Optical imaging of nucleic acids

Abstract

The present disclosure relates to improved methods for imaging target nucleic acids by in situ sequencing. In particular, the present disclosure provides nucleic acid constructs (and compositions thereof), methods, systems, and kits for imaging at least one target nucleic acid in a single sample using in situ sequencing.

Description

[0001] OPTICAL IMAGING OF NUCLEIC ACIDS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] The application claims priority to U.S. Provisional Application No. 63 / 612,853, filed December 20, 2023, and U.S. Provisional Application No. 63 / 677,727, filed July 31, 2024, the contents of each of which are incorporated herein by reference in their entireties.

[0004] FIELD

[0005] The present disclosure relates to methods for optically imaging nucleic acids in single cells and compositions for use in the disclosed methods.

[0006] BACKGROUND

[0007] The analysis of nucleic acid expression and distribution is useful in understanding complex biological systems. In particular, the analysis of nucleic acid expression has facilitated the identification of genes involved in organismal growth and development, as well as the determining the causes and analyzing the progression of a wide variety of diseases. Conventional strategies for detecting and characterizing nucleic acids within the cellular context comprise in situ hybridization and in situ sequencing. These strategies, however, do not allow for the detection of nucleic acids in different cell types in complex biological systems to facilitate the identification of cellular phenotypes associated with the expression of such nucleic acids. Accordingly, there remains a need in the art for improved methods for the analysis of nucleic acids, e.g., across different cell types.

[0008] SUMMARY

[0009] The present disclosure provides, in certain embodiments, methods for imaging a target nucleic acid in a plurality of cells. In certain embodiments, a method of the present disclosure comprises (a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter, (e) performing an amplification process to amplify the target nucleic acid and (f) imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, the target nucleic acid comprises from about 4 to about 1,000 nucleotides. In certain embodiments, the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof. In certain embodiments, the target nucleic acid encodes a gRNA. In certain embodiments, the gRNA has an editing efficiency greater than about 60%, e.g., an editing efficiency greater than about 80% or an editing efficiency greater than about 90%.

[0010] The present disclosure further provides a method for performing a genomic screen that comprises (a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid encoding a gRNA, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the gRNA using the first promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) transcribing the gRNA in at least one cell of the plurality of fixed cells using the second promoter, (e) performing an amplification process for amplifying the gRNA; (f) imaging the amplified gRNA in the at least one cell and (g) analyzing a change in a characteristic of the at least one cell of the plurality of cells associated with expression of the gRNA. In certain embodiments, the gRNA has an editing efficiency greater than about 60%, e.g., an editing efficiency greater than about 80% or an editing efficiency greater than about 90%.

[0011] In certain embodiments, the plurality of cells comprises at least about 1,000 cells.

[0012] In certain embodiments, providing the plurality of cells comprises contacting the plurality of cells with the nucleic acid construct.

[0013] In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter, e.g., as a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0014] In certain embodiments, the first promoter is a promoter for expression in live cells. In certain embodiments, the first promoter is a Pol III or a Pol II promoter. In certain embodiments, the first promoter is a Pol III promoter. In certain embodiments, the first promoter is a Pol II promoter. For example, but not by way of limitation, the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof. In certain embodiments, the first promoter is a U6 promoter. In certain embodiments, the second promoter is a promoter for expression in fixed cells. In certain embodiments, the second promoter is a promoter for a phage RNA polymerase. In certain embodiments, the second promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter and a combination thereof. In certain embodiments, the second promoter is a T7 promoter. In certain embodiments, the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

[0015] In certain embodiments, the amplification process is a rolling circle amplification process. In certain embodiments, the rolling circle amplification process comprises (a) contacting the plurality of cells with (i) a padlock probe comprising two nucleotide sequences that are complementary to the target nucleic acid and (ii) a ligase to generate a circular DNA template; and (b) performing a rolling circle amplification process to generate an amplicon from the circular DNA template.

[0016] In certain embodiments, the plurality of cells is permeabilized prior to performing the amplification process.

[0017] In certain embodiments, the plurality of cells is decrosslinked prior to performing the amplification process.

[0018] In certain embodiments, fixing the plurality of cells to generate a plurality of fixed cells comprises contacting the plurality of cells with an aldehyde fixative. In certain embodiments, the aldehyde fixative is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof. In certain embodiments, the fixative is paraformaldehyde.

[0019] In certain embodiments, the plurality of cells is obtained from a tissue sample. In certain embodiments, the plurality of cells comprises at least two different cell types, e.g., pooled together.

[0020] In certain embodiments, the amplified target nucleic acids are imaged by in situ sequencing. In certain embodiments, the amplified target nucleic acids are imaged by fluorescent in situ hybridization. In certain embodiments, the nucleic acid construct further comprises a polynucleotide encoding a nuclease. In certain embodiments, the nucleic acid construct further comprises a barcode. In certain embodiments, the barcode is located downstream of the target nucleic acid.

[0021] In certain embodiments, the plurality of cells comprises a second cell that comprises a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

[0022] In certain embodiments, the plurality of cells comprises a second cell that comprises a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid encoding a second gRNA, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

[0023] In certain embodiments, a method of the present disclosure further comprises analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed prior to imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid is performed after fixation of the plurality of cells and prior to transcription of the target nucleic acid, e.g., using the second promoter of the hybrid promoter. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed after fixation but prior to decrosslinking.

[0024] In certain embodiments, the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels (e.g., mRNA expression levels), protein expression levels, nucleic acid modifications (e.g., methylation), post-translational modifications (e.g., phosphorylation, ubiquitination and / or glycosylation), activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity (e.g., enzymatic cleavage), chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof. In certain embodiments, the characteristic is protein expression levels. In certain embodiments, the characteristic is protein expression localization. In certain embodiments, the characteristic is nucleic acid expression levels. In certain embodiments, the characteristic is nucleic acid localization.

[0025] In certain embodiments, a method of the present disclosure further comprises performing an immunofluorescence process for detecting one or more target proteins, e.g., performing an immunofluorescence process for detecting one or more, two or more, three or more, four or more or five or more target proteins. In certain embodiments, the immunofluorescence process for detecting the one or more target proteins is performed after fixation of the plurality of cells and prior to transcription of the target nucleic acid, e.g., using the second promoter of the hybrid promoter. In certain embodiments, the immunofluorescence process for detecting the one or more target proteins is performed after fixation but prior to decrosslinking.

[0026] The present disclosure further provides kits for performing a method described herein. In certain embodiments, a kit of the present disclosure comprises at least one container comprising a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter. In certain embodiments, the first promoter is a promoter for expression in live cells. In certain embodiments, the first promoter is a Pol III or a Pol II promoter. In certain embodiments, the first promoter is a Pol III promoter. In certain embodiments, the first promoter is a Pol II promoter. In certain embodiments, the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof. In certain embodiments, the first promoter is a U6 promoter. In certain embodiments, the second promoter is a promoter for expression in fixed cells. In certain embodiments, the second promoter is a promoter for a phage RNA polymerase. In certain embodiments, the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter and a combination thereof. In certain embodiments, the phage promoter is a T7 promoter. In certain embodiments, the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

[0027] In certain embodiments, the target nucleic acid in a nucleic acid construct of a kit of the present disclosure comprises from about 4 to about 1,000 nucleotides. In certain embodiments, the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi- interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof. In certain embodiments, the target nucleic acid encodes a gRNA. In certain embodiments, the nucleic acid construct further comprises a polynucleotide encoding a nuclease. In certain embodiments, the nucleic acid construct further comprises a barcode.

[0028] In certain embodiments, a kit of the present disclosure can further include a reducing agent, e.g., DTT. For example, but not by way of limitation, a kit of the present disclosure can include a reducing agent, e.g., DTT, in a container and / or within a buffer in a container.

[0029] The present disclosure further provides a nucleic acid construct comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence and a target nucleic acid, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct. In certain embodiments, the first promoter is a promoter for expression in live cells. In certain embodiments, the first promoter is a Pol III promoter or a Pol II promoter. In certain embodiments, the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75 J promoter, EF- la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof. In certain embodiments, the first promoter is a U6 promoter. In certain embodiments, the second promoter is a promoter for expression in fixed cells. In certain embodiments, the second promoter is a promoter for a phage RNA polymerase. In certain embodiments, the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof. In certain embodiments, the phage promoter is a T7 promoter. In certain embodiments, the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18. In certain embodiments, the target nucleic acid comprises from about 4 to about 1,000 nucleotides. In certain embodiments, the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof. In certain embodiments, the target nucleic acid encodes a gRNA. In certain embodiments, the gRNA has an editing efficiency greater than about 60%, e.g., an editing efficiency greater than about 80% or an editing efficiency greater than about 90%. In certain embodiments, the nucleic acid construct further comprises a polynucleotide encoding a nuclease. In certain embodiments, the nucleic acid construct further comprises a barcode. In certain embodiments, the barcode is located downstream of the target nucleic acid (e.g., 3’ to the target nucleic acid).

[0030] The present disclosure further discloses a nucleic acid comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter, wherein the nucleic acid comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 7-18.

[0031] The present disclosure further provides a composition comprising a nucleic acid construct disclosed herein.

[0032] The present disclosure further provides a method for imaging a target nucleic acid in a plurality of cells that includes (a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising (i) a target nucleic acid and (ii) a hybrid promoter located upstream to the target nucleic acid in the nucleic acid construct, wherein the hybrid promoter comprises a first promoter and a second promoter, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter of the hybrid promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter of the hybrid promoter, (e) performing an amplification process to amplify the target nucleic acid, and (f) imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, imaging the amplified target nucleic acid comprises imaging the target nucleic acid by in situ sequencing. In certain embodiments, the method further comprises analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid. In certain embodiments, the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed prior to imaging the amplified target nucleic acid (e.g., by in situ sequencing) in the at least one cell. In certain embodiments, the characteristic is protein expression levels. In certain embodiments, the characteristic is nucleic acid expression levels. In certain embodiments, the method further includes performing an immunofluorescence process for detecting one or more target proteins, e.g., one or more target proteins in one or more cells of the plurality of cells. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed prior to imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid is performed after fixation of the plurality of cells and prior to transcription of the target nucleic acid, e.g., using the second promoter of the hybrid promoter. In certain embodiments, the immunofluorescence process for detecting the one or more target proteins is performed after fixation of the plurality of cells and prior to transcription of the target nucleic acid, e.g., using the second promoter of the hybrid promoter. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed after fixation but prior to decrosslinking.

[0033] The present disclosure further provides a method for imaging a target nucleic acid in a plurality of cells, comprising: (a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, (c) fixing the plurality of cells in a fixative comprising aldehyde to generate a plurality of fixed cells, (d) decrosslinking the plurality of fixed cells to generate a plurality of decrosslinked cells, (e) transcribing the target nucleic acid in the at least one cell of the plurality of decrosslinked cells using the second promoter of the hybrid promoter, (f) performing an amplification process to amplify the target nucleic acid, and (g) imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, the aldehyde is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof. In certain embodiments, imaging the amplified target nucleic acid comprises imaging the target nucleic acid by in situ sequencing. In certain embodiments, the method further comprises analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid. In certain embodiments, the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed prior to imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid is performed after fixation of the plurality of cells and prior to transcription of the target nucleic acid, e.g., using the second promoter of the hybrid promoter. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed after fixation but prior to decrosslinking. In certain embodiments, analyzing a change in a characteristic of one or more cells is performed after fixation but prior to decrosslinking. In certain embodiments, the characteristic is protein expression levels. In certain embodiments, the characteristic is nucleic acid expression levels. In certain embodiments, the method further includes performing an immunofluorescence process for detecting one or more target proteins, e.g., one or more target proteins in one or more cells of the plurality of cells. In certain embodiments, the immunofluorescence process for detecting one or more target proteins is performed after permeabilization of the plurality of cells and prior to transcription of the target nucleic acid using the second promoter of the hybrid promoter. In certain embodiments, the immunofluorescence process for detecting one or more target proteins is performed after fixation but prior to decrosslinking.

[0034] The present disclosure further provides a method for analyzing one or more characteristics of a plurality of cells. In certain embodiments, the method includes (a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, and wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter of the hybrid promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) detecting one or more characteristics of the at least one cell of the plurality of fixed cells, (e) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter of the hybrid promoter, (f) performing an amplification process to amplify the target nucleic acid, (g) imaging the amplified target nucleic acid in the at least one cell and (h) comparing the characteristic of the at least one cell expressing the target nucleic acid to the characteristic of one or more cells in the plurality of cells that does not express the target nucleic acid to determine the change in the characteristic of the at least one cell expressing the target nucleic acid. In certain embodiments, the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof. In certain embodiments, the method further includes decrosslinking the plurality of cells prior to performing the amplification process. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

[0035] The present disclosure further provides systems for performing the methods disclosed herein.

[0036] BRIEF DESCRIPTION OF THE FIGURES

[0037] FIG. 1 provides a schematic of an exemplary method according to the present disclosure that can comprise fixation and permeabilization of cells followed by decrosslinking. The exemplary method can further comprise performing T7 in vitro transcription followed by in situ sequencing to image the target nucleic acid. In certain embodiments, in situ sequencing can comprise performing a reverse transcription process, a gap filling process, rolling circle amplification (RCA) and sequencing by synthesis.

[0038] FIG. 2 provides immunofluorescence (Left panel: bottom left, Right panel: Top Left), DAPI staining (Left panel: Top Left, Right panel: Bottom left) and in situ sequencing images of a nucleic acid in A549 cells and neurons using a previously known in situ sequencing technique. Bases sequenced are specified in the inset text on the in situ sequencing figures.

[0039] FIG. 3A provides a schematic of an exemplary nucleic acid construct according to the present disclosure.

[0040] FIG. 3B provides exemplary promoter sequences for use in the nucleic acid constructs of the present disclosure.

[0041] FIG. 4 shows that the incorporation of the T7 promoter into the U6 promoter does not affect the editing efficiency of the gRNAs under control of the U6 promoter. U6,r / refers to the wild type form of the U6 promoter and U6r / , U6V2, U6V3, U6V4and U61corresponds to the T7-U6 promoters shown in FIG. 3B.

[0042] FIG. 5A provides fluorescence in situ hybridization images showing that the incorporation of the T7 promoter into the U6 promoter resulted in increased expression of gRNAs that can be detected by in situ sequencing (ISS) in A549 cells compared to the standard ISS technique after T7 addition. Left: U6 WT, Right: U6 T7. Diagonal division in panel corresponds to a higher display contrast on the bottom right quadrant for the same image. Left and right images are contrasted identically. FIG. 5B provides fluorescence in situ hybridization images showing that the incorporation of the T7 promoter into the U6 promoter resulted in increased expression of gRNAs transcripts after T7 in vitro transcription in A549 cells.

[0043] FIG. 6 provides a schematic of an exemplary screen in primary cells using the presently disclosed methods.

[0044] FIG. 7 shows that many NFKB pathway components were identified using the screen shown in FIG. 6.

[0045] FIG. 8 provides a schematic of an exemplary screen using the presently disclosed methods.

[0046] FIG. 9A provides an overview of an exemplary method of the present disclosure.

[0047] FIGS. 9B-9C show the CRISPR editing efficiency (FIG. 9B) and in vitro transcription activity (FIG. 9C). Distribution of Target 1 expression levels (FIG. 9B; control-normalized Z-scores) and IVT+ISS nuclear intensity (FIG. 9C; single cell fluorescence intensity of sgRNA reads from each promoter variant) for each promoter design (FIG. 9B, left; numbers indicate the position of the T7 promoter insertion and U6 truncations with respect to the U6 promoter start) in A549 cells. Top: a standard CROPseq Target 1 sgRNA (gray). Dotted lines: Target 1 distribution in wild-type (WT) cells. Knockout efficiency is labeled as % population below 0 (vertical line). At least k=5,517 cells per promoter; 10,236 on average. Asterisks: chosen Perturb View construct.

[0048] FIG. 9D illustrates that Perturb View enables bright in vitro transcription from the U6 promoter with minimal modifications to the U6 sequence. Top, WT U6 promoter and Perturb View construct sequences. Bottom, A549 cells post in vitro transcription from the original CROP-Seq and Perturb View vector (Green = G base, scale bar, 50 pm).

[0049] FIG. 9E provides a frame-shift reporter screen to determine sensitivity and specificity of barcode detection. Left, Representative image of cells with immunofluorescence (IF) of HA-staining (right) or guide decoding with screen assignments (left, TP, FN and TN labeled by presence or absence of HA epitope and the first base of reads) (scale bar, 25 pm).

[0050] FIGS. 9F-9G highlight the improved sensitivity and precision of Perturb View. Sensitivity (purple) and precision (blue) of barcode detection (y axis) by conventional ISS- based sgRNA detection and Perturb View (x axis) at 10X (FIG. 9F) and 4X (FIG. 9G) magnification (n=4 independent replicates; SD error bar, each dot representing a replicate).

[0051] FIG. 9H shows that Perturb View performs well across primary and iPSC-derived cells. Left, Representative images of sgRNA barcode detection by conventional ISS and Perturb View across cell types (Scale bar, 25 pm). All images are acquired identically except images denoted by an asterisk (* denotes a four-fold longer exposure duration to account for the drastically dimmer signal of some cell types in standard ISS experiments). Right, Fraction of cells positive for sgRNA signal (>1 sgRNA read per cell, mean of well replicates with error bar indicating SD, each dot representing a replicate) across cell types. n>2 for iAstrocytes (mean £=2,107 cells per replicate), n=2 for IMR90 fibroblasts (k=67,547 cells), n=9 for iNeurons ( =15,332 cells), n>2 for immortalized macrophages (k=175,182 cells), n>5 for T cells (£=4518 cells).

[0052] FIG. 10A shows the varied activity of the CROP-Seq vector by HCR FISH in primary cells. Left, HCR FISH of CROP-Seq expressed transcript (green; detected with FISH probes against puromycin and U6 promoter regions; Table 1C) across different cell lines (scale bar, 200 pm). Right, CROP-Seq transcript density in A549 (left) and mouse BMDM (right) cells (scale bar, 50 pm). All cells were transduced at low MOI and puromycin-selected.

[0053] FIG. 10B highlights that the position of the T7 promoter dramatically affects IVT- enhanced ISS signal. Distribution of median single cell nuclear intensity following IVT in the original U6 promoter (top; gray, n=62,321 cells pooled from three well replicates), T7 promoter in place of the U6 promoter (orange, n=48,123), and T7 promoter upstream of U6 promoter (blue, n=53,777). Bottom, representative cellular images from each construct (scale bar, 25 pm).

[0054] FIG. 10C shows that the U6 / T7 promoter (U6pub) has lower CRISPR editing activity than the unmodified U6 promoter (U6WT). Distribution of Target 1 expression by flow cytometry for each construct. Fraction of knocked-out cells (thresholded by the vertical line) is noted on left. £=34,950 cells, at least 11,247 cells per condition.

[0055] FIG. 10D shows that the editing efficiency of the Perturb View vector is identical to wild-type U6 promoter (U6WT) in A549 cells, immortalized macrophages and fibroblasts. Distribution of distribution of target gene expression of each construct in A549 cells (top; Target 1, n=3 independent infection replicates combined; 876,505 cells, at least 61,250 cells per replicate and condition), primary IMR90 fibroblasts (bottom; Target 1, 17,497 cells, at least 5,524 cells per condition) and immortalized macrophages (right; Target 2, sgl and sg2: separate guide replicates; 126,093 cells, at least 20,844 cells per condition). Fraction of knocked-out cells (thresholded by the vertical line) is noted on left.

[0056] FIGS. 10E-10F show that de-crosslinking and IVT duration impact sensitivity and precision of barcode detection. Mean Sensitivity (purple) and precision (blue) by at different durations of decrosslinking (FIG. 10E, n=4 well replicates (dots), at least 9,393 cells per replicate) or IVT (FIG. 10F, n=4 well replicates (dots), at least 9,387 cells per replicate). Error bars: SD. Top, representative cellular images from each condition (scale bar, 25 pm).

[0057] FIG. 10G shows that Perturb View enables in situ sequencing at 4x magnification. Left, whole well (top; scale bar, 1 mm) or zoomed image (bottom; scale bar, 50 pm) representative image acquired at 4X magnification with either conventional ISS (left) or Perturb View (right). All images are contrasted identically. Heat decrosslinking prior to Perturb View results in increased nuclear DAPI intensity.

[0058] FIG. 10H provides the gating strategy for the CRISPR editing efficiency flow cytometry assay of Target 1. Yellow = Gated cells, Blue = All events.

[0059] FIG. 101 shows the mean sensitivity (blue) and precision (orange) with (65°C) or without (25°C) decrosslinking in methanol-fixed cells (left) or PFA-fixed cells (right).

[0060] FIG. 10J shows that DTT rescues IVT efficiency at low T7 polymerase concentration in MCF7 cells. Top, representative cellular images from each condition (scale bar, 25 pm). Bottom, Population mean of the maximum normalized intensity of in situ sequencing spots. Each dot represents technical replicates (n > 2). Error bars: SD.

[0061] FIG. HA provides an overview of an exemplary NFKB screen in primary mouse BMDMs.

[0062] FIG. 11B illustrates that Perturb View but not conventional OPS sensitively detects sgRNA barcodes in BMDMs. Left, Reads (fluorescent signals) from standard ISS (top) and Perturb View (bottom) in BMDMs (Scale bar, 25 pm). Right, Mean fraction of cells with detectable reads (y axis) from standard ISS (conventional OPS, n=2 technical replicates), standard ISS after IF (n=2 technical replicates) and Perturb View after IF (n=2 replicates pooled from three independent experiments. Replicates with open dots were phenotyped and genotyped a week after fixation). Error bars: SD.

[0063] FIGS. 11C-11E provides the shared and context-specific hits from Perturb View OPS in three stimuli. Significance (-logio(FDR), y axis) and effect size (normalized change in nuclear p65 intensity) for each perturbation (dot) in TNFa (FIG. 11C), IL- 1 P (FIG. 1 ID), and LPS (FIG. HE) stimuli, colored for positive (blue; FDR < 0.05), negative (orange; FDR < 0.05), control (red, non-targeting sgRNA and non-essential genes) perturbations. (£=1940±541, 2874±809, and 990±288 (mean±SD) cells per targeting gene from n=3, 2 and 1 well replicates in TNFa (FIG. 11C), IL-ip (FIG. HD), and LPS (FIG. HE), respectively. FIG. 11F provides an exemplary workflow for multimodal NFKB Perturb View screen using RNA FISH (HCR) and IF (IBEX). Representative image of BMDM assayed in order by HCR FISH (left), immunofluorescence (middle), and Perturb View (right).

[0064] FIG. 11G shows successful sgRNA barcode detection in multimodal Perturb View, but not conventional OPS. Mean percent of cells with detected barcode (y axis) in conventional OPS, conventional OPS after FISH and IF, and multi-modal Perturb View (x axis). Error bars: SDXX. Dots: each well and condition.

[0065] FIGS. 11H-11I show co-functional perturbation modules based on multimodal Perturb View. PHATE embedding of perturbation profiles (dots) following TNFa (FIG. 11H) or IL-ip (FIG. HI) stimulus, sized by q value of perturbation effect and colored by cluster or as controls. Gene labels are shown for q-value < 0.02 in selected clusters (1 and 6 in (FIG. 11H); 1, 2, 4 and 6 in (FIG. HI)).

[0066] FIG. 11 J provides a schematic of an exemplary workflow for a multimodal NFKB Perturb View screen using RNA FISH (HCR) and IF (IBEX).

[0067] FIG. 12A shows agreement in sgRNA detection in Perturb View and NGS. Perturb View ISS cell counts (y axis) and NSG read count of the cell library (x axis) for each perturbation barcode (dot). Top left: Pearson’s r.

[0068] FIG. 12B highlights the intersection of hit genes between TNFa, ILip, and LPS Perturb View screens (circles) of NFKB translocation in primary BMDMs.

[0069] FIGS. 12C-12E show the cumulative distribution functions (CDFs) of robust z- scores for p65 nuclear intensity in response to LPS (left), TNFa (middle), or ILip (right) for each of four guides (colored curves; n=cell number per guide) targeting the genes Map3k7 (FIG. 12C), Prkarla (FIG. 12D), and Tnfrsfla (FIG. 12E), compared to cells with non-targeting or non-essential controls (gray line (combined); shading standard deviation of robust z-scores).

[0070] FIG. 12F shows PHATE embeddings of RNA / protein joint profiles (dots) for each sgRNA in the TNFa (left) or ILip (right) screen targeting a gene (color) or controls (grey). Gene names are shown for each guide whose 5 nearest neighbors contains another guide targeting the same gene.

[0071] FIG. 12G shows the distribution of cosine similarity of the phenotypic profiles embeddings derived from joint RNA / protein profiling for random pairs of guides (“-”, blue) and either impactful guides targeting the same gene in the (orange; top) or targeting Olfir genes (orange bottom). FIG. 12H shows the contribution of different molecular phenotypes to perturbation impact. Impact score (p-values UNIT, color bar) for each perturbed gene (row) in the TNFa (left), ILip (middle), or LPS (right) screen, when assessed only based on one imaging feature (RNA, protein or DAPI; columns). Rows and columns are clustered by hierarchical clustering.

[0072] FIG. 121 shows representative cellular images of p65 staining (top) and segmentation results (bottom) (Scale bar, 25 pm).

[0073] FIG. 12J shows that PerturbView enables efficient sgRNA recovery after multiplexed imaging techniques. Left, BMDMs were stained with F4 / 80 repeatedly using 4i, IBEX and cycIF (Scale Bar, 50 pm). Middle, Representative images of in situ sequencing results after 6 rounds of staining (Scale Bar, 50 pm). Right, Fraction of cells positive for sgRNA signal (>1 sgRNA read per cell, mean of well replicates with error bar indicating SD. n=2 independent replicates) across conditions.

[0074] FIG. 12K shows that CDFs of phospho-rpS6 intensity in response to TNFa for four guides (colored curves), compared to cells with non-targeting or non-essential controls (gray line (combined); shading standard deviation) (Top). FDRs were computed among the gene list in FIG. 12H. Representative phospho-rpS6 images under perturbations are shown (Bottom). Two cells were sampled from each of a 10-percentile group (according to the mean cellular phospho-rpS6 level) and arranged from low (left) to high (high).

[0075] FIG. 13A provides representative H&E staining image (left, scale bar = 1mm) and PerturbView detection of sgRNAs (right, colored bases scale bar = 1mm) of a DLD-1 subcutaneous xenograft. Right, single cell PerturbView detection in an inset zoom (scale bar = 200 pm).

[0076] FIGS. 13B-13C provide the mean percent of sgRNA library (FIG. 13B, y axis) and mean percentage of cells with detectable sgRNAs (FIG. 13C, y axis), captured by standard ISS or by PerturbView (x axis) in FFPE (light green) or fresh frozen (FF) (dark green) subcutaneous tumors. n=2 independent experiments, Error bars: SD.

[0077] FIG. 13D provides the frequency of each sgRNA (dots; normalized counts) estimated by NGS of the plasmid library (x axis) or PerturbView (y axis) of FF (dark green) or FFPE (light green) samples. n=2 for each FF and FFPE treatment. Pearson’s r is noted.

[0078] FIG. 13E provides a tissue section image of Xenium spatial transcriptomics (left; 377 human pan-cancer markers) followed by sgRNA identification with PerturbView (right). FIGS. 13F-13G provide a tumor section colored by sgRNA clone (FIG. 13F), Shannon index computed from clonal analysis (FIG. 13G, top) or low, middle and high Shannon diversity (FIG. 13G, bottom).

[0079] FIG. 13H shows the genes (columns) that are differentially expressed between regions with high and low Shannon diversity (rows). n=4 tissue sections from a single tumor.

[0080] FIG. 131 shows a representative image of PRKDC immunofluorescence for staining human cells. Mouse cells (outer rim) or necrotic regions (central region) show low PRKDC staining. Scale bar, 1 mm.

[0081] FIG. 13J shows spatial transcriptome and barcode detection in UMAP and spatial domains. From left to right: (1) UMAP based on transcriptome with each color and number represents a Leiden cluster at a resolution of 0.5; (2) corresponding Leiden clusters visualized in spatial domain; (3) Total transcript counts in each cell; (4) barcode’s minimum hamming distance in spatial domain (showing hamming distance up to 2).

[0082] FIG. 13K shows tumor sections profiled (scale bar, 1 mm), colored by Shannon diversity (top) or corresponding diversity groups (bottom) for all analyzed sections aside from the one shown in FIG. 13H.

[0083] FIG. 13L shows genes (columns) that are differentially expressed between regions with high and low Shannon diversity (rows) for each tumor section (n=2 consecutive sections per tumor).

[0084] FIG. 13M shows sgRNA detection efficiency in DLD-1 (PRKDC+) xenograft model. Left, representative image of DAPI (magenta), PRKDC (cyan) and nuclear segmentation (yellow) with (+) or without (-) detected sgRNAs. Scale bar, 50 pm. Right, mean percentage of cells with detectable sgRNAs (y axis) in low (lower quartile) and high (upper quartile) PRKDC+ population (n=2 tumor sections, Error bars: SD).

[0085] FIG. 13N provides an exemplary workflow that include Perturb View and Xenium. Left: DLD-1 cells carrying a 100 NTC barcode library were implanted to a mouse xenograft model, followed by Xenium spatial transcriptomics, and in situ sequencing of sgRNAs with Perturb View. Right, UMAP embedding of single cell profiles (dots, top) or zoomed in tumor section (bottom, scale bar, 200 pm) from Xenium colored by Leiden clusters (left) or sgRNA identity (right).

[0086] FIG. 14A shows the barcode mapping rate (y axis, fraction of assigned reads at a Hamming distance < 1 to the pre-defined sgRNA lookup table) for conventional ISS and Perturb View (x axis) in FF and FFPE tumor tissue (n=4). FIG. 14B shows the Fraction of barcodes (x axis) mapped at different Hamming distances (colors) in each of four samples (y axis).

[0087] FIG. 14C shows the clonal aggregation of gene expression to enhance complexity in Xenium measurements. Distribution of number of unique genes detected (x axis) by Xenium in single cells or per clone (in aggregate) (x axis).

[0088] FIG. 14D shows the clonal maps and associated expression agree across serial sections. Clonal maps colored by Shannon diversity index of two consecutive sections (left and right) in each of two tumors (top and bottom).

[0089] FIG. 14E shows the genes (columns) that are differentially expressed between regions with high and low Shannon diversity (rows) for each of two consecutive tissue sections in each of two tumors (left vertical line indicates a pair of adjacent sections).

[0090] DETAILED DESCRIPTION

[0091] The present disclosure relates, in certain embodiments, to methods for the imaging of nucleic acids, e.g., gRNAs, expressed in sample, e.g., a sample comprising a plurality of cells. The present disclosure further provides, in certain embodiments, nucleic acid constructs and other compositions for performing the disclosed methods.

[0092] In certain embodiments, methods of the present disclosure allow for the visualization of a target nucleic acid in a cell. In certain embodiments, the cell is present within a plurality of cells. In certain embodiments, method further comprises the correlation of the presence of the target nucleic acid to the characteristics of the cell. For example, but not by way of limitation, methods of the present disclosure can be used to determine phenotypic characteristics of cells present in a sample (e.g., in a plurality of cells) that express the target nucleic acid.

[0093] In certain embodiments, methods of the present disclosure can be used in screening methods. For example, but not by way of limitation, methods of the present disclosure can be used in genomic screening, e.g., for performing optical genetic screens. In certain embodiments, the detection of gRNA expression in a cell (present within a plurality of cells) can be associated with the phenotype and / or genotype of the cell to determine the function of the gene targeted by the gRNA.

[0094] As described herein, known methods of in situ sequencing have been shown to be inefficient for imaging nucleic acids in certain contexts, e.g., in complex biological systems such as primary cell lines and tissue. In addition, the requirement to keep RNA barcodes intact through phenotyping, e.g., spatial transcriptomics, proteomics and cell painting, prevents the reliable detection of RNA barcodes after high information content readouts are applied to cells. Also, as shown in FIG. 2, the use of in situ sequencing is not compatible with many cell types, which can limit the use of in situ sequencing in biological systems that comprise a plurality of cell types. The present disclosure, however, provides methods for imaging target nucleic acids in a plurality of cell types, as shown in FIG. 4B, FIG. 9G and FIG. 13A. In addition, methods of the present disclosure provide for the imaging of target nucleic acids, including target nucleic acids in complex biological systems. For example, such complex biological systems can comprise a plurality of diverse cells such as those in situ. As shown in FIGS. 13A-13H, the presently disclosed methods allow for in situ sequencing in a complex biological system such as a cancer xenograft model in combination with phenotypic analyses (e.g., analysis of gene expression). In certain embodiments, the disclosed method enables complex genotype / phenotype investigations such as understanding modifications to therapeutically relevant cell types (e.g., T cells, neurons, macrophages, etc.) to better enable optimizations of these cell types for cell therapy applications.

[0095] The present disclosure is based, in part, on methods comprising the in vitro transcription of a target nucleic acid introduced into a cell, followed by amplification of the transcribed target nucleic acid, to allow for the robust visualization of the target nucleic acid in the cell via in situ sequencing. The present disclosure is further based, in part, on the use of a hybrid promoter that allows amplification of a target nucleic acid in fixed cells. The present disclosure is also based, in part, on the use of a hybrid promoter that allows the expression of a gRNA in live cells and transcription of the gRNA in fixed cells without effecting the editing efficiency of the gRNA. The present disclosure is further based, in part, on using decrosslinking to allow the use of standard phenotyping protocols, e.g., use of antibodies, oligonucleotides and dyes for phenotyping, to be performed prior to performing in situ sequencing to visualize target nucleic acids. In addition, decrosslinking allows for the use of additional types of fixatives, e.g., including aldehyde-based fixatives, prior to performing in vitro transcription.

[0096] For clarity, but not by way of limitation, the detailed description of the presently disclosed subject matter is divided into the following subsections:

[0097] I. Definitions;

[0098] II. Nucleic Acid Constructs and Compositions Thereof;

[0099] III. Cells;

[0100] IV. Methods of Imaging Nucleic Acids; and V. Kits;

[0101] VI. Systems; and

[0102] VII. Exemplary Embodiments.

[0103] I. DEFINITIONS

[0104] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which the subject matter of the present disclosure belongs. The following references provide one of skill with a general definition of many of the terms used in the present disclosure: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

[0105] As used herein, the use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification can mean “one,” but it is also consistent with the meaning of “one or more,” “at least one,” and “one or more than one.”

[0106] The term “about” or “approximately” means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, z.e., the limitations of the measurement system. For example, “about” can mean within 3 or more than 3 standard deviations, per the practice in the art. Alternatively, “about” can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value.

[0107] The term “amplification process” refers generally to any process where a portion of a nucleic acid is copied or replicated into at least one additional nucleic acid molecule.

[0108] The term “antibody” herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) and antibody fragments so long as they exhibit the desired antigen-binding activity.

[0109] An “antibody fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments comprise but are not limited to Fv, Fab, Fab’, Fab’- SH, F(ab’)2, diabodies, linear antibodies, single-chain antibody molecules (e.g., scFv) and multispecific antibodies formed from antibody fragments.

[0110] The terms “comprise(s),” “comprise(s),” “having,” “has,” “can,” “contain(s)” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms or words that do not preclude additional acts or structures. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0111] The term “coupled” can refer to the connecting or uniting of two or more components by an interaction, bond, link, force or tie in order to keep two or more components together. In certain embodiments, the term “coupled” encompasses either direct or indirect binding where, for example, a first component is directly bound to a second component, or one or more intermediate molecules are disposed between the first component and the second component. Exemplary bonds comprise covalent bonds, ionic bonds, van der Waals interactions and other bonds identifiable by a skilled person.

[0112] The terms “detect” or “detection,” as used herein, indicate the determination of the existence and / or presence of a target, e.g., a nucleic acid target, in a limited portion of space, including but not limited to a sample. The terms “detect” or “detection,” as used herein, can comprise determination of chemical and / or biological properties of the target, including but not limited to ability to interact, and in particular bind, other compounds, ability to activate another compound and additional properties identifiable by a skilled person upon reading of the present disclosure. The detection can be quantitative or qualitative. A detection is “quantitative” when it refers, relates to, or involves the measurement of quantity or amount of the target or signal (also referred as quantitation), which comprises but is not limited to any analysis designed to determine the amounts or proportions of the target or signal. A detection is “qualitative” when it refers, relates to, or involves identification of a quality or kind of the target or signal in terms of relative abundance to another target or signal, which is not quantified.

[0113] The term “editing efficiency,” as used herein, refers to the total number of sequence reads with insertions or deletions of nucleotides into a target region of interest over the total number of sequence reads following cleavage by an RNA-guided nuclease.

[0114] The terms “guide RNA,” “gRNA” or “gRNA molecule,” as used interchangeably herein, refer to a nucleic acid that promotes the specific targeting or homing of an RNA- guided nuclease to a target nucleic acid. As used herein, the term “hybridization,” refers to the process in which two singlestranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide.

[0115] The terms “hybrid promoter” or “chimeric promoter,” used interchangeably herein, refer to a promoter sequence, e.g., a promoter nucleotide sequence, that comprises nucleotide sequences (or portions thereof) derived from at least two different promoters. For example, but not by way of limitation, a “hybrid promoter” of the present disclosure comprises a nucleotide sequence (or a portion thereof) derived from at least one promoter for expressing a nucleic acid in live cells and comprises a nucleotide sequence (or a portion thereof) derived from at least one promoter for expressing the nucleic acid in fixed cells. In certain embodiments, a hybrid promoter of the present disclosure includes a nucleotide sequence (or a portion thereof) derived from at least one mammalian promoter (e.g., for expressing a nucleic acid in live cells) and comprises a nucleotide sequence (or a portion thereof) derived from at least one bacteriophage promoter (e.g., for expressing the nucleic acid in fixed cells). In certain embodiments, a hybrid promoter is a promoter that includes a nucleotide sequence (or a portion thereof) derived from a second promoter that is incorporated into the nucleotide sequence (or a portion thereof) derived from a first promoter.

[0116] As used herein, the term “imaging” refers to microscopy. In certain embodiments, microscopy comprises immunofluorescence microscopy. In certain embodiments, microscopy comprises optical microscopy.

[0117] As used herein, the term “individual” or “subject” refers to a vertebrate or an invertebrate, such as a human or non-human animal, for example, a mammal. Mammals comprise, but are not limited to, humans, non-human primates, farm animals, sport animals, rodents and pets. Non-limiting examples of non-human animal subjects comprise rodents such as mice, rats, hamsters, guinea pigs, rabbits, dogs, cats, sheep, pigs, goats, cattle, horses, apes and monkeys. In certain embodiments, the individual or subject is a human.

[0118] As used herein, the term “z z vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments exemplified, but are not limited to, test tubes and cell cultures.

[0119] As used herein, a “label” refers to an agent that allows for direct or indirect detection. Labels comprise, but are not limited to, fluorescent labels, chromogenic labels, electron dense labels, chemiluminescent labels and radioactive labels. Non-limiting examples of labels comprise green fluorescent protein (“GFP”), mCherry, dtTomato, or other fluorescent proteins known in the art e.g., Shaner et al., A Guide to Choosing Fluorescent Proteins, Nature Methods 2(12):905-909 (2005) incorporated by reference herein,32P,14C,1251,3H and131I, fluorogens (such as Rare Earth Chelate or lucifer yellow and its derivatives), Rhodamine (rhodamine) and its derivatives, dansyl, umbelliferone, luciferase (such as firefly luciferase and bacterial fluorescence plain enzyme) (U.S. Patent number 4,737,456), fluorescein, 2,3-dihydros phthalazine diketone, as well as enzymes producing detectable signals, e.g., horseradish peroxidase (HRP), alkaline phosphorus sour enzyme, beta galactosidase, glucoamylase, lysozyme, carbohydrate oxidase (such as glucose oxidase, galactose oxidase and glucose-6-phosphate dehydrogenase (G6PD)) and heterocyclic oxidases (such as uricase and xanthine oxidase).

[0120] The term “ligation,” as used herein, refers to the formation of a covalent bond or linkage between two or more molecules, e.g., between the termini of two or more nucleic acid molecules.

[0121] As used herein, the term “ligation process” refers generally to a process for covalently linking two or more molecules together by an enzyme. For example, two or more nucleic acid molecules can be covalently linked together by a ligation process using a ligase.

[0122] The term “monoclonal antibody,” as used herein, refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and / or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations, which typically comprise different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier “monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the presently disclosed subject matter may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.

[0123] The term “nucleic acid” or “polynucleotide” comprises any compound and / or substance that comprises a polymer of nucleotides. Each nucleotide is composed of a base, specifically a purine- or pyrimidine base (z.e., cytosine (C), guanine (G), adenine (A), thymine (T) or uracil (U)), a sugar (z.e., deoxyribose or ribose), and a phosphate group. Often, the nucleic acid molecule is described by the sequence of bases, whereby said bases represent the primary structure (linear structure) of a nucleic acid molecule. The sequence of bases is typically represented from 5’ to 3’. The term nucleic acid encompasses deoxyribonucleic acid (DNA) including, e.g., complementary DNA (cDNA) and genomic DNA, ribonucleic acid (RNA), e.g., messenger RNA (mRNA), synthetic forms of DNA or RNA, and mixed polymers comprising two or more of these molecules. The nucleic acid molecule can be linear or circular. In addition, the term nucleic acid comprises both, sense and antisense strands, as well as single stranded and double stranded forms. Moreover, the herein described nucleic acid can contain naturally occurring or non-naturally occurring nucleotides. Examples of non-naturally occurring nucleotides comprise modified nucleotide bases with derivatized sugars or phosphate backbone linkages or chemically modified residues.

[0124] The term “operative connection,” “operably linked” or “operatively linked,” as used herein, with regard to regulatory sequences of a nucleic acid, e.g., a gene, indicate an arrangement of elements in a combination enabling production of an appropriate effect. With respect to nucleic acids, e.g., genes, and regulatory sequences, an operative connection indicates a configuration of the nucleic acids, e.g., genes, with respect to the regulatory sequence allowing the regulatory sequences to directly or indirectly increase or decrease transcription or translation of the nucleic acids, e.g., genes. In particular, in certain embodiments, regulatory sequences directly increasing transcription of the operatively linked nucleic acid, e.g., gene, comprise promoters typically located on a same strand and upstream on a DNA sequence (towards the 5’ region of the sense strand), adjacent to the transcription start site of the nucleic acids, e.g., genes, whose transcription they initiate. In certain embodiments, regulatory sequences directly increasing transcription of the operatively linked nucleic acid, e.g., gene, comprise enhancers that can be located more distally from the transcription start site compared to promoters, and either upstream or downstream from the regulated nucleic acids, e.g., genes, as understood by those skilled in the art. Enhancers are typically short (50-1500 bp) regions of DNA that can be bound by transcriptional activators to increase transcription of a particular nucleic acid, e.g., gene. Typically, enhancers can be located up to 1 Mbp away from the nucleic acid, e.g., gene, upstream or downstream from the start site. As used herein, “percentage of sequence identity” or “percentage of identity” means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window can comprise additions or deletions (gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity. As understood by those skilled in the art, determination of percent identity between any two sequences can be accomplished using certain well-known mathematical algorithms. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller, the local homology algorithm of Smith et al.; the homology alignment algorithm of Needleman and Wunsch; the search-for-similarity-method of Pearson and Lipman; the algorithm of Karlin and Altschul, modified as in Karlin and Altschul. Computer implementations of suitable mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations comprise, but are not limited to: CLUSTAL, ALIGN, GAP, BESTFIT, BLAST, FASTA, among others identifiable by skilled persons. Sequence alignment algorithms also are disclosed in, for example, Altschul et al., J. Molecular Biol., 215(3): 403-410 (1990); Beigert et al., Proc. Natl. Acad. Sci. USA, 106(10): 3770-3775 (2009), Durbin et al., eds., Biological Sequence Analysis: Probalistic Models of Proteins and Nucleic Acids, Cambridge University Press, Cambridge, UK (2009); Soding, Bioinformatics, 21(7): 951-960 (2005); Altschul et al., Nucleic Acids Res., 25(17): 3389-3402 (1997); and Gusfield, Algorithms on Strings, Trees and Sequences, Cambridge University Press, Cambridge UK (1997), each of which is incorporated herein by reference in its entirety).

[0125] The term “plurality” refers to a number larger than one. In certain embodiments, the term “plurality of cells” refers to a number of cells larger than one. For example, but not by way of limitation, a plurality of proteins comprises at least two cells. In certain embodiments, the term “plurality of nucleic acids” refers to a number of nucleic acids larger than one. For example, but not by way of limitation, a plurality of nucleic acids comprises at least two nucleic acids. In certain embodiments, the term “plurality of guide RNAs” refers to a number of guide RNAs larger than one. For example, but not by way of limitation, a plurality of guide RNAs comprises at least two guide RNAs. The term “reverse-transcription process” refers to a process of generating a complementary strand of DNA using an enzyme called a reverse transcriptase.

[0126] The term “sample,” as used herein, refers to any sample containing one or more individual cells. In certain embodiments, “sample” refers to a sample of biological material obtained from a subject, e.g., a tissue biopsy or a tissue sample. In certain embodiments, the sample can be obtained from a tissue, e.g., a tissue sample. Non-limiting examples of tissues comprise eye, muscle, skin, tendon, vein, artery, blood, heart, spleen, lymph node, bone, bone marrow, lung, bronchi, trachea, gut, small intestine, large intestine, colon, rectum, salivary gland, tongue, gallbladder, appendix, liver, pancreas, brain, stomach, skin, kidney, ureter, bladder, urethra, gonad, testicle, ovary, uterus, fallopian tube, thymus, pituitary, thyroid, adrenal or parathyroid tissue. In certain embodiments, the samples are obtained from a subject. In certain embodiments, the subject can be a human, non-human primate, e.g., an ape or a monkey, a farm animal, a mouse, a rat, a hamster, a guinea pig, a rabbit, a dog, cat, a sheep, a pig, a goat, a cow or a horse. In certain embodiments, the subject is a human. In certain embodiments, the sample can be obtained from preserved tissue, e.g., fixed tissue, from frozen tissue or from fresh tissue, e.g., tissue samples. In certain embodiments, a sample that can be analyzed using the methods of the present disclosure comprise at least two or more cells. For example, but not by way of limitation, a sample can comprise about 10 or more cells, about 100 or more cells, about 1,000 or more cells, about 5,000 or more cells, about 10,000 or more cells, about 20,000 or more cells, about 30,000 or more cells, about 40,000 or more cells, about 50,000 or more cells, about 100,000 or more cells, about 150,000 or more cells, about 200,000 or more cells, about 300,000 or more cells, about 400,000 or more cells or 500,000 or more cells. In certain embodiments, the cells of a sample are obtained from (e.g., isolated from) a tissue.

[0127] As used herein, “sequence identity” or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the nucleotide bases or amino acid residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity or similarity is used in reference to proteins, it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted with a functionally equivalent residue of the amino acid residues with similar physiochemical properties and therefore do not change the functional properties of the molecule. The term “specifically binds,” as used herein, refers to the preferential binding to a target molecule, e.g., a protein or nucleic acid, relative to other molecules, e.g., proteins or nucleic acids, in a sample.

[0128] As used herein, “treatment” (and grammatical variations thereof such as “treat” or “treating”) refers to clinical intervention in an attempt to alter the natural course of a disease in the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment comprise, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The decrease can be at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% decrease in severity of complications, signs or symptoms or in likelihood of progression to another grade. “Treatment” can also refer to inhibiting proliferation of a cancer or progression to a higher grade by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99%. In certain embodiments, gRNAs identified by methods of the present disclosure can used to delay development of a disease or to slow the progression of a disease.

[0129] The term “vector,” as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term comprises the vector as a self-replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as “expression vectors.”

[0130] II. NUCLEIC ACID CONSTRUCTS AND COMPOSITIONS THEREOF

[0131] The present disclosure provides nucleic acid constructs for use in the methods of the present disclosure. The present disclosure further provides compositions (e.g., nucleic acid compositions) that comprise one or more nucleic acid constructs for use in the methods of the present disclosure.

[0132] In certain embodiments, a nucleic acid construct of the present disclosure comprises one or more target nucleic acids and / or two or more promoters. In certain embodiments, a nucleic acid construct of the present disclosure comprises two or more promoters. In certain embodiments, a nucleic acid construct of the present disclosure comprises one or more target nucleic acids. In certain embodiments, a nucleic acid construct of the present disclosure comprises one or more target nucleic acids and two or more promoters.

[0133] In certain embodiments, a nucleic acid construct of the present disclosure comprises a target nucleic acid. In certain embodiments, a nucleic acid construct of the present disclosure comprises a target nucleic acid that is to be detected and / or visualized by a method disclosed herein. In certain embodiments, the target nucleic acid can be about 2 to about 10,000 nucleotides, e.g., about 2 to about 1,000 nucleotides, in length. In certain embodiments, the target nucleic acid can be about 10 to about 10,000 nucleotides, about 100 to about 10,000 nucleotides, about 200 to about 10,000 nucleotides, about 300 to about 10,000 nucleotides, about 400 to about 10,000 nucleotides, about 500 to about 10,000 nucleotides, about 600 to about 10,000 nucleotides, about 700 to about 10,000 nucleotides, about 800 to about 10,000 nucleotides, about 900 to about 10,000 nucleotides, about 1,000 to about 10,000 nucleotides, about 2,000 to about 10,000 nucleotides, about 3,000 to about 10,000 nucleotides, about 4,000 to about 10,000 nucleotides, about 5,000 to about 10,000 nucleotides, about 6,000 to about 10,000 nucleotides, about 7,000 to about 10,000 nucleotides, about 8,000 to about 10,000 nucleotides, about 9,000 to about 10,000 nucleotides, about 10 to about 9,000 nucleotides, about 10 to about 8,000 nucleotides, about 10 to about 7,000 nucleotides, about 10 to about 6,000 nucleotides, about 10 to about 5,000 nucleotides, about 10 to about 4,000 nucleotides, about 10 to about 3,000 nucleotides, about 10 to about 2,000 nucleotides, about 10 to about 1,000 nucleotides, about 10 to about 900 nucleotides, about 10 to about 800 nucleotides, about 10 to about 700 nucleotides, about 10 to about 600 nucleotides, about 10 to about 500 nucleotides, about 10 to about 400 nucleotides, about 10 to about 300 nucleotides, about 10 to about 200 nucleotides, about 10 to about 100 nucleotides, about 100 to about 5,000 nucleotides, about 100 to about 4,000 nucleotides, about 100 to about 3,000 nucleotides, about 100 to about 2,000 nucleotides, about 100 to about 1,000 nucleotides or about 50 to about 1,000 nucleotides in length. In certain embodiments, the target nucleic acid can be about 2 to about 900 nucleotides, about 2 to about 800 nucleotides, about 2 to about 700 nucleotides, about 2 to about 600 nucleotides, about 2 to about 500 nucleotides, about 2 to about 400 nucleotides, about 2 to about 300 nucleotides, about 2 to about 200 nucleotides, about 2 to about 150 nucleotides, about 2 to about 100 nucleotides, about 2 to about 90 nucleotides, about 2 to about 80 nucleotides, about 2 to about 70 nucleotides, about 2 to about 60 nucleotides, about 2 to about 90 nucleotides, about 50 to about 900 nucleotides, about 50 to about 800 nucleotides, about 50 to about 700 nucleotides, about 50 to about 600 nucleotides, about 50 to about 500 nucleotides, about 50 to about 400 nucleotides, about 50 to about 300 nucleotides or about 50 to about 200 nucleotides in length. In certain embodiments, the target nucleic acid visualized by the methods of the present disclosure can comprise about 10 or more, about 15 or more, about 20 or more, about 25 or more, about 30 or more, about 35 or more, about 40 or more, about 60 or more, about 80 or more, about 100 or more, about 150 or more, about 200 or more, about 300 or more, about 400 or more, about 500 or more, about 1,000 or more, about 2,000 or more, about 3,000 or more, about 4,000 or more, about 5,000 or more, about 6,000 or more, about 7,000 or more, about 8,000 or more, about 9,000 or more or about 10,000 or more nucleotides in length.

[0134] In certain embodiments, the target nucleic acid can be about 1 to about 1,000 nucleotides in length.

[0135] In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed affects the expression of a gene and / or affects the levels of a messenger RNA (mRNA). In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed results in the knock down or knock out of a gene. In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed results in gene activation. In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed results in the insertion of a polynucleotide into a genomic sequence. In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed results in the deletion of a genomic sequence. In certain embodiments, the target nucleic acid can be a nucleic acid that when expressed affects the expression, cellular localization and / or post- translational modification of a protein. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target nucleic acid can be a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), a piwi-interacting RNA (piRNA), an aptamer, a ribozyme, an endogenous siRNA (endo-siRNA) or a short hairpin RNA (shRNA), a generic barcode indicating the identity of a larger RNA or DNA molecule that the barcode is a component of, e.g., a sequence of, an mRNA encoding a protein of interest.

[0136] In certain embodiments, the target nucleic acid can be a barcode, e.g., a generic barcode. In certain embodiments, a generic barcode is a barcode comprising random nucleotides or a barcode comprising a designed series of nucleotides.

[0137] In certain embodiments, a target nucleic acid that is detected by methods of the present disclosure can be a nucleic acid that comprises a nucleotide sequence that is at least partially complementary to or at least partially identical a known nucleotide sequence. For example, but not by way of limitation, a target nucleic acid can comprise a nucleotide sequence that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to a known sequence, e.g., a genomic sequence. In certain embodiments, a target nucleic acid can comprise a nucleotide sequence that has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to a known sequence, e.g., a genomic sequence. In certain embodiments, the genomic sequence can be an intron or an exon. In certain embodiments, the genomic sequence can be a regulatory sequence of a gene, e.g., a promoter and / or an enhancer.

[0138] In certain embodiments, the target nucleic acid encodes a gRNA. In certain embodiments, a gRNA that is encoded by a nucleic acid construct of the present disclosure has a length from about 20 to about 200 nucleotides, e.g., from about 20 to about 190, from about 20 to about 180, from about 20 to about 170, from about 20 to about 160, from about 20 to about 150, from about 20 to about 140, from about 20 to about 130, from about 20 to about 120, from about 20 to about 110, from about 20 to about 100, from about 30 to about 200, from about 40 to about 200, from about 50 to about 200, from about 60 to about 200, from about 70 to about 200, from about 80 to about 200, from about 90 to about 200, from about 50 to about 150, from about 80 to about 120 or from about 90 to about 100 nucleotides. In certain embodiments, a gRNA of the present disclosure has a length from about 80 to about 120 nucleotides. In certain embodiments, a gRNA of the present disclosure is about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195 or about 200 or more nucleotides in length.

[0139] In certain embodiments, the gRNA comprises a targeting domain that is complementary to, e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to, a genomic nucleotide sequence. In certain embodiments, the targeting domain is from about 15 to about 25 nucleotides in length. In certain embodiments, the targeting domain is 18 nucleotides in length. In certain embodiments, the targeting domain is 19 nucleotides in length. In certain embodiments, the targeting domain is 20 nucleotides in length. In certain embodiments, the targeting domain is 21 nucleotides in length. In certain embodiments, the targeting domain is 22 nucleotides in length. In certain embodiments, the targeting domain is 23 nucleotides in length. In certain embodiments, the targeting domain is 24 nucleotides in length. In certain embodiments, the targeting domain is 25 nucleotides in length.

[0140] In certain embodiments, a gRNA of the present disclosure can have a scaffold as disclosed in Dang et al., Genome Biology 16:280 (2015), the contents of which are incorporated by reference herein in their entirety. For example, but not by way of limitation, the duplex region of the gRNA scaffold can be extended by at least 1 base pair, 2 base pairs, 3 base pairs, 4 base pairs, 5 base pairs, 6 base pairs, 7 base pairs, 8 base pairs, 9 base pairs or 10 base pairs (see Figure 1 of Dang et al. (2015)). In certain embodiments, the duplex region of the gRNA scaffold can be extended by at least 5 base pairs, e.g., to improve editing efficiency of the gRNA (see Figure 7 of Dang et al. (2015)). In certain embodiments, the gRNA of the present disclosure can further include one or more mutations in the duplex (e.g. , in the lower stem of the duplex). For example, but not by way of limitation, the gRNA scaffold of the present disclosure can include a mutation in the continuous sequence of Ts present in the duplex (e.g., present in the lower stem of the duplex), as shown in Figure 7 of Dang et al. (2015), to improve editing efficiency of the gRNA. In certain embodiments, position 4 of the continuous sequence of Ts in the lower stem of the duplex is mutated to a C or G).

[0141] In certain embodiments, a gRNA of the present disclosure can have an editing efficiency of about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or 100% (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 60% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 65% or greater (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 70% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 75% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 80% or greater. In certain embodiments, the gRNA has an editing efficiency of about 85% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 90% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)). In certain embodiments, the gRNA has an editing efficiency of about 95% or greater (e.g., when expressed using a nucleic acid construct of the present disclosure (e.g., under control of a hybrid promoter disclosed herein)).

[0142] In certain embodiments, the methods of the present disclosure can be used to identify gRNAs that have an editing efficiency of about 5% or greater, about 10% or greater, about

[0143] 15% or greater, about 20% or greater, about 25% or greater, about 30% or greater, about

[0144] 35% or greater, about 40% or greater, about 45% or greater, about 50% or greater, about

[0145] 55% or greater, about 60% or greater, about 65% or greater, about 70% or greater, about

[0146] 75% or greater, about 80% or greater, about 85% or greater, about 90% or greater or about 95% or greater.

[0147] In certain embodiments, a nucleic acid construct of the present disclosure comprises at least two promoters. For example, but not by way of limitation, a nucleic acid construct of the present disclosure comprises at least two promoters located upstream of the target nucleic acid, e.g., as shown in FIG. 3B. In certain embodiments, a nucleic acid construct of the present disclosure comprises a first promoter and a second promoter located upstream of the target nucleic acid, e.g., operably linked to the target nucleic acid. In certain embodiments, a nucleic acid construct of the present disclosure comprises at least two promoters located immediately 5’ to the nucleotide sequence of the target nucleic acid.

[0148] In certain embodiments, the first promoter and the second promoter in a nucleic acid construct of the present disclosure are different. For example, but not by way of limitation, the first promoter and the second promoter are recognized by different polymerases, e.g., different RNA polymerases.

[0149] In certain embodiments, one of the promoters (e.g., a first promoter) for use in the present disclosure is configured to express the target nucleic acid in live cells. In certain embodiments, the first promoter is a promoter active in live cells. In certain embodiments, live cells comprise cells that are actively dividing, have intact membranes and / or are metabolically active. In certain embodiments, the first promoter is a promoter that is inactive in fixed cells, e.g., cells that have been contacted with a fixative. In certain embodiments, the first promoter is a regulated promoter (e.g., inducible promoter). In certain embodiments, the first promoter is a constitutive promoter. In certain embodiments, the first promoter is a viral promoter. In certain embodiments, the first promoter is a mammalian promoter. In certain embodiments, the first promoter is a non-viral promoter. Non-limiting examples of promoters for expressing the target nucleic acid in a live cell comprise U6, U3, U2, U5, Hl, 75J, EF-la, CMV, tRNA promoters, pGK, SV40, CAG, TRE, 7SK and VAI. In certain embodiments, the first promoter can be a promoter recognized by an RNA polymerase. In certain embodiments, the first promoter is recognized by RNA polymerase II (e.g. , a CMV promoter), e.g. , a Pol II promoter. In certain embodiments, the first promoter is recognized by RNA polymerase III (e.g. , a U6 promoter), e.g., a Pol III promoter. In certain embodiments, the promoter for expressing the target nucleic acid in live cells is a U6 promoter.

[0150] In certain embodiments, an additional promoter for use in the present disclosure is configured to express the target nucleic acid in fixed cells (e.g., a second promoter). In certain embodiments, fixed cells are cells that have been contacted with a fixative. In certain embodiments, the second promoter is a promoter that is active in fixed cells. In certain embodiments, the second promoter is a promoter inactive in live cells. In certain embodiments, the second promoter is a regulated promoter (e.g., inducible promoter). In certain embodiments, the second promoter is a constitutive promoter. In certain embodiments, the second promoter is a viral promoter. In certain embodiments, the second promoter is a non-viral promoter. In certain embodiments, the second promoter can be a promoter for a phage RNA polymerase. Non-limiting examples of phage RNA polymerases comprise a bacteriophage T3 RNA polymerase, a bacteriophage T7 RNA polymerase, a bacteriophage SP6 RNA polymerase or a combination thereof. In certain embodiments, the second promoter can be a T3 promoter, a T7 promoter and / or a Sp6 promoter. In certain embodiments, the promoter for expressing the target nucleic acid in fixed cells (e.g., a second promoter) is a T7 promoter.

[0151] In certain embodiments, the first promoter is a promoter active in live cells and the second promoter is a promoter active in fixed cells.

[0152] In certain embodiments, the first promoter is a mammalian promoter and the second promoter is a bacteriophage promoter.

[0153] In certain embodiments, the promoter for expressing the target nucleic acid in fixed cells (e.g., the second promoter) is located upstream to, downstream to or integrated into the promoter being used to express the target nucleic acid in live cells (e.g., the first promoter). In certain embodiments, the promoter for expressing the target nucleic acid in fixed cells (e.g., the second promoter) is located upstream to the promoter being used to express the target nucleic acid in live cells (e.g., the first promoter). In certain embodiments, the promoter for expressing the target nucleic acid in fixed cells (e.g., the second promoter) is located downstream to the promoter being used to express the target nucleic acid in live cells (e.g., the first promoter). In certain embodiments, the promoter for expressing the target nucleic acid in fixed cells (e.g., the second promoter) is integrated into the promoter being used to express the target nucleic acid in live cells (e.g., the first promoter). For example, but not by way of limitation, the promoter for expressing the target nucleic acid in fixed cells (e.g., the second promoter) is integrated into the promoter being used to express the target nucleic acid in live cells (e.g., the first promoter) to generate a hybrid promoter. Non-limiting examples of nucleic acids that comprise the nucleotide sequences of the first promoter and the second promoter are provided in FIG. 3B.

[0154] In certain embodiments, the nucleotide sequence of the second promoter is integrated into the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter is integrated into the nucleotide sequence of the first promoter at a position that does not affect the function of the first promoter, e.g., the ability of the first promoter to initiate expression of the target nucleic acid (e.g., in live cells). In certain embodiments, the nucleotide sequence of the second promoter is integrated into the nucleotide sequence of the first promoter at a position that does not affect the function of the second promoter, e.g., the ability of the second promoter to initiate expression of the target nucleic acid (e.g., in fixed cells). As shown in FIG. 9B, incorporation of the nucleotide sequence of the second promoter (e.g., T7 promoter) into the nucleotide sequence of the first promoter (e.g., U6 promoter) did not reduce the editing efficiency of the expressed gRNA as compared to the editing efficiency of the gRNA when expressed using the wild-type U6 promoter. In contrast, the use of a second promoter (e.g., T7 promoter) that is placed 3’ to the sequence of the first promoter (e.g., U6 promoter) and not incorporated into the sequence of the first promoter (referred to as the U6pubpromoter herein) reduced the editing efficiency of the expressed gRNA significantly as shown in FIG. IOC.

[0155] In certain embodiments, the use of a nucleic acid construct comprising a hybrid promoter described herein does not reduce the editing efficiency of the gRNA under control of the hybrid promoter by more than about 30% (e.g., by more than about 25%, by more than about 20%, by more than about 15%, by more than about 10% or by more than about 5%) compared to the editing efficiency of the gRNA under control of the wild-type U6 promoter. In certain embodiments, the use of a nucleic acid construct comprising a hybrid promoter described herein does not reduce the editing efficiency of the gRNA under control of the hybrid promoter by more than about 20% compared to the editing efficiency of the gRNA under control of the wild-type U6 promoter. In certain embodiments, the use of a nucleic acid construct comprising a hybrid promoter described herein does not reduce the editing efficiency of the gRNA under control of the hybrid promoter by more than about 10% compared to the editing efficiency of the gRNA under control of the wild-type U6 promoter. In certain embodiments, the use of a nucleic acid construct comprising a hybrid promoter described herein does not reduce the editing efficiency of the gRNA under control of the hybrid promoter by more than about 5% compared to the editing efficiency of the gRNA under control of the wild-type U6 promoter.

[0156] In certain embodiments, the nucleotide sequence of the second promoter can be inserted within the first 10 nucleotides located at the 5’ end of the nucleotide sequence of the first promoter, e.g., within the first 20 nucleotides, within the first 30 nucleotides, within the first 40 nucleotides, within the first 50 nucleotides, within the first 60 nucleotides, within the first 70 nucleotides, within the first 80 nucleotides, within the first 90 nucleotides, within the first 100 nucleotides, within the first 110 nucleotides, within the first 120 nucleotides, within the first 130 nucleotides, within the first 140 nucleotides, within the first 150 nucleotides, within the first 160 nucleotides, within the first 170 nucleotides, within the first 180 nucleotides, within the first 190 nucleotides, within the first 200 nucleotides, within the first 210 nucleotides, within the first 210 nucleotides, within the first 220 nucleotides or within the first 230 nucleotides located at the 5’ end of the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted within the first 100 nucleotides located at the 5’ end of the nucleotide sequence of the first promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted within the first 150 nucleotides located at the 5’ end of the nucleotide sequence of the first promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted within the first 200 nucleotides located at the 5’ end of the nucleotide sequence of the first promoter.

[0157] In certain embodiments, the second promoter can be inserted within the last 10 nucleotides located at the 3 ’ end of the nucleotide sequence of the first promoter, e.g. , within the last 20 nucleotides, within the last 30 nucleotides, within the last 40 nucleotides, within the last 50 nucleotides, within the last 60 nucleotides, within the last 70 nucleotides, within the last 80 nucleotides, within the last 90 nucleotides, within the last 100 nucleotides, within the last 110 nucleotides, within the last 120 nucleotides, within the last 130 nucleotides, within the last 140 nucleotides, within the last 150 nucleotides, within the last 160 nucleotides, within the last 170 nucleotides, within the last 180 nucleotides, within the last 190 nucleotides, within the last 200 nucleotides, within the last 210 nucleotides, within the last 210 nucleotides, within the last 220 nucleotides or within the last 230 nucleotides located at the 3’ end of the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the second promoter can be inserted within the last 50 nucleotides located at the 3’ end of the nucleotide sequence of the first promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted within the last 100 nucleotides located at the 3 ’ end of the nucleotide sequence of the first promoter.

[0158] In certain embodiments, the nucleotide sequence of the second promoter can be inserted between nucleotides located about 40 to about 200 nucleotides downstream from the 5’ end of the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between nucleotides located about 50 to about 200 nucleotides downstream from the 5’ end of the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between nucleotides located about 40 to about 190 nucleotides downstream from the 5’ end of the nucleotide sequence of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between nucleotides located about 100 to about 200 nucleotides downstream from the 5’ end of the nucleotide sequence of the first promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between nucleotides located about 150 to about 200 nucleotides downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0159] In certain embodiments, the nucleotide sequence of the second promoter can be inserted between a SPH element and a TATA box of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between an octamer (OCT) element and a TATA box of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the second promoter can be inserted between a SPH element and a PSE element of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between an OCT element and a PSE element of the first promoter, e.g., to generate a hybrid promoter. In certain embodiments, the nucleotide sequence of the second promoter can be inserted between the TATA box and the 3’ end of the first promoter, e.g., to generate a hybrid promoter.

[0160] In certain embodiments, a nucleic acid construct of the present disclosure can comprise a T7 promoter as the second promoter. In certain embodiments, the T7 promoter has the nucleotide sequence TAATACGACTCACTATAG (SEQ ID NO: 1). In certain embodiments, the T7 promoter has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the T7 promoter has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, a nucleic acid construct of the present disclosure can comprise a Sp6 promoter as the second promoter. In certain embodiments, the Sp6 promoter has the nucleotide sequence ATTTAGGTGACACTATAG (SEQ ID NO: 2). In certain embodiments, the Sp6 promoter has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In certain embodiments, the Sp6 promoter has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 2.

[0161] In certain embodiments, a nucleic acid construct of the present disclosure can comprise a T3 promoter as the second promoter. In certain embodiments, the T3 promoter has the nucleotide sequence AATTAACCCTCACTAAAG (SEQ ID NO: 3). In certain embodiments, the T3 promoter has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 3. In certain embodiments, the T3 promoter has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 3.

[0162] In certain embodiments, a nucleic acid construct of the present disclosure can comprise a U6 promoter as the first promoter. In certain embodiments, the U6 promoter is derived from mouse or human. In certain embodiments, the U6 promoter is the human U6 promoter. For example, but not by way of limitation, the U6 promoter comprises the following nucleotide sequence

[0163] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTA TGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 4). For example, but not by way of limitation, the U6 promoter is the U6 promoter shown in FIG. 3B and comprises the nucleotide sequence of SEQ ID NO: 4. In certain embodiments, the U6 promoter is the mini U6 promoter and has the following nucleotide sequence GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATAG CTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAA GGAC (SEQ ID NO: 5). In certain embodiments, the U6 promoter has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5. In certain embodiments, the U6 promoter has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 4 or 5.

[0164] In certain embodiments, a nucleic acid construct of the present disclosure can comprise a hybrid promoter comprising the sequence of a T7 promoter inserted into the sequence of a U6 promoter. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can comprise a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to a nucleotide sequence shown in FIG. 3B and Table 2. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence shown in FIG. 3B and Table 2.

[0165] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0166] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTG TTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAA AATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATT ATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTT CTTGGCTTTATATATCTTGTAATACGACTCACTATAG (SEQ ID NO: 6). In certain embodiments, the nucleic acid construct comprising at least two promoters is the U6pubshown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 6. In U6pub, the sequence of T7 promoter is located 3’ to the nucleotide sequence of the U6 promoter and is not incorporated into the nucleotide sequence of U6 promoter, as shown in FIG. 3B. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, does not comprise or consist of the nucleotide sequence of SEQ ID NO: 6.

[0167] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0168] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTTAATACG ACTCACTATAGGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 7). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTTAATACG ACTCACTATAGGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 8). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6vlpromoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 7 or 8.

[0169] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0170] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTATAATACGACTCACTATAGGGTAGTTTGCAGTTTTAAAATTA TGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 9). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v2promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 9.

[0171] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0172] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACTAATACGACTCACTATAGATTTCTTGGGTAGTTTGCAGTTTTAAAATTAT GTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCT TGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 10). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v3promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 10.

[0173] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0174] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTAATACGACTCACTATAGTAAAATTA TGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 11). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v4promoter shown in FIG. 3B and comprises the nucleotide sequence of SEQ ID NO: 11.

[0175] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0176] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATACGACTCACTATAGTTTGCAGTTTTAAAATTA TGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 12). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v5promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 12.

[0177] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0178] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGAATTTAATACG ACTCACTATAGGGAGAGTCATATGCTTACCGTAACTTGAAAGTATTTCGATTT CTTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 13). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, is the U6v6promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 13.

[0179] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0180] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGAATTTAATACG ACTCACTATAGGGATAATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 14). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v7promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 14.

[0181] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0182] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTT AGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAA ATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTG AATTTAATACGACTCACTATAGGGCTTACCGTAACTTGAAAGTATTTCGATTTC TTGGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 15). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v8promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0183] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATAGAATTTAATA CGACTCACTATAGGGAGAGTGCTTACCGTAACTTGAAAGTATTTCGATTTCTT GGCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 16). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v9promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 16.

[0184] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0185] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATAGAATTTAATA CGACTCACTATAGGGATAATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTG GCTTTATATATCTTGTGGAAAGGAC (SEQ ID NO: 17). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v10promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 17.

[0186] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of

[0187] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATAAATACGACTC ACTATAGGGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATC TTGTGGAAAGGAC (SEQ ID NO: 18). In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, is the U6v11 promoter shown in FIG. 3B and / or Table 2 and comprises the nucleotide sequence of SEQ ID NO: 18.

[0188] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 85% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0189] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0190] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0191] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0192] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 90% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0193] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0194] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0195] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NOs: 6-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NOs: 7-18. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 6. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 7. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 8. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 9. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 10. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 11. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 12. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 13. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 14. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 15. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 16. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 17. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can have the nucleotide sequence of SEQ ID NO: 18.

[0196] In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include a first promoter comprising a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can include a second promoter comprising a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-3. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include a second promoter comprising a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1.

[0197] In certain embodiments, the first promoter is a U6 promoter and the second promoter is a T7 promoter. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 95% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 96% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g. , a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 97% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 98% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g, a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence that has at least about 99% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In certain embodiments, the nucleic acid construct comprising the at least two promoters, e.g., a hybrid promoter, can include (i) a first promoter comprising a nucleotide sequence that is identical to the nucleotide sequence of any one of SEQ ID NOs: 4-5, and (ii) a second promoter comprising a nucleotide sequence is identical to the nucleotide sequence of SEQ ID NO: 1.

[0198] In certain embodiments, the nucleic acid constructs, or compositions thereof, of the present disclosure can further comprise a nucleotide sequence (e.g., a polynucleotide) that encodes a nuclease. In certain embodiments, the nucleotide sequence that encodes a nuclease is operatively coupled to one or more of the at least two promoters. Alternatively, the nucleotide sequence that encodes a nuclease is operatively coupled to a different promoter, e.g., a third promoter, present in the nucleic acid construct. Non-limiting examples of nucleases comprise a zinc-finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN) and a Cas protein.

[0199] In certain embodiments, the nuclease is an RNA-guided nuclease. In certain embodiments, the RNA-guided nuclease is a Cas protein. Non-limiting examples of Cas proteins are disclosed in Makarova and Koonin, Methods Mol. Biol. 1311 :47-75 (2015), the contents of which are incorporated herein by reference in their entirety. In certain embodiments, Cas proteins comprise Casl, Cas2, Cas3, Cas3-HD, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, CaslO, Casl2a (Cpfl), Casl3, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, CsaX, Csm2, Csm3, Csm4, Csm5, Csm6, Csn2, Csbl, Csb2, Csb3, Csxl, Csx3, CsxlO, Csxl4, Csxl5, Csxl6, Csxl7, Csfl, Csf2, Csf3, Csf4, C2cl, C2c2 and C2c3. In certain embodiments, the Cas protein is selected from the group consisting of a Cas9, a Cas 12a, a Cas 13 and a combination thereof. In certain embodiments, the Cas protein is a Cas9 protein. In certain embodiments, the Cas protein is a Casl2a protein.

[0200] In certain embodiments, the Cas protein is an engineered Cas protein that differs from a reference Cas protein, e.g., a wild-type Cas protein. In certain embodiments, the reference Cas protein is a naturally occurring Cas protein. In certain embodiments, the Cas protein comprises one or more amino acid variations compared to a reference Cas protein, e.g., a wild-type Cas protein. In certain embodiments, an engineered Cas protein retains or substantially retains the nuclease (e.g., endonuclease) activity of the reference Cas protein. In certain embodiments, the engineered Cas protein retains at least about 70%, about 80%, about 90%, about 95% or about 99% nuclease activity of the reference Cas protein. In certain embodiments, an engineered Cas protein has no or no substantial cleavage activity. In certain embodiments, a Cas protein can lack cleavage activity or have substantially less, e.g., less than 20%, about 10%, about 5% or about 1% of the cleavage activity of a reference Cas protein.

[0201] In certain embodiments, the engineered Cas protein comprises one or more deletions that reduces the size of the Cas protein while at least partially retaining the nuclease activity of the Cas protein. In certain embodiments, the reduced size of the engineered Cas protein can allow flexibility with respect to the methods for delivering such engineered Cas proteins.

[0202] In certain embodiments, a Cas protein interacts with a gRNA molecule of the present disclosure and, in concert with the gRNA molecule, localizes to a target genomic sequence (e.g., a sequence that is complementary to the targeting domain sequence of the gRNA molecule) and a PAM sequence. In certain embodiments, the ability of a Cas protein to interact with and cleave a target genomic sequence is PAM sequence dependent. In certain embodiments, cleavage of the target genomic sequence occurs upstream from the PAM sequence. In certain embodiments, cleavage of the target genomic sequence occurs downstream from the PAM sequence. Cas molecules from different species, e.g., bacterial species, can recognize different PAM sequences.

[0203] In certain embodiments, a Cas protein for use in the present disclosure can be derived from any one of the following species: Streptococcus pyogenes, Streptococcus pneumoniae, Streptococcus thermophilus, Streptococcus agalactiae, Streptococcus parasanguinis, Streptococcus oralis, Streptococcus salivarius, Streptococcus macacae, Streptococcus dysgalactiae, Streptococcus anginosus, Streptococcus constellatus, Streptococcus pseudoporcinus, Streptococcus mutans, Listeria innocua, Spiroplasma apis, Spiroplasma syrphidicola, Porphyromonas catoniae, Prevotella intermedia, Treponema socranskii, Finegoldia magna, Pasteurella bettyae, Olivibacter sitiensis, Epilithonimonas tenax, Mesonia mobilis, Lactobacillus plantarum, Coriobacteriaceae bacterium, Olsenella profusa, Haemophilus sputorum, Bacillus cereus, Aquimarina muellen, Chryseobacterium palustre, Bacteroides graminisol vens, Neisseria meningitidis, Francisella novicida, Haemophilus pittmaniae, Pasteurella bettyae, Olivibacter sitiensis, Epilithonimonas tenax, Mesonia mobilis, Lactobacillus plant arum, Bacillus cereus, Aquimarina muellen, Chryseobacterium palustre, Bacteroides gra minisolvens, Neisseria meningitidis, Francisella novicida, Flavobacterium frigidarium, Flavobacterium soli and / or Treponema denticola.

[0204] In certain embodiments, a Cas protein for use in the present disclosure directs cleavage of one or both strands at a genomic location. For example, but not by way of limitation, a Cas protein for use in the present disclosure directs cleavage of one or both strands within a genomic location. Alternatively, the Cas protein directs cleavage of one or both strands within about 500 base pairs (e.g., within about 400, about 300, about 200, about 100, about 80, about 60, about 40, about 20, about 10 or about 5 base pairs) from the targeted genomic location.

[0205] In certain embodiments, a Cas protein, e.g., a Cas9, that comprises functional RuvC and HNH nuclease domains can cleave both strands of a target nucleic acid sequence. In certain embodiments, the Cas protein, e.g., Cas9, comprises one functional endonuclease domain that allows the Cas protein to cleave only one strand (z.e., nick) of a target nucleic acid sequence. For example, but not by way of limitation, a Cas9 nickase can comprise (i) a non-functional RuvC domain (e.g., a mutant RuvC domain) and (ii) a functional HNH domain (e.g., a wild type HNH domain). In certain embodiments, a Cas9 nickase can comprise (i) a functional RuvC domain (e.g., wild type RuvC domain) and (ii) a nonfunctional HNH domain (e.g., a mutant HNH domain). In certain embodiments, a Cas9 nickase comprises a functional HNH-like and comprise a mutation at D10, e.g., D10A. In certain embodiments, a Cas9 nickase comprises a functional RuvC domain and comprises a mutation at H840, e.g., H840A. In certain embodiments, a Cas9 nickase comprises a functional RuvC domain and comprises a mutation at N863, e.g., N863A.

[0206] In certain embodiments, the nucleotide sequence encoding a Cas protein is codon optimized. For example, but not by way of limitation, the nucleotide sequence encoding a Cas protein can be codon optimized, e.g., where at least one non-common codon or less- common codon has been replaced by a common codon, for optimized expression in a particular cell type, e.g., a mammalian cell.

[0207] In certain embodiments, the Cas protein is a fusion protein that comprises one or more heterologous protein domains. In certain embodiments, a Cas fusion protein can comprise any additional protein domains, e.g., epitope tags, reporter sequences and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.

[0208] In certain embodiments, the Cas protein comprises one or more nuclear localization sequences to promote accumulation of the Cas protein in a detectable amount in the nucleus of a cell. Nuclear localization sequences are known in the art. For example, but not by way of limitation, a Cas protein can comprise a nuclear localization sequence (e.g., from SV40) at its N-terminus and / or C-terminus.

[0209] In certain embodiments, a nucleic acid construct of the present disclosure can further comprise one or more unique sequences. In certain embodiments, a nucleic acid construct of the present disclosure can further comprise one or more unique sequences downstream of the target nucleic acid. In certain embodiments, a nucleic acid construct of the present disclosure can further comprise one or more unique sequences located 3’ to the target nucleic acid. For example, but not by way of limitation, a nucleic acid construct of the present disclosure can further comprise one or more barcodes. In certain embodiments, a nucleic acid construct of the present disclosure can further comprise two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten barcodes. In certain embodiments, the barcode can be under control of one or more of the promoters (e.g., hybrid promoter) comprised in a construct of the present disclosure. In certain embodiments, the barcode can be under control of a different promoter (e.g., a third or fourth promoter) comprised in a nucleic acid construct of the present disclosure. In certain embodiments, the barcode has a known nucleotide sequence. In certain embodiments, the barcode can be used as an identifier for an associated nucleic acid, e.g., target nucleic acid. Alternatively or additionally, the barcode can be used as an identifier of the source of an associated molecule, such as a cell-of-origin. In certain embodiments, the barcode is about 10 to about 50 nucleotides, e.g., about 10 to about 30 nucleotides, in length. In certain embodiments, the barcode can be located downstream of the target nucleic acid in a nucleic acid construct of the present disclosure. In certain embodiments, the barcode can be imaged using a method of the present disclosure. In certain embodiments, a single target nucleic acid can be associated with a single barcode. In certain embodiments, the present disclosure provides a plurality of constructs, where a first construct of the plurality of constructs can comprise a first target nucleic acid and a first barcode under control of a promoter disclosed herein and a second construct of the plurality of constructs can comprise a second target nucleic acid and a second barcode under control of a promoter disclosed herein.

[0210] In certain embodiments, the vector or delivery vehicle for a nucleic acid construct of the present disclosure is a viral vector (e.g., for generation of recombinant viruses). In certain embodiments, the virus is a DNA virus (e.g., dsDNA or ssDNA virus). In certain embodiments, the virus is an RNA virus (e.g., an ssRNA virus). Exemplary viral vectors / viruses comprise, e.g., retroviruses, lentiviruses, adenovirus, adeno-associated virus (AAV), vaccinia viruses, poxviruses, and herpes simplex viruses. In certain embodiments, the virus infects dividing and / or non-dividing cells. In certain embodiments, the virus can integrate into the host genome. In certain embodiments, the virus is replication-competent. In certain embodiments, the virus is replication-defective, e.g., having one or more coding regions for the genes necessary for additional rounds of virion replication and / or packaging replaced with other genes or deleted.

[0211] In certain embodiments, a nucleic acid construct of the present disclosure is delivered by a non-vector-based method (e.g., using naked DNA or DNA complexes). For example, but not by way of limitation, the DNA can be delivered, e.g., by electroporation, organically modified silica or silicate, transient cell compression or squeezing, gene gun, sonoporation, magnetofection, lipid-mediated transfection, dendrimers, inorganic nanoparticles, calcium phosphates, or a combination thereof.

[0212] III. CELLS

[0213] The present disclosure provides a method for optical imaging target nucleic acids in different cell types. As discussed herein, in situ sequencing can be inefficient for optically detecting nucleic acids in a complex biological sample that comprise a variety of cell types. The present disclosure provides an improved method for optical detecting target nucleic acids by in situ sequencing by increasing expression of the target nucleic acids after fixation.

[0214] In certain embodiments, cells that are to be analyzed by the methods of the present disclosure comprise one or more of the nucleic acid constructs disclosed herein or a vector comprising a nucleic acid construct disclosed herein. In certain embodiments, cells that are to be analyzed by the methods of the present disclosure comprise two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more or ten or more nucleic acid constructs described herein. For example, but not by way of limitation, cells (e.g., a plurality of cells) that are to be analyzed by the methods of the present disclosure can comprise at least one cell comprising a first nucleic acid construct and at least a second cell comprising a second nucleic acid construct, where the first and second nucleic acid constructs comprise different target nucleic acids.

[0215] In certain embodiments, a method of the present disclosure can comprise providing a cell or a plurality of cells that comprise at least one nucleic acid construct described herein. In certain embodiments, a method of the present disclosure can comprise introducing at least one nucleic acid construct described herein into a cell or a plurality of cells. For example, but not by way of limitation, a method of the present disclosure can comprise contacting a cell or a plurality of cells with at least one nucleic acid construct described herein (or a composition thereof). In certain embodiments, the nucleic acid construct can be integrated into the genome of the cell or the genomes of the plurality of cells. In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from a subject. In certain embodiments, the subject can be a human, non-human primate, e.g., an ape or a monkey, a farm animal, a mouse, a rat, a hamster, a guinea pig, a rabbit, a dog, cat, a sheep, a pig, a goat, a cow or a horse. In certain embodiments, the subject is a human.

[0216] In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from a biological fluid. Non-limiting examples of biological fluids comprise whole blood, plasma, serum, sweat, urine, sputum, spinal fluid, pleural fluid, mucus, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal and genitourinary tracts, interstitial fluid, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, vaginal secretions, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid, bronchoalveolar fluid, biliary fluid and combinations thereof.

[0217] In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from a tissue, e.g., a tissue sample, or are present in a tissue sample. In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from a tissue, e.g., a tissue sample. In certain embodiments, the cells (e.g., the plurality of cells) are present in a tissue, e.g., in a tissue sample. Non-limiting examples of tissues comprise eye, muscle, skin, tendon, vein, artery, blood, heart, spleen, lymph node, bone, bone marrow, lung, bronchi, trachea, gut, small intestine, large intestine, colon, rectum, salivary gland, tongue, gallbladder, appendix, liver, pancreas, brain, stomach, skin, kidney, ureter, bladder, urethra, gonad, testicle, ovary, uterus, fallopian tube, thymus, pituitary, thyroid, adrenal or parathyroid tissue.

[0218] In certain embodiments, the cells (e.g., the plurality of cells) can comprise primary cells, blood cells, somatic cells, epithelial cells, endothelial cells, fibroblast cells, microglia, neurons, astrocytes, cancer cells, cells derived from organoids or xenografts or stem cells, e.g., pluripotent stem cells (iPSCs) or embryonic stem cells. In certain embodiments, the cells can comprise primary cells. In certain embodiments, the cells for use in the present disclosure can be derived from stem cells, e.g., stem cells that have undergone natural differentiation or artificially induced reprogramming or transdifferentiation.

[0219] In certain embodiments, the cells (e.g., the plurality of cells) for use in the present disclosure can be fetal cells, e.g., obtained from or present in fetal tissue and / or amniotic fluid. In certain embodiments, the methods of the present disclosure can be used to analyze fetal health and / or identify an abnormality in individual fetal cells.

[0220] In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from preserved samples, e.g., fixed samples, from frozen samples or from fresh samples, e.g., tissue samples. In certain embodiments, the cells (e.g., the plurality of cells) are present in preserved samples, e.g., fixed samples, frozen samples or fresh samples, e.g., tissue samples.

[0221] In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from in vitro cell cultures. For example, but not by way of limitation, the cells (e.g., the plurality of cells) can comprise cell lines, e.g., A549 cells.

[0222] In certain embodiments, the cells (e.g., the plurality of cells) can be immune cells. Non-limiting examples of immune cells comprise neutrophils, eosinophils, basophils, mast cells, monocytes, macrophages, dendritic cells, natural killer cells (NK cells) and lymphocytes, e.g., B cells and T cells (e.g., cytotoxic T cells, natural killer T cells, regulatory T cells and helper T cells). In certain embodiments, the cells can be modified immune cells that have been genetically engineered to express a chimeric antigen receptor (CAR), e.g., CAR T cells and CAR NK cells.

[0223] In certain embodiments, the cells (e.g., the plurality of cells) can be obtained from and / or present in a malignancy of a tissue or a tumor. Non-limiting examples of such malignancies comprise carcinomas, adenocarcinomas, sarcomas and fibroadenomas. In certain embodiments, the cells are obtained from a cancer such as bladder cancer, bone cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, head and neck cancer, kidney cancer, leukemia, lung cancer, lymphoma, melanoma, pancreatic cancer, parathyroid cancer, prostate cancer, stomach cancer, testicular cancer, thyroid cancer and uterine cancer. In certain embodiments, the methods of the present disclosure can be used to identify mutations and / or gene alterations present in single cancer cells.

[0224] In certain embodiments, the cells can comprise diseased cells and healthy cells. For example, but not by way of limitation, the cells can comprise cells obtained from a tumor or cancer and comprise non-cancerous cells (e.g., healthy cells that were located adjacent to the tumor or cancer or healthy cells obtained from a subject that does not have cancer).

[0225] In certain embodiments, the cells (e.g., the plurality of cells) can be bacterial cells. For example, but not by way of limitation, the methods of the present disclosure can be used to analyze the microbiome of a subject, e.g., the gut microbiome of a subject.

[0226] In certain embodiments, the cells (e.g., the plurality of cells) can comprise cells having different developmental stages. In certain embodiments, the cells can comprise cells of different disease states.

[0227] In certain embodiments, the cells (e.g., the plurality of cells) can be from any model organism. For example, but not by way of limitation, the model organism can be E. coli, yeast, Arabidopsis, xenopus, zebrafish, drosophila melanogaster, ascidians, nematodes, mice and monkeys.

[0228] In certain embodiments, the cells (e.g., the plurality of cells) can be cells that have been infected by an infectious agent. Non-limiting examples of infectious agents comprise viruses, bacteria, fungi and protozoans.

[0229] In certain embodiments, the cells (e.g., the plurality of cells) can be enriched for cells of interest to produce an enriched cell sample, which can be subjected to the methods of the present disclosure. Any technique known in the art can be used to enrich for the cells of interest.

[0230] In certain embodiments, the cells (e.g., the plurality of cells) have been genetically modified to express and / or secrete an agent, e.g., a therapeutic agent. For example, but not by way of limitation, the cells to be used in the methods of the present disclosure express an antibody or an antibody fragment.

[0231] In certain embodiments, the cells (e.g., the plurality of cells) for use in the present disclosure can be treated with an agent. For example, but not by way of limitation, the agent can be a therapeutic agent. In certain embodiments, methods of the present disclosure can be used in drug screening, e.g., to determine the genomic and / or transcriptional changes associated with a test therapeutic agent, e.g., a newly identified therapeutic agent. In certain embodiments, methods of the present disclosure can be used in determining the genomic and / or transcriptional changes associated with resistance to a therapeutic agent. Nonlimiting examples of such therapeutics comprise polypeptide therapeutics, e.g., antibodybased therapeutics, oligonucleotides, and small molecule therapeutics. In certain embodiments, the therapeutic can be cell cycle regulators, kinase regulators (e.g., kinase inhibitors or activators), receptor regulators (e.g., receptor inhibitors or activators), chemotherapeutics and / or antibodies (e.g., agonist or antagonist antibodies).

[0232] IV. METHODS FOR IMAGING NUCLEIC ACIDS

[0233] The present disclosure provides methods for imaging nucleic acids in a sample, e.g., in a plurality of cells. For example, but not by way of limitation, the present disclosure provides methods for imaging exogenous nucleic acids, e.g., exogenous RNAs, in a sample. In certain embodiments, the present disclosure provides methods for imaging one or more gRNAs in a sample. In certain embodiments, the present disclosure provides methods for imaging one or more barcodes in a sample.

[0234] In certain embodiments, methods of the present disclosure can comprise detecting a plurality of target nucleic acids in a plurality of cells, e.g., in a single sample. The methods of the present disclosure can be used for a variety of purposes, e.g., the present disclosure provides methods for imaging the distribution of one or more nucleic acids in one or more cells in a plurality of cells, e.g., in a single sample.

[0235] In certain embodiments, methods of the present disclosure allow for visualizing a target nucleic acid in a plurality of cells and correlating the presence of the target nucleic acid to the characteristics of the cell containing the target nucleic acid. For example, but not by way of limitation, the methods of the present disclosure can also be used to determine phenotypic characteristics of cells that express the target nucleic acid compared to cells that do not express the target nucleic acid or cells that express a different target nucleic acid. The nucleic acid can also provide information reporting on the location of modified cells, enabling linkage of genotype to tissue localization of cells.

[0236] FIG. 1 and FIG. 9A provides a flowchart of an exemplary method of the present disclosure. In certain embodiments, an exemplary method of the present disclosure can comprise one or more steps of: providing a sample, fixing the sample, permeabilizing the sample, decrosslinking the sample and performing an in vitro transcription process. In certain embodiments, the method can further comprise performing an in situ sequencing process that comprises performing a reverse transcription process, performing a rolling circle amplification (RCA) process and performing sequencing by synthesis. In certain embodiments, a method of the present disclosure can further include analyzing a change in a characteristic (e.g., a phenotypic characteristic) of one or more cells in the sample, e.g., prior to decrosslinking the sample and / or prior to performing an in vitro transcription process, as shown in FIG. 9A.

[0237] In certain embodiments, a method of the present disclosure can comprise providing a cell or a plurality of cells that comprise at least one nucleic acid construct described herein. Non-limiting examples of nucleic acid constructs and cells are described herein in Section II and III, respectively.

[0238] In certain embodiments, a method of the present disclosure can comprise introducing at least one nucleic acid construct described herein into a cell or a plurality of cells. For example, but not by way of limitation, a method of the present disclosure can comprise contacting a cell or a plurality of cells with at least one nucleic acid construct described herein (or a composition thereof). In certain embodiments, the plurality of cells can comprise at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 5,000, at least about 10,000, at least about 100,000, at least about 1,000,000, at least about 10,000,000, at least about 100,000,000 or at least about 1,000,000,000 cells.

[0239] In certain embodiments, the plurality of cells can comprise a variety of cells, e.g., cells of different types, cells of different lineages and / or cells with different genomic mutations.

[0240] In certain embodiments, the plurality of cells can comprise a variety of cell types pooled together. In certain embodiments, a plurality of cells can comprise at least two or more cell types, at least three or more cell types, at least four or more cell types, at least five or more cell types, at least six or more cell types, at least seven or more cell types, at least eight or more cell types, at least nine or more cell types or at least ten or more cell types.

[0241] In certain embodiments, a method of the present disclosure can comprise providing a first cell or a first plurality of cells that comprise a first nucleic acid construct (e.g., that comprises a first target nucleic acid) and providing a second cell or a second plurality of cells that comprise a second nucleic acid construct (e.g., that comprises a second target nucleic acid). In certain embodiments, a method of the present disclosure can comprise contacting a first cell or a first plurality of cells with a first nucleic acid construct described herein (or a composition thereof), e.g, that comprises a first target nucleic acid, and contacting a second cell or a second plurality of cells with a second nucleic acid construct described herein (or a composition thereof), e.g, that comprises a second target nucleic acid. In certain embodiments, the first cell (or first plurality of cells) and the second cell (or second plurality of cells) can be pooled before undergoing sample preparation. In certain embodiments, the first cell and the second cell can be different cell types or be the same cell type.

[0242] In certain embodiments, the method can further comprise incubating the cell or plurality of cells to promote expression of the target nucleic acid using the promoter (e.g., first promoter) that is active in live cells. For example, but not by way of limitation, the promoter for expression in live cells (e.g., first promoter) is a Pol III or Pol II promoter. In certain embodiments, the promoter for expression in live cells (e.g., first promoter) is a Pol III promoter. In certain embodiments, the promoter for expression in live cells (e.g., first promoter) is a Pol II promoter. In certain embodiments, the promoter that is active in live cells (e.g., the first promoter) is a U6, U3, U2, U5, Hl, 75J, EF-la, CMV, tRNA, pGK, SV40, CAG, TRE, 7SK or VAI promoter. In certain embodiments, the method comprises incubating (e.g., culturing) the cell or plurality of cells to express the target nucleic acid by using the Pol III promoter present in the nucleic acid construct present in the cell or plurality of cells. In certain embodiments, the method comprises incubating (e.g., culturing) the cell or plurality of cells to express the target nucleic acid by using the Pol II promoter present in the nucleic acid construct present in the cell or plurality of cells. In certain embodiments, the method comprises incubating (e.g., culturing) the cell or plurality of cells to express the target nucleic acid by using the U6 promoter present in the nucleic acid construct present in the cell or plurality of cells. For example, but not by way of limitation, the method can comprise incubating (e.g., culturing) the cell or plurality of cells to express the target nucleic acid from the promoter recognized by RNA polymerase III (e.g., a U6 promoter), e.g., the first promoter present with a hybrid promoter of the present disclosure. In certain embodiments, the method can comprise incubating (e.g., culturing) the cell or plurality of cells for a sufficient amount of time to allow expression of the target nucleic acid, e.g., incubating (e.g., culturing) the cell or plurality of cells for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days or about 10 days.

[0243] In certain embodiments, the target nucleic acid encodes a gRNA, and a method of the present disclosure can comprise incubating (e.g., culturing) the cell or plurality of cells to express the gRNA. In certain embodiments, the method can comprise incubating (e.g., culturing) the cell or plurality of cells for a sufficient amount of time to allow expression of the target nucleic acid and / or editing of the target genomic sequence by the gRNA. For example, but not by way of limitation, the method can comprise incubating (e.g., culturing) the cell or plurality of cells for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days or about 10 days to allow expression of the gRNA and / or editing of the target genomic sequence present in the cell by the gRNA.

[0244] In certain embodiments, the target nucleic acid includes a barcode, and a method of the present disclosure can comprise incubating (e.g., culturing) the cell or plurality of cells to express the barcode. For example, but not by way of limitation, the method can comprise incubating (e.g., culturing) the cell or plurality of cells for about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours, about 10 hours, about 11 hours, about 12 hours, about 13 hours, about 14 hours, about 15 hours, about 16 hours, about 17 hours, about 18 hours, about 19 hours, about 20 hours, about 21 hours, about 22 hours, about 23 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days or about 10 days to allow expression of the barcode, e.g., allow expression of the target nucleic acid that includes the barcode.

[0245] A. Sample Preparation

[0246] In certain embodiments, the method can further comprise preparing the sample (e.g., a cell or a plurality of cells) for detection of the target nucleic acids. As shown in FIG. 1 and FIG. 9A, exemplary methods of the present disclosure comprise the preparation of a sample (e.g., a cell or a plurality of cells) for the imaging of one or more target nucleic acids in the sample.

[0247] In certain embodiments, the sample (e.g., the cell or plurality of cells) to be analyzed undergoes a sample preparation process prior to the imaging of the one or more target nucleic acids in the sample. In certain embodiments, the sample preparation process can comprise a fixation process, a permeabilization process and / or a decrosslinking process. In certain embodiments, sample preparation comprises a fixation process. In certain embodiments, sample preparation can comprise a permeabilization process. In certain embodiments, sample preparation can comprise a decrosslinking process. In certain embodiments, sample preparation comprises a fixation process and a permeabilization process. In certain embodiments, sample preparation comprises a fixation process and a decrosslinking process. In certain embodiments, sample preparation comprises a fixation process, a permeabilization process and a decrosslinking process.

[0248] In certain embodiments, the fixation process comprises contacting a sample (e.g., a cell or a plurality of cells) with a fixative to generate a fixed sample (e.g., a fixed cell or a plurality of fixed cells). Non-limiting examples of fixatives comprise aldehydes (e.g., formaldehyde, paraformaldehyde and glutaraldehyde), imidoesters, N-Hydroxysuccinimide (NHS) esters (e.g., Bis-NHS ester), alcohols (e.g., methanol and ethanol), acetone and acetic acid. In certain embodiments, the fixation process can be performed by exposing the sample to an aldehyde. In certain embodiments, the fixation process can be performed by exposing the sample to formaldehyde. In certain embodiments, the fixation process can be performed by exposing the sample to glutaraldehyde. In certain embodiments, the fixation process can be performed by exposing the sample to a solution that comprises formaldehyde and glutaraldehyde. In certain embodiments, the fixation process can be performed by exposing the sample to a solution that comprises an aldehyde (e.g., formaldehyde) and acetic acid. In certain embodiments, the fixation process can be performed by exposing the sample to a solution that comprises a non-crosslinking fixative (e.g., an alcohol). In certain embodiments, the sample is fixed in a final fixative concentration (e.g., in v / v, w / w, v / w or w / v) of about 0.1% to about 10% , about 1% to about 10%, about 1% to about 8%, about 2% to about 7%, about 2% to about 6%, about 3% to about 6% or about 3% to about 5%. In certain embodiments, the sample is fixed in a final formaldehyde concentration (e.g., in v / v, w / w, v / w or w / v) of about 0.1% to about 10%, about 1% to about 10%, about 1% to about 8%, about 2% to about 7%, about 3% to about 6% or about 3% to about 5%, e.g., about 4%. In certain embodiments, the sample is fixed in a final formaldehyde concentration of about 2% to about 6%. In certain embodiments, the sample is fixed in a final formaldehyde concentration of about 4%. In certain embodiments, the sample can be contacted with a fixative for about 5 hours or less, about 4 hours or less, about 3 hours or less, about 2 hours or less, about 1 hour or less, about 50 minutes or less, about 40 minutes or less, about 30 minutes or less, about 20 minutes or less, about 10 minutes or less or about 5 minutes or less. In certain embodiments, the sample can be contacted with a fixative for about 1 hour or less. In certain embodiments, the sample can be contacted with a fixative for about 5 minutes to about 1 hour, e.g., for about 5 minutes to about 30 minutes. In certain embodiments, a sample can be contacted by a fixative at a temperature ranging from about -20°C to 50°C, e.g., at room temperature (RT). For example, the sample can be fixed after the sample is contacted with a presently disclosed nucleic acid construct or composition thereof of the present disclosure but prior to detecting a target nucleic acid expressed from the nucleic acid construct in the sample.

[0249] In certain embodiments, the sample can be permeabilized after fixation. For example, but not by way of limitation, the sample can be permeabilized after fixation of the sample and prior to detecting the target nucleic acid (e.g., to generate a fixed and permeabilized sample (e.g., a fixed and permeabilized cell or a plurality of fixed and permeabilized cells)). Techniques for permeabilizing cells are known in the art and one of skill in the art would be able to assess the appropriateness of a particular technique for use in connection with the methods of the present disclosure. Non-limiting examples of reagents for permeabilizing cells comprise detergents (e.g., saponin, Tween-20 and Triton X-100) and fixatives (e.g., acetone, methanol and ethanol). For example, but not by way of limitation, the sample can be permeabilized with an alcohol, e.g., methanol, and / or a detergent, e.g., such as Triton X-100. In certain embodiments, a reagent for permeabilization can be used at a concentration e.g. , in v / v, w / w, v / w or w / v) of about 0.1% to about 90%, e.g., about 10% to about 90%, about 20% to about 90%, about 30% to about 90%, about 40% to about 90%, about 50% to about 90%, about 60% to about 90%, about 10% to about 80% or about 10% to about 80%. In certain embodiments, a reagent for permeabilization can be used at a concentration of about 0.1% to about 90% v / v, e.g., about 10% to about 90% v / v, about 20% to about 90% v / v, about 30% to about 90% v / v, about 40% to about 90% v / v, about 50% to about 90% v / v, about 60% to about 90% v / v, about 10% to about 80% v / v or about 10% to about 80% v / v. In certain embodiments, a reagent (e.g., an alcohol) for permeabilization can be used at a concentration of about 50% v / v to about 90% v / v, e.g., 70% v / v. In certain embodiments, permeabilization can be performed by contacting the fixed sample about 70% v / v ethanol. In certain embodiments, the sample, e.g., fixed sample, can be contacted with a permeabilization reagent for about 5 hours or less, about 4 hours or less, about 3 hours or less, about 2 hours or less, about 1 hour or less, about 50 minutes or less, about 40 minutes or less, about 30 minutes or less, about 20 minutes or less, about 10 minutes or less or about 5 minutes or less. In certain embodiments, the sample, e.g., fixed sample, can be contacted with a permeabilization reagent for about 1 hour or less. In certain embodiments, the sample, e.g., fixed sample, can be contacted with a permeabilization reagent for about 5 minutes to about 1 hour, e.g., for about 5 minutes to about 30 minutes. In certain embodiments, a sample can be contacted with a permeabilization reagent, e.g., an alcohol, at a temperature ranging from about -80°C to 50°C, e.g., at room temperature (RT). In certain embodiments, the permeabilization reagent comprises an alcohol. In certain embodiments, the permeabilization reagent is ethanol (e.g., about 70% v / v ethanol) and / or methanol. In certain embodiments, the permeabilization reagent comprises ethanol, e.g., about 70% v / v ethanol. In certain embodiments, the permeabilization reagent comprises methanol. For example, but not by way of limitation, the sample can be permeabilized after the sample undergoes fixation but prior to detecting a target nucleic acid present in the nucleic acid construct in the sample. In certain embodiments, fixation and permeabilization can occur simultaneously.

[0250] In certain embodiments, the sample can be treated to remove crosslinking (referred to herein as decrosslinking), e.g., fixative-induced crosslinking. In certain embodiments, the sample can undergo decrosslinking after fixation and permeabilization. For example, but not by way of limitation, the sample can be decrosslinked after fixation and permeabilization of the sample and prior to detecting the target nucleic acid (e.g., to generate a fixed, permeabilized and decrosslinked sample (e.g., a fixed and permeabilized cell or a plurality of fixed, permeabilized and decrosslinked cells)). The use of decrosslinking after fixation allows for an increase in the sensitivity and precision of target nucleic acid detection as shown in FIG. 10E compared to no decrosslinking. In addition, the use of decrosslinking allows for the allows for the use of additional types of fixatives, e.g., including aldehyde- based fixatives, prior to performing in vitro transcription. In certain embodiments, decrosslinking comprises heating the fixed sample. In certain embodiments, decrosslinking comprises contacting the sample with a reagent or composition thereof for decrosslinking. In certain embodiments, a reagent or a composition thereof for decrosslinking comprises one or more salts, one or more small molecule catalysts, one or more buffers and / or one or more detergents. In certain embodiments, the decrosslinking reagent or composition thereof comprises sodium chloride, a boronic acid or a derivative thereof (e.g., an aminophenylboronic acid or a cyclic boronic acid ester), a phosphonic acid ester, a bismuth salt (e.g., ranitidine bismuth citrate, colloidal bismuth subcitrate, tripotassium dicitratobismuthate, bismuth subsalicylate and bismuth subnitrate) and / or sodium bicarbonate. In certain embodiments, the sample, e.g., fixed and permeabilized sample, can be contacted with a decrosslinking reagent or composition thereof for about 24 hours or less, e.g., about 22 hours or less, about 20 hours or less, about 18 hours or less, about 16 hours or less, about 14 hours or less, about 12 hours or less, about 10 hours or less, about 9 hours or less, about 8 hours or less, about 7 hours or less, about 6 hours or less, about 5 hours or less, about 4 hours or less, about 3 hours or less, about 2 hours or less or about 1 hour or less. In certain embodiments, the sample, e.g., fixed and permeabilized sample, can be contacted with a decrosslinking reagent composition thereof for about 5 hours or less. In certain embodiments, the sample, e.g., fixed and permeabilized sample, can be contacted with a decrosslinking reagent or composition thereof for about 2 hours to about 6 hours, e.g. , about 4 hours. In certain embodiments, a sample can be contacted with a decrosslinking reagent or composition thereof, e.g, sodium chloride and / or sodium bicarbonate, at a temperature ranging from about 25°C to 100°C, e.g, at 65°C. For example, the sample can undergo decrosslinking after the sample undergoes fixation and permeabilization but prior to detecting a target nucleic acid present in the nucleic acid construct in the sample. In certain embodiments, the analysis of a characteristic of the cells expressing (or not expressing) the target nucleic acid is performed prior to decrosslinking.

[0251] B. In Vitro Transcription

[0252] In certain embodiments, methods of the present disclosure comprise performing an in vitro transcription process. In certain embodiments, methods of the present disclosure comprise synthesis of the nucleic acid that is contained within the nucleic acid construct present in the cell (e.g., in a plurality of cells) by in vitro transcription. For example, but not by way of limitation, methods of the present disclosure comprise transcribing the target nucleic acid that is comprised within the nucleic acid construct present in the cell (e.g., in a plurality of cells) using the promoter that is active in fixed cells (e.g., the second promoter). In certain embodiments, the method comprises transcribing the target nucleic acid using the second promoter, e.g., present within a hybrid promoter of the present disclosure.

[0253] In certain embodiments, in vitro transcription is performed by contacting the sample with a reagent composition that comprises the RNA polymerase that recognizes the promoter present in the nucleic acid construct for expressing the target nucleic acid in fixed cells (e.g., the second promoter). In certain embodiments, the second promoter can be a T3 promoter, a T7 promoter and / or a Sp6 promoter. In certain embodiments, the reagent composition comprises a phage RNA polymerase. Non-limiting examples of phage RNA polymerases comprise a bacteriophage T3 RNA polymerase, a bacteriophage T7 RNA polymerase, a bacteriophage SP6 RNA polymerase or a combination thereof. In certain embodiments, the second promoter is a Sp6 promoter, and the RNA polymerase in the reagent composition is a Sp6 RNA polymerase. In certain embodiments, the second promoter is a T3 promoter, and the RNA polymerase in the reagent composition is a T3 RNA polymerase. In certain embodiments, the second promoter is a T7 promoter, and the RNA polymerase in the reagent composition is a T7 RNA polymerase. In certain embodiments, the reagent composition can further comprise one or more of: NTPs, an RNase inhibitor and / or a buffer.

[0254] In certain embodiments, in vitro transcription can be performed in the presence of a reducing agent. Non-limiting examples of reducing agents are disclosed herein, e.g., DTT (dithiothreitol), DTE (dithioerythritol), L-glutathione (GSH) and TCEP (Tris (2- Carboxyethyl) phosphine hydrochloride). For example, but not by way of limitation, in vitro transcription can be performed in the presence of DTT. In certain embodiments, in vitro transcription can be performed in the presence of a reducing agent at a concentration from about 1 mM to about 50 mM. In certain embodiments, in vitro transcription can be performed in the presence of a reducing agent at a concentration from about 1 mM to about 10 mM, e.g., about 5 mM. As shown in FIG. 101-10 J, the presence of DTT allows for the use of a reduced concentration of the T7 polymerase during in vitro transcription.

[0255] In certain embodiments, in vitro transcription is performed for about 4 hours to about 48 hours, e.g., about 24 hours, about 12 hours or about 6 hours. In certain embodiments, in vitro transcription is performed for about 24 hours. In certain embodiments, in vitro transcription is performed for about 12 hours. In certain embodiments, in vitro transcription is performed at a temperature ranging from about 25°C to 50°C, e.g., at 37°C. In certain embodiments, in vitro transcription is performed at about 37°C.

[0256] C. Nucleic Acid Imaging

[0257] In certain embodiments, methods of the present disclosure can comprise the imaging of the one or more target nucleic acids in the sample (e.g., the cell or the plurality of cells). For example, but not by way of limitation, methods of the present disclosure can further comprise the imaging of one target nucleic acid, two or more target nucleic acids, three or more target nucleic acids, four or more target nucleic acids, five or more target nucleic acids, six or more target nucleic acids, seven or more target nucleic acids, eight or more target nucleic acids, nine or more target nucleic acids or ten or more target nucleic acids in a sample.

[0258] In certain embodiments, methods of the present disclosure can comprise imaging a target nucleic acid in a cell of a sample (e.g., a plurality of cells) and imaging a second target nucleic acid in a second cell of the sample (e.g., the plurality of cells). In certain embodiments, methods of the present disclosure can comprise imaging a target nucleic acid in a cell of a sample (e.g., a plurality of cells), imaging a second target nucleic acid in a second cell of the sample (e.g., the plurality of cells) and imaging a third target nucleic acid in a third cell of the sample (e.g., the plurality of cells).

[0259] In certain embodiments, methods of the present disclosure can comprise imaging a target nucleic acid in a subset of cells in the sample (e.g., a plurality of cells) and imaging a second target nucleic acid in a second subset of cells in the sample (e.g., the plurality of cells). In certain embodiments, methods of the present disclosure can comprise imaging a target nucleic acid in a subset of cells in the sample (e.g., a plurality of cells), imaging a second target nucleic acid in a second subset of cells in the sample (e.g., the plurality of cells) and imaging a third target nucleic acid in a third subset of cells in the sample (e.g., the plurality of cells).

[0260] In certain embodiments, imaging of one or more target nucleic acids in the sample can comprise one or more of the following processes: performing a reverse transcription process, performing a gap filling process, performing an amplification process, performing a sequencing process and / or performing fluorescent in situ hybridization.

[0261] In certain embodiments, imaging one or more target nucleic acids in the sample, e.g., using an in situ sequencing process, can comprise one or more of the following processes: performing a reverse transcription process, performing a gap filling process, performing an amplification process and performing a sequencing process. In certain example embodiments, the amplified target nucleic acids are detected using in situ sequencing. As described herein, in situ sequencing is the sequencing of a nucleic acid directly in the cell and / or sample the nucleic acid is present in. In certain embodiments, in situ sequencing allows for the resolution of target nucleic acids in single cells. In certain embodiments, detection of one or more target nucleic acids in the sample can be performed using an in situ sequencing process that comprises performing a reverse transcription process, performing a gap filling process, performing an amplification process and performing a sequencing process.

[0262] In certain embodiments, methods of the present disclosure can comprise performing reverse transcription of the expressed target nucleic acid. In certain embodiments, reverse transcription comprises the generation of cDNA from the target nucleic acid that is expressed from nucleic acid construct. In certain embodiments, reverse transcription is performed by contacting the sample with a reagent composition that comprises a Reverse Transcriptase. In certain embodiments, the reagent composition can further comprise one or more of: dNTPs, an RNase inhibitor, one or more primers and / or a buffer. In certain embodiments, the one or more primers hybridizes to the target nucleic acid expressed from the nucleic acid construct, e.g., expressed from the first promoter, the second promoter or both promoters. In certain embodiments, reverse transcription is performed for about 4 hours to about 48 hours, e.g., about 24 hours or about 12 hours. In certain embodiments, reverse transcription is performed for about 24 hours. In certain embodiments, reverse transcription is performed for about 12 hours. In certain embodiments, reverse transcription is performed at a temperature ranging from about 25°C to 50°C, e.g., at 37°C. In certain embodiments, reverse transcription is performed at about 37°C.

[0263] In certain embodiments, methods of the present disclosure can further comprise performing an amplification process to amplify the target nucleic acid, e.g., the cDNA generated from the reverse transcription process. Suitable nucleic acid amplification methods known in the art can be assessed by those of skill in the art to identify strategies appropriate to amplify the target nucleic acid. Non-limiting examples of such amplification processes comprise polymerase chain reaction (PCR), reverse transcriptase PCR, real-time PCR, rolling circle amplification (RCA), self-sustained sequence replication (3 SR), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), transcription-mediated amplification (TMA), single primer isothermal amplification (SPIA), helicase-dependent amplification (HDA), loop mediated amplification (LAMP), recombinase-polymerase amplification (RPA), nicking enzyme amplification reaction (NEAR), nicking endonuclease assisted nanoparticle activation (NENNA) and ligase chain reaction (LCR). Fakruddin et al., J. Pharm. Bioallied. Sci. 5(4): 245-252 (2013) and Yan et al., Mol. BioSyst. 10:970-1003 (2014) disclose additional amplification processes for use in the present disclosure, the contents of each of which are disclosed in their entireties herein.

[0264] In certain embodiments, the amplification process can comprise a gap filling process. For example, but not by way of limitation, a method of the present disclosure can comprise a gap filling process prior to amplification. In certain embodiments, gap filling is performed by contacting the sample with a reagent composition that comprises a polymerase, e.g., a Taq polymerase, a padlock oligonucleotide and a ligase. In certain embodiments, padlock oligonucleotides are linear oligonucleotides that can be converted into a circular DNA molecule by ligation upon hybridization to a target nucleic acid. In certain embodiments, ligation is performed using a ligase that ligates single stranded DNA, e.g., Ampligase ligase. Additional disclosure regarding the use of padlock oligonucleotides is provided in Sountoulidis et al., PLoS Biology 18(1 l):e3000675 (2020), the contents of which is herein incorporated by reference.

[0265] In certain embodiments, hybridization of the padlock oligonucleotides to the target nucleic acids can occur in hybridization buffer for a period of about 1 hour to about 24 hours, e.g., from about 2 hours to about 20 hours, from about 2 hours to about 16 hours or from about 2 hours to about 12 hours. In certain embodiments, the padlock oligonucleotides can be used at a concentration from about 100 pM to about 100 pM, e.g., about 100 pM to about 10 pM, about 100 pM to about 1,000 nM, about 100 pM to about 100 nM, about 100 pM to about 10 nM, about 100 pM to about 1 nM or about 1 nM to about 1,000 nM. In certain embodiments, the padlock oligonucleotides can be used at a concentration from about 1 nM to about 1,000 nM, e.g., from about 1 nM to about 900 nM, from about 1 nM to about 800 nM, from about 1 nM to about 700 nM, from about 1 nM to about 600 nM, from about 1 nM to about 500 nM, from about 1 nM to about 400 nM, from about 1 nM to about 300 nM, from about 1 nM to about 200 nM, from about 10 nM to about 200 nM or from about 50 nM to about 200 nM. In certain embodiments, the concentration of the padlock oligonucleotides is from about 1 nM to about 200 nM. In certain embodiments, the gap filling process can occur for a period of about 1 hour to about 24 hours, e.g., from about 1 hours to about 20 hours, from about 10 minutes to about 16 hours, from about 1 hour to about 12 hours, from about 1 hour to about 10 hours, from about 1 hour to about 5 hours, from about 1 hour to about 2 hours. In certain embodiments, the gap filling process can occur at a temperature ranging from about 10°C to 60°C, e.g., at 37°C and / or 45°C.

[0266] In certain embodiments, a plurality of oligonucleotides, e.g., padlock oligonucleotides, for detecting multiple different target nucleic acids can be used in the present disclosure. For example, but not by way of limitation, each oligonucleotide, e.g., padlock oligonucleotide, specifically binds to a single target nucleic acid. For example, but not by way of limitation, two or more padlock oligonucleotides, three or more padlock oligonucleotides, four or more padlock oligonucleotides, five or more padlock oligonucleotides, six or more padlock oligonucleotides, seven or more padlock oligonucleotides, eight or more padlock oligonucleotides, nine or more padlock oligonucleotides or ten or more padlock oligonucleotides can be used in the present disclosure, where each padlock oligonucleotide specifically binds to a single target nucleic acid, e.g., when the plurality of cells are contacted with more than one nucleic acid construct of the present disclosure.

[0267] In certain embodiments, the resulting circularized single-stranded DNA molecules can then be amplified using an amplification process. In certain embodiments, performing an amplification process comprises contacting the sample with the reagents necessary for the amplification process and performing that process under conditions suitable for amplification of the target nucleic acid. Non-limiting examples of such reagents comprise polymerases, nucleoside triphosphates or NTP analogues, primers, probes, primers, cofactors, ligation reaction reagents, endonucleases, lysis reagents, dyes, markers or labels. In certain embodiments, additional reagents can comprise RNase inhibitors to protect the integrity of the RNA in the sample, e.g., by inhibiting the activity of RNase A, B and / or C.

[0268] In certain embodiments, the amplification reaction is RCA. In certain embodiments, the amplification reaction comprises amplification reactions that use a polymerase with exonuclease activity. In certain embodiments, the amplification reaction comprises amplification reactions that comprise phi29 polymerase. In certain embodiments, the amplification process is an RCA process that uses phi29 polymerase. This RCA process produces a single-stranded DNA molecule, referred to herein as an “RCA amplicon,” containing multiple tandem repeats of the original target nucleic acid sequence. In certain embodiments, the RCA process can be performed for about 24 hours or less, e.g., about 22 hours or less, about 20 hours or less, about 18 hours or less, about 16 hours or less, about 14 hours or less, about 12 hours or less, about 10 hours or less, about 9 hours or less, about 8 hours or less, about 7 hours or less, about 6 hours or less, about 5 hours or less, about 4 hours or less, about 3 hours or less, about 2 hours or less or about 1 hour or less. In certain embodiments, the RCA process can be performed for about 1 hour to about 24 hours, e.g., about 2 hours to about 22 hours, about 4 hours to about 20 hours, about 6 hours to about 18 hours, about 8 hours to about 18 hours, about 10 hours to about 18 hours, about 12 hours to about 18 hours or about 14 hours to about 18 hours. In certain embodiments, the RCA process can be performed for about 16 hours. In certain embodiments, the RCA process can occur at a temperature ranging from about 10°C to 60°C, e.g., at 30°C. In certain embodiments, the RCA process can occur at a temperature of about 30°C.

[0269] In certain embodiments, the in situ sequencing technique can further comprise performing a sequencing process, e.g., a next-generation sequencing (NGS) process. In certain embodiments, the sequencing process can be a sequencing by synthesis process. In certain embodiments, the in situ sequencing technique can further comprise performing sequencing by synthesis. In certain embodiments, amplicons generated by an amplification process are imaged using a sequencing process, e.g., a sequencing by synthesis process. In certain embodiments, sequencing by synthesis relies on a primer complementary to a sequence present in the amplicons and a DNA polymerase to incorporate four reversible terminator-bound dNTPs. In certain embodiments, each of the four reversible terminatorbound dNTPs are coupled to a different detectable label. Non-limiting examples of detectable labels comprise fluorescent labels (such as fluorescein (e.g., 5 -fluorescein, 6- carboxyfluorescein, 3’6-carboxyfluorescein, 5(6)-carboxyfluorescein, 6-hexachloro- fluorescein, 6-tetrachlorofluorescein, fluorescein isothiocyanate, and the like), rhodamine, phycobiliproteins and R-phycoerythrin and quantum dots (e.g., zinc sulfide-capped cadmium selenide)), chromogenic labels, electron dense labels, chemiluminescent labels and radioactive labels. One or more bases are added per cycle and the fluorescently labeled reversible terminator is imaged as each dNTP is added. In certain embodiments, each cycle has a duration of about 10 msec to about 500 msec, e.g., about 200 msec. In certain embodiments, if a cell contains a target nucleic acid, spot-like structures will be observed in the cell, as shown in FIGS. 9D-9E. In certain embodiments, multiple target nucleic acids within the same cell can be imaged by sequencing by synthesis. In certain embodiments, different target nucleic acids present in different cells within the plurality of cells can be imaged using sequencing by synthesis. In certain embodiments, a first cell within the plurality of cells can comprise a first nucleic acid that is imaged by sequencing by synthesis and a second cell within the plurality of cells can comprise a second nucleic acid that is imaged by sequencing by synthesis.

[0270] In certain embodiments, imaging of one or more target nucleic acids in the sample can comprise one or more of the following processes: performing a reverse transcription process, performing a gap filling process, performing an amplification process and performing fluorescent in situ hybridization. For example, but not by way of limitation, imaging of one or more target nucleic acids in the sample can comprise performing fluorescent in situ hybridization, e.g., without performing a reverse transcription process, performing a gap filling process and / or performing an amplification process. In certain embodiments, imaging of one or more target nucleic acids in the sample can comprise performing a reverse transcription process, performing an amplification process and performing fluorescent in situ hybridization. In certain embodiments, imaging of one or more target nucleic acids in the sample can comprise performing a reverse transcription process and performing fluorescent in situ hybridization. In certain embodiments, imaging of the target nucleic acids can be performed by in situ hybridization using detection probes. Alternatively or additionally, a method of the present disclosure comprises an in situ sequencing process to image the target nucleic acids and further comprises imaging other nucleic acids within the plurality of cells using a detection probe. A “detection probe” refers to an oligonucleotide that can selectively hybridize to at least a portion of a target sequence (e.g., a portion of a target sequence that has been amplified during RCA) under appropriate hybridization conditions. In certain embodiments, the detection probe can comprise or consist of about 10 to about 50 nucleotides, e.g., about 15 to about 30 nucleotides. In certain embodiments, a detection probe for use in the present disclosure comprises a sequence that specifically hybridizes to an RCA amplicon. In certain embodiments, the detection probe is conjugated to a detectable label to facilitate imaging. In certain embodiments, the detection probe is fluorescently labeled. In certain embodiments, the detection probe covalently bound to a fluorescent label at its 5’ end or 3’ end.

[0271] In certain embodiments where multiple target nucleic acids are to be imaged in a single sample, specific detection probes, e.g., detection probes for specific target nucleic acids, can each be labeled with a different label, e.g., fluorophore, thus allowing for simultaneous imaging of a plurality of target nucleic acids. Similarly, in certain embodiments where multiple target nucleic acids are to be imaged in a single sample, specific detection probes, e.g., detection probes for specific target nucleic acids, each can be labeled with a different label, e.g., fluorophore, thus allowing for simultaneous imaging of a plurality of target nucleic acids.

[0272] D. Analysis of Characteristics

[0273] In certain embodiments, a method of the present disclosure can further comprise analyzing the characteristics of the cells expressing (or not expressing) the target nucleic acid. For example, but not by way of limitation, the present disclosure provides methods for analyzing one or more characteristics in a plurality of cells, e.g., in a plurality of cells comprising two or more different cell types, in a plurality of cells comprising cells having different developmental stages, in a plurality of cells comprising cells of different lineages, in a plurality of cells comprising cells of different disease states, in a plurality of cells comprising cells treated with an agent, in a plurality of cells comprising cells that are genetically modified, in a plurality of cells comprising cells obtained from a tissue sample and / or in a plurality of cells comprising cells obtained from a cell culture.

[0274] In certain embodiments, a method of the present disclosure can comprise analyzing a change in one or more characteristics of a cell that expresses a target nucleic acid, e.g., a gRNA, compared to a cell that does not express the target nucleic acid, e.g., the gRNA. Non-limiting examples of characteristics that can be analyzed comprise cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, karyotype, chromosomal aberrations, nucleic acid expression levels (e.g., mRNA expression levels, e.g., RNA transcriptome), nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications (e.g., methylation), post- translational modifications (e.g., phosphorylation, ubiquitination and / or glycosylation), activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity (e.g., enzymatic cleavage), chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, and membrane potential.

[0275] In certain embodiments, the characteristic to be analyzed in a method of the present disclosure is the localization of one or more proteins. In certain embodiments, the characteristic to be analyzed in a method of the present disclosure is the expression, e.g., expression level, of one or more proteins.

[0276] In certain embodiments, a method of the present disclosure can include analyzing about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more or about 100 or more target proteins in a cell of the plurality of cells. For example, but not by way of limitation, a method of the present disclosure can include analyzing about 1 to about 100 target proteins, e.g., about 10 to about 100 target proteins, about 20 to about 100 target proteins, about 30 to about 100 target proteins, about 40 to about 100 target proteins, about 50 to about 100 target proteins, about 60 to about 100 target proteins, about 70 to about 100 target proteins, about 80 to about 100 target proteins, about 90 to about 100 target proteins, about 1 to about 90 target proteins, about 1 to about 80 target proteins, about 1 to about 70 target proteins, about 1 to about 60 target proteins, about 1 to about 50 target proteins, about 1 to about 40 target proteins, about 1 to about 30 target proteins, about 1 to about 20 target proteins, about 1 to about 10 target proteins, about 10 to about 80 target proteins, about 10 to about 70 target proteins or about 10 to about 50 target proteins.

[0277] In certain embodiments, more than 1 target protein can be analyzed by immunofluorescence, e.g., by iterative immunolabeling (e.g., indirect or direct) and removal (e.g., by chemical bleaching) for highly multiplexed imaging of proteins. For example, but not by way of limitation, the immunofluorescence process can be an iterative bleaching extends multiplexity (IBEX) process or an iterative indirect immunofluorescence imaging (4i) process.

[0278] In certain embodiments, a method of the present disclosure can comprise analyzing a change in protein expression levels, e.g., as shown in FIG. 11F and FIG. 11J. For example, but not by way of limitation, a method of the present disclosure can further include performing immunofluorescence to detect a change in expression of one or more target proteins, e.g. two or more, three or more, four or more or five or more target proteins. In certain embodiments, a method of the present disclosure can further include performing immunofluorescence to detect a change in expression of about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more or about 100 or more target proteins.

[0279] In certain embodiments, a method of the present disclosure can comprise analyzing a change in protein localization, e.g, as shown in FIG. 11F and FIG. 11 J. For example, but not by way of limitation, a method of the present disclosure can further include performing immunofluorescence to detect a change in localization of one or more target proteins, e.g., two or more, three or more, four or more or five or more target proteins. In certain embodiments, a method of the present disclosure can further include performing immunofluorescence to detect a change in localization of about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more or about 100 or more target proteins.

[0280] In certain embodiments, the characteristic to be analyzed in a method of the present disclosure is the localization of one or more nucleic acids, e.g., mRNAs. In certain embodiments, the characteristic to be analyzed in a method of the present disclosure is the expression, e.g., expression level, of one or more nucleic acids, e.g., mRNAs.

[0281] In certain embodiments, a method of the present disclosure can include analyzing about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 200 or more, about 300 or more, about 400 or more, about 500 or more, about 600 or more, about 700 or more, about 800 or more, about 900 or more, about 1,000 or more, about 1,500 or more, about 2,000 or more, about 2,500 or more or about 3,000 or more nucleic acids, e.g., mRNAs, in a cell of the plurality of cells. For example, but not by way of limitation, a method of the present disclosure can include analyzing about 1 to about 2,000, about 1 to about 1,500, about 1 to about 1,000, about 1 to about 500, about 1 to about 100, about 10 to about 3,000, about 50 to about 3,000, about 100 to about 3,000, about 500 to about 3,000, about 1,000 to about 3,000, about 1,500 to about 3,000, about 2,000 to about 3,000, about 10 to about 1,000, about 10 to about 500 or about 10 to about 100 more nucleic acids, e.g., mRNAs, in a cell of the plurality of cells. In certain embodiments, the nucleic acids being analyzed (e.g., prior to transcription) are distinct from the target nucleic acids included in the nucleic acid construct present within the cells.

[0282] In certain embodiments, a method of the present disclosure can comprise analyzing a change in nucleic acid expression levels (e.g., mRNA expression levels, e.g., RNA transcriptome). For example, but not by way of limitation, a method of the present disclosure can include performing in situ hybridization, e.g., fluorescent in situ hybridization (FISH), for analyzing a change in nucleic acid expression levels (e.g., mRNA expression levels, e.g., RNA transcriptome). In certain embodiments, a method of the present disclosure can comprise analyzing a change in the expression levels of about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 200 or more, about 300 or more, about 400 or more, about 500 or more, about 600 or more, about 700 or more, about 800 or more, about 900 or more, about 1,000 or more, about 1,500 or more, about 2,000 or more, about 2,500 or more or about 3,000 or more nucleic acids (e.g., mRNAs).

[0283] In certain embodiments, a method of the present disclosure can comprise analyzing a change in nucleic acid localization (e.g., mRNA localization), e.g., as shown in FIG. 11F, FIG. 11 J and FIG. 13N. For example, but not by way of limitation, a method of the present disclosure can include performing in situ hybridization, e.g., fluorescent in situ hybridization (FISH), for analyzing a change in nucleic acid localization (e.g., mRNA localization). In certain embodiments, a method of the present disclosure can comprise analyzing a change in the localization of about 1 or more, about 10 or more, about 20 or more, about 30 or more, about 40 or more, about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 200 or more, about 300 or more, about 400 or more, about 500 or more, about 600 or more, about 700 or more, about 800 or more, about 900 or more, about 1,000 or more, about 1,500 or more, about 2,000 or more, about 2,500 or more or about 3,000 or more nucleic acids (e.g., mRNAs).

[0284] In certain embodiments, a method of the present disclosure can comprise analyzing the characteristics of a cell expressing the target nucleic acid compared to a cell that does not express the target nucleic acid to determine a change in a characteristic that is associated with the expression of the target nucleic acid. In certain embodiments, the method comprises providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the method can further comprise culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, fixing the plurality of cells to generate a plurality of fixed cells and transcribing the target nucleic acid in at least one cell of the plurality of fixed cells using the second promoter. In certain embodiments, the method comprises performing an amplification process for amplifying the target nucleic acid, imaging the amplified target nucleic acid using in situ sequencing (e.g., sequencing by synthesis) and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the target nucleic acid. In certain embodiments, the change in a characteristic is determined prior to the imaging of the amplified target nucleic acid (e.g., by in situ sequencing). In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the target nucleic acid in the plurality of fixed cells using the second promoter.

[0285] In certain embodiments, a method of the present disclosure can comprise analyzing the characteristics of a cell expressing the target nucleic acid compared to a cell that does not express the target nucleic acid to determine a change in a characteristic that is associated with the expression of the target nucleic acid. In certain embodiments, the method comprises providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the method can further comprise culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter and fixing the plurality of cells to generate a plurality of fixed cells. The method can further include analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the target nucleic acid. In certain embodiments, the characteristic can be protein and / or RNA expression levels or localization. In certain embodiments, the method includes transcribing the target nucleic acid in at least one cell of the plurality of fixed cells using the second promoter. In certain embodiments, the method comprises performing an amplification process for amplifying the target nucleic acid and imaging the amplified target nucleic acid using in situ sequencing (e.g., sequencing by synthesis). In certain embodiments, the method includes correlating the change in characteristic with the expression of the target nucleic acid as determined by in situ sequencing. In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the target nucleic acid in the plurality of fixed cells using the second promoter.

[0286] In certain embodiments, a method of the present disclosure comprises providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a first nucleic acid construct and at least a second cell comprises a second nucleic acid construct. In certain embodiments, the first nucleic acid construct comprises a first promoter, a second promoter and a first target nucleic acid, wherein the first promoter and the second promoter are located upstream to the first target nucleic acid in the first nucleic acid construct. In certain embodiments, the second nucleic acid construct comprises the first promoter, the second promoter and a second target nucleic acid, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the method can further comprise culturing the plurality of cells to allow expression of the first and second target nucleic acids using the first promoter, fixing the plurality of cells to generate a plurality of fixed cells and transcribing the first and second target nucleic acids in the plurality of fixed cells using the second promoter. In certain embodiments, the genome screen comprises performing an amplification process for amplifying the first and second target nucleic acids, imaging the amplified target nucleic acids using in situ sequencing (e.g., sequencing by synthesis) and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the first target nucleic acid and / or second target nucleic acid. In certain embodiments, the change in a characteristic is determined prior to the imaging of the amplified target nucleic acid (e.g., by in situ sequencing). In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the first and second target nucleic acids in the plurality of fixed cells using the second promoter.

[0287] In certain embodiments, a method of the present disclosure can comprise analyzing the characteristics of a cell expressing a gRNA compared to a cell that does not express the gRNA to determine a change in a characteristic that is associated with the genetic perturbation caused by the gRNA, e.g., the knock down or knock out of the gene targeted by the gRNA. For example, but not by way of limitation, the present disclosure provides a method for performing a genomic screen. In certain embodiments, a genomic screen of the present disclosure comprises providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid encoding a gRNA, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the genomic screen can further comprise culturing the plurality of cells to allow expression of the gRNA using the first promoter, fixing the plurality of cells to generate a plurality of fixed cells and transcribing the gRNA in at least one cell of the plurality of fixed cells using the second promoter. In certain embodiments, the genomic screen comprises performing an amplification process for amplifying the gRNA, imaging the amplified gRNA in situ sequencing (e.g., using sequencing by synthesis) and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the gRNA. In certain embodiments, the change in a characteristic is determined prior to the imaging of the amplified target nucleic acid (e.g., by in situ sequencing). In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the gRNA in the plurality of fixed cells using the second promoter.

[0288] In certain embodiments, a genomic screen of the present disclosure comprises providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a first nucleic acid construct and at least a second cell comprises a second nucleic acid construct. In certain embodiments, the first nucleic acid construct comprises a first promoter, a second promoter and a first target nucleic acid encoding a first gRNA, wherein the first promoter and the second promoter are located upstream to the first target nucleic acid in the first nucleic acid construct. In certain embodiments, the second nucleic acid construct comprises the first promoter, the second promoter and a second target nucleic acid encoding a second gRNA, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the genome screen can further comprise culturing the plurality of cells to allow expression of the first and second gRNA using the first promoter, fixing the plurality of cells to generate a plurality of fixed cells and transcribing the first and second gRNA in the plurality of fixed cells using the second promoter. In certain embodiments, the genome screen comprises performing an amplification process for amplifying the first and second gRNAs, imaging the amplified gRNAs using in situ sequencing (e.g., sequencing by synthesis) and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the first gRNA and / or second gRNA. In certain embodiments, the change in a characteristic is determined prior to the imaging of the amplified target nucleic acid (e.g., by in situ sequencing). In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the first and second gRNAs in the plurality of fixed cells using the second promoter.

[0289] In certain embodiments where the nucleic acid construct further comprises a barcode, the barcode can be imaged by in situ sequencing in a method of the present disclosure. For example, but not by way of limitation, a method of the present disclosure can include providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter, a target nucleic acid and a barcode, wherein the first promoter and the second promoter are located upstream to the target nucleic acid and the barcode in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the method can further comprise culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, fixing the plurality of cells to generate a plurality of fixed cells and transcribing the target nucleic acid and the barcode in at least one cell of the plurality of fixed cells using the second promoter. In certain embodiments, the method comprises performing an amplification process for amplifying the target nucleic acid and / or the barcode, imaging the amplified target nucleic acid and / or the barcode using in situ sequencing and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the target nucleic acid. In certain embodiments, only the barcode is imaged using in situ sequencing. In certain embodiments, the change in a characteristic is determined prior to the imaging of the amplified target nucleic acid and / or barcode (e.g., by in situ sequencing). In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the target nucleic acid and barcode in the plurality of fixed cells using the second promoter.

[0290] In certain embodiments, a method of the present disclosure can comprise analyzing the characteristics of a cell expressing the target nucleic acid compared to a cell that does not express the target nucleic acid to determine a change in a characteristic that is associated with the expression of the target nucleic acid. For example, but not by way of limitation, in certain embodiments where the nucleic acid construct further comprises a barcode, the barcode can be imaged by in situ sequencing in a method of the present disclosure and the presence of the barcode confirms the presence of the target nucleic acid in the cell. In certain embodiments, the method of the present disclosure can include providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter, a target nucleic acid and a barcode, wherein the first promoter and the second promoter are located upstream to the target nucleic acid and the barcode in the nucleic acid construct. In certain embodiments, the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter. In certain embodiments, the method can further comprise culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter and fixing the plurality of cells to generate a plurality of fixed cells. The method can further include analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the target nucleic acid. In certain embodiments, the characteristic can be protein and / or RNA expression levels or localization. In certain embodiments, the method can further include transcribing the target nucleic acid and the barcode in at least one cell of the plurality of fixed cells using the second promoter. In certain embodiments, the method comprises performing an amplification process for amplifying the target nucleic acid and / or the barcode, imaging the amplified target nucleic acid and / or the barcode using in situ sequencing and analyzing a change in a characteristic of one or more cells of the plurality of cells associated with expression of the target nucleic acid. In certain embodiments, only the barcode is imaged using in situ sequencing. In certain embodiments, the presence of the barcode confirms the presence of the target nucleic acid in the cell. In certain embodiments, the method can further include decrosslinking the fixed cells prior to transcribing the target nucleic acid and barcode in the plurality of fixed cells using the second promoter.

[0291] In certain embodiments, methods of the present disclosure can comprise staining the cells with other imaging agents. For example, but not by way of limitation, methods of the present disclosure can comprise performing a cell painting technique and using immunofluorescence. In certain embodiments, additional imaging agents can be used to label cellular structures including, but not limited to, nuclei, cytoskeleton, golgi, endoplasmic reticulum, mitochondria and cell membranes. In certain embodiments, a method of the present disclosure can further comprise labeling the nucleic of the cells within the sample, e.g., the plurality of cells.

[0292] In certain embodiments, a method of the present disclosure can further comprise analyzing protein expression and / or localization of a cell expressing or not expressing the target nucleic acid. For example, but not by way of limitation, methods of the present disclosure can comprise detecting one or more proteins in the sample (e.g., cell or plurality of cells). For example, but not by way of limitation, methods of the present disclosure can comprise the staining and imaging of one or more target proteins, e.g., about 1 to about 100 target proteins. In certain embodiments, methods of the present disclosure can comprise the staining and imaging of two or more target proteins, three or more target proteins, four or more target proteins, five or more target proteins, six or more target proteins, seven or more target proteins, eight or more target proteins, nine or more target proteins or ten or more target proteins. In certain embodiments, proteins that can be stained and imaged using the methods of the present disclosure comprise any protein that is present in or on the surface of a cell. For example, but not by way of limitation, the target protein can be an intracellular protein, an extracellular protein or a transmembrane protein. In certain embodiments, the target protein is a mutated form of a protein or a wild type form of a protein. In certain embodiments, the target protein is an exogenous protein. In certain embodiments, the target protein is an endogenous protein. In certain embodiments, a method of the present disclosure includes performing immunofluorescence for detecting one or more target proteins, e.g., two or more target proteins, three or more target proteins, four or more target proteins, five or more target proteins, six or more target proteins, seven or more target proteins, eight or more target proteins, nine or more target proteins or ten or more target proteins.

[0293] In certain embodiments, a method of the present disclosure can further comprise analyzing expression of other nucleic acids, e.g., mRNA expression, in a cell expressing or not expressing the target nucleic acid. For example, but not by way of limitation, methods of the present disclosure can comprise detecting one or more nucleic acids (other than the target nucleic acids) in the sample (e.g., cell or plurality of cells). In certain embodiments, about 1 to about 2,000 nucleic acids (other than the target nucleic acids) can be detected in a sample. For example, but not by way of limitation, methods of the present disclosure can comprise performing transcriptomics to identify the expression level of mRNAs in cells expressing or not expressing the target nucleic acid.

[0294] In certain embodiments, the staining and imaging of one or more protein targets in a sample can comprise contacting a sample with a reagent that binds to a target protein, also referred to herein as a “protein binding reagent,” in the sample. In certain embodiments, the protein binding reagent is a reagent that specifically binds to a target protein, e.g., specifically binds to a target protein of a cell in a sample. In certain embodiments, the reagent that bind to the target protein allows for the imaging of the target protein. In certain embodiments, the reagent that binds to the target protein allows for the quantitative analysis of the target protein. Non-limiting example of protein binding reagents comprise antibodies or antibody binding fragments thereof, aptamers, peptides and small molecules. In certain embodiments, the sample can be contacted with the protein binding reagent, e.g., the antibody specific for the target protein, for amount of time and under conditions to support specific binding of the protein binding reagent to the target protein.

[0295] In certain embodiments, analyzing a change in one or more characteristics of a cell that expresses a target nucleic acid occurs after fixation of the plurality of cells and prior to transcription, e.g., as shown in FIG. 9A. For example, but not by way of limitation, a method of the present disclosure, e.g., a method for analyzing one or more characteristics of a plurality of cells, can include (a) providing a plurality of cells, where at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, where the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) analyzing a change in one or more characteristics of the cell of the plurality of fixed cells, (e) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter, (f) performing an amplification process to amplify the target nucleic acid and (g) imaging the amplified target nucleic acid in the at least one cell. In certain embodiments, a method of the present disclosure, e.g., a method for analyzing one or more characteristics of a plurality of cells, can include (a) providing a plurality of cells, where at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, where the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct, (b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter, (c) fixing the plurality of cells to generate a plurality of fixed cells, (d) analyzing a change in one or more characteristics of the cell of the plurality of fixed cells, (e) decrosslinking the cells to generate a plurality of decrosslinked cells, (f) transcribing the target nucleic acid in the at least one cell of the decrosslinked cells using the second promoter, (g) performing an amplification process to amplify the target nucleic acid and (h) imaging the amplified target nucleic acid in the at least one cell.

[0296] V. KITS

[0297] The present disclosure provides kits for performing the methods of the present disclosure. For example, but not by way of limitation, the present disclosure provides kits containing materials for performing a method for optically imaging a nucleic acid in a sample.

[0298] In certain embodiments, a kit of the present disclosure can comprise one or more nucleic acid constructs described herein, e.g., two or more, three or more, four or more or five or more nucleic acid constructs. In certain embodiments, a kit of the present disclosure can comprise a composition comprising one or more nucleic acid constructs described herein. In certain embodiments, a kit of the present disclosure can comprise a vector comprising one or more nucleic acid constructs described herein. For example, but not by way of limitation, a kit of the present disclosure can comprise a nucleic acid construct that comprises at least two promoter sequences upstream of the target nucleic acid, e.g., gRNA nucleotide sequence. In certain embodiments, at least one of the promoters is incorporated into the nucleotide sequence of the other promoter as described herein. In certain embodiments, the first promoter is a promoter for expressing the target nucleic acid in live cells and the second promoter is a promoter for expressing the target nucleic acids in fixed cells. In certain embodiments, the first promoter is a U6 promoter and the second promoter is a T7 promoter.

[0299] In certain embodiments, a kit of the present disclosure can further comprise reagents for preparing sample. For example, but not by way of limitation, a kit of the present disclosure can comprise reagents for performing a fixation process, a permeabilization process and / or a decrosslinking process. Non-limiting examples of such reagents comprise a fixative (e.g., an aldehyde), a permeabilizing reagent (e.g., an alcohol) and / or a decrosslinking reagent (e.g., sodium chloride and / or sodium bicarbonate).

[0300] In certain embodiments, a kit of the present disclosure can further comprise reagents for performing an in vitro transcription reaction, e.g., an in vitro transcription reaction. In certain embodiments, a kit of the present disclosure can further comprise reagents for performing a reverse transcription reaction. In certain embodiments, a kit of the present disclosure can further comprise reagents for performing an amplification reaction, e.g., an RCA reaction. In certain embodiments, a kit of the present disclosure can further comprise reagents for performing a sequencing by synthesis reaction. For example, but not by way of limitation, a kit of the present disclosure can comprise reagents comprising one more of the following: polymerases (e.g., phi29 polymerase and / or Taq polymerase), RNA polymerases (e.g., T7 RNA polymerase), reverse transcriptases, nucleoside triphosphates or NTP analogues, primers, padlock probes, cofactors, ligation reaction reagents, endonucleases, lysis reagents, dyes, markers, RNase inhibitors and labels.

[0301] In certain embodiments, a kit of the present disclosure can include one or more reducing agents, e.g., for performing an in vitro transcription reaction. Non-limiting examples of reducing agents include DTT (dithiothreitol), DTE (dithioerythritol), L- glutathione (GSH) and TCEP (Tris (2-Carboxyethyl) phosphine hydrochloride). In certain embodiments, a kit of the present disclosure includes DTT. For example, but not by way of limitation, a kit of the present disclosure can include DTT in a container at a concentration from about 1 mM to about 50 mM, e.g., about 5 mM.

[0302] In certain embodiments, a kit of the present disclosure can comprise one or more detection probes, e.g., fluorescently labeled detection probes. Non-limiting examples of suitable containers comprise bottles, test tubes, vials and microtiter plates. The containers can be formed from a variety of materials such as glass or plastic.

[0303] In certain embodiments, the kit can comprise other materials desirable from a commercial and user standpoint, including other buffers and diluents. In certain embodiments, a kit of the present disclosure can include a buffer, e.g., a buffer for performing an in vitro transcription reaction, comprising one or more reducing agents, e.g., DTT.

[0304] In certain embodiments, the kit further comprises a package insert that provides instructions for using the components provided in the kit. For example, a kit of the present disclosure can comprise a package insert that provides instructions for performing methods for imaging one or more target nucleic acids in a single sample.

[0305] In certain embodiments, the components of the kit are provided in predetermined ratios, with the relative amounts of the various reagents suitably varied to obtain the desired sensitivity and throughput of the disclosed methods.

[0306] VI. SYSTEMS

[0307] The present disclosure provides systems for performing the methods of the present disclosure. For example, but not by way of limitation, the present disclosure provides systems containing materials for performing a method for optically imaging a nucleic acid in a sample. In certain embodiments, the present disclosure provides systems that include materials or reagents (e.g., in one or more reservoirs or containers) for performing a method for optically imaging a nucleic acid in a sample. In certain embodiments, the system is an automated system. In certain embodiments, the automated system includes one or more automated pipettes for dispensing materials or reagents onto a sample.

[0308] In certain embodiments, a system of the present disclosure can include a Xenium analyzer and / or Xenium slides for use in a Xenium analyzer (lOx Genomics), e.g., as shown in FIG. 13. In certain embodiments, an automated system can include a Xenium analyzer and / or Xenium slides. For example, but not by way of limitation, a system of the present disclosure can include a Xenium analyzer for performing a method disclosed herein, where the cells analyzed using the disclosed methods and systems are cells obtained from a cell culture. In certain embodiments, a system of the present disclosure can include a Xenium analyzer for performing a method disclosed herein, where the cells analyzed using the disclosed methods and systems are cells in a tissue sample (e.g., a tissue section). In certain embodiments, the cells to be analyzed (e.g., cells containing a nucleic acid construct of the present disclosure) are placed on Xenium slides and analyzed on the Xenium analyzer prior to performing one or more steps of a method of the present disclosure. For example, but not by way of limitation, a method of the present disclosure includes the analysis of the transcriptome (e.g., RNA localization) of a sample (e.g., dissociated cells from a cell culture or a tissue sample) on a Xenium slide using a Xenium device followed by performing one or more steps of a method of the present disclosure, e.g., imaging of the target nucleic acid (e.g., by in situ sequencing), on a separate device. In certain embodiments, the Xenium slide that is used with the Xenium device for performing transcriptomics can be transferred to a separate device (e.g., imaging device) for performing imaging of the target nucleic acid (e.g., by in situ sequencing). In certain embodiments, the data obtained from the Xenium device (e.g., transcriptomic data) is aligned with the data obtained from a method of the present disclosure (e.g., images of the target nucleic acid).

[0309] In certain embodiments, a system of the present disclosure can comprise one or more nucleic acid constructs described herein, e.g., two or more, three or more, four or more or five or more nucleic acid constructs. In certain embodiments, a system of the present disclosure can comprise a composition comprising one or more nucleic acid constructs described herein. In certain embodiments, a system of the present disclosure can comprise a vector comprising one or more nucleic acid constructs described herein. For example, but not by way of limitation, a system of the present disclosure can comprise a nucleic acid construct that comprises at least two promoter sequences upstream of the target nucleic acid, e.g., gRNA nucleotide sequence. In certain embodiments, at least one of the promoters is incorporated into the nucleotide sequence of the other promoter as described herein. In certain embodiments, the first promoter is a promoter for expressing the target nucleic acid in live cells and the second promoter is a promoter for expressing the target nucleic acids in fixed cells. In certain embodiments, the first promoter is a U6 promoter and the second promoter is a T7 promoter.

[0310] In certain embodiments, a system of the present disclosure can further comprise reagents for preparing a sample (e.g., in one or more reservoirs or containers). For example, but not by way of limitation, a system of the present disclosure can comprise reagents for performing a fixation process, a permeabilization process and / or a decrosslinking process. Non-limiting examples of such reagents comprise a fixative (e.g., an aldehyde), a permeabilizing reagent (e.g., an alcohol) and / or a decrosslinking reagent (e.g., sodium chloride and / or sodium bicarbonate). In certain embodiments, a system of the present disclosure can further comprise reagents (e.g., in one or more reservoirs or containers) for performing an in vitro transcription reaction, e.g, an in vitro transcription reaction. In certain embodiments, a system of the present disclosure can further comprise reagents for performing a reverse transcription reaction. In certain embodiments, a system of the present disclosure can further comprise reagents for performing an amplification reaction, e.g., an RCA reaction. In certain embodiments, a system of the present disclosure can further comprise reagents for performing a sequencing by synthesis reaction. For example, but not by way of limitation, a system of the present disclosure can comprise reagents comprising one more of the following: polymerases (e.g., phi29 polymerase and / or Taq polymerase), RNA polymerases (e.g., T7 RNA polymerase), reverse transcriptases, nucleoside triphosphates or NTP analogues, primers, padlock probes, cofactors, ligation reaction reagents, endonucleases, lysis reagents, dyes, markers, RNase inhibitors and labels.

[0311] In certain embodiments, a system of the present disclosure can include one or more reducing agents, e.g., for performing an in vitro transcription reaction. Non-limiting examples of reducing agents include DTT (dithiothreitol), DTE (dithioerythritol), L- glutathione (GSH) and TCEP (Tris (2-Carboxyethyl) phosphine hydrochloride). In certain embodiments, a system of the present disclosure includes DTT. For example, but not by way of limitation, a system of the present disclosure can include DTT in a container at a concentration from about 1 mM to about 50 mM, e.g., about 5 mM.

[0312] In certain embodiments, a system of the present disclosure can comprise one or more detection probes, e.g., fluorescently labeled detection probes. Non-limiting examples of suitable containers comprise bottles, test tubes, vials and microtiter plates. The containers can be formed from a variety of materials such as glass or plastic.

[0313] In certain embodiments, the system can comprise other materials or reagents desirable from a commercial and user standpoint, including other buffers and diluents. In certain embodiments, a system of the present disclosure can include a buffer, e.g., a buffer for performing an in vitro transcription reaction, comprising one or more reducing agents, e.g, DTT.

[0314] In certain embodiments, the components of the system are provided in predetermined ratios, with the relative amounts of the various reagents suitably varied to obtain the desired sensitivity and throughput of the disclosed methods. VII. EXEMPLARY EMBODIMENTS

[0315] A. The present disclosure provides a method for imaging a target nucleic acid in a plurality of cells, comprising: a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct; b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter; c) fixing the plurality of cells to generate a plurality of fixed cells; d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter; e) performing an amplification process to amplify the target nucleic acid; and f) imaging the amplified target nucleic acid in the at least one cell.

[0316] Al . The method of A, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

[0317] A2. The method of A or Al , wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

[0318] A3. The method of A2, wherein the target nucleic acid encodes a gRNA.

[0319] A4. The method of A3, wherein the gRNA has an editing efficiency greater than about 60%.

[0320] B. The present disclosure provides a method for performing a genomic screen, comprising: a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid encoding a gRNA, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct; b) culturing the plurality of cells to allow expression of the gRNA using the first promoter; c) fixing the plurality of cells to generate a plurality of fixed cells; d) transcribing the gRNA in the at least one cell of the plurality of fixed cells using the second promoter; e) performing an amplification process for amplifying the gRNA; and f) imaging the amplified gRNA in the at least one cell; and g) analyzing a change in a characteristic of the at least one cell of the plurality of cells associated with expression of the gRNA.

[0321] Bl. The method of B, wherein the gRNA has an editing efficiency greater than about 60%.

[0322] B2. The method of any one of A-Bl, wherein the plurality of cells comprises at least about 1,000 cells.

[0323] B3. The method of any one of A-B2, wherein providing the plurality of cells comprises contacting the plurality of cells with the nucleic acid construct.

[0324] B4. The method of any one of A-B3, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

[0325] B5. The method of B4, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0326] B6. The method of any one of A-B5, wherein the first promoter is a promoter for expression in live cells.

[0327] B7. The method of any one of A-B6, wherein the first promoter is a Pol III promoter or a Pol II promoter.

[0328] B8. The method of any one of A-B7, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75 J promoter, EF- la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

[0329] B9. The method of B8, wherein the first promoter is a U6 promoter.

[0330] B10. The method of any one of A-B9, wherein the second promoter is a promoter for expression in fixed cells.

[0331] B 11. The method of any one of A-B 10, wherein the second promoter is a promoter for a phage RNA polymerase.

[0332] B12. The method of Bl 1, wherein the second promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

[0333] B13. The method of Bl 2, wherein the second promoter is a T7 promoter. B14. The method of the any one of A-B13, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

[0334] B15. The method of any one of A-B14, wherein the amplification process is a rolling circle amplification process.

[0335] Bl 6. The method of Bl 5, wherein the rolling circle amplification process comprises: a) contacting the plurality of cells with (i) a padlock probe comprising two nucleotide sequences that are complementary to the target nucleic acid and (ii) a ligase to generate a circular DNA template; and b) performing a rolling circle amplification process to generate an amplicon from the circular DNA template.

[0336] Bl 7. The method of any one of A-B16, wherein the plurality of cells is permeabilized prior to performing the amplification process.

[0337] Bl 8. The method of any one of A-B17, wherein the plurality of cells is decrosslinked prior to performing the amplification process.

[0338] Bl 9. The method of any one of A-B18, wherein the fixing the plurality of cells to generate a plurality of fixed cells comprising contacting the plurality of cells with an aldehyde fixative.

[0339] B20. The method of Bl 9, wherein the aldehyde fixative is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof.

[0340] B21. The method of any one of A-B20, wherein the plurality of cells is obtained from a tissue sample.

[0341] B22. The method of any one of A-B21, wherein the plurality of cells comprises at least two different cell types.

[0342] B23. The method of any one of A-B22, wherein the amplified target nucleic acids are imaged by in situ sequencing.

[0343] B24. The method of any one of A-B23, wherein the amplified target nucleic acids are imaged by fluorescent in situ hybridization.

[0344] B25. The method of any one of A-B24, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease. B26. The method of any one of A-B25, wherein the nucleic acid construct further comprises a barcode.

[0345] B27. The method of B26, wherein the barcode is located downstream of the target nucleic acid.

[0346] B28. The method of any one of A-B25, wherein the target nucleic acid is a barcode.

[0347] B29. The method of any one of A-B28, wherein the plurality of cells further comprises a second cell comprising a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

[0348] B30. The method of any one of B-B29, wherein the plurality of cells further comprises a second cell comprising a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid encoding a second gRNA, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

[0349] B31. The method of any one of A-B30, further comprising analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid.

[0350] B32. The method of B or B31, wherein the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof.

[0351] B33. The method of any one of A-B32, wherein the characteristic is protein expression levels.

[0352] B34. The method of any one of A-B33, wherein the characteristic is nucleic acid expression levels. B35. The method of any one of A-B34 further comprising performing an immunofluorescence process for detecting one or more target proteins.

[0353] B36. The method of the any one of A-B35, wherein the first promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5.

[0354] B37. The method of the any one of A-B36, wherein the second promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-3.

[0355] B38. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 6-18.

[0356] B39. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18.

[0357] B40. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 7.

[0358] B41. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 8.

[0359] B42. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 9.

[0360] B43. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 10.

[0361] B44. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 11.

[0362] B45. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 12.

[0363] B46. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 13.

[0364] B47. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 14.

[0365] B48. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 15.

[0366] B49. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 16.

[0367] B50. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 17.

[0368] B51. The method of the any one of A-B37, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0369] C. The present disclosure provides a kit for performing the method of any one of A-B51.

[0370] D. The present disclosure provides a kit for performing a method for imaging a target nucleic acid in a plurality of cells, comprising: at least one container comprising the nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct.

[0371] DI. The kit of D, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

[0372] D2. The kit of D or DI, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0373] D3. The kit of any one of D-D2, wherein the first promoter is a promoter for expression in live cells.

[0374] D4. The kit of any one of D-D3, wherein the first promoter is a Pol III promoter or a Pol II promoter. D5. The kit of any one of D-D4, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75 J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

[0375] D6. The kit of D5, wherein the first promoter is a U6 promoter.

[0376] D7. The kit of any one of D-D6, wherein the second promoter is a promoter for expression in fixed cells.

[0377] D8. The kit of any one of D-D7, wherein the second promoter is a promoter for a phage RNA polymerase.

[0378] D9. The kit of D8, wherein the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

[0379] DIO. The kit of D9, wherein the phage promoter is a T7 promoter.

[0380] Dl l. The kit of any one of D-D2, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

[0381] D12. The kit of any one of D-D2, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

[0382] D13. The kit of any one of D-D2, wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

[0383] D14. The kit of D13, wherein the target nucleic acid encodes a gRNA.

[0384] DI 5. The kit of DI 4, wherein the gRNA has an editing efficiency greater than about 60%.

[0385] DI 6. The kit of any one of D-D 15, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease.

[0386] DI 7. The kit of any one of D-D 16, wherein the nucleic acid construct further comprises a barcode.

[0387] D18. The kit of D17, wherein the barcode is located downstream of the target nucleic acid. DI 9. The kit of any one of D-D 18 further comprising dithiothreitol (DTT).

[0388] D20. The kit of any one of D-D 19, wherein the first promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5.

[0389] D21. The kit of any one of D-D20, wherein the second promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-3.

[0390] D22. The kit of any one of D-D21, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 6-18.

[0391] D23. The kit of any one of D-D22, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18.

[0392] E. The present disclosure provides a nucleic acid construct comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence and a target nucleic acid, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

[0393] El. The nucleic acid construct of E, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct.

[0394] E2. The nucleic acid construct of E or El, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0395] E3. The nucleic acid construct of E2, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 100 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter. E4. The nucleic acid construct of any one of E-E3, wherein the first promoter is a promoter for expression in live cells.

[0396] E5. The nucleic acid construct of any one of E-E4, wherein the first promoter is a Pol III promoter or a Pol II promoter.

[0397] E6. The nucleic acid construct of any one of E-E5, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

[0398] E7. The nucleic acid construct of E6, wherein the first promoter is a U6 promoter.

[0399] E8. The nucleic acid construct of E-E7, wherein the second promoter is a promoter for expression in fixed cells.

[0400] E9. The nucleic acid construct of E-E8, wherein the second promoter is a promoter for a phage RNA polymerase.

[0401] E10. The nucleic acid construct of E9, wherein the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

[0402] El l. The nucleic acid construct of E10, wherein the phage promoter is a T7 promoter.

[0403] E12. The nucleic acid of the any one of E-El 1, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

[0404] E13. The nucleic acid construct of any one of E-E12, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

[0405] E14. The nucleic acid construct of any one of E-E13, wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

[0406] E15. The nucleic acid construct of E14, wherein the target nucleic acid encodes a gRNA. E16. The nucleic acid construct of El 5, wherein the gRNA has an editing efficiency greater than about 60%.

[0407] E17. The nucleic acid construct of any one of E-E16, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease.

[0408] E18. The nucleic acid construct of any one of E-E17, wherein the nucleic acid construct further comprises a barcode.

[0409] E19. The nucleic acid construct of El 8, wherein the barcode is located downstream of the target nucleic acid.

[0410] E20. The nucleic acid construct of any one of E-E19, wherein the nucleotide sequence of the first promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5.

[0411] E21. The nucleic acid construct of any one of E-E20, wherein the nucleotide sequence of the second promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-3.

[0412] E22. The nucleic acid construct of any one of E-E21, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 6-18.

[0413] E23. The nucleic acid construct of any one of E-E22, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18.

[0414] F. The present disclosure provides a nucleic acid comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter, wherein the nucleic acid comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18.

[0415] F 1. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 7.

[0416] F2. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 8.

[0417] F3. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 9.

[0418] F4. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 10.

[0419] F5. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 11.

[0420] F6. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 12.

[0421] F7. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 13.

[0422] F8. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 14.

[0423] F9. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 15.

[0424] F10. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 16.

[0425] F 11. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 17.

[0426] F 12. The nucleic acid construct of F, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of SEQ ID NO: 18.

[0427] F13. The nucleic acid construct of F, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 7-18. G. The present disclosure provides a composition comprising the nucleic acid construct of any one of E-F13.

[0428] H. The present disclosure provides a method for imaging a target nucleic acid in a plurality of cells, comprising: a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising (i) a target nucleic acid and (ii) a hybrid promoter located upstream to the target nucleic acid in the nucleic acid construct, wherein the hybrid promoter comprises a first promoter and a second promoter, and wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter; b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter of the hybrid promoter; c) fixing the plurality of cells to generate a plurality of fixed cells; d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter of the hybrid promoter; e) performing an amplification process to amplify the target nucleic acid; and f) imaging the amplified target nucleic acid in the at least one cell.

[0429] I. The present disclosure provides a method for imaging a target nucleic acid in a plurality of cells, comprising: a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, and wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct; b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter; c) fixing the plurality of cells in a fixative comprising aldehyde to generate a plurality of fixed cells; d) decrosslinking the plurality of fixed cells to generate a plurality of decrosslinked cells; e) transcribing the target nucleic acid in at least one cell of the plurality of decrosslinked cells using the second promoter of the hybrid promoter; f) performing an amplification process to amplify the target nucleic acid; and g) imaging the amplified target nucleic acid in the at least one cell.

[0430] 11. The method of I, wherein the aldehyde is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof.

[0431] 12. The method of I or II, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

[0432] 13. The method of any one of H-I2, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0433] 14. The method of any one of H-I3, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 100 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

[0434] 15. The method of any one of H-I4, wherein the nucleotide sequence of the first promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 4-5.

[0435] 16. The method of any one of H-I5, wherein the nucleotide sequence of the second promoter comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-3.

[0436] 17. The method of any one of H-I6, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.[04...

Claims

WHAT IS CLAIMED IS:

1. A method for imaging a target nucleic acid in a plurality of cells, comprising:(a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct;(b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter;(c) fixing the plurality of cells to generate a plurality of fixed cells;(d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter;(e) performing an amplification process to amplify the target nucleic acid; and(f) imaging the amplified target nucleic acid in the at least one cell.

2. The method of claim 1, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

3. The method of claim 1 or 2, wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

4. The method of claim 3, wherein the target nucleic acid encodes a gRNA.

5. The method of claim 4, wherein the gRNA has an editing efficiency greater than about 60%.

6. A method for performing a genomic screen, comprising:(a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid encoding a gRNA, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct;(b) culturing the plurality of cells to allow expression of the gRNA using the first promoter;(c) fixing the plurality of cells to generate a plurality of fixed cells;(d) transcribing the gRNA in the at least one cell of the plurality of fixed cells using the second promoter;(e) performing an amplification process for amplifying the gRNA; and(f) imaging the amplified gRNA in the at least one cell; and(g) analyzing a change in a characteristic of the at least one cell of the plurality of cells associated with expression of the gRNA.

7. The method of claim 6, wherein the gRNA has an editing efficiency greater than about 60%.

8. The method of any one of claims 1-7, wherein the plurality of cells comprises at least about 1,000 cells.

9. The method of any one of claims 1-8, wherein providing the plurality of cells comprises contacting the plurality of cells with the nucleic acid construct.

10. The method of any one of claims 1-9, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

11. The method of claim 10, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

12. The method of any one of claims 1-11, wherein the first promoter is a promoter for expression in live cells.

13. The method of any one of claims 1-12, wherein the first promoter is a Pol III promoter or a Pol II promoter.

14. The method of any one of claims 1-13, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75 J promoter, EF- la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

15. The method of claim 14, wherein the first promoter is a U6 promoter.

16. The method of any one of claims 1-15, wherein the second promoter is a promoter for expression in fixed cells.

17. The method of any one of claims 1-16, wherein the second promoter is a promoter for a phage RNA polymerase.

18. The method of claim 17, wherein the second promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

19. The method of claim 18, wherein the second promoter is a T7 promoter.

20. The method of the any one of claims 1-19, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

21. The method of any one of claims 1-20, wherein the amplification process is a rolling circle amplification process.

22. The method of claim 21, wherein the rolling circle amplification process comprises:(a) contacting the plurality of cells with (i) a padlock probe comprising two nucleotide sequences that are complementary to the target nucleic acid and (ii) a ligase to generate a circular DNA template; and(b) performing a rolling circle amplification process to generate an amplicon from the circular DNA template.

23. The method of any one of claims 1-22, wherein the plurality of cells is permeabilized prior to performing the amplification process.

24. The method of any one of claims 1-23, wherein the plurality of cells is decrosslinked prior to performing the amplification process.

25. The method of any one of claims 1-24, wherein the fixing the plurality of cells to generate a plurality of fixed cells comprising contacting the plurality of cells with an aldehyde fixative.

26. The method of claim 25, wherein the aldehyde fixative is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof.

27. The method of any one of claims 1-26, wherein the plurality of cells is obtained from a tissue sample.

28. The method of any one of claims 1-27, wherein the plurality of cells comprises at least two different cell types.

29. The method of any one of claims 1-28, wherein the amplified target nucleic acids are imaged by in situ sequencing.

30. The method of any one of claims 1-29, wherein the amplified target nucleic acids are imaged by fluorescent in situ hybridization.

31. The method of any one of claims 1-30, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease.

32. The method of any one of claims 1-31, wherein the nucleic acid construct further comprises a barcode.

33. The method of claim 32, wherein the barcode is located downstream of the target nucleic acid.

34. The method of any one of claims 1-33, wherein the plurality of cells further comprises a second cell comprising a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

35. The method of any one of claims 6-34, wherein the plurality of cells further comprises a second cell comprising a second nucleic acid construct comprising the first promoter, the second promoter and a second target nucleic acid encoding a second gRNA, wherein the first promoter and the second promoter are located upstream to the second target nucleic acid in the second nucleic acid construct.

36. The method of any one of claims 1-5 and 7-35, further comprising analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid.

37. The method of claim 6 and 36, wherein the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof.

38. The method of any one of claims 1-37, wherein the characteristic is protein expression levels.

39. The method of any one of claims 1-37, wherein the characteristic is nucleic acid expression levels.

40. The method of any one of claims 1-39 further comprising performing an immunofluorescence process for detecting one or more target proteins.

41. A kit for performing the method of any one of claims 1-40.

42. A kit for performing a method for imaging a target nucleic acid in a plurality of cells, comprising: at least one container comprising the nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct.

43. The kit of claim 42, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

44. The kit of claim 42 or 43, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

45. The kit of any one of claims 42-44, wherein the first promoter is a promoter for expression in live cells.

46. The kit of any one of claims 42-45, wherein the first promoter is a Pol III promoter or a Pol II promoter.

47. The kit of any one of claims 42-46, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75 J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

48. The kit of claim 47, wherein the first promoter is a U6 promoter.

49. The kit of any one of claims 42-48, wherein the second promoter is a promoter for expression in fixed cells.

50. The kit of any one of claims 42-49, wherein the second promoter is a promoter for a phage RNA polymerase.

51. The kit of claim 49, wherein the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

52. The kit of claim 51, wherein the phage promoter is a T7 promoter.

53. The kit of the any one of claims 42-52, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

54. The kit of any one of claims 42-53, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

55. The kit of any one of claims 42-54, wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

56. The kit of claim 55, wherein the target nucleic acid encodes a gRNA.

57. The kit of claim 56, wherein the gRNA has an editing efficiency greater than about 60%.

58. The kit of any one of claims 42-57, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease.

59. The kit of any one of claims 42-58, wherein the nucleic acid construct further comprises a barcode.

60. The kit of claim 59, wherein the barcode is located downstream of the target nucleic acid.

61. The kit of any one of claims 41-60 further comprising dithiothreitol (DTT).

62. A nucleic acid construct comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence and a target nucleic acid, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

63. The nucleic acid construct of claim 62, wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct.

64. The nucleic acid construct of claim 62 or 63, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 40 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

65. The nucleic acid construct of claim 64, wherein the nucleotide sequence of the second promoter is incorporated into nucleotides 100 to about 200 located downstream from the 5’ end of the nucleotide sequence of the first promoter.

66. The nucleic acid construct of any one of claims 62-65, wherein the first promoter is a promoter for expression in live cells.

67. The nucleic acid construct of any one of claims 62-66, wherein the first promoter is a Pol III promoter or a Pol II promoter.

68. The nucleic acid construct of any one of claims 62-67, wherein the first promoter is selected from the group consisting of a U6 promoter, U3 promoter, U2 promoter, U5 promoter, Hl promoter, 7SK promoter, 75J promoter, EF-la promoter, CMV promoter, a tRNA promoter, pGK promoter, SV40 promoter, CAG promoter, TRE promoter, VAI promoter and a combination thereof.

69. The nucleic acid construct of claim 68, wherein the first promoter is a U6 promoter.

70. The nucleic acid construct of any one of claims 62-69, wherein the second promoter is a promoter for expression in fixed cells.

71. The nucleic acid construct of any one of claims 62-70, wherein the second promoter is a promoter for a phage RNA polymerase.

72. The nucleic acid construct of claim 71, wherein the phage promoter is selected from the group consisting of a T3 promoter, a T7 promoter, a Sp6 promoter or a combination thereof.

73. The nucleic acid construct of claim 72, wherein the phage promoter is a T7 promoter.

74. The nucleic acid of the any one of claims 62-73, wherein the nucleic acid construct comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 1-18.

75. The nucleic acid construct of any one of claims 62-74, wherein the target nucleic acid comprises from about 4 to about 1,000 nucleotides.

76. The nucleic acid construct of any one of claims 62-75, wherein the target nucleic acid encodes a guide RNA (gRNA), a microRNA (miRNA), a small nucleolar RNA (snoRNA), a small interfering RNA (siRNA), piwi-interacting RNAs (piRNAs), aptamers, ribozymes, endogenous siRNAs (endo-siRNAs), a short hairpin RNA (shRNA) or a combination thereof.

77. The nucleic acid construct of claim 76, wherein the target nucleic acid encodes a gRNA.

78. The nucleic acid construct of claim 77, wherein the gRNA has an editing efficiency greater than about 60%.

79. The nucleic acid construct of any one of claims 62-78, wherein the nucleic acid construct further comprises a polynucleotide encoding a nuclease.

80. The nucleic acid construct of any one of claims 62-79, wherein the nucleic acid construct further comprises a barcode.

81. The nucleic acid construct of claim 80, wherein the barcode is located downstream of the target nucleic acid.

82. A nucleic acid comprising a first promoter comprising a first nucleotide sequence, a second promoter comprising a second nucleotide sequence, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter, wherein the nucleic acid comprises a nucleotide sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% sequence identity to the nucleotide sequence of any one of SEQ ID NOs: 7-18.

83. The nucleic acid construct of claim 82, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 7-18.

84. A composition comprising the nucleic acid construct of any one of claims 62-83.

85. A method for imaging a target nucleic acid in a plurality of cells, comprising:(a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising (i) a target nucleic acid and (ii) a hybrid promoter located upstream to the target nucleic acid in the nucleic acid construct, wherein the hybrid promoter comprises a first promoter and a second promoter, and wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter;(b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter of the hybrid promoter;(c) fixing the plurality of cells to generate a plurality of fixed cells;(d) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter of the hybrid promoter;(e) performing an amplification process to amplify the target nucleic acid; and(f) imaging the amplified target nucleic acid in the at least one cell.

86. A method for imaging a target nucleic acid in a plurality of cells, comprising:(a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoter and a target nucleic acid, and wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct;(b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter;(c) fixing the plurality of cells in a fixative comprising aldehyde to generate a plurality of fixed cells;(d) decrosslinking the plurality of fixed cells to generate a plurality of decrosslinked cells;(e) transcribing the target nucleic acid in at least one cell of the plurality of decrosslinked cells using the second promoter of the hybrid promoter;(f) performing an amplification process to amplify the target nucleic acid; and(g) imaging the amplified target nucleic acid in the at least one cell.

87. The method of claim 86, wherein the aldehyde is formaldehyde, paraformaldehyde, glutaraldehyde or a combination thereof.

88. The method of any one of claims 85-87, wherein imaging the amplified target nucleic acid comprises imaging the target nucleic acid by in situ sequencing.

89. The method of any one of claims 85-88 further comprising analyzing a change in a characteristic of one or more cells in the plurality of cells expressing the target nucleic acid compared to one or more cells in the plurality of cells that does not express the target nucleic acid.

90. The method of claim 89, wherein the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof.

91. The method of any one of claims 36-37 and 89-90, wherein analyzing a change in a characteristic of one or more cells is performed prior to imaging the amplified target nucleic acid in the at least one cell.

92. The method of any one of claims 36-37 and 89-91, wherein analyzing a change in a characteristic of one or more cells is performed after fixation and prior to decrosslinking.

93. The method of any one of claims 85-92, wherein the characteristic is protein expression levels.

94. The method of any one of claims 85-92, wherein the characteristic is nucleic acid expression levels.

95. The method of any one of claims 85-94 further comprising performing an immunofluorescence process for detecting one or more target proteins.

96. A method for analyzing one or more characteristics of a plurality of cells, comprising:(a) providing a plurality of cells, wherein at least one cell of the plurality of cells comprises a nucleic acid construct comprising a first promoter, a second promoterand a target nucleic acid, and wherein the first promoter and the second promoter are located upstream to the target nucleic acid in the nucleic acid construct;(b) culturing the plurality of cells to allow expression of the target nucleic acid using the first promoter of the hybrid promoter;(c) fixing the plurality of cells to generate a plurality of fixed cells;(d) detecting one or more characteristics of the at least one cell of the plurality of fixed cells;(e) transcribing the target nucleic acid in the at least one cell of the plurality of fixed cells using the second promoter of the hybrid promoter;(f) performing an amplification process to amplify the target nucleic acid;(g) imaging the amplified target nucleic acid in the at least one cell; and(h) comparing the characteristic of the at least one cell expressing the target nucleic acid to the characteristic of one or more cells in the plurality of cells that does not express the target nucleic acid to determine the change in the characteristic of the at least one cell expressing the target nucleic acid.

97. The method of claim 96, wherein the characteristic is selected from the group consisting of cell viability, cell proliferation, cell size, cell morphology, cell motility, cell differentiation, cell adhesion, cell-cell contact, mutational status, karyotype, chromosomal aberrations, nucleic acid expression levels, nucleic acid localization, protein expression levels, protein localization, nucleic acid modifications, post-translational modifications, activation of a cell signaling pathway, repression of a cell signaling pathway, enzymatic activity, chromatin accessibility, histone modifications and other epigenetic changes, concentrations of cytokines and hormones, drug sensitivity, drug absorption and metabolism pharmacokinetics and pharmacodynamics, membrane potential and a combination thereof.

98. The method of claim 95 or 96 further comprising decrosslinking the plurality of cells prior to performing the amplification process.

99. The method of any one of claims 96-98, wherein the nucleotide sequence of the second promoter is incorporated into the nucleotide sequence of the first promoter.

100. A system for performing the method of any one of claims 1-40 and 86-99.

Images