1,4-butanediol by using same

Abstract

The present invention relates to a mutant microorganism with improved 1,4-butanediol productivity, and a method for producing 1,4-butanediol by using same. The mutant microorganism expresses one or more enzymes selected from the group consisting of pyridoxal kinases and pyridoxine 5'-phosphate oxidase derived from Escherichia coli, thereby enhancing the supply of pyridoxal 5'-phosphate used as a coenzyme in the 1,4-butanediol production pathway and efficiently producing 1,4-butanediol.

Description

Mutant microorganism with improved 1,4-butanediol production ability and method for producing 1,4-butanediol using the same

[0001] The present invention relates to a mutant microorganism having improved 1,4-butanediol production ability and a method for producing 1,4-butanediol using the same.

[0002] 1,4-Butanediol is used across the chemical industry as a solvent, polymer intermediate, and fine chemical intermediate. It is primarily produced by reacting acetylene and formaldehyde, followed by the addition of hydrogen. It can also be produced from maleic anhydride and propylene oxide. However, the use of fossil fuels leads to global warming gases and waste generation, as well as problems such as disruptions in raw material supply and increased production costs due to volatile international oil prices.

[0003] To complement these chemical production processes, low-cost and environmentally friendly processes for biologically producing 1,4-butanediol using biomass as a raw material have recently been developed. Typically, 1,4-butanediol is produced through microbial metabolism via α-ketoglutarate or succinyl-CoA. However, microbial 1,4-butanediol production processes have limitations, including the production of unnecessary byproducts in addition to 1,4-butanediol during microbial metabolism and the relatively low production yield. Therefore, continuous efforts are being made to develop microorganisms capable of producing high-yield 1,4-butanediol using genetic engineering techniques to overcome these limitations.

[0004] [Prior Art Literature]

[0005] [Patent Document]

[0006] European Patent No. 3050970

[0007] European Patent No. 2782893

[0008] The purpose of the present invention is to provide a mutant microorganism having improved 1,4-butanediol production ability.

[0009] In addition, the present invention aims to provide a method for producing the mutant microorganism.

[0010] In addition, the present invention aims to provide a method for producing 1,4-butanediol using the mutant microorganism.

[0011] One aspect of the present invention provides a mutant microorganism having improved 1,4-butanediol production ability, which expresses at least one enzyme selected from the group consisting of pyridoxal kinase and pyridoxine 5'-phosphate oxidase derived from Escherichia coli.

[0012] The 1,4-butanediol biosynthetic pathway from glutamic acid using microorganisms involves the following steps: an enzymatic reaction that converts glutamic acid to 4-aminobutyric acid (gadB gene), an enzymatic reaction that converts 4-aminobutyric acid to succinate semialdehyde (gabT gene), an enzymatic reaction that converts succinate semialdehyde to 4-hydroxybutyric acid (yqhD gene), and an enzymatic reaction that converts 4-hydroxybutyric acid to 1,4-butanediol (car / yqhD genes). Pyridoxal 5'-phosphate (PLP) is used as a coenzyme in the process of converting glutamic acid to 4-aminobutyric acid and the process of converting 4-aminobutyric acid to succinate semialdehyde.

[0013] In the present invention, the 1,4-butanediol production ability of a mutant microorganism can be improved by introducing pyridoxal phosphatase, pyridoxine 5'-phosphate oxidase, or both, which are enzymes involved in the production pathway of pyridoxal 5'-phosphate.

[0014] The “pyridoxal kinase” used in the present invention is an enzyme that catalyzes a reaction that produces pyridoxine-5'-phosphate from pyridoxine using ATP, and may be a polypeptide having pyridoxal kinase activity encoded by the pdxK gene, but is not limited thereto.

[0015] The “pyridoxine 5'-phosphate oxidase” used in the present invention is an enzyme that catalyzes a reaction that produces pyridoxal-5'-phosphate from pyridoxine-5'-phosphate, and may be a polypeptide encoded by the pdxH gene and having pyridoxine 5'-phosphate oxidase activity, but is not limited thereto.

[0016] According to one specific example of the present invention, the pyridoxal kinase may be composed of an amino acid sequence of SEQ ID NO: 2, and the pyridoxine 5'-phosphate oxidase may be composed of an amino acid sequence of SEQ ID NO: 4.

[0017] The amino acid sequences of pyridoxal kinase and pyridoxine 5'-phosphate oxidase according to the present invention may be composed of or essentially include sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% homology or identity with respect to the respective amino acid sequences of SEQ ID NOs: 2 and 4, and may have an original function. Here, “homology” or “identity” means the rate of identity (%) between two sequences when a reference amino acid sequence and any other amino acid sequence are aligned and analyzed to correspond as much as possible.

[0018] In the present invention, the 1,4-butanediol production ability can be improved by expressing an exogenous pyridoxal phosphatase or pyridoxine 5'-phosphate oxidase derived from a different species of microorganism in a microorganism that does not originally have a pyridoxal 5'-phosphate production pathway, or by expressing an exogenous pyridoxal phosphatase or pyridoxine 5'-phosphate oxidase having a higher activity than the endogenous pyridoxal 5'-phosphate production pathway inherent in the microorganism.

[0019] In addition, the present invention can enhance the activity or increase the expression level of endogenous / exogenous pyridoxal kinase or pyridoxine 5'-phosphate oxidase, specifically, it can include a case where the activity of the protein itself is increased compared to the activity of the original protein through nucleotide substitution, insertion, deletion or a combination thereof of the gene encoding the enzyme, a case where the copy number of the gene encoding the enzyme is increased, a case where the expression level of the gene is increased through modification of a regulatory factor that controls the expression of the gene encoding the enzyme (e.g., promoter sequence mutation, replacement with a strong promoter), or a combination thereof.

[0020] As used herein, “improved 1,4-butanediol productivity” means increased productivity of 1,4-butanediol compared to a microorganism before mutation (parent strain). The parent strain refers to a wild type or mutant microorganism that is the target of mutation, and includes a target that is directly subject to mutation or transformed with a recombinant vector, etc. In the present invention, the parent strain may be a microorganism or strain of the genus Corynebacterium that does not have 1,4-butanediol productivity or has 1,4-butanediol productivity, for example, a wild type Corynebacterium or a Corynebacterium genus mutant from the wild type.

[0021] According to one specific example of the present invention, the mutant microorganism may be of the genus Corynebacterium.

[0022] Specifically, the mutant microorganism belongs to the genus Corynebacterium, including Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium callunae, Corynebacterium suranareeae, Corynebacterium lubricantis, Corynebacterium doosanense, Corynebacterium efficiens, Corynebacterium uterequi, Corynebacterium stationis, Corynebacterium pacaense, Corynebacterium singulare, Corynebacterium humireducens, Corynebacterium marinum, Corynebacterium halotolerans, Corynebacterium spheniscorum, Corynebacterium freiburgense, Corynebacterium striatum, Corynebacterium canis, Corynebacterium ammoniagenes, Corynebacterium renale, Corynebacterium pollutisoli,It may be at least one selected from the group consisting of, but is not limited to, Corynebacterium imitans, Corynebacterium caspium, Corynebacterium testudinoris, Corynebacterium pseudopelargi, and Corynebacterium flavescens.

[0023] According to one specific example of the present invention, the mutant microorganism may be Corynebacterium glutamicum.

[0024] The mutant microorganism having improved 1,4-butanediol production ability according to the present invention exhibits increased 1,4-butanediol production ability compared to the microorganism before mutation (parent strain), and in particular, the 1,4-butanediol production ability is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the parent strain, or 1.1 times, 1.5 times, 2 times, 2.5 times, 3 times, 3.5 times, 4 times, 4.5 times, 5 times, 5.5 times, 6 times, 6.5 times, 7 times, It may be increased by, but is not limited to, 7.5 times, 8 times, 8.5 times, 9 times, 9.5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, or 100 times. For example, the mutant microorganism expressing the pyridoxal kinase and / or pyridoxine 5'-phosphate oxidase may have an increased 1,4-butanediol production of 0.5 times or more, specifically 0.5 to 30 times (preferably 1 to 20 times) compared to the parent strain.

[0025] A composition comprising a mutant microorganism according to the present invention can be used as a composition for producing 1,4-butanediol.

[0026]

[0027] Another aspect of the present invention provides a method for producing the mutant microorganism, comprising the step of introducing a gene encoding at least one enzyme selected from the group consisting of pyridoxal kinase and pyridoxine 5'-phosphate oxidase derived from Escherichia coli.

[0028] The above step is a process of transforming a parent strain with a vector containing a polynucleotide of a gene encoding pyridoxal kinase and / or pyridoxine 5'-phosphate oxidase.

[0029] According to one specific example of the present invention, the gene encoding the pyridoxal kinase may include a base sequence of SEQ ID NO: 1, and the gene encoding the pyridoxine 5'-phosphate oxidase may include a base sequence of SEQ ID NO: 3.

[0030] The term “vector” as used herein refers to any type of nucleic acid sequence carrier structure used as a means for delivering and expressing a target gene, i.e., a gene encoding pyridoxal kinase or pyridoxine 5'-phosphate oxidase, to a microorganism to be mutated (host cell). Unless otherwise specified, the vector may mean one that allows the carried nucleic acid sequence to be inserted into the host cell genome and expressed and / or to be expressed independently. Such a vector includes essential regulatory sequences that are operably linked to allow the gene insert to be expressed, and “operably linked” means that the target gene and its regulatory sequence are functionally linked to each other in a manner that enables gene expression, and a “regulatory sequence” includes a promoter sequence for performing transcription, an optional operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates the termination of transcription and translation.

[0031] The vector used in the present invention is not particularly limited as long as it is capable of replicating in a host cell, and any vector known in the art can be used. Examples of the vector include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state. For example, phage vectors or cosmid vectors include pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., and plasmid vectors include, but are not limited to, pBR series, pUC series, pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series.

[0032] The above vector can typically be constructed as a cloning vector or an expression vector. The expression vector can be any vector commonly used in the art to express foreign genes or proteins in plants, animals, or microorganisms, and can be constructed using various methods known in the art.

[0033] The “recombinant vector” used in the present invention can be constructed using a prokaryotic or eukaryotic cell as a host, and can replicate independently of the host cell’s genome or can be integrated into the genome itself. The host cell can replicate the vector, and can include an origin of replication, which is a specific base sequence where replication begins. For example, when the vector used is an expression vector and the host is a prokaryotic cell, it typically includes a strong promoter capable of driving transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. In the case of using a eukaryotic cell as a host, the replication origin that operates in the eukaryotic cell included in the vector includes, but is not limited to, the f1 replication origin, the SV40 replication origin, the pMB1 replication origin, the adeno replication origin, the AAV replication origin, and the BBV replication origin. In addition, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., an adenovirus late promoter, a vaccinia virus 7.5K promoter, an SV40 promoter, a cytomegalovirus promoter, a tk promoter of HSV) can be used, and generally has a polyadenylation sequence as a transcription termination sequence.

[0034] The above recombinant vector may include a selection marker, which is used to select transformants (host cells) transformed with the vector. Since only cells expressing the selection marker can survive in a medium treated with the selection marker, selection of transformed cells is possible. Representative examples of the selection marker include, but are not limited to, ampicillin, kanamycin, streptomycin, and chloramphenicol.

[0035] A transformant can be created by inserting the above recombinant vector into a host cell, and the transformant can be obtained by introducing the recombinant vector into an appropriate host cell. Any host cell known in the art that can stably and continuously clone or express the expression vector can be used as the host cell.

[0036] When transforming prokaryotic cells to produce recombinant microorganisms, the host cells may include, but are not limited to, various strains of Escherichia coli such as E. coliDH5α, E. coliJM109, E. coliBL21, E. coliRR1, E. coliLE392, E. coliB, E. coliX 1776, E. coliW3110, and E. coliXL1-Blue, strains of Corynebacterium, strains of Bacillus such as Bacillus subtilis and Bacillus thuringiensis, and various enterobacteria and strains such as Salmonella typhimurium, Serratia marcescens, and Pseudomonas species.

[0037] When transforming eukaryotic cells to produce recombinant microorganisms, yeast (e.g., Saccharomyces cerevisiae), insect cells, plant cells, and animal cells, such as Sp2 / 0, CHO K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, and MDCK cell lines, can be used as host cells, but are not limited thereto.

[0038] “Transformation” as used in the present invention refers to a phenomenon in which a genetic change is artificially caused by introducing external DNA into a host cell, and “transformant” refers to a host cell into which external DNA is introduced and in which the expression of a target gene is stably maintained.

[0039] The above transformation can be performed by selecting an appropriate vector introduction technique depending on the host cell, so that the target gene or the recombinant vector containing it can be expressed within the host cell. For example, vector introduction can be performed by electroporation, heat shock, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lithium acetate-DMSO method, or a combination thereof, but is not limited thereto. The transformed gene can be included without limitation, whether it is integrated into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed within the host cell.

[0040] The above transformant includes cells transfected, transformed, or infected with a recombinant vector according to the present invention in vivo or in vitro, and may be used as the same term as recombinant host cell, recombinant cell, or recombinant microorganism.

[0041] The transformant of the present invention may be other than a human.

[0042] Genes inserted into the recombinant vector for transformation of the present invention can be introduced into a host cell such as a microorganism of the genus Corynebacterium through homologous recombination crossing over.

[0043] According to one specific example of the present invention, the host cell may be a microorganism of the genus Corynebacterium, and for example, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0044]

[0045] In addition, another aspect of the present invention provides a method for producing 1,4-butanediol, comprising the steps of culturing the mutant microorganism in a medium; and recovering 1,4-butanediol from the mutant microorganism or the medium in which the mutant microorganism is cultured.

[0046] The above culture can be performed using an appropriate medium and culture conditions known in the art, and those skilled in the art can easily adjust the medium and culture conditions for use. Specifically, the medium may be a liquid medium, but is not limited thereto. The culture method may include, but is not limited to, batch culture, continuous culture, fed-batch culture, or a combination thereof.

[0047] According to one specific embodiment of the present invention, the medium should meet the requirements of a specific strain in an appropriate manner and can be appropriately modified by a person skilled in the art. Culture media for microorganisms of the genus Corynebacterium can be found in a known document (Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981), but are not limited thereto.

[0048] According to one embodiment of the present invention, the medium may include various carbon sources, nitrogen sources, and trace element components. Carbon sources that can be used include sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto. Nitrogen sources that can be used include peptone, yeast extract, meat juice, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture, but are not limited thereto. Sources of phosphorus that can be used include, but are not limited to, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or their corresponding sodium-containing salts. Additionally, the culture medium may contain, but is not limited to, metal salts required for growth, such as magnesium sulfate or iron sulfate. In addition, essential growth substances, such as amino acids and vitamins, may be included. Appropriate precursors may also be used in the culture medium. The medium or individual components may be added to the culture solution during the culturing process in a suitable manner, either batchwise or continuously, but are not limited thereto.

[0049] According to one specific example of the present invention, the medium may contain pyridoxine.

[0050] According to one specific example of the present invention, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be appropriately added to the microbial culture medium during cultivation to adjust the pH of the culture medium. In addition, foaming may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester during cultivation. Additionally, oxygen or an oxygen-containing gas (e.g., air) may be injected into the culture medium to maintain an aerobic state of the culture medium. The temperature of the culture medium may typically be 20 to 45°C, for example, 25 to 40°C. The culture period may continue until a desired amount of useful substances is obtained, and may be, for example, 10 to 160 hours.

[0051] According to one specific example of the present invention, the step of recovering 1,4-butanediol from the cultured mutant microorganism or the culture medium containing the same may be performed by collecting or recovering the 1,4-butanediol produced from the medium using a suitable method known in the art depending on the culture method. For example, centrifugation, filtration, extraction, spraying, drying, evaporation, precipitation, crystallization, electrophoresis, differential dissolution (e.g., ammonium sulfate precipitation), chromatography (e.g., ion exchange, affinity, hydrophobicity, and size exclusion) may be used, but is not limited thereto.

[0052] According to one specific example of the present invention, the step of recovering the 1,4-butanediol may include removing biomass by low-speed centrifugation of the culture medium and separating the obtained supernatant through ion exchange chromatography.

[0053] According to one specific example of the present invention, the step of recovering 1,4-butanediol may include a process of purifying 1,4-butanediol.

[0054] The mutant microorganism according to the present invention can efficiently produce 1,4-butanediol by enhancing the supply of pyridoxal 5'-phosphate, which is used as a coenzyme in the 1,4-butanediol production pathway, by expressing pyridoxal kinase and pyridoxine 5'-phosphate oxidase derived from Escherichia coli.

[0055] The present invention will be described in more detail below. However, this description is provided merely as an example to aid understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

[0056]

[0057] Example 1. Production of a mutant Corynebacterium glutamicum with an established 1,4-BDO production pathway.

[0058] 1-1. Construction of vectors for introducing gadB, gabT, yqhD, car, and sfp genes

[0059] A pathway for biosynthesizing 1,4-butanediol from glutamic acid was constructed by introducing the gadB, gabT, yqhD, car, and sfp genes into Corynebacterium glutamicum ATCC13032.

[0060] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 1 and 2, 3 and 4, 7 and 8, 37 and 38, 39 and 40, and 41 and 8, respectively, as a template. pCES208H36EcGADmut (ACS Omega. 2022 Aug 23; 7(33): 29106-29115.) DNA containing the gadB gene was amplified by PCR using primers 5 and 6 as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the HindIII and XbaI sites of the pK19mobSacB vector (ATCC, 87098). This vector was named pk19mobsacB-gadB(E89Q,△452-466)gabT.

[0061] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 9 and 10, 11 and 12, and 15 and 16, respectively, as a template. The chromosomal DNA of Escherichia coli K-12 MG1655 containing the yqhD gene (derived from Escherichia coli) was amplified by PCR using primers 13 and 14, as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-yqhD.

[0062] The chromosomal DNA of Corynebacterium glutamicum ATCC13032 was used as a template and amplified by PCR using primers 17 and 18, 19 and 20, and 23 and 24, respectively. The Escherichia coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184) containing the car gene (derived from Mycobacterium abscessus) was used as a template and amplified by PCR using primers 21 and 22. The obtained PCR products were amplified by crossover PCR and inserted into the restriction enzymes HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-car.

[0063] To insert the sfp gene required for activating the enzymatic activity of the car gene, the chromosomal DNA of Corynebacterium glutamicum ATCC13032 was amplified by PCR using primers 25 and 26, 27 and 28, and 31 and 32 as a template, respectively. The Escherichia coli expression vector pKE112CAR3pptase (Polymers (Basel). 2019 11(7):1184) containing the sfp gene (derived from Bacillus subtilis) was amplified by PCR using primers 29 and 30 as a template. The obtained PCR products were amplified by crossover PCR and then inserted into the restriction enzymes HindIII and XbaI sites of the pK19mobSacB vector. This vector was designated pk19mobsacB-sfp.

[0064] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract chromosomal DNA from each fungus. The base sequences of the amplified gadB, gabT, yqhD, car, and sfp genes are shown in Table 1 below, and the primers used for PCR are shown in Table 2 below. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan). 1 pM of oligonucleotides and 10 ng of template DNA were added to a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), and 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) was added.

[0065] pk19mobsacB-gadB(E89Q,△452-466)gabT, pk19mobsacB-yqhD, pk19mobsacB-car and pk19mobsacB-sfp vectors constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB, USA) and restriction enzymes HindIII (NEB, USA) and XbaI (NEB, USA) were transformed into E. coliDH5a (HIT Competent cells™, Cat No. RH618), plated on LB-agar plates containing 50 μg / ml kanamycin, and cultured at 37°C for 24 hours. The resulting colonies were isolated to confirm that the insert was present in the vector. The vector was then isolated and used to produce a mutant strain of Corynebacterium glutamicum with the glutamate-1,4-butanediol pathway introduced.

[0066] 서열번호유전자 및 염기서열 (5'-3')5Escherichia coli유래, gadB 유전자AAGTACAGAACGCCTCTTACCAGGTTGCCGCTTATCTGGCGGATGAAATCGCCAAACTGGGGCCGTATGAGTTCATCTGTACGGGTCGCCCGGACGAAGGCATCCCGGCGGTTTGCTTCAAACTGAAAGATGGTGAAGATCCGGGATACACCCTGTATGACCTCTCTGAACGTCTGCGTCTGCGCGGCTGGCAGGTTCCGGCCTTCACTCTCGGCGGTGAAGCCACCGACATCGTGGTGATGCGCATTATGTGTCGTCGCGGCTTCGAAATGGACTTTGCTGAACTGTTGCTGGAAGACTACAAAGCCTCCCTGAAATATCTCAGCGATCACTGA6Corynebacterium glutamicum유래, gabT 유전자AGACCCGCGCGCAAGAAATCGAGACCATCATCCGCGATGAATTCGCGCAGCTGAGTGCCTTCCCGGAGGTCGCCGAAATCCGCGGCCGCGGAGCAATGATGGCCATTGAGCTTATCGACGCTACCGGCCGCCCGAACGCAGCTTTAACCGCCGCAGTGGCTGCGCGCGCAAAAGCTGAAGGTGTGCTGCTGCTGACTTGCGGCACCGATGGCAACGTCATCCGCCTGCTGCCACCACTGGTCATTGCAGAGGACACTCTCCGTGATGGTCTTCAGGTGTTAGTCGCAGCCCTAGAGCGCGAAACCGCGCACCAGAAGGTGGGCTAA7Escherichia coli유래, yqhD 유전자CCCACCTCTCCGACTACGGTCTGGACGGCAGCTCCATCCCGGCTTTGCTGAAAAAACTGGAAGAGCACGGCATGACCCAACTGGGCGAAAATCATGACATTACGTTGGATGTCAGCCGCCGTATATACGAAGCCGCCCGCtaa8Mycobacterium abscessus유래,car 유전자ttctatgaattggatgccgacggcaatcggcagcgcgctcactatgacggtgtgcccggcgatttcaccgccgcatcgatcaccgccatcggcggtgtgaacgtggtagacggttaccgcagcttcgacgtgttcaacccgcaccatgacggtgtctcgatggataccttcgtcgactggctgatcgacgcaggctacaagatcgcgcggatcgacgattacgaccagtggctcgcccggttcgagctggccctcaagggattgcccgagcagcagcggcaacagtcggtgttgccacttctcaagatgtacgagaagccgcaaccggcgatcgacggaagtgcacttccgaccgcagaattcagtcgcgccgtgcacgaggcgaaggtcggagacagcggtgagataccgcacgtcaccaaggagctgatcctcaagtacgccagcgatattcagctgttgggcctggtgtag9Bacillus subtilis유래,sfp 유전자ATGAAGATTTACGGAATTTATATGGACCGCCCGCTTTCACAGGAAGAAAATGAACGGTTCATGTCTTTCATATCACCTGAAAAACGGGAGAAATGCCGGAGATTTTATCATAAAGAAGATGCTCACCGCACCCTGCTGGGAGATGTGCTCGTTCGCTCAGTCATAAGCAGGCAGTATCAGTTGGACAAATCCGATATCCGCTTTAGCACGCAGGAATACGGGAAGCCGTGCATCCCTGATCTTCCCGACGCTCATTTCAACATTTCTCACTCCGGACGCTGGGTCATTTGCGCGTTTGATTCACAGCCGATCGGCATAGATATCGAAAAAACGAAACCGATCAGCCTTGAGATCGCCAAGCGCTTCTTTTCAAAAACAGAGTACAGCGACCTTTTAGCAAAAGACAAGGACGAGCAGACAGACTATTTTTATCATCTATGGTCAATGAAAGAAAGCTTTATCAAACAGGAAGGCAAAGGCTTATCGCTTCCGCTTGATTCCTTTTCAGTGCGCCTGCACCAGGACGGACAAGTATCCATTGAGCTTCCGGACAGCCATTCCCCATGCTATATCAAAACGTATGAGGTCGATCCCGGCTACAAAATGGCTGTATGCGCCGCACACCCTGATTTCCCCGAGGATATCACAATGGTCTCGTACGAAGAGCTTTTATAA,

[0067] Sequence number Primer name Primer sequence (5'-3') 10 Primer 1 aacagctatgaccatgattacgccaCAAGGATTACGAGCTCGTTGGTGAG 11 Primer 2 CTTCGGATCTAAACGATCTGGGCTTTTACCTTCGTTTCGC 12 Primer 3 CGAAGGTAAAAGCCCAGATCGTTTAGATCCGAAGGAAAAC 13 Primer 4 ACTTGCTTCTTATCCATTGTATGTCCTCCTGGACTTCGTG 14 Primer 5 AGTCCAGGAGGACATACAATGGATAAGAAGCAAGTAACGG 15 Primer 6 gcagctaagtagggtTCAGTGATCGCTGAGATATTTCAGG 16 Primer 7 CTCAGCGATCACTGACAAAAAGCCGGACCCTTGCTTTAAG 17 Primer 8ggtacccggggatcctctagTGCTCATGCAGTACCTGC18 Primer 9TGATTACGCCAAGCTGGGCGATGGCGGCGAATCCG19 Primer 10CCTTCGGATCTAAACGATCTTTCCTTAAGTGCTGATTCGC20 Primer 11GCGAATCAGCACTTAAGGAAAGATCGTTTAGATCCGAAGG21 Primer 12CAGATTAAAGTTGTTcatTGTATGTCCTCCTGGACTTCG22 Primer 13GTCCAGGAGGACATACAatgAACAACTTTAATCTGCACAC23 Primer 14TCAGAACCTGTAGGTCttaGCGGGCGGCTTCGTATATACG24 Primer 15CGAAGCCGCCCGCtaaGACCTACAGGTTCTGACAATTTAAATCTC25 Primer 16CCGGGGATCCTCTAGCTGGGACTTCAGCAACATCG26 Primer 17aacagctatgaccatgattacgccaTCCGACCTGGCCGGTGATGG27 Primer 18agctaagtagggtGAGCCAAGATTAGCGCTGAAAAGTAGC28 Primer 19GCGCTAATCTTGGCTCaccctacttagctgccaattattc29 Primer20ggagatcgtttcagtcatgggtaaaaaatcctttcgtagg30Primer 21aaggattttttacccatgactgaaacgatctccacagcgg31Primer 22GTCTGTAATCAGCGTCCTActacaccaggcccaacagctg32Primer 23ttgggcctggtgtagTAGGACGCTGATTACAGACGTGTCC33Primer 24ggtacccggggatcctctagTCTGCTCTAAAGAGCGGCGGGTGG34Primer 25gaccaTGATTACGCCAAGCTCGACGCAGAAGGTGTGATCC35Primer 26aattggcagctaagtagggtTTAGCCCACCTTCTGGTGCG36Primer 27CAGAAGGTGGGCTAAaccctacttagctgccaattattcc37Primer 28TAAATTCCGTAAATCTTCATgggtaaaaaatcctttcgta38 Primer 29aaggattttttacccATGAAGATTTACGGAATTTATATGG39 Primer 30TCACGGCAAAGCGAGGTACTTATAAAAGCTCTTCGTACG40 Primer 31CGTACGAAGAGCTTTTATAAGTACCTCGCTTTGCCGTGAC41 Primer 32ggtacCCGGGGATCCTCTAGCGAAGCTTGCCGTGTGCAGG42 Primer 33GTTGGGCAGGAGTATATTGggatccatgTCTGATAACGACGAATTGCAGC43 Primer 34CTcatatgtatatctccttcaGGGTGCAAGACGATCAATC44 Primer 35ACCCtgaaggagatatacatatgAGTAGTTTGTTGTTGTTTAACG45 Primer 36atggacgggcctgcaggtttaTGCTTCCGCCAGCGGCGGC46 Primer 37TCTCAGCGATCACTGAaccctacttagctgccaattattc47 Primer 38GTATGAGAGATCTTCCACgggtaaaaaatcctttcgtagg48 Primer 39aaggattttttacccGTGGAAGATCTCTCATACCGCATCC49 Primer40CAAGGGTCCGGCTTTTTGTTAGCCCACCTTCTGGTGCGCG50Primer 41CAGAAGGTGGGCTAACAAAAAGCCGGACCCTTGCTTTAAG

[0068]

[0069] 1-2. Creation of a mutant strain with a 1,4-BDO production pathway

[0070] Using an electroporator (BIO-RAD, USA), the pk19mobsacB-gadB(E89Q,△452-466)gabT vector produced in Example 1-1 was introduced into the Corynebacterium glutamicum ATCC13032 strain produced as a competent cell by electroporation, and then spread on 2YT KM AGAR medium (containing 2YT AGAR and 30 mg / L kanamycin) and cultured in an incubator at 30°C for 2 days to obtain colonies. Among the colonies in which the first homologous recombination was induced, the colonies confirmed by PCR were cultured in 2YT liquid medium (containing 16 g / L tryptophan, 10 g / L yeast extract, and 5 g / L NaCl) for 12 hours and then plated on 2YT Sucrose AGAR medium (containing 2YT AGAR and 100 g / L sucrose) to remove the antibiotic marker through the second homologous recombination. The selected colonies were finally confirmed through PCR and sequence analysis to determine whether the gadB and gabT genes had been introduced as intended.

[0071] Thereafter, the above process was sequentially performed using the pk19mobsacB-yqhD, pk19mobsacB-car and pk19mobsacB-sfp vectors produced in Example 1-1 to produce a Corynebacterium glutamicum mutant strain in which the gadB, gabT, yqhD, car and sfp genes were introduced and a pathway for producing 1,4-butanediol from glutamic acid was constructed, and this strain was named WB04-P001.

[0072]

[0073] Example 2. Production of a mutant Corynebacterium glutamicum with a pyridoxal 5-phosphate production pathway.

[0074] 2-1. Construction of expression vectors for pyridoxal kinase and pyridoxine 5'-phosphate oxidase

[0075] The chromosomal DNA of Escherichia coli K-12 MG1655 was used as a template for PCR with primers 33 and 34. The obtained PCR products were then subjected to overlapping PCR with primers 33 and 36 as a template to obtain fragments. The obtained PCR products were ligated to the pCES208H30 vector (Shin et al. Microb Cell Fact (2016) 15:174) treated with restriction enzymes BamHI and XbaI, and the obtained plasmid was named pCES208H30-pdxHK.

[0076] Here, the Wizard Genomic DNA Purification Kit (Promega, USA) was used to extract chromosomal DNA from E. coli, and the base sequences of the amplified genes are shown in Table 3 below, and the primers used for PCR are shown in Table 2 above. PCR was performed using a Thermocycler (TP600, TAKARA BIO Inc., Japan) in the presence of 1 unit of PrimeSTAR Max DNA Polymerase (Takara, Japan) in a reaction solution containing 100 μM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 1 pM of oligonucleotide, and 10 ng of template DNA.

[0077] Plasmids were constructed using NEBuilder HiFi DNA Assembly Master Mix (NEB, USA) and restriction enzymes HindIII (NEB, USA) and XbaI (NEB, USA).

[0078] 서열번호유전자 및 염기서열 (5'-3')1Escherichia coli유래, pdxK 유전자atgAGTAGTTTGTTGTTGTTTAACGATAAGAGTAGGGCACTGCAGGCGGATATCGTCGCCGTGCAGTCGCAGGTGGTTTACGGCAGCGTGGGCAACAGCATTGCCGTGCCTGCTATCAAACAGAACGGCCTGAATGTCTTTGCCGTGCCGACGGTATTGCTGAGCAATACGCCGCATTATGACACTTTCTACGGTGGTGCGATTCCGGACGAATGGTTTAGCGGCTATTTGCGTGCGCTTCAGGAGCGTGATGCGCTGCGCCAACTTCGTGCTGTAACCACGGGCTATATGGGAACGGCATCGCAAATCAAAATCCTTGCCGAGTGGCTGACTGCGCTACGCAAAGACCATCCTGACCTATTGATCATGGTCGATCCGGTGATTGGCGATATTGATAGCGGAATTTATGTCAAACCTGACCTTCCCGAAGCGTATCGACAATATTTACTGCCGCTGGCGCAGGGAATTACCCCCAATATCTTTGAGTTGGAAATCCTGACCGGTAAAAATTGCCGCGATCTCGACAGTGCCATTGCTGCCGCAAAAAGTCTGCTTTCAGACACATTAAAATGGGTGGTGGTTACCAGCGCCTCCGGTAATGAAGAAAATCAGGAGATGCAGGTTGTGGTGGTCACTGCCGACAGCGTGAATGTCATTTCCCATTCACGGGTAAAAACCGACCTGAAAGGGACTGGCGACCTGTTTTGTGCTCAGCTCATCAGTGGCTTGCTGAAAGGGAAGGCGTTAACCGATGCAGTGCACCGAGCGGGGTTGCGCGTACTGGAAGTGATGCGCTACACCCAGCAGCATGAGAGCGATGAATTGATTTTGCCGCCGCTGGCGGAAGCAtaa3Escherichia coli유래,pdxH 유전자atgTCTGATAACGACGAATTGCAGCAAATCGCGCATCTGCGCCGTGAATACACCAAAGGCGGGTTACGCCGCCGCGATCTTCCCGCCGATCCATTAACCCTTTTTGAACGTTGGCTCTCTCAGGCTTGTGAAGCCAAACTGGCGGACCCTACCGCGATGGTGGTCGCTACCGTGGATGAACATGGTCAGCCTTATCAGCGCATCGTTTTACTCAAACATTACGACGAAAAAGGCATGGTGTTTTACACCAACCTCGGCAGCCGTAAAGCACATCAAATCGAAAATAATCCGCGCGTTAGCCTGCTGTTCCCGTGGCATACCCTTGAGCGCCAGGTGATGGTGATCGGTAAAGCAGAACGACTTTCGACTCTCGAAGTGATGAAATATTTTCATAGCCGCCCGCGTGATAGCCAGATTGGTGCATGGGTTTCGAAGCAGTCCAGTCGCATTTCTGCCCGCGGTATCCTTGAAAGTAAATTCCTGGAGCTGAAGCAGAAGTTTCAACAGGGCGAAGTGCCATTGCCGAGCTTTTGGGGCGGTTTTCGCGTCAGCCTTGAACAGATTGAGTTCTGGCAGGGTGGTGAGCATCGCCTGCATGACCGCTTTTTGTACCAGCGTGAAAATGATGCGTGGAAGATTGATCGTCTTGCACCCtga,

[0079]

[0080] 2-2. 피리독살 인산화효소 및 피리독신 5'-인산 산화효소 발현 벡터 도입

[0081] As a parent strain for introducing pCES208H30-pdxHK, the 1,4-butanediol-producing strain WB04-P001 based on Corynebacterium glutamicum produced in Example 1 was used. For the transformation of the WB04-P001 strain, an electrocompetent cell production method modified based on the method of van der Rest et al. was used. First, the WB04-P001 strain was primary cultured in 10 ml of a medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol) to prepare a seed culture solution. Afterwards, OD was added to 100 ㎖ of medium (containing Beef Extract 10 g / ℓ, Brain Heart infusion 40 g / ℓ and sorbitol 30 g / ℓ, glycine 2.5 g / L, Isoniazid 400 mg / L, Tween80 100 ㎕ / L). 610 After inoculating the seed culture so that the value becomes 0.3, culture it at 30℃, 200 rpm for 1.5 to 2 hours to determine the OD 610The value was set to 0.5 to 0.6. The culture medium was left on ice for 30 minutes and centrifuged at 4°C, 3500 rpm for 5 minutes. The supernatant was discarded, and the precipitated strain was washed three times with 10% glycerol solution, and finally resuspended in 0.5 ml of 10% glycerol solution to prepare competent cells. Electroporation was performed using an electroporator from Bio-Rad. The pCES208H30-pdxHK vector was added to the competent cells prepared in the electroporation cuvette (0.2 mm), and then electroporated under the conditions of 2.5 kV, 200 Ω, and 12.5 μF. Immediately after the electric shock, 1 ml of regeneration medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol) was added and heat-treated at 46°C for 6 minutes. The tube was then placed on ice to cool, incubated at 30°C for 2 hours, and plated on selection medium (containing 10 g / ℓ of Beef Extract, 40 g / ℓ of Brain Heart infusion, and 30 g / ℓ of sorbitol, 20 g / ℓ of agar, and 30 μg / ℓ of kanamycin). Colonies were obtained after culturing in an incubator at 30°C for 2 days. Finally, a 1,4-butanediol-producing strain based on Corynebacterium glutamicum with a vector expressing the pdxH and pdxK genes was constructed and named WB04-P002.

[0082]

[0083] Example 3. Productivity evaluation of a 1,4-butanediol-producing strain with a pyridoxal 5-phosphate production pathway introduced.

[0084] The 1,4-butanediol productivity of a strain (WB04-P002) expressing pyridoxal phosphatase and pyridoxine 5'-phosphate oxidase was evaluated compared to the parent strain WB04-P001.

[0085] Each strain was inoculated into a flask medium (containing 10% glucose, 0.25% MgSO4, 2.5% yeast extract, 0.25% KH2PO4, 2.5% (NH4)2SO4, 100 ppm FeSO4, 2.5% peptone, 100 ug / L biotin, 25 ppm nicotinamide, 25 ppm CPN, and 1% pyridoxine) and incubated at 30°C for 24 h. After incubation, the culture medium was filtered through a 0.45 μm filter, and the 1,4-butanediol content in the culture medium was analyzed using high-performance liquid chromatography (HPLC) (Agilent, 1260 infinity II) equipped with a column (Avantor HPLC Column Apollo C18). A 0.1 M phosphate buffer was used as the mobile phase, and analysis was performed using an RI detector at 40°C and a flow rate of 0.8 mL / min for 15 minutes. The results are shown in Table 4 below.

[0086] Strain 1,4-butanediol (g / L) WB04-P0010.2 WB04-P0021.5

[0087] As shown in Table 4 above, the mutant microorganism (WB04-P002) expressing pyridoxal kinase and pyridoxine 5'-phosphate oxidase, which act in the biosynthetic pathway of pyridoxal 5'-phosphate, increased the production of 1,4-butanediol by 7.5 times compared to the parent strain without the biosynthetic pathway of pyridoxal 5'-phosphate.

[0088]

[0089] The present invention has been described above, focusing on preferred embodiments thereof. Those skilled in the art will appreciate that the present invention can be implemented in modified forms without departing from its essential characteristics. Therefore, the disclosed embodiments should be considered illustrative rather than limiting. The scope of the present invention is set forth in the claims, not the foregoing description, and all differences within the scope equivalent thereto should be construed as being encompassed by the present invention.

Claims

1. A mutant microorganism having improved 1,4-butanediol production ability, which expresses one or more enzymes selected from the group consisting of pyridoxal kinase and pyridoxine 5'-phosphate oxidase derived from Escherichia coli.

2. In claim 1, The above pyridoxal kinase is composed of an amino acid sequence of sequence number 2, A mutant microorganism wherein the above pyridoxine 5'-phosphate oxidase is composed of an amino acid sequence of sequence number 4.

3. In claim 1, The above mutant microorganism is a mutant microorganism belonging to the genus Corynebacterium.

4. A method for producing a mutant microorganism of claim 1, comprising a step of introducing a gene encoding at least one enzyme selected from the group consisting of pyridoxal kinase and pyridoxine 5'-phosphate oxidase derived from Escherichia coli.

5. In claim 4, The gene encoding the above pyridoxal kinase comprises the base sequence of sequence number 1, A method for producing a mutant microorganism, wherein the gene encoding the above pyridoxine 5'-phosphate oxidase comprises the base sequence of sequence number 3.

6. A step of culturing the mutant microorganism of claim 1 in a medium; and A method for producing 1,4-butanediol, comprising a step of recovering 1,4-butanediol from the mutant microorganism or a medium in which the mutant microorganism is cultured.