Method of generating natural killer cells resistant to plasmid toxicity, natural killer cells and uses thereof

By disrupting the cGAS-STING pathway in NK cells, the issue of plasmid toxicity is addressed, leading to increased viability and transgene expression, and maintaining the cells' cytotoxic function against tumor cells.

WO2025137573A1PCT designated stage expired Publication Date: 2025-06-26ACAD SINICA +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/061462
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-22
Filing Date
2024-12-20
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Natural killer (NK) cells are challenging to modify genetically due to plasmid toxicity, which significantly decreases cell viability and hinders research advancements in NK cell therapy.

Method used

Disrupting the activity of the cGAS-STING pathway in NK cells by methods such as CRISPR genome editing, RNA interference, or pharmacological inhibitors to generate NK cells resistant to plasmid toxicity and enhance transgene expression.

Benefits of technology

The disruption of the cGAS-STING pathway effectively reduces plasmid-induced apoptosis and enhances transgene expression in NK cells, improving their viability and functionality without impairing their cytotoxic capabilities against tumor cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024061462_26062025_PF_FP_ABST
    Figure US2024061462_26062025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure discloses a method of generating NK cells resistant to plasmid toxicity, comprising disrupting the activity of cGAS-STING pathway in NK cells. The present disclosure also discloses NK cell or chimeric antigen receptor (CAR)-expressing NK cells and uses thereof.
Need to check novelty before this filing date? Find Prior Art

Description

METHOD OF GENERATING NATURAL KILLER CELLS RESISTANT TO PLASMID TOXICITY, NATURAL KILLER CELLS AND USES THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of and priority to U.S. Provisional Patent Applications No. 63 / 613,950, filed on December 22, 2023. The contents of which is incorporated by reference in its entirety.SEQUENCE LISTING

[0002] The instant disclosure contains a Sequence Listing which is submitted electronically in .xml format and is hereby incorporated by reference in its entirety. The .xml copy, created on December 20, 2024, is named “G4590-18900PCT_20241220_SeqListing.xmr and is 19,640 bytes in size.Field of the Invention

[0003] The present disclosure relates to immunotherapy. Particularly, the disclosure provides a method of generating natural killer (NK) cells resistant to plasmid toxicity, NK cells and uses thereof.Background of the Invention

[0004] Natural killer (NK) cell therapy holds the potential to generate an 'off-the-shelf product due to its ability to use an unlimited source of allogeneic NK cells without concerns of graft-versus-host disease (GvHD). Although NK cells hold great potential in cancer immunotherapy, the outcomes of studies involving unmodified autologous NK cells have generally not met expectations. Therefore, there is a need in enhancing NK cell function through genetic modification. However, gene delivery methods, both viral and non-viral, present several challenges on NK cells.

[0005] The delivery and expression of synthetic vectors to NK cells are less efficient than in other human cell types. Thus, increasing the efficiencies of vector delivery' and gene expression is important to advance the research of NK cells and the development of NK cell therapeutics.

[0006] In order to mitigate the risks associated with viral transduction, non-viral delivery methods have been investigated as safer alternatives for gene delivery into NK cells. Electroporation stands as one of the earliest and most frequently used techniques within non-viral transfection methods. However, the viability of cells post-transfection is dependent on the cargo, with the size of the cargo affecting efficiency. When it comes to NK cells, it has been found that electroporation using plasmids can significantly decrease cell viability, thereby creating a significant barrier to research advancements (Huang, RS., et al., Enhanced NK-92 Cytotoxicity by CRISPR Genome Engineering Using Cas9 Ribonucleoproteins. Front Immunol, 2020. 11: p. 1008).

[0007] Therefore, there is a need to improve the delivery and transgene expression efficiencies of synthetic vectors in NK cells.Summary of the Invention

[0008] The present disclosure found that as the GMP-AMP synthase (cGAS)- stimulator of interferon genes (STING) pathway plays a primary role in the detection of cytoplasmic DNA within cells, it becomes particularly relevant to the toxicity observed in NK cells upon plasmid delivery. The present disclosure is to investigate the involvement of the cGAS-STING pathway in the toxicity induced by plasmid in NK cells.

[0009] In one aspect, the present disclosure provides a method of generating NK cells resistant to plasmid toxicity, comprising disrupting the activity of cGAS-STING pathway in NK cells.

[0010] The present disclosure provides a method of generating NK cells resistant to plasmid toxicity upon plasmid delivery and / or having increased transgene expression, comprising disrupting the activities of one or more of cGAS, STING and TANK-binding kinase 1 (TBK1) proteins in NK cells.

[0011] In one embodiment, examples of the NK cells include, but are not limited to, primaryNK cells isolated from peripheral and cord blood, NK cells differentiated from induced pluripotent stem cells (iPSC), and NK-92 cell line and its derivatives.

[0012] In one embodiment, the NK cells described herein are one or more of the CGAS, STING and TBK1 gene knockout cells generated by CRISPR genome editing.

[0013] In some embodiments, the disruption of the activities of one or more cGAS, STING and TBK1 proteins comprises knockdown or knockout of gene expression or inhibition of the activities of one or more cGAS, STING and TBK1 proteins.

[0014] In one embodiment, the NK cells described herein are one or more of the CGAS, STING and TBK1 knockdown cells generated by RNA interference.

[0015] In one embodiment, the NK cells described herein treated with pharmacological inhibitors to inactivate the cGAS, STING or TBK1 enzymatic activities. An example of the pharmacological inhibitors to inactivate the cGAS enzymatic activities is G140. An example of the pharmacological inhibitors to inactivate the STING enzymatic activities is H151.

[0016] In some embodiments, exon 1 of the CGAS gene is targeted and disrupted. In some embodiments, exon 1 of the CGAS gene is targeted and disrupted by CRISPR genome editing using Cas9 and single guide RNA (sgRNA) ribonucleoproteins.

[0017] In some embodiments, the CRISPR genome editing described herein for disrupting theCGAS gene uses a sgRNA comprising an exon 1 -targeting nucleotide sequence having GGCCATGCAGAGAGCTTCCG (SEQ ID NO. 1), GCTTCCGCACGGAATGCCAG (SEQ ID NO. 2),GGAGACTCGGTGGGATCCAT (SEQ ID NO. 3), CCGGCAGAAAAAGAGCGCCC (SEQ ID NO. 4), GCTGGTTCTTGCCGCCAGAG (SEQ ID NO. 5), TGGGGCCTCGAAGCTCCGGG (SEQ ID NO. 6), CCGCGATGATATCTCCACGG (SEQ ID NO. 7), GACTCCGCGTTCAGAGGCGT (SEQ ID NO. 8) or GAGCTACTATGAGCACGTGA (SEQ ID NO. 9). Preferably, the sgRNA comprises a target nucleotide sequence having GAGCTACTATGAGCACGTGA (SEQ ID NO. 9)

[0018] In one embodiment, the method further comprises culturing the CGTS-knockout NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single cGTS-knockout clones of NK cells.

[0019] In one embodiment, exon 3 and 4 of the STING gene is targeted and disrupted. In some embodiments, exon 3 and 4 of the STING gene is targeted and disrupted by CRISPR genome editing using Cas9 and sgRNA ribonucleoproteins.

[0020] In some embodiments, the CRISPR genome editing described herein for disrupting the exon 3 of the STING gene uses a sgRNA comprising an exon 3-targeting nucleotide sequence having CCATCCATCCCGTGTCCCAG (SEQ ID NO. 10), GCAGGCACTCAGCAGAACCA (SEQ ID NO. 11) or GCTGGGACTGCTGTTAAACG (SEQ ID NO. 12). Preferably, the sgRNA comprises a target nucleotide sequence having GCAGGCACTCAGCAGAACCA (SEQ ID NO. 11).

[0021] In some embodiments, the CRISPR genome editing described herein for disrupting the exon 4 of the STING gene uses a sgRNA comprising an exon 4-targeting nucleotide sequence having GCAGCTACTGGAGGACTGTG (SEQ ID NO. 13), GCAGCAACAGGGCCCCACGG (SEQ ID NO. 14) or GCAAGCATCCAAGTGAAGGG (SEQ ID NO. 15).

[0022] In one embodiment, the method further comprises culturing the .S'7TVG-knockoiit NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single .S7 / M7-knockoiit clones of NK cells.

[0023] In one embodiment, exon 2 or 3 of the TBK1 gene is targeted and disrupted. In some embodiments, exon 2 or 3 of the TBK1 gene is targeted and disrupted by CRISPR genome editing using Cas9 and sgRNA ribonucleoproteins.

[0024] In some embodiments, the CRISPR genome editing described herein for disrupting the exon 2 of the TBK1 gene uses a sgRNA comprising an exon 2-targeting nucleotide sequence having: AGAGCACTTCTAATCATCTG (SEQ ID NO. 16), GCTACTGCAAATGTCTTTCG (SEQ ID NO. 17) or AGACATTTGCAGTAGCTCCT (SEQ ID NO 18).

[0025] In some embodiments, the CRISPR genome editing described herein for disrupting the exon 3 of the TBK1 gene uses a sgRNA comprising an exon 3-targeting nucleotide sequence having: CATAAGCTTCCTTCGTCCAG (SEQ ID NO. 19), TCTCTCATTTGAACATCCAC (SEQ ID NO. 20) or CAAATTATTTGCTATTGAAG (SEQ ID NO. 21).

[0026] In one embodiment, the method further comprises culturing the TBK1 -knockout NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single TBK1 -knockout clones of NK cells.

[0027] In one embodiment, the NK cells described herein is NK-92 cell line and its derivatives.

[0028] In another aspect, the present disclosure also provides NK cells resistant to plasmid toxicity, wherein cGAS, STING or TBK1 gene is knocked out or knocked down.

[0029] In another aspect, the present disclosure also provides chimeric antigen receptor(CAR)-expressing NK cells wherein the gene-knockout or knockdown and plasmid-resistant NK cells, as described herein, are transfected with a plasmid encoding CAR sequences or immunomodulating genes. The embodiments of the knockout are as described herein.

[0030] In one embodiment, the NK cell or CAR-expressing NK cells are primary NK cells,NK cell lines or iPSC-differentiated NK cells.

[0031] In another aspect, the present disclosure also provides the NK cell lines or CAR- expressing NK cells as described herein for use in immunotherapy. Alternatively, the present disclosure also provides use of the NK cell lines or CAR-expressing NK cells as described herein for use in the manufacture of a medicament for in immunotherapy. Still alternatively, the present disclosure also provides an immunotherapy comprising administrating the NK cell lines or CAR-expressing NK cells as described herein to a subject in need.

[0032] In another aspect, the present disclosure also provides the NK cell lines or CAR- expressing NK cells as described herein for use in treating cancer. Alternatively, the present disclosure also provides use of the NK cell lines or CAR-expressing NK cells as described herein for use in the manufacture of a medicament for treating cancer. Still alternatively, the present disclosure also provides a method for treating cancer comprising administrating the NK cell lines or CAR-expressmg NK cells as described herein to a subject in need.Brief Description of the Drawings

[0033] FIG. 1 shows graphical abstract of the disclosure. Addressing plasmid toxicity in NK cells for a CAR screening platform.

[0034] FIGs. 2A to 2D show that plasmid electroporation induces NK cell death via the cGAS-STING pathway. FIG. 2A shows timeline of NK cell plasmid electroporation. NK cells were treated with the inhibitor 15 minutes post electroporation, and viability and GFP+ percentages were detected by flow cytometry 3 days after electroporation. FIG. 2B shows workflow of the Precision beads viability assay. Cells were collected in equal volumes for all samples in tubes for cell counting by flow cytometry. Precision beads were subsequently added to the cell suspension. Cell count was determined per 2000 counts ofPrecision beads, and viability percentage was calculated by normalizing with the mock group. All viability measurements in this thesis were conducted using this approach. FIG. 2C shows that the effects of GMO (cGAS inhibitor) and H151 (STING inhibitor) were examined in NK-92 cells electroporated with Ipg of pmaxGFP Viability and GFP+ cells in the viable population were quantified by flow cytometry. FIG. 2D shows that the time course of phospho-IRF3 (Ser396) following pmaxGFP electroporation was determined by immunoblotting in NK-92 cells.

[0035] FIGs. 3A to 3E show inhibition of the cGAS-STING pathway in NK cells usingCRISPR genome engineering. FIGs. 3 A to 3 C show cell -based screening for efficient sgRNA. A total of 15 sgRNAs were synthesized to target the cGAS and STING genes at the specified exons. The percentages of insertions or deletions (indels) were determined using Sanger sequencing and ICE analysis. FIGs. 3D to 3E show that Western blots for cGAS, STING, and GAPDH in parental, CGAS KO and STING KO NK-92 or primary NK cells were carried out. Knockout of cGAS and STING was performed using sgRNA 9 and sgRNA 11, respectively.

[0036] FIGs. 4A to 4D show that genetic knockout attenuates activation of the cGAS-STING pathway. FIGs. 4Ato 4B show that Western blot analysis was performed to assess levels of phospho- STING (Ser366) and phospho-IRF3 (Ser396) in parental, CGAS KO and STING KO NK-92 cells following electroporation with I pg of pmaxGFP. RNA levels of IL6 (FIG. 4C) and IL10 (FIG. 4D) were measured using RT-qPCR in parental, CGAS KO, and STING KO NK-92 cells that were electroporated with Ipg of pmaxGFP.

[0037] FIGs. 5A to 5D show that CGAS knockout suppresses apoptosis induced by plasmid electroporation. Apoptosis was quantified by flow cytometry in CGAS or STING KO NK-92 cells (FIGs. 5A-5B) and primary NK cells (FIGs. 5C-5D) 24 hours (for NK-92) or 4 hours (for primary NK cells) posttransfection with 1 pg of pmaxGFP.

[0038] FIGs. 6 A to 6C Interference with cGAS-STING activation promotes plasmid expression in NK cells. FIG. 6A shows timeline of NK cell plasmid electroporation. NK cells were electroporated with 1 pg of pmaxGFP, and both viability and GFP+ percentages were measured by flow cytometry 3 days post-electroporation. FIGs. 6B to 6C show that GFP expression and cell viability in CGAS or STING KO NK-92 or primary NK cells post-pmaxGFP delivery were determined by flow cytometry.

[0039] FIGs. 7Ato 7C show interference of cGAS-STING activation promotes CAR plasmid expression in NK-92 cells. FIG. 7A shows a depiction of the CAR plasmid construct and the timeline for NK cell CAR plasmid electroporation. The CAR sequence is preceded by a tandem of the GFP gene and T2A split sequence. FIGs. 7B and 7C show that GFP expression and cell viability in NK-92 or primary NK cells after CAR plasmid delivery were determined by flow cytometry.

[0040] FIG. 8 shows that fluorescence imaging illustrates enhanced plasmid expression inNK-92 cells following disruption of cGAS-STING activation. NK-92 parental cells, along with CGAS KO and STING KO NK-92 cells, were electroporated with 1 pg of pmaxGFP, 1 pg of CD 19 CAR, and 2 pg of CD 19 CAR. The resulting fluorescence images capture the enhanced plasmid expression in NK cells following the disruption of the cGAS-STING activation.

[0041] FIGs. 9A and 9B show ineffective enhancement of plasmid expression in primary NK despite varied cGAS and STING inhibitor dosages. FIG. 9A shows the timeline of the pmaxGFP electroporation procedure in primary NK cells, including the addition of cGAS or STING inhibitors 15 minutes post-electroporation. FIG. 9B shows that the effects of cGAS and STING inhibitors on GFP expression and cell viability in primary NK cells post-pmaxGFP delivery were assessed using flow cytometry.

[0042] FIGs. 10A to 10D show persistent low plasmid expression in primary NK despiteSTING pre-treatment and concurrent caspase inhibition. FIG. 10A shows a timeline illustrating the pmaxGFP electroporation process in primary NK cells. STING inhibitors (H151 or SN011) were administered prior to electroporation, while Z-VAD-FMK (caspase inhibitor) was added 15 minutes postelectroporation. FIGs. 10B to 10D show assessment of the effects of STING inhibitor alone, and in cotreatment with caspase inhibitor, on the viability and the percentage of GFP+ viable cells in pmaxGFP electroporated primary NK cells, as quantified via flow cytometry.

[0043] FIGs. HA and 1 IB show intensified plasmid expression observed in NK-92 STINGKO clone. FIG. HA shows that the timeline illustrates the procedure of pmaxGFP electroporation in parental NK-92 and NK-92 STING KO clone cells. FIG. 1 IB shows a comparison of the effects of various pmaxGFP dosages on both the viability and GFP expression in parental NK-92 and NK-92 STING KO clone.

[0044] FIG. 12 shows enhanced CAR expression in CGAS and STING KO NK-92. A CAR binding assay was performed on CD 19 CAR-transfected parental, CGAS KO, and STING KO NK-92 cells using flow cytometry, following the electroporation of 2ug of CD19 CAR plasmid. CD19-CAR+ and GFP+ NK-92 cells were quantified after staining with biotinylated human CD 19 and APC streptavidin.

[0045] FIGs. 13A to 13C show marked enhancement of CAR-NK cell cytotoxicity in vitro.FIG. 13A show that a CAR binding assay was conducted using flow cytometry. Single clones of NK-92 STING knockout cells electroporated with EGFP-CAR or EpCAM-CAR were stained for the HA-tag, and GFP expression was monitored. FIGs. 13B to 13C show that the cytotoxicity of NK-92 STING KO single clone cells transfected with CAR plasmid was evaluated against human colon cancer cells (HCT116) (FIG. 13B) and human glioblastoma cells (U87-MG) (FIG. 13C). E:T ratio represents the effector to target ratio.

[0046] FIGs. 14A and 14B show that CGAS-STING knockout does not impair NK cell cytotoxicity. Cytotoxicity of CGAS or STING knockout primary NK cells was assessed against human colon cancer cells (HCT 116) (FIG. 14A) and human glioblastoma cells (U-87 MG) (FIG. 14B). E:T ratio refers to the effector to target ratio.Detailed Description of the Invention

[0047] Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art

[0048] The singular form "a", "an", and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following alternatives: "A", "B", "A or B", and "A and B."

[0049] "Natural killer cells" or "NK cells," has its plain and ordinary meaning when read in light of the disclosure, and may include but is not limited to, for example, natural killer cells from any tissue source and also includes natural killer cells produced using methods such as those described herein. Some aspects of the present disclosure provide compositions, methods, and strategies for the generation of modified NK cells. In some embodiments, such modified NK cells are generated by editing the genome of mature NK cells. In some embodiments, modified NK cells are generated by editing the genome of a cell from which an NK cell is derived, either in vitro or in vivo. In some embodiments, the cell from which and NK cell is derived is a stem cell, for example, a hematopoietic stem cell (HSC), or a pluripotent stem cells, such as, e.g., an embryonic stem cell (ES cell) or an induced pluripotent stem cell (iPS cell). For example, in some embodiments, modified NK cells are generated by editing the genome of an ES cell, an iPS cell, or a hematopoietic stem cell, and subsequently differentiating the edited stem cell into an NK cell. In some embodiments, where the generation of modified NK cells involves differentiation of the modified NK cell from an iPS cell, the editing of the genome may take place at any suitable time during the generation, maintenance, or differentiation of the iPS cell. In some embodiments, the present disclosure provides compositions, methods, and strategies for generating NK cells that have been derived from developmentally mature cells, also referred to as somatic cells, such as, for example, fibroblasts or peripheral blood cells.

[0050] A "nucleic acid construct", "DNA construct" or simply "construct" is a nucleic acid molecule produced by recombinant means that includes at least two juxtaposed or operably linked nucleic acid sequences that are not juxtaposed or operably linked to one another in nature

[0051] A "vector" is any genetic element capable of serving as a vehicle of genetic transfer, expression, or replication for a foreign polynucleotide in a host cell. For example, a vector may be an artificial chromosome or a plasmid, and may be capable of stable integration into a host cell genome, or it may exist as an independent genetic element (e.g., episome, plasmid). A vector may exist as a single polynucleotide or as two or more separate polynucleotides. Vectors may be single copy vectors or multicopy vectors when present in a host cell.

[0052] As used herein, the term "plasmid" refers to a circular double-stranded (ds) DNA construct that can be used as a vector for introducing DNA into a cell. Plasmids act as extrachromosomal self-replicating genetic element in many bacteria and some eukaryotes. In some embodiments, one or more plasmids can be integrated into the genome of the host cell into which it is introduced.

[0053] As used herein the terms "pathway" refers to a communication process that governs basic activities of cells and coordinates multiple-cell actions. A pathway involves biochemical reactions between molecules that control cell function. A cellular pathway includes the entire sequence of molecular events that are involved in such processes including, for example, the synthesis and release of a signaling molecule by a cell, transport of a signal to a target cell, binding of a signaling molecular to a specific receptor, receptor activation, and initiation of signal-transduction pathways.

[0054] As used herein the term "pathway disruption," also known as "pathway dysregulation”, refers to an abnormality or impairment in the regulation of a cellular pathway. Disruption can occur at any step in the gene expression process including, without limitation, during transcription, RNA splicing, RNA export, translation, and post-translational modification of a protein. Regulation of gene expression gives control over the timing, location, and amount of a given gene product (i.e., protein or ncRNA) present in a cell. Thus, cellular pathway disruption may involve over- or under-expression of genes, as well as changes in protein function or stability. In some cases, genetic variation, such as a mutation, gene fusion, or DNA copy number change, methylation state, contributes to cellular disruption.

[0055] By "deletion or disruption" of a metabolic pathway, it means that the pathway is either rendered completely inoperative, or else its activity is reduced by at least 75%, preferably at least 90%, relative to the wild-type cell. Activity of a pathway may be reduced by reducing the amount of active enzyme that is produced, by reducing the activity of the enzyme that is produced, or some combination of both. By "deletion or disruption" of a gene it is meant that the entire coding region of the gene is eliminated (deletion), or the coding region of the gene, its promoter, and / or its terminator region is modified (such as by deletion, insertion, or mutation) so that the gene no longer produces an active enzyme, the gene produces a severelyreduced quantity (at least 75% reduction, preferably at least 90% reduction) of the active enzyme, or the gene produces an enzyme with severely reduced (at least 75% reduced, preferably at least 90% reduced) activity.

[0056] The term "knock-out" refers to the elimination of a gene or the expression of a gene.For example, a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame. As another example, a gene may be knocked out by replacing a part of the gene with an irrelevant sequence. The term "knock-down" as used herein refers to reduction in the expression of a gene or its gene product(s). As a result of a gene knock-down, the protein activity or function may be attenuated or the protein levels may be reduced or eliminated.

[0057] "Gene editing," has its plain and ordinary meaning when read in light of the specification, and may include but is not limited to, for example, a type of genetic engineering in which DNA is inserted, deleted or replaced in the genome of a living organism using a nuclease or an engineered nuclease or nucleases. Without being limiting, the nuclease can be of the CRISPR / CAS9 system, a zinc finger nuclease or TALEN nuclease. The nuclease can be used to target a locus, or a targeted locus on a nucleic acid sequence.

[0058] A "CRISPR system" or "CRISPR-Cas system" refers to a Cas protein, such as but not limited to a Cas9 protein or a variant thereof, or a nucleic acid molecule encoding a Cas protein, along with one or more RNAs required for targeting and / or altering a genetic locus. For example, a CRISPR-Cas system can include a Cas protein or a nucleic acid molecule encoding a Cas protein and at least one tracrRNA ("trans-activating CRISPR RNA") or gene encoding a tracr RNA and at least one crRNA or "CRISPR RNA" or gene encoding a crRNA, in which the crRNA comprises sequences homologous to a target nucleic acid sequence. The crRNA may further include a "tracrRNA" basepairing sequence that is able to hybridize with the tracrRNA. Alternatively, a CRISPR system can include a Cas protein (or a gene or transcript encoding a Cas protein) and a gene or transcript that includes both the tracrRNA and crRNA sequences. A single RNA molecule that includes both a tracrRNA sequence and a crRNA (target homologous) sequence is referred to herein as a "single guide RNA", "sgRNA" or simply a "guide RNA". A crRNA or guide RNA can further include a "tracrRNA" basepairing equence (encompassing a "direct repeat" and / or a tracrRNA-processed partial direct repeat as in an endogenous CRISPR system).

[0059] As used herein, the terms "Chimeric Antigen Receptor" and the term "CAR" are used interchangeably. As used herein, a "CAR" is defined to be a fusion protein comprising antigen recognition moieties and cell-activation elements.

[0060] As used herein, "CAR NK cells" or "CAR expressing NK cells" are used interchangeably, and are defined to be NK cells containing the capability of producing CAR polypeptide,regardless of actual expression level. For example a cell that is capable of expressing a CAR is a NK cell containing nucleic acid sequences for the expression of the CAR in the cell.

[0061] "Subject" means ahuman or non-human animal. Ahuman subject can be any age (e.g., an infant, child, young adult, or adult), and may suffer from a disease, or may be in need of alteration of a gene or a combination of specific genes. Alternatively, the subject may be an animal, which term includes, but is not limited to, a mammal, and, more particularly, a non-human primate, a rodent (e.g., a mouse, rat, hamster, etc.), a rabbit, a guinea pig, a dog, a cat, and so on. In certain embodiments of this disclosure, the subject is livestock, e.g., a cow, a horse, a sheep, or a goat. In certain embodiments, the subject is poultry.

[0062] The terms "treatment," "treat," and "treating," refer to a clinical intervention aimed to reverse, alleviate, delay the onset of, or inhibit the progress, and / or prevent or delay the recurrence of a disease or disorder, or one or more symptoms thereof, as described herein. Treatment, e.g., in the form of a modified NK cell or a population of modified NK cells as described herein, may be administered to a subject after one or more symptoms have developed and / or after a disease has been diagnosed. Treatment may be administered in the absence of symptoms, e.g., to prevent or delay onset of a symptom or inhibit onset or progression of a disease . For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence.

[0063] NK cells are a promising cell type for cancer immunotherapy because of their ability to kill tumor cells without prior sensitization. However, NK cells are difficult to modify genetically due to interference and toxicity induced by plasmid and viral vectors. Overcoming this challenge is necessary to facilitate the research ofNK cells and development of NK cell therapeutics.

[0064] Plasmid toxicity refers to the adverse effects that plasmids, which are small, circularDNA molecules found in bacteria, can have on host cells. While plasmids often carry beneficial genes, such as those for antibiotic resistance or metabolic functions, their replication and maintenance can impose a metabolic burden on the host cell. This burden can lead to reduced growth rates, impaired cellular functions, or even cell death, particularly if the plasmid encodes toxic proteins or if its replication competes with essential cellular processes. Additionally, the presence of plasmids can disrupt the balance of cellular resources, leading to stress responses that further compromise cell viability. Understanding plasmid toxicity is crucial in biotechnology and microbiology, especially when engineering bacteria for industrial applications or studying microbial ecology.

[0065] Accordingly, the present disclosure provides a method of generating NK cells resistant to plasmid toxicity and / or having increased transgene expression, comprising disrupting the activity of cGAS-STING pathway in NK cells.~io~

[0066] The present disclosure explores the mechanism underlying plasmid toxicity, with an emphasis on the cyclic GMP-AMP synthase -stimulator of interferon genes (cGAS-STING) pathway. It was surprisingly found that the activation of cGAS-STING pathway by plasmid DNA is the leading cause to NK cell death. Furthermore, disrupting the cGAS-STING pathway could rescue the NK cells from plasmid toxicity and enable transgene expression from plasmid vector. The present disclosure uses CRISPR genetic knockout (KO) to confirm the roles of cGAS or STING in plasmid toxicity in primary human NK cells and NK cell line. The present disclosure evaluates the toxic effects of plasmid on critical NK cell parameters such cell viability, cytokine induction, program cell death, transgene expression and in vitro cytotoxicity. The KO of CGAS and STING genes led to a significant reduction in the activation of the cGAS-STING pathway, as evident by decreased phosphorylation of STING and interferon regulatory factor 3 (IRF3), and reduced expression of Interleukin-6 (IL-6) and Tumor Necrosis Factor-a (TNF-a). The genetic intervention improves NK cell viability without impairing the cytotoxic function of NK cells against tumor cells. However, the effects were less pronounced in primary NK cells. The present disclosure found that the cGAS- STING pathway significantly contributes to cell death induced by plasmid electroporation in NK cells. Bypassing this DNA surveillance pathway is crucial for genetic research of NK cells and development of NK cell immunotherapy. The difference in plasmid toxicity between NK cell line and primary NK cells underscores the importance to better understand the DNA surveillance systems to allow robust engineering of NK cells.

[0067] The present disclosure provides a method of generating NK cells resistant to plasmid toxicity upon plasmid delivery, comprising disrupting the activities of one or more of cGAS, STING and TANK-binding kinase 1 (TBK1) proteins in NK cells. In some embodiments, the disruption of the activities of one or more cGAS, STING and TBK1 proteins comprises knockdown or knockout of gene expression or inhibition of the activities of one or more cGAS, STING and TBK1 proteins.

[0068] The CGAS gene encodes an enzyme that plays a crucial role in the innate immune response to cytosolic DNA. Upon detecting foreign DNA, such as that from viruses or bacteria, cGAS catalyzes the synthesis of cyclic GMP-AMP (cGAMP) from ATP and GTP This second messenger then binds to the stimulator of interferon genes (STING) protein, leading to the activation of downstream signaling pathways that promote the production of type I interferons and other pro-inflammatory cytokines. This process is vital for initiating an immune response.

[0069] The STING gene plays a crucial role in the innate immune response by detecting cytosolic DNA from pathogens or damaged cells. It encodes a protein that acts as a sensor for DNA, triggering a signaling cascade that leads to the production of type I interferons and other cytokines, which are essential for antiviral defense and the activation of adaptive immunity.

[0070] The TBK1 gene encodes a serine / threomne kinase that plays a crucial role in various cellular processes, including immune response, inflammation, and autophagy. It is part of the IKK family of kinases and is involved in the activation of NF-KB, a key transcription factor that regulates the expression of genes related to immune and inflammatory responses.

[0071] Examples of the manner for cGAS. STING and / or TBK1 gene knockout include, but are not limited to CRISPR genome editing, RNA interference, and treatment with pharmacological inhibitors to inactivate the CGAS, STING orTBKl enzymatic activities.

[0072] The knockout described herein can be performed by CRISPR genome editing. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of an endogenous CRISPR system). In the context of formation of a CRISPR complex, "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. A target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotides. A sequence or template that may be used for recombination into the targeted locus comprising the target sequences is referred to as an "editing template" or "editing sequence", "donor sequence" or "donor DNA". In aspects of the disclosure, an exogenous template polynucleotide may be referred to as a donor DNA molecule.

[0073] In some embodiments, exon 1 of the CGAS gene is targeted and disrupted. In some embodiments, exon 1 of the CGAS gene is targeted and disrupted by CRISPR genome editing using Cas9 and single guide RNA (sgRNA) ribonucleoproteins. In some embodiments, the CRISPR genome editing described herein for disrupting the CGAS gene uses a sgRNA comprising an exon 1 -targeting nucleotide sequence having any of SEQ ID NOs. 1 to 9. Preferably, the sgRNA comprises a target nucleotide sequence having SEQ ID NO. 9.

[0074] In one embodiment, exon 3 and 4 of the STING gene is targeted and disrupted. In some embodiments, exon 3 and 4 of the STING gene is targeted and disrupted by CRISPR genome editing using Cas9 and sgRNA ribonucleoproteins. In some embodiments, the CRISPR genome editing described herein for disrupting the exon 3 of the STING gene uses a sgRNA comprising an exon 3-targeting nucleotide sequence having any of SEQ ID NOs. 10 to 12. Preferably, the sgRNA comprises a target nucleotide sequence having SEQ ID NO. 11. In some embodiments, the CRISPR genome editing described herein for disrupting the exon 4 of the STING gene uses a sgRNA comprising an exon 4-targeting nucleotide sequence having any of SEQ ID NOs. 13 to 15.

[0075] In one embodiment, exon 2 or 3 of the TBK1 gene is targeted and disrupted. In some embodiments, exon 2 or 3 of the TBK1 gene is targeted and disrupted by CRISPR genome editing using Cas9 and sgRNA ribonucleoproteins. In some embodiments, the CRISPR genome editing described herein for disrupting the exon 2 of the TBK1 gene uses a sgRNA comprising an exon 2-targeting nucleotide sequence having any of SEQ ID NOs. 16 to 18. In some embodiments, the CRISPR genome editing described herein for disrupting the exon 3 of the TBK1 gene uses a sgRNA comprising an exon 3 -targeting nucleotide sequence having any of SEQ ID NOs. 19 to 21.

[0076] Methods of introducing a nucleic acid into a host cell are known in the art, and any known method can be used to introduce a nucleic acid (e.g., an expression construct) into a stem cell, progenitor cell, cell line, primary cell, or microbial cell. Suitable methods include, include e.g., viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery. Depending on the host / vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector.

[0077] Clones that included the construct we then screened for gene expression by flow cytometry monitoring for GFP fluorescence.

[0078] In one embodiment, the method further comprises culturing the CGAS, STING and / orTBK1 -knockout NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single CGAS. STING and / or TBK1 -knockout clones ofNK cells.

[0079] Single-cell sorting is a technique used in cellular biology to isolate and analyze individual cells from a heterogeneous population. This process typically employs advanced technologies such as flow cytometry or microfluidics, allowing researchers to sort cells based on specific characteristics, such as size, shape, or the presence of particular biomarkers.

[0080] Clonal expanding refers to the process by which a specific population of cells, often immune cells such as T cells or B cells, proliferates in response to a particular antigen or stimulus. This phenomenon is crucial for the adaptive immune response, as it allows for the rapid amplification of cells that can effectively recognize and combat pathogens. During clonal expansion, a single progenitor cell undergoes multiple rounds of division, resulting in a large number of genetically identical daughter cells, or clones, that share the same receptor specificity.

[0081] In another aspect, the present disclosure also provides NK cells resistant to plasmid toxicity, wherein CGAS, STING or TBK1 gene is knocked out or knocked down.

[0082] In another aspect, the present disclosure also provides chimeric antigen receptorexpressing NK cells wherein the gene-knockout or knockdown and plasmid-resistant NK cells, as described herein, are transfected with a plasmid encoding CAR sequences or immunomodulating genes. The embodiments of the knockout are as described herein.

[0083] The NK cells of the present disclosure can be transfected with CAR gene or its recombinant. Chimeric Antigen Receptors (CARs) are engineered molecules designed to target immune cells to specific molecular targets expressed on cell surfaces. In their most basic form, they are receptors introduced into a cell that couple a specificity domain expressed on the outside of the cell to signaling pathways on the inside of the cell such that when the specificity domain interacts with its target, the cell becomes activated. Adoptive immunotherapy using chimeric antigen receptor (CAR)-expressing T cells allows these cells to directly recognize and kill antigen-expressing tumor cells in a manner independent of human leukocyte antigen (HLA). It is a promising cancer treatment. However, CAR-T therapy faces several challenges, including high production costs and potential severe toxicities such as cytokine release syndrome. Therefore, there is increasing interest in utilizing NK cells as candidates for immunotherapy. The NK cells of the present disclosure are able to resist cytotoxicity upon plasmid transfection and thus can overcome the challenges faced in CARNK cell engineering.

[0084] In one embodiment, the NK cell or CAR-expressing NK cells are primary NK cells,NK cell lines or iPSC-differentiated NK cells.

[0085] In another aspect, the present disclosure also provides the NK cell lines or CAR- expressing NK cells as described herein for use in immunotherapy. Alternatively, the present disclosure also provides use of the NK cell lines or CAR-expressing NK cells as described herein for use in the manufacture of a medicament for in immunotherapy. Still alternatively, the present disclosure also provides an immunotherapy comprising administrating the NK cell lines or CAR-expressing NK cells as described herein to a subject in need.

[0086] In another aspect, the present disclosure also provides the NK cell lines or CAR- expressing NK cells as described herein for use in treating cancer. Alternatively, the present disclosure also provides use of the NK cell lines or CAR-expressing NK cells as described herein for use in the manufacture of a medicament for treating cancer. Still alternatively, the present disclosure also provides a method for treating cancer comprising administrating the NK cell lines or CAR-expressing NK cells as described herein to a subject in need. In some embodiments, the NK cell lines or CAR-expressing NK cells as described herein show markedly enhanced cytotoxicity.

[0087] Although disclosure has been provided in some detail by way of illustration and example for the purposes of clarity and understanding, it will be apparent to those of skill in the art thatvarious changes and modifications can be practiced without departing from the spirit or scope of the disclosure. Accordingly, the foregoing disclosure and following examples should not be construed as limiting.EXAMPLE

[0088] Reagents

[0089] All chemical and cell culture reagents were purchased from Merck and Thermo FisherScientific unless specified otherwise. All human cell lines were purchased from American Type Culture Collection (ATCC) and routinely monitored for mycoplasma contamination by Mycoplasma PCR Detection Kit (Biosmart™). Cell density and viability were determined by Trypan blue staining in Countess II cell counter (Thermo Fisher Scientific™).

[0090] Maintenance of NK-92 cell line

[0091] The malignant non-Hodgkin's lymphoma cell line NK-92 cells were cultured in RPMI1640 medium (ATCC modification) supplemented with 12.5% heat-inactivated fetal bovine serum (FBS), 1% Penicillin-Streptomycin (P / S), 25 mM HEPES, IX GlutaMAX, and 100 U / mL of fresh recombinant human IL-2 (PeproTech™). The cells were incubated in a humidified 5% CO2 air atmosphere at 37°C, and passaged every 2-3 days to maintain the cell density at 2 x 105to 8 x 105cells / mL.

[0092] Maintenance of cancer cell lines

[0093] K-562 lymphoblast, HCT 116 human colon carcinoma and U-87 MG human glioblastoma-astrocytoma cell lines were maintained as per ATCC’s protocols. Briefly, the cell lines were cultured in high glucose DMEM (HyClone™) supplemented with 15% heat-inactivated FBS, 25 mM HEPES, 1% v / v of GlutaMAX, and 1% v / v of P / S. Cells were maintained in a 37°C incubator with 5% CO2. All cells were passaged at -80% confhiency. HCT 116 and U-87 MG cells were dissociated by trypsin- EDTA.

[0094] Plasmid construction

[0095] The pmaxGFP plasmid, which encodes a turbogfp gene, is included in the LonzaNucleofection P3 Kit. The plasmid was propagated in Escherichia coli Stbl3 strain (Thermo Fisher Scientific™) and purified using the QIAGEN™ Plasmid Midi Kit. The CAR sequence consists of CSF2RA signaling peptide, HA tag, anti-EGFR or anti-EpCAM single-chain variable fragment, IgG4 hinge, CD8a transmembrane domain, 4-1 BB costimulatory domain, and CD3L signaling domain, as referenced in previous studies (Li, Y., etal, Human iP SC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activity. Cell Stem Cell, 2018. 23(2): p. 181-192. e5). The CAR constructs, together with a T2A self-cleaving peptide sequence, were inserted into the pmaxGFP vector downstream of the turbogfp gene for co-expression. The gene fragments were amplified by PCR using KAPA HiFi DNA polymerase (Roche™). The gene fragments were constructed by HiFi DNA Assembly Cloning Kit(NEB™). The plasmids were validated by Sanger sequencing. The plasmids were extracted by QIAGEN™ plasmid Midi kit for electroporation.

[0096] Plasmid DNA electroporation

[0097] Plasmid DNA electroporation was carried out using the Lonza™ 4D Nucleofector system as described by Huang et al., 2020 and 2021 (Huang, R.S., et al., Enhanced NK-92 Cytotoxicity by CRISP R Genome Engineering Using Cas9 Ribonucleoproteins. Front Immunol, 2020. 11: p. 1008; Huang, R.-S., M.-C. Lai, and S. Lin, Ex Vivo Expansion and CRISP R-Cas9 Genome Editing of Primary Human Natural Killer Cells. Current Protocols, 2021. 1(9): p. e246). Briefly, in one electroporation reaction 4 x 105NK-92 cells were suspended in 20 pL of Sol2 nucleofection buffer, consisting of 150 mM sodium phosphate buffer (pH 7.2), 15 mM MgCT- 5 mM KC1, 15 mM HEPES and 50 mM mannitol. For primary NK cells, 4 x 105cells were suspended in 20 pL of P3 nucleofection buffer (Lonza). Plasmids were added to the electroporation mixture at the concentrations specified in the figures. The mixture was then transferred to a 16-well nucleofection strip by gentle pipetting. The strip was placed in the Lonza 4D Nucleofector and electroporated using pulse codes CA-137 and CM-137 for NK-92 and primary NK cells, respectively. Immediately after electroporation, 100 pL of pre-warmed medium was added to the cuvette to recover the cells in a 37°C incubator for 15 minutes. The electroporated cells were then transferred to a 24- well plate and maintained by the standard procedures.

[0098] Flow cytometry

[0099] Flow cytometry was performed on CytoFLEX (Beckman Coulter™). The data were analyzed using FlowJo (BD Biosciences™) and C t Expert (Beckman Coulter™). NK cells were collected by centrifugation at 500 x g for 5 minutes, and washed in ice-cold Flow buffer (DPBS supplemented with 2% FBS, 25 mM HEPES, and 0.5 mM EDTA). The cells were then stained on ice in the dark for 20 minutes with antibodies diluted at the manufacturers' recommended ratios. After staining, the cells were washed with 1 mL of Flow buffer, pelleted at 500 x g for 5 min, resuspended in 200 pL of Flow buffer, and transferred to a 5-mL Falcon polystyrene flow tube with a cell strainer snap cap (Coming™). The cell suspension was kept on ice before analysis.

[0100] Precision beads viability assay

[0101] Precision beads assay is as described previously with modifications (Huang, R S, et al., Enhanced NK-92 Cytotoxicity by CRISP R Genome Engineering Using Cas9 Ribonucleoproteins. Front Immunol, 2020. 11: p. 1008). Precision cell count beads (BioLegend™) were mixed thoroughly before use by vortexing at maximal speed for 45 seconds. NK cells (180 uL) were collected and transferred by gentle pipetting from the culture plate to 5-mL Falcon™ polystyrene flow tube with cell strainer snap cap. Precision beads (20 pL) were added at 10% v / v ratio to each cell sample and vortexed at low speed for 2 seconds. Two thousand events of Precision beads were counted by analyzing APC and PB450 signals toserve as an internal standard for cell density quantitation. Viable cells were gated based on the FSC and SSC scattering plot. The % recovery of viable cells and viable GFP+ cells were calculated using the following equations.% Recovery of viable cells = [(Counts of viable cells in the sample) / (Counts of viable cells in the untreated control)] x 100% Viable GFP+ cells = [(Counts of GFP+ cells in the viable cell population) / (Counts of total viable cells)] x 100

[0102] Annexin V apoptosis assay

[0103] The apoptosis of NK cells was detected by APC Annexin V Apoptosis Detection kit(BioLegend™) as perthe manufacturer’s protocol. Briefly, approximately 1 * 105NK cells per sample were collected by centrifugation at 500 x g for 5 min, washed once with PBS, and resuspended in 50 pL of Annexin V Binding Buffer. To each cell sample, 5 pL of 4’,6-diamidino-2-phenylindole (DAPI) and 2.5 pL of APC-conjugated Annexin V were added to the cell suspension to stain the nuclei and PS of the apoptotic cells, respectively. The cell mixture was incubated at room temperature in the dark for 15 min. After the incubation, 200 pL of Annexin V Binding Buffer was added to each sample in preparation for flow cytometry. The cell samples were analyzed by flow cytometry using APC and PB450 channels to detect the apoptotic cells.

[0104] Immunoblotting

[0105] NK cells were collected by centrifugation at 500 x g for 5 mins, and the cell pellet was dissolved in 50 pL of SDS loading dye containing 80 mM Tris (pH 6.8), 2 % [3-mercaptoethanol, 4 % SDS, 15 % glycerol, 0.01 % Orange G). The cell lysate was incubated at 95°C for 5 minutes for protein denaturation. The protein samples were resolved by electrophoresis in 10 % SDS-PAGE gels at 100 V, and then transferred to PVDF membrane (0.2-pm, Millipore™) in Tris-Glycine Transfer buffer by Trans-Blot SD Semi-Dry Transfer (BioRad™) at 80 mA for 1 hour. The PVDF membrane was incubated in TBST with 0.5% w / v bovine serum albumin (BSA, GOLDBIO™) at room temperature for 60 minutes. The membrane was incubated with the primary antibodies in TBST with 0.5% BSA at 4°C overnight. The membrane was washed three times with TBST and incubated with HRP-conjugated secondary antibodies in TBST with 0.5% BSA at room temperature for 60 minutes. The membrane was washed three times with TBST. The target proteins were visualized using the Western Lightning Plus or Western Lightning Ultra (PerkinElmer™) chemiluminescence detection kit. Images were acquired by Azure Biosystems C300.

[0106] Calcein-AM Cytotoxic Assay

[0107] HCT 116 or U-87 MG target cells were collected by trypsin dissociation, pelleted by centrifugation at 300 * g for 5 mins, and then washed with 1 mL of DPBS. Approximately 2 x 106cells were incubated in 1 mL of DMEM culture medium containing 8 pM of Calcein-AM (BioLegend™) at 37°Cfor 30 minutes. The cells were washed two times with DMEM medium and resuspended at 5 x 104cells / mL in RPMI-1640 (ATCC modification). NK-92 cells were pelleted at 90 x g for 10 minutes and resuspended at 4 x 105cells / mL in RPMI-1640 (ATCC modification). In a U-bottom 96-well plate, 100 pL of NK cells were added per well, and serial dilution was performed to dilute the NK cells for different effector-to-target cell ratios. Next, 100 pL of the Calcein-AM-labeled target cells were added to each well. The 96-well plate was centrifuged at 120 x g for 1 minute to promote contact between NK cells and target cells. The cells were co-cultured for 2-4 hours at 37°C incubator. The spontaneous release of Calcein-AM by the target cells was measured in the absence of NK-92 cells, while the maximal release was determined by complete lysis of target cells in RPMI-1640 (ATCC modification) containing 2% Triton-XIOO. Following the coculture, the plates were centrifuged at 120 x g for 1 minute, and 100 pL of the supernatant was transferred to 96-well Opti-plates (PerkinElmer™). M1000 pro (Tecan) was used to determine the optical intensities at 488 and 520 nm. Cytotoxicity was calculated using the following equation:Target lysis (%) = [(Experimental release-spontaneous release) / (Maximal release -spontaneous release)] x 100

[0108] Preparation of recombinant Cas9 protein and single-guide RNA

[0109] The synthesis and purification of Cas9 protein and sgRNA were as described by Lin et al., 2022 (Lin, S. W., V. Q. Nguyen, and S. Lin, Preparation of Cas9 Ribonucleoproteins for Genome Editing. Bio-protocol, 2022. 12(10): p. e4420). Briefly, recombinant Streptococcus pyogenes Cas9 was expressed and purified from E. coli Tuner DE3 strain (Novagen). Cas9 protein was purified sequentially by nickel- affmity, ion exchange and size-exclusion chromatography. The final Cas9 protein was adjusted to 40 pM in Cas9 RNP buffer consisting of 20 mM HEPES (pH 7.5), 150 mM KC1, 10% glycerol, 1 mM |3- mercaptoethanol and 10 mM MgCL. Cas9 protein was stored as small aliquots at -80°C. The CGAS- and STING-targeting sgRNA were designed by the CRISPR Design tool on Benchling website (www.benchling.com). To ensure high editing precision and minimal off-target effect, sgRNA with high off-target scores were selected and subsequently synthesized by in vitro transcription (IVT) using recombinant T7 RNA polymerase. The DNA templates were assembled by overlapping PCR. The IVT reaction was resolved by denaturing urea-PAGE, and full-length sgRNA were excised and extracted. The PAGE-purified sgRNA was treated with calf-intestine phosphatase (NEB) to remove the immunogenic 5' phosphate group (Wienert, B., et al., In vitro-transcribed guide RNAs trigger an innate immune response via the RIG-1 pathway. PLoS biology, 2018. 16(7): p. e2005840; Kim, S., et al., CRISPR RNAs trigger innate immune responses in human cells. Genome Research, 2018. 28(3): p. 367-373). The final sgRNA product was quantitated by NanoDrop Lite (Thermo Fischer Scientific™), adjusted to 48 pM in Cas9 RNP buffer, and then stored as aliquots at -80°C.

[0110] Cas9 RNP electroporation

[0111] Cas9 RNP electroporation was performed by the same procedure as plasmid DNA electroporation. Cas9 RNP was prepared by mixing 1 pL of each 40 pM Cas9 and 48 pM sgRNA to give 2 pL of Cas9 RNP for one electroporation reaction. The Cas9 and sgRNA mixture was incubated at 37°C for 15 minutes to form Cas9 RNP. An electroporation reaction consisted of 4 x 105 of NK cells in 20 pL of electroporation buffer and 2 pL of Cas9 RNP (equivalent to 40 pmol) in the Lonza 16-well electroporation strip cuvette. Immediately after electroporation, 100 pL of pre-warmed medium was added to the cuvette to recoverthe NK cells at 37°C for 15 minutes. The cells were transferred from the cuvette to 24-well plates and maintained by the standard method.

[0112] Gene Editing Analyses by DNA Sequencing

[0113] Th gene-edited NK cells were collected by centrifugation at 300 * g for 5 minutes and then washed once with DPBS. Genomic DNA was extracted by adding 50 pL of QuickExtraction solution (Lucigen™) to dissolve the cell pellet. The cell lysate was incubated at 65°C for 15 minutes and 98°C for 5 minutes to digest the proteins. The extracted genomic DNA was stored at -20°C. PCR was performed to amplify the target sequences using KAPA HiFi HotStart PCR kit (Roche™). After purification using QIAGEN™ QIAquick PCR Purification Kit, the PCR products were eluted with molecular-grade water. A total of 50 pg of PCR DNA was used for Sanger sequencing. Analysis of indel percentages was conducted using the online Inference of CRISPR Edits (ICE) tool, available at https: / / www.synthego.com / products / bioinformatics / crispr-analysis.

[0114] Statistical analysis

[0115] Except for the screening experiments, all data were collected from multiple donors or multiple independent experiments, as specified in the figure legends, to determine mean values ± SD as shown. Two-tailed Welch's unequal variances t-test was used to test for significant differences between two groups. P-values < 0.05 were considered statistically significant. Statistical analyses were performed using GraphPad Prism 8.

[0116] Example 1 Inhibition of cGAS-STING pathway reduced plasmid toxicity and increased transgene expression

[0117] The inventors of the present disclosure consider that the cGAS-STING pathway is triggered when plasmid DNA is introduced to NK cells, resulting in severe immune reactions and cell death. NK-92 human NK cell line was used as a model to test this theory. In the example CRISPR-Cas9 genome engineering technology was used to selectively knock out the CGAS or STING genes (FIG. 1). We electroporated a GFP reporter plasmid pmaxGFP into NK-92 cells, and treated NK-92 cells with the cGAS and STING inhibitors G140 and H151, respectively, to try to reduce plasmid toxicity and improve NK-92 cell viability (FIGs. 2A and 2B). We then analyzed the cell viability and GFP expression by flow cytometry to determine the impact of the inhibitors on cell survival. To confirm the activation of cGAS-STINGpathway, we analyzed the levels of phosphorylated IRF3, which is a key transcription factor downstream of the cGAS-STING pathway, by immunoblottmg.

[0118] It was discovered that the cGAS inhibitor increased NK-92 cell viability after the electroporation of 1 pg pmaxGFP. The viability increased from 5.8% in the untreated condition to 25.0% in G140 treatment, suggesting that cGAS might be involved in NK-92 cell death after plasmid electroporation (FIG. 2C). The G140 treatment also increased GFP expression to 28.2% from 17.3% in untreated cells. The combination of higher cell viability and higher transgene expression gave more GFP- positive NK-92 cells. Conversely, neither H151 treatment nor the combination of G140 and H151 led to a significant increase in NK-92 cell viability due to large variations in the triplicate experiment.

[0119] Using immunoblotting, we detected the phosphorylation of IRF3 at 2 hours after plasmid electroporation, confirming the activation of the cGAS-STING pathway (FIG. 2D) . Taken together, the inhibitor experiment suggests that cGAS may be crucial to NK-92 cell death after plasmid electroporation.

[0120] Example 2 CRISPR gene knockout by Cas9 ribonucleoproteins robustly ablated the CGAS, STING and TBK1 genes

[0121] The inhibitor experiment provided a promising hint to the role of cGAS-STING pathway in plasmid toxicity in NK cells. To overcome the limitation of chemical inhibitors, we set up CRISPR genome editing to knockout (KO) the CGAS and STING genes. We designed a total of 15 sgRNAs to target the CGAS exon 1 and STING exon 3 and 4 regions (FIG. 3A). We synthesized the sgRNAs from DNA templates by in vitro transcription using recombinant T7 RNA polymerase. The sgRNAs were purified by denaturing PAGE to full length, and treated with CIP to remove the immunogenic 5' triphosphate group. The purified sgRNAs were assembled in vitro with recombinant Cas9 protein to form Cas9 ribonucleoproteins (Cas9 RNP). The CGAS and .S77M / -targcting Cas9 RNPs were electroporated into NK cells for gene knockout.

[0122] We first screened the 15 sgRNAs in NK-92 cells to identify the most efficient sgRNA.I determined the insertion-deletion efficiencies (% indel) of the sgRNAs by Sanger sequencing and ICE analysis (FIGs. 3B to 3C). The sgRNA9 and sgRNAl l gave the highest % indel of 73% and 74%, respectively. Therefore, sgRNA9 and sgRNAl l were selected forknocking out the CGAS and STING genes in primary NK cells. We also examined the protein expression of cGAS and STING in the parental and KO cells in NK-92 and primary NK cells. By immunoblotting at 3 days after editing (FIGs. 3D and 3E). We observed substantial reductions or absence of cGAS and STING proteins in the cells where the respective genes were targeted for KO. By analyzing the heterogenous knockout cell populations, the results indicate that the CGAS and STING KO were highly efficient by the Cas9 RNP approach in both NK-92 cells and primary NK cells. The KO NK cells were used subsequent studies.

[0123] The testing regarding CRISPR genome editing to knockout (KO) the TBK1 was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0124] Example 3 Genetic knockout attenuated the activation of cGAS-STING pathway

[0125] Following the successful KO of the CGAS and STING genes in NK-92 and primaryNK cells, we performed immunoblottmg and RT-qPCRto confirm the genetic inactivation of cGAS-STING pathway. To monitor the activation of cGAS-STING pathway, we first used Western blot analysis to detect on the phosphorylation of STING (Ser366) and IRF3 (Ser396) in the CGAS KO and STING KO NK-92 cells following plasmid electroporation (FIGs. 4A and 4B). We also used RT-qPCR to measure the induction of pro-inflammatory cytokine IL-6 and IL-10, which are the downstream products of the cGAS- STING pathway (FIGs. 4C and 4D).

[0126] When plasmid DNA was electroporated into the parental NK-92 cells, the signals of phosphorylated STING and IRF3 appeared, indicative of cGAS-STING activation. In contrast, phosphorylated STING and IRF3 were not detected in the CGAS and STING KO mutant cells, confirming that the pathway was inactivated. The genetic inactivation of cGAS-STING pathway also led to a substantial reduction in IL-6 transcript levels in the KO cells. The relative IL-6 transcript levels decreased from 11.53 in the parental NK-92 cells to 1.04 and 3.89 in the CGAS KO and STING KO cells, respectively (FIG. 4C). Surprisingly, we did not detect the induction of IL- 10 after plasmid electroporation (FIG. 4D). Taken together, our findings show that genetic knockout of CGAS and STING genes effectively impedes the activation of the cGAS-STING pathway, as evidenced by the marked reduction in the phosphorylated STING and IRF3 and decreased expression of IL-6.

[0127] The testing regarding the KO of the TBK1 gene in attenuating the activation of cGAS-STING pathway was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0128] Example 4 The KO of CGAS, STING and TBK1 genes alleviated plasmid-induced apoptosis

[0129] To better quantitate NK cell death, we performed Annexin V assay to determine the level of apoptotic cells in the parental and KO NK cells after plasmid electroporation. Cells were stained with Annexin V and DAPI and analyzed using flow cytometry'. Annexin V stains phosphatidylserine that is displayed on the extracellular membrane of apoptotic cells. In NK-92 cells, both the CGAS and STING KO cells exhibited significant reductions in the percentages of apoptotic cells as compared to the parental cells (FIGs. 5A and 5B). The percentages of apoptotic cells decreased from an average of 64.0% in the parental cells to 38.3% and 40.4% in the CGAS and STING KO cells, respectively. In primary NK cells, only the CGAS knockout cells demonstrated a statistically significant decrease in apoptosis (FIGs. 5C and 5D). Apoptotic cells decreased from 50.3% in the parental cells to 33.4% in the CGAS KO cells. The KOof STING also decreased the % apoptotic cells to 39%, although the reduction was not statistically significant. These observations are in line with my previous results where the use of a cGAS inhibitor increased cell viability following plasmid electroporation. Taken together, the findings underscore the importance of cGAS-STING pathway in plasmid toxicity in NK cells. The disruption of the cGAS-STING pathway can effectively mitigate apoptosis of both NK-92 and primary NK cells after plasmid electroporation, especially evident in the CGAS KO cells.

[0130] The testing regarding the KO of the TBK1 gene in alleviating plasmid-mduced apoptosis was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0131] Example 5 Blocking cGAS-STING pathway promoted plasmid expression in NK-92 cells

[0132] To this end, we have shown that the pharmacological inhibition and genetic disruption of cGAS-STING activation alleviate plasmid toxicity and improve cell viability in NK cells. Next, we assessed the % recovery of viable cells and % viable GFP+ cells in the parental and KO NK cells after the electroporation of pmaxGFP reporter plasmid by flow cytometry (FIG. 6A). After pmaxGFP electroporation, the parental NK-92 had fewer than 5 % of viable cells remained, and within the viable cells, only 18% were GFP positive (FIG. 6B). Strikingly, the CGAS and STING KO significantly improved cell viability and GFP expression. Both CGAS and STING KO in NK-92 cells gave -30% of viable cells and 50-65% viable GFP positive cells. Similar improvements were observed in primary NK cells (FIG. 6C). The CGAS and STING KO in primary NK cells also increased the recovery of viable cells to 25-30% and viable GFP+ cells to 20-25%, although the effect on GFP expression was less dramatic than the NK-92 KO cells.

[0133] To confirm the effect we observed with pmaxGFP was reproducible for larger plasmids and different gene cargos, we electroporated NK-92 cells with a plasmid encoding a tandem of gfp gene, T2A split sequence and anti-CD19 CAR cassette (pGFP-T2A-CD19-CAR, FIGs. 7A and Table 1). As seen previously in the pmaxGFP experiment, nearly all the parental NK-92 cells died after electroporation, and the transgene expression as measured by GFP expression was below 10% (FIG. 7B). In contrast, the CGAS and STING KO improved cell viability to 27% and 9%, respectively. GFP expression also increased significantly in the CGAS and STING mutant cells to 47% and 43%, respectively. We electroporated the KO primary NK cells with another CAR plasmid encoding a tandem construct of gfp, T2A and anti-EpCAM CAR sequences. Although the STING KO did not rescue the primary NK cells from plasmid toxicity, the expression of GFP-CAR increased to -25% (FIG. 7C). It was surprising that plasmid toxicity was not alleviated because the CAR-expressing plasmid was only -1000 bp larger than pmaxGFP.Table 1: The design of the CAR, with details of the signal peptide, scFv, hinge region, transmembrane domain, intracellular domain, and the total size of each construct variant.

[0134] The expression of pmaxGFP and pGFP-T2A-CD19-CAR in NK-92 cells were validated by fluorescent microscopy. The CGAS and STING KO NK-92 mutants showed significantly higher levels of GFP signaling, whereas the parental NK-92 cells gave no detectable GFP signal (FIG. 8). The results indicate that the disruption of cGAS-STING in NK-92 helps improve cell viability and transgene expression regardless of plasmid size and gene cargo. However, the same strategy was not universally applicable in primary NK cells, suggesting that other DNA surveillance systems are in place to trigger NK cell death and interfere with plasmid expression.

[0135] The testing regarding TBK1 KO in NK-92 cells KO to promote plasmid expression inNK-92 cells was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0136] Example 6 Pharmacological inhibition could not rescue primary NK cells from plasmid toxicity

[0137] Small molecular inhibitors were used to try to rescue the cells from apoptosis. We electroporated the STING KO primary NK cells with pGFP-T2A-EpCAM-CAR. After plasmid electroporation, we incubated the primary NK cells in the media containing Y-27632 (ROCK inhibitor), RevitaCell (ROCK inhibitor) or Z-VAD-FMK (caspase inhibitor). After three days of culture, we analyzed GFP expression and cell viability by flow cytometry (FIG. 9A). None of the inhibitors helped increase CAR expression or rescue the primary NK cells from plasmid-induced cell death.

[0138] We also tested the cGAS inhibitor G140 and STING inhibitor H151 in primary NK cells, because the inhibitors increased cell viability and transgene expression in NK-92. Furthermore, inhibitor treatment would be more straightforward than CRISPR KO for the engineering of primary NK cells. To test the inhibitors, we electroporated the primary NK cells with pmaxGFP plasmid, incubated the cells in different concentrations of inhibitors, and analyzed the cells after three days of culture by flow cytometry. GMO was toxic to primary NK cells at high dosages, but GFP expression increased slightly (FIG. 9B). H151 was less toxic to primary NK cells and improved the viability at low dosages; however, the effect on GFP expression was minimal. The experiment needs to be repeated with different donor cells to confirm the effects of GMO and H151 in primary NK cells.

[0139] We also combined the cGAS-STING and apoptosis inhibitors. We focused on theSTING inhibitors H151 because it was less toxic. We also tested another STING inhibitor SN011 andpretreated the primary NK cells with H151 or SN011 for one hour before electroporation to ensure the inhibitor enter the cells and bind to the STING protein. In addition to the STING inhibitors, we also included Z-VAD-FMK caspase inhibitor (FIG. 10A). Regardless of the inhibitor combination or pretreatment, none of the strategies showed significant improvement in cell viability and GFP expression (FIGs. 10B, IOC and 10D). To this end, our attempts to use small molecule inhibitors to rescue primary NK cells from plasmid toxicity was unsuccessful. Plasmid toxicity in primary NK cells may involve a more complicated mechanism than the NK-92 cells. More work is necessary to identify other factors of DNA surveillance system in order to bypass or block the immune detection of plasmid.

[0140] Example 7 NK-92 STING KO single clone could tolerate higher plasmid concentrations

[0141] We wanted to establish homozygous CGAS and STING KO clones in NK-92 cell line and then repeated the gene KO by Cas9 RNP electroporation and performed single cell sorting to seed the single cells into 96-well plates (FIG. HA). It was challenging to expand NK-92 from single cells. Surprisingly, we obtain a single clone of STING KO NK-92 as confirmed by immunoblotting. The single clone showed normal proliferation rate and cell morphology, and maintained stable KO phenotype. We challenged the parental NK-92 and STING KO clone with increasing concentrations of pmaxGFP plasmid ranging from 0.5 to 8 pg. Most of the parental cells died when electroporated with pmaxGFP at as little as 0.5 pg (FIG. 1 IB). Also, GFP expression did not increase significantly at higher plasmid concentrations. The STING KO clone tolerated the plasmid toxicity substantially better than the parental cells. Most of the STING KO cells survived at 0.5 pg of pmaxGFP; GFP expression was also higher at -35% as compared to -15% of the parental cells. Although cell viability decreased as the plasmid concentration increased, the STING KO clone maintained -50% and -20% viable at 4 and 8 pg of pmaxGFP of respectively (FIG. 1 IB). The results further confirm that genetic inactivation of the STING gene alleviates plasmid toxicity in NK- 92 cells.

[0142] The testing regarding NK-92 TBK1 KO single clone in tolerating plasmid concentrations was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0143] Example 8 CGAS, STING and TBK1 KO enable CAR expression by plasmid electroporation

[0144] Our CAR constructs encode a 5’ gfp gene for co-expression and detection by flow cytometry. We also performed antigen binding assay to confirm that the CAR protein was expressed and localized to extracellular membrane. We stained the parental NK-92 and KO mutant cells after the electroporation of CD19-CAR-expressing plasmid using recombinant biotinylated CD 19 and subsequently fluore scent-conjugated streptavidin. We used flow cytometry to detect the GFP-positive and CD19-bindingcell population. A small fraction of parental NK-92 was GFP -positive, but CD19-binding activity was almost undetectable (FIG. 12). The result suggests that although GFP was expressed, CD19-CAR was not. In contrast, both the CGAS KO and STING KO cells showed notable increases in GFP expression and CD- 19-binding activity, suggesting a more robust expression and localization of CD19-CAR to the cell membrane.

[0145] We also electroporated the STING KO clone with two other CAR constructs: EGFR- and EpCAM-targeting CAR. To simplify the detection of CAR expression and localization, we introduced a HA affinity tag between the N-terminal signal peptide and single-chain variable fragment (scFv). We were able to detect high levels of GFP expression from the two new CAR constructs. The GFP- and HA- double positive cells were 31% and 9% for EGFR-CAR and EpCAM-CAR, respectively (FIGs. 13 A and B). The results demonstrate that the STING KO clone could efficiently CAR from plasmid.

[0146] The testing regarding TBK1 KO in enabling CAR expression by plasmid electroporation was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0147] Example 9 CAR-expressing NK-92 showed markedly enhanced in vitro cytotoxicity

[0148] Plasmid is one of the most popular and straightforward vectors for transgene expression to facilitate genetic research. The KO of CGAS and STING genes opens the possibility to use plasmid for transgene expression in NK cells. Particularly, the STING KO NK-92 clone could be advantageous for the development of NK cell therapeutics, such as the optimization and validation of NK cell-specific CAR design.

[0149] To demonstrate this application, we electroporated the STING KO clone with EFGR- and EpCAM-CAR plasmids, and analyzed the cytotoxicity in vitro against HCT116 colon cancer and U87- MG glioblastoma cell lines (FIG. 13B). The untreated STING KO clone could not kill the cancer cells across all the effector-to-target ratios. The expression of EGFR- and EpCAM-CAR activated high levels of cytoxicity against HCT116, which was EGFR- and EpCAM-positive. The expression of EGFR-CAR also enabled robust cytotoxicity against U87-MG, which was EGFR-positive. As anticipated, EpCAM-CAR electroporation did not increase the cytotoxic effect on U87-MG cells. Collectively, the results showcase the application of the STING KO NK-92 clone in the testing of CAR design. Furthermore, the increased plasmid tolerance in the STING KO clone could allow other applications beyond CAR-based therapies.

[0150] The testing regarding the KO of TBK1 gene NK cell-specific CAR design was also conducted following the above-mentioned procedure, and similar results can be obtained.

[0151] Example 10 CGAS, STING KO and TBK1 did not affect the cytotoxicity of primary NK cells

[0152] To evaluate the impact of CGAS and STING KO on NK cell function, we performed cytotoxicity assays in the parental and mutant primary NK cells against HCT 116 and U87-MG. Primary NK cells have robust basal cytotoxic activities even without genetic modifications (FIGs. 14A and 14B). This allowed us to observe the influence of CGAS and STING KO on NK cell function. We tested primary NK cells from three donors. Despite donor variations, the results show that neither CGAS nor STING KO alters the in vitro cytotoxicity of primary NK cells against HCT116 and U87-MG target cells across various effector-to-target ratios.

[0153] The data provide a basis for the usability of our NK-92 STING KO single clone cells.The results confirmed that the cytotoxic capabilities ofNK cells remained unaffected by STING knockout, underscoring their potential for utilization in research and therapeutic applications. These results not only validate the functional integrity of STING knockout NK cells but also hint at their potential for improved performance in applications involving plasmid transfection. The increased plasmid tolerance in STING knockout single clone NK-92 cells could play a pivotal role in boosting the efficacy of gene therapies that depend on the transfection of therapeutic genes.

[0154] The testing regarding TBK1 KO in the cytotoxicity of primary NK cells was also conducted following the above-mentioned procedure, and similar results can be obtained.

Claims

Claims1. A method of generating natural killer (NK) cells resistant to plasmid toxicity and / or having increased transgene expression, comprising disrupting the activity of cyclic GMP-AMP synthase (cGAS)- stimulator of interferon genes (STING) pathway in NK cells.

2. The method of claim 1, wherein the method comprises disrupting the activities of one or more of cGAS, STING and TANK-binding kinase 1 (TBK1) proteins in NK cells.

3. The method of claim 1, wherein the NK cells are primary NK cells isolated from peripheral and cord blood, NK cells differentiated from iPSC, or NK-92 cell line and its derivatives.

4. The method of claim 2, wherein the disruption of the activities of one or more cGAS, STING and TBK1 proteins comprises knockdown or knockout of gene expression or inhibition of the activities of one or more cGAS, STING and TBK1 proteins.

5. The method of claim 2, wherein the NK cells are one or more of the CGAS, STING and TBK1 knockdown cells generated by RNA interference.

6. The method of claim 2, wherein the NK cells are one or more of the CGAS, STING and TBK1 knockout cells generated by CRISPR genome editing.

7. The method of claim 2, wherein the NK cells are treated with pharmacological inhibitors to inactivate the cGAS, STING or TBK1 enzymatic activities.

8. The method of claim 2, wherein exon 1 of the CGAS gene is targeted and disrupted.

9. The method of claim 8, wherein exon 1 of the CGAS gene is targeted and disrupted by CRISPR genome editing using Cas9 and single guide RNA (sgRNA) ribonucleoproteins.

10. The method of claim 9, wherein the CRISPR genome editing for disrupting the CGAS gene uses single guide RNA (sgRNA) comprising a nucleotide sequence having GGCCATGCAGAGAGCTTCCG (SEQ ID NO. 1), GCTTCCGCACGGAATGCCAG (SEQ ID NO. 2), GGAGACTCGGTGGGATCCAT (SEQ ID NO. 3), CCGGCAGAAAAAGAGCGCCC (SEQ ID NO. 4), GCTGGTTCTTGCCGCCAGAG (SEQ ID NO. 5), TGGGGCCTCGAAGCTCCGGG (SEQ ID NO. 6), CCGCGATGATATCTCCACGG (SEQ ID NO. 7), GACTCCGCGTTCAGAGGCGT (SEQ ID NO. 8) or GAGCTACTATGAGCACGTGA (SEQ ID NO. 9).

11. The method of claim 4, which further comprises culturing the CGAS -knockout NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single CGAS -knockout clones of NK cells.

12. The method of claim 2, wherein exon 3 or 4 of the STING gene is targeted and disrupted.

13. The method of claim 12, wherein the CRISPR genome editing for disrupting the exon 3 of the STING gene uses sgRNA comprising a nucleotide sequence having CCATCCATCCCGTGTCCCAG (SEQID NO. 10), GCAGGCACTCAGCAGAACCA (SEQ ID NO. 11) or GCTGGGACTGCTGTTAAACG (SEQ ID NO. 12).

14. The method of claim 12, wherein the CRISPR genome editing for disrupting the exon 4 of the STING gene uses sgRNA comprising a nucleotide sequence having GCAGCTACTGGAGGACTGTG (SEQ ID NO. 13), GCAGCAACAGGGCCCCACGG (SEQ ID NO. 14) or GCAAGCATCCAAGTGAAGGG (SEQ ID NO. 15).

15. The method of claim 4, which further comprises culturing the >S7' / A'G-knockoiit NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single STING- knockout clones of NK cells.

16. The method of claim 2, wherein exon 2 or 3 of the TBK1 gene is targeted and disrupted.

17. The method of claim 16, wherein the CRISPR genome editing for disrupting the exon 2 of the TBK1 gene uses sgRNA comprising a nucleotide sequence having AGAGCACTTCTAATCATCTG (SEQ ID NO. 16), GCTACTGCAAATGTCTTTCG (SEQ ID NO. 17) or AGACATTTGCAGTAGCTCCT (SEQ ID NO. 18).

18. The method of claim 16, wherein the CRISPR genome editing for disrupting the exon 3 of the TBK1 gene uses sgRNA comprising a nucleotide sequence having CATAAGCTTCCTTCGTCCAG (SEQ ID NO. 19), TCTCTCATTTGAACATCCAC (SEQ ID NO. 20) or CAAATTATTTGCTATTGAAG (SEQ ID NO. 21).1 . The method of claim 4, which further comprises culturing the TBK1 -knockout NK cells, performing single-cell sorting, and clonal expanding the single NK cells, and identifying the single TBK1 -knockout clones of NK cells.

20. The method of claim 1, wherein the NK cells described herein is NK-92 cell line and its derivatives.

21. NK cells resistant to plasmid toxicity, wherein CGAS, STING or TBK1 gene is knocked out or knocked down.

22. Chimeric antigen receptor (CAR)-expressing NK cells, wherein the NK cells of claim 21 are transfected or electroporated with a plasmid encoding a CAR sequence or an immune-modulating gene.

23. The NK cells or CAR-expressing NK cells of claim 21 or 22, wherein the NK cells are genetically modified by CRISPR genome editing.

24. The NK cells or CAR-expressing NK cells of claim 21 or 22, which are primary NK cells, NK cell lines or iPSC-differentiated NK cells.

25. The NK cell lines or CAR-expressing NK cells of claim 21 or 22, wherein the cGAS protein is inactivated by gene knockout, gene knockdown or pharmacological inhibition.

26. The NK cell lines or CAR-expressing NK cells of claim 21 or 22, wherein the STING protein is inactivated by gene knockout, gene knockdown or pharmacological inhibition.

27. The NK cell lines or CAR-expressing NK cells of claim 21 or 22, wherein the TBK1 protein is inactivated by gene knockout, gene knockdown or pharmacological inhibition.

28. The NK cell lines or CAR-expressing NK cells of claim 21 or 22 for use in immunotherapy.

29. The NK cell lines or CAR-expressing NK cells of claim 21 or 22 for use in treating cancer.