DNA double-strand break-capturing nuclear envelope tubules drive DNA repair
Modulating dsbNETs through dsbNETs modulators improves DNA repair efficiency and stability, addressing inefficiencies in existing repair pathways and reducing genomic instability and associated pathologies.
Patent Information
- Application Number
- PCT/CA2024/051735
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-05-06
- Filing Date
- 2024-12-27
- Publication Date
- 2025-07-03
AI Technical Summary
Current understanding of how the nuclear envelope facilitates DNA repair in mammals is limited, and aberrant DNA double-strand breaks (DSBs) can lead to chromosome rearrangements and cell growth stalling, with existing repair pathways being inefficient or error-prone.
Administration of dsbNETs modulators, such as inhibitors or downregulators of dsbNETs regulators, to manage the formation and function of DNA double-strand break-capturing nuclear envelope tubules (dsbNETs) to enhance DNA repair efficiency and stability, using agents like siRNA, shRNA, CRISPR, or antibodies targeting specific dsbNETs regulators.
Enhances DNA repair accuracy, reduces genomic instability, and mitigates conditions associated with dsbNETs dysfunction, including cancer and premature aging, by modulating dsbNETs activity.
Smart Images

Figure CA2024051735_03072025_PF_FP_ABST
Abstract
Description
DNA DOUBLE-STRAND BREAK-CAPTURING NUCLEAR ENVELOPE TUBULESDRIVE DNA REPAIRRELATED APPLICATIONS
[0001] This disclosure claims the benefit and priority of United States Provisional Patent Application serial nos. 63 / 616,096 filed December 29, 2023; 63 / 570,426 filed March 27, 2024; 63 / 573,935 filed April 3, 2024; and Canadian Patent Application no. 3,237,512 filed May 6, 2024, all of which are incorporated herein by reference in their entirety.SEQUENCE LISTING
[0002] A computer readable form of the Sequence Listing “2223-P74410PC00_Se- quenceListing” (70,527 bytes) was created on December 13, 2024, is filed herewith by electronic submission.FIELD
[0003] The present disclosure relates to the field of molecular biology, particularly to pathologies / conditions characterized with a higher degree of DNA damage or nuclear envelope deformations.BACKGROUND
[0004] DSBs, highly toxic lesions induced by radiation or chemotherapeutics, can instigate aberrant chromosome rearrangements, stalling cell growth. Most DSBs are repaired by the non-homologous end-joining (NHEJ) and homologous recombination (HR) DNA repair pathways1. NHEJ operates throughout the Gi and S / G2 cell cycle stages, while HR is active during S / G2. NHEJ and HR have been extensively studied using different model organisms. Studies in yeast and flies revealed that damage increases DNA mobility2'13, facilitating temporary DSB relocation onto intranuclear microtubule or actin filaments to the nuclear periphery9,10’12'14. DSBs interact with protein complexes embedded within the nuclear envelope’s inner and outer nuclear membranes (INM, ONM). Such perinuclear factors, including LINC and NPCs, facilitate NHEJ or HR via unclear mechanisms7'9’11'14LINC encompasses the INM proteins SUN1 and SUN2 and ONM proteins known as SYNEs or Nesprins12. The chromatin-facing SUN proteins interact with the cytoplasmic-facing SYNEs within the nuclear envelope lumen12. Disrupting mammalian LINC or its associated nuclearlamina compromises DSB mobility and repair15. Although some DSBs and telomeres exhibit longer-range mobility in mammalian nuclei16'20, most mammalian DSBs show small-scale mobility and reside far from the nuclear edge during repair21'23. It is unclear how the nuclear envelope promotes DNA repair in mammals, or mechanistically drives repair in any organism.SUMMARY
[0005] The present disclosure describes a method of treating a dsbNETs-associated pathology or condition in a subject in need thereof, comprising administering a therapeutically effective amount of a dsbNETs modulator in the subject, wherein dsbNETs repair or misrepair damaged DNA or wherein excessively induced or persistent dsbNETs trigger DNA damage.
[0006] In some embodiments, the dsNETs modulator is an inhibitor or downregulator of a dsbNETs regulator. In some embodiments, the dsbNETs regulator is selected from the group consisting of Actin, ARP2, ARP3, ATAT1 (a.k.a. alpha-TATl or aTATl), ATM, ATR, DNAPK (a.k.a. DNA-PK, DNA-PKcs), FMN1, FMN2, HATs (histone acetyl transferases), HDACs (histone deacetylases), Kinesin-1 (KIF5A, KIF5B, or KIF5C; referred to as KIF5A / B / C), Kinesin-5 (KIF11), Kinesin-3 (KIF13B), Kinesin-6 (KIF20A), Kinesin-8 (KIF18A), Kinesin-13 (KIF2C), Kinesin-14A (KIFC1), Kinesin-14B (KIFC3), KIF5B-ALK, KIF5B-EGFR, KIF5B-RET, KU70, LMNA / C, LMNB1, LMNB2, microtubules (including TUB proteins, such as TUBA1B and TUBA4A), MRE11, NAT10, NBS1, PARP, Progerin, RAD50, SUN1, SUN2, MYH10, SENP2, NUMEN / ENDOD1, RNF4, VASH1, VASH2, SVBP, a dsbNETs regulator as shown in Table 2, or a combination of the foregoing. In some embodiments, the microtubles are TUB proteins. In some embodiments, the TUB proteins are TABA1B or TUBA4A. In some embodiments, the dsbNETs-associated pathology or condition is cancer, aging, or premature aging, and the method comprises administering 4SC-205 (AEGIS), Adociasulfates, Afatinib, Alectinib, Anacardic Acid, ART0380, ATRN-119, AZ82, AZD0156, AZD1390, AZD4877, AZD6738, BAY1895344, Belinostat (PXD101), Berzosertib, Blascorid (Pirexyl), Brigatinib, BTB-1, C60211, C646, C75, Cabazitaxel, Cabozantinib, Camonsertib, CBP-93872, Ceftolozane, Ceritinib, Chaetoglobosin A, CK 666, CK-312, CK-666, CK-689, CK-869, colchicine, Compound L, Copanlisib, Crizotinib, Curcumin, CW069, Cytochalasin B, Cytochalasin D, Cytochalasin E, Valproic acid, Dimethylenastron, Docetaxel, DPQ, EB-47, Enfortumab vedotin, Ensartinib, Entinostat (MS- 275), Entrectinib, Eribulin, Erlotinib, a Famesyltransferase inhibitor, Panobinostat (LBH-589), Filanesib (ARRY-520), Folic Acid, Gefitinib, Gossypol, Hesperidin, IC486241, IC86621,IC87361, Ispinesib, Romidepsin (FK228), Ixabepilone, KIF18A-IN-1, KIFC3 blocking Peptide, kinesin-derived angiogenesis inhibitor (KAI), KU-0060648, Latrunculin-A, Latrunculin-B, Lenvatinib, Litrinosib, Lonafamib, Lorlatinib, LY294002, Olaparib, M1774, M3541, M4076, Mangafodipir, Metformin, Methotrexate, MG149, Mirin, Monastrol, NK314, Nocodazole, NU1025, NU7026, NU7163, NU7427, NU7441, Oftasceine, OK1305, Osimertinib, Panobinostat, Paprotrain, PARP Inhibitor XIV, Pemetrexed, PJ34, Pravastatin, Progerin, a Progerini inhibitor, Pralatrexate, PU139, Quercetin, Remodelin, Rimacalib, RP- 3500, Rucaparib, RXDX-105, Sarizotan, Selpercatinib, SMIFH2, Sovilnesib, SR31527 chloride, STL127705, STLC (S-trityl-L-cysteine), SU11752, TAE684, Talazoparib, Paclitaxel, Tirbanibulin, Trastuzumab emtansine, Tubacin, Tubastatin A, UCM-13207, Vandetanib, Vanillin, Vimentin, Vinblastine, VLS-1488, VX-803, VX-970, Wiskostatin, Wortmannin, XRD-0394, Niraparib, oledronic acid, SAHA (Vorinostat), CCW16, ZHAWOC8697, SENP2- IN-1, NSC 632839, 1,2,5-Oxadiazoles, GM-90257, GM-90631, or EPOY, or any combination thereof, in a subject.
[0007] In some embodiments, the Belinostat is Belodap™, the Valproic acid is Depacon™, the Famesyltransferase inhibitor is Tipifamib or Lonafamib, the Panobinostat is Farydak™, the Romidepsin is Istodax™, the Olaparib is Lynparza™, the Progerini inhibitor is Progerinin™ (SLC-D011), the Rucaparib is Rubraca™, the Talazoparib is Talzena™, the Paclitaxel is Taxol™, and / or the Niraparib is Zejula™.
[0008] In some embodiments, the dsbNETs regulator is ATAT1, wherein the dsbNETs inhibitor or downregulator is Mangafodipir, Hesperidin, Folic Acid, Pemetrexed, Ceftolozane, Oftasceine, Vimentin, Methotrexate, Pralatrexate, Copanlisib, GM-90257, GM-90631, or any combination thereof, and wherein the dsbNETs-associated pathology or condition is Type 1 Spherocytosis, Testicular Disease, Congenital Hydrocephalus, cancer, aging, or pre-mature aging. In some embodiments, the cancer is breast cancer, colorectal cancer, or pancreatic cancer. In some embodiments, the dsbNETs modulator is an siRNA, shRNA, CRISPR, or antibody specifically targeting the dsbNETs regulator.BRIEF DESCRIPTION OF THE DRAWINGS
[0009] The embodiments of the disclosure will now be described in greater detail with reference to the attached drawings in which:
[0010] FIG. 1A shows DSBs at LMNB1 tubules driven by cytoplasmic microtubules and the DNA damage response in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 1A shows representative images showing etoposide (ETP)-induced intranuclear LMNB1 tubules and their reversal upon removing the drug (wash) or their prevention by nocodazole (NOC). Etoposide was 100 pM for Ih; scale bars, 3 pm.
[0011] FIG. IB shows DSBs at LMNB1 tubules driven by cytoplasmic microtubules and the DNA damage response in U2OS cells, in an exemplary embodiment of the disclosure. FIG. IB shows quantifications relating to LMNB1 tubules scores of etoposide (ETP)-induced intranuclear LMNB1 tubules and their reversal upon removing the drug (wash) or their prevention by nocodazole (NOC). Etoposide was 100 pM for Ih. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0012] FIG. 1C shows DSBs at LMNB1 tubules driven by cytoplasmic microtubules and the DNA damage response in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 1C shows quantifications relating to tubules-positive cells of etoposide (ETP)-induced intranuclear LMNB1 tubules and their reversal upon removing the drug (wash) or their prevention by nocodazole (NOC). Etoposide was 100 pM for Ih. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0013] FIG. ID shows Etoposide treatment induced LMNB1 tubules during the Gi and S / G2 cell cycle stages in U2OS cells, in an exemplary embodiment of the disclosure. Data are shown as the mean ± s.d.; n = 6 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0014] FIG. IE shows Etoposide-induced LMNB1 tubules infdtrated by cytoplasmic microtubules (arrows) visualized using SIR-Tubulin (SRT) in live U2OS cells, in an exemplary embodiment of the disclosure. Etoposide was 100 pM for Ih; scale bars, 5 pm.
[0015] FIG. IF shows Etoposide-induced LMNB1 tubules and 53BPl-marked DSBs in U2OS cells, in an exemplary embodiment of the disclosure. FIG. IF shows representative images with the ratio of DSBs at tubular versus boundary LMNB1 in ETP -treated cells. Etoposide was 100 pM for Ih; scale bars, 3 pm. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-tailed paired t-test.
[0016] FIG. 1G shows Etoposide-induced LMNB1 tubules and 53BPl-marked DSBs in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 1G shows 53BP1 nuclear foci counts presented as total number. Etoposide was 100 pM for Ih. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0017] FIG. IH shows Etoposide-induced LMNB1 tubules and 53BPl-marked DSBs in U2OS cells, in an exemplary embodiment of the disclosure. FIG. IH shows positioning at (left) or away from (right) the LMNB1 tubules. Etoposide was 100 pM for Ih. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-tailed unpaired t-test.
[0018] FIG. II shows the effect of different DDR kinase inhibitors (ATMi, ATRi, DNAPKi) on LMNB1 tubule formation in U2OS cells, in an exemplary embodiment of the disclosure. FIG. II shows that ETP-dependent percent changes are shown on the bars and DDR kinase inhibitor-dependent percent changes to the induction compared to control (CTL) are shown above the bars. Etoposide was 100 pM for Ih. Data are shown as the mean ± s.d.; n = 9 except for conditions combining ETP and the DDR kinase inhibitors (n = 8), biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0019] FIG. 2A shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2A shows Etoposide (ETP)- induced LMNB1 tubules colocalize with the LINC subunits SUN2 and SYNE1 and the NPC factor NUP98. Scale bar, 5 pm.
[0020] FIG. 2B shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2B shows the effect of knocking down LINC proteins SUN1 or SUN2 on etoposide-induced LMNB1 tubule formation and the accumulation of 53BPl-marked DSBs. Data are shown as the mean ± s.d.; n = 3biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0021] FIG. 2C shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2C shows the proximity ligation assay (PLA) assessing the effect of etoposide on the proximity of endogenous 53BP1 to LMNB1 or SUN1. Representative images are shown in FIG. 9B. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0022] FIG. 2D shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2D shows the effect of knocking down the NPC subunit NUP98 or NUP153, on etoposide-induced LMNB1 tubule formation and the accumulation of DSBs marked by 53BP1. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0023] FIG. 2E shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2E shows the effect of knocking down the NPC subunit NUP153 on the accumulation of DSBs marked by 53BP1 or / H2AX following etoposide treatment. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0024] FIG. 2F shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2F shows the effect of knocking down the kinesins KIF5B or KIFC3, on etoposide-induced LMNB1 tubule formation and the accumulation of DSBs marked by 53BP1. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0025] FIG. 2G shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2G shows the effect of KIFC3 knockdown on the reversal of etoposide-induced LMNB1 tubules following the removal of the drug. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0026] FIG. 2H shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 2H shows Acetylated a- Tubulin (Ac-aTub) localization to etoposide-induced LMNB1 tubules (arrows). The percentage of Ac-aTub-positive tubules relative to the total number of tubules is shown. Scale bars, 5 pm.
[0027] FIG. 21 shows factors controlling DNA damage-inducible LMNB1 tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 21 shows immunoblots indicating the effect of etoposide, etoposide removal (ETP+wash), different DDR kinase inhibitors alone (ATMi, ATRi, or DNAPKi) or in combination (DDRKi) on the levels of Ac- aTub and aTub with Vinculin control. The levels of Ac-aTub relative to aTub are shown below the blot.
[0028] FIG. 2 J shows factors controlling DNA damage-inducible LMNB1 tubules inU2OS cells, in an exemplary embodiment of the disclosure. FIG. 2J shows the effect of knocking down ATAT1, KIF13B, or PERI on etoposide-induced LMNB1 tubule formation and the levels of 53BPl-marked DSBs. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0029] FIG. 3A shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 3A shows representative images showing Fokl-DSB at (bottom arrow) or away from (top arrow) LMNB1 tubules. For foci not at the tubules, the average DSB-to-tubule distance is shown. Scale bars, 5 pm.
[0030] FIG. 3B shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3B shows Fokl-DSB activation induced LMNB1 tubules-positive cells. Tubules were repressed by nocodazole (NOC). Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0031] FIG. 3C shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 3C shows Fokl-DSB activation induced LMNB1 tubular score. Tubules were repressed by nocodazole (NOC). Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0032] FIG. 3D shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3D shows Fokl-DSB activation induced LMNB1 tubular diameter. Tubules were repressed by nocodazole (NOC). 2-6-5 Fokl- DSB cells; scale bars; data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0033] FIG. 3E shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3E shows Association of Fokl- DSB with LMNB1 at the tubules or nuclear boundary. The tubules / boundary ratio (T / B) is shown. Data are reshown in FIG. 4F as they were part of the same experiments to facilitate comparison. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two- tailed unpaired Etest with Welch’s correction.
[0034] FIG. 3F shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3F shows the Effect of disrupting LINC, NPC, or kinesin proteins on LMNB1 tubular score following Fokl-DSB activation. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two- way ANOVA with Tukey’s multiple comparisons test.
[0035] FIG. 3G shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3G shows Representative images showing nuclear actin filaments (upward-pointing arrows) connecting Fokl-DSB (downward-pointing arrow) to a LMNBl tubule. Scale bars, 5 pm.
[0036] FIG. 3H shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3H shows effect of disrupting actin polymerization using latrunculin-B (LATB) on the association of Fokl-DSB with LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, one-way ANOVA with Dunnett’s multiple comparisons test.
[0037] FIG. 31 shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 31 shows changes to the proportion of cells with Fokl-DSB at the free nuclear actin filament tip over time. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-tailed unpaired Etest with Welch’s correction.
[0038] FIG. 3J shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3J shows representative images demonstrating the Fokl-DSB (bottom right arrow) connected to a network of nuclear actin fdaments (other three arrows). Scale bars, 5 pm.
[0039] FIG. 3K shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3K shows the effect of disrupting actin polymerization using LATB on Fokl-DSB-induced LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0040] FIG. 3L shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl- DSB cells, in an exemplary embodiment of the disclosure. FIG. 3L shows the effect of SUN1 or SUN2 knockdown on Fokl-DSB shape. Scale bars, 1 pm.
[0041] FIG. 3M shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 3M shows the effect of SUN1 or SUN2 knockdown on Fokl-DSB shape. Quantifications from cells treated with vehicle (m, left) or enoxacin (ENO; m, right) are shown. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0042] FIG. 3N shows capture and connection of DSB ends by dsbNETs in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 3N shows the effect of LINC protein knockdowns and enoxacin treatment on LMNB1 tubular score in cells without or with Fokl-DSB activation. Data from (f) are reshown as controls in (n) as they were part of the same experiments and for comparison. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0043] FIG. 4A shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4 A shows the removal of the N-terminal lamina / chromatin interaction domain of SUN1 (AN) prevents the protein from efficiently accessing LMNB1 tubules (two vertical arrows) induced by Fokl-DSB activation. The AN does not prevent SUN1 from colocalizing with LMNB1 atthe nuclear boundary (horizontal arrows). KU70-GFP served as negative control. Scale bar, 4 m.
[0044] FIG. 4B shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4B shows that LMNB1 tubules similarly form following Fokl-DSB activation in cells expressing the indicated fusion proteins. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0045] FIG. 4C shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4C shows that LMNB1 tubules similarly form following Fokl-DSB activation in cells expressing the indicated fusion proteins. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0046] FIG. 4D shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4D shows the level of localization of the indicated proteins to LMNB1 tubules relative to full GFP-SUN1. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two- way ANOVA with Tukey’s multiple comparisons test.
[0047] FIG. 4E shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4E shows the expression of GFP-SUN1AN but not KU70-GFP-SUN1AN increases the distance between the Fokl-DSB and the nuclear edge. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0048] FIG. 4F shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 4F shows the assessment of the colocalization of Fokl-DSB with tubular or boundary LMNB1 in cells expressing the indicated proteins. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0049] FIG. 4G shows licensing of SUN1 for dsbNETs and DSB tethering via the nuclear lamina in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG.4G shows the effect of overexpressing indicated proteins on Fokl-DSB shape. Dashed lines indicate the baseline levels in wild-type cells not expressing any of the chimeric fusion proteins. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0050] FIG. 5A shows the restraint of cancer via the modulation of dsbNETs in 2-6-5 Fokl-DSB cells, in an exemplary embodiment of the disclosure. FIG. 5A shows KIF5B and KIFC3 expression positively and negatively correlated with the NHEJ signature across cancers, respectively. Tumor numbers are shown with cancer acronyms (BRCA, breast cancer; also see Table 1). Significant Pearson’s correlation coefficients (PCCs) for KIF5B (dashed lines) and KIFC3 (solid lines) are in black- and grey-filled data points, respectively. White squares, not statistically significant.
[0051] FIG. 5B shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5B shows as in FIG. 5A but shows PCCs for the HR signature.
[0052] FIG. 5C shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5C shows Etoposide (ETP, lOOpM, Ih) induced microtubule-positive LMNB1 tubules in MCF10A, MDA-MB-231 (231), and MDA-MB-436 (436) cells. Data are shown as mean ± s.d., n = 3 biologically independent replicates, two-tailed unpaired Etest.
[0053] FIG. 5D shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5D shows the PARP inhibitor olaparib (PARPi, 2 pM, Ih) induced microtubule-positive LMNB1 tubules more in MDA-MB-436 cells than in MDA-MB-231 or MCF10A cells. Data are shown as mean ± s.d., n = 3 biologically independent replicates; two-tailed unpaired Etest.
[0054] FIG. 5E shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5E shows BRCA1 knockdown increases microtubule-positive LMNB1 tubules in MDA-MB-231 cells treated with PARPi (2 pM, 1 h). Data are shown as mean ± s.d., n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0055] FIG. 5F shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5F shows the knockdown of KIF5B but not KIFC3 provided resistance to the PARPi olaparib in a long-term growth assay. Data are shown as mean ± s.d., n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0056] FIG. 5G shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5G shows the knockdown of KIF5B or KIFC3 decreased long-term cell growth in MDA-MB-231 and especially in MDA-MB-436 cells as assessed by standard cell culture in the absence of DNA-damaging agents. *P < 0.05, ****P < 0.0001.
[0057] FIG. 5H shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5H shows the knockdown of KIF5B or KIFC3 decreased long-term cell growth in MDA-MB-231 and especially in MDA-MB-436 cells as assessed by colony assays in the absence of DNA-damaging agents. Data are shown as mean ± s.d., n = 3 biologically independent replicates; one-way ANOVA with Tukey’s multiple comparisons test.
[0058] FIG. 51 shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 51 shows images and quantifications of murine xenografts 39 days-post-inj ection showing KIF5B or KIFC3 knockdown restrains tumor formation by MDA-MB-436 cells. Data are shown as mean ± s.d., n = 5 mice per condition; two-way ANOVA with Tukey’s multiple comparisons test.
[0059] FIG. 5J shows the restraint of cancer via the modulation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 5J shows the general dsbNETs model. See description and FIG. 23 for details. DDR, DNA damage response kinases ATR, DNAPK, and ATM; ATAT1, a-tubulin acetyltransferase 1; MTs, microtubules acetylated at lysine 40 (AcK40) of a-tubulin; KIF5B and KIF13B, MT plus-end-directed kinesin-1 and kinesin-3; KIFC3, MT minus-end-directed kinesin-14; INM / ONM, inner / outer nuclear membrane; LMN, nuclear lamina; NPC, nuclear pore complex; LINC, linker of nucleoskeleton and cytoskeleton complex; ACT, nuclear actin filament; DSB, DNA double-strand break.
[0060] FIG. 6A shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules, in an exemplary embodimentof the disclosure. FIG. 6A shows schematics illustrating the major treatments in FIG. 1 (also see Example’s Methods).
[0061] FIG. 6B shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6B shows LMNB1 imaging, reconstruction, and measurement of tubule formation by calculating the ratio of the total LMNB1 surface area (boundary + tubular) divided by the total surface area of DAPI-marked DNA to reveal the LMNB1 tubules score. Scale bar, 3 pm. ETP, etoposide; NOC, nocodazole.
[0062] FIG. 6C shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6C shows representative images of LMNB1 signals in nuclei visualized three-dimensionally (left) and in two dimensions along XY, XZ, and YZ planes. Scale bar, 3 pm. U2OS cells were used; ETP, etoposide; NOC, nocodazole.
[0063] FIG. 6D shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6D shows representative two-dimensional planes from nuclei that are negative (top) or positive (bottom) for LMNB1 -tubules. Such planes were used to calculate the percentage of cells with tubules, their width, and the number of tubules crossing the nuclear mid-plane. Scale bars, 3 pm (top), 5 pm (bottom). ETP, etoposide.
[0064] FIG. 6E shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules, in an exemplary embodiment of the disclosure. FIG. 6E shows schematics illustrating tubular versus other nuclear envelope invaginations.
[0065] FIG. 6F shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6F shows quantifications of the number of tubules crossing the nuclear mid-plane showing etoposide-induced intranuclear LMNB1 tubules and their reversal upon removing the drug (wash) or their prevention by nocodazole. U2OS cells were used; ETP, etoposide; NOC, nocodazole; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0066] FIG. 6G shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6G shows the effect of nocodazole on LMNB1 tubules as assessed by the percentage of tubules-positive cells. Nocodazole pre-treatment prevented etoposide from inducing tubules whether nocodazole was kept in or removed from the media before adding etoposide. ETP, etoposide; NOC, nocodazole; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0067] FIG. 6H shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6H shows the effect of nocodazole on LMNB1 tubules as assessed by tubular width. ETP, etoposide; NOC, nocodazole; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0068] FIG. 61 shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 61 shows cell cycle stage profiling of cells subjected to the indicated treatments. No changes were detected within the short timeframe of these experiments. ETP, etoposide; NOC, nocodazole; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0069] FIG. 6J shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6J shows representative images and quantification from live cells showing the induction of SIR-tubulin (SRT)-stained microtubules displacing chromatin (arrows) following etoposide treatment, their reversal upon etoposide removal, and their prevention by nocodazole. ETP, etoposide; NOC, nocodazole; MTs, microtubules; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0070] FIG. 6K shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplaryembodiment of the disclosure. FIG. 6K shows fixed cell immunofluorescence showing etoposide-induced endogenous Tubulin (TUB)-positive filaments infiltrating chromatin (arrows) are prevented by pre-treatment with nocodazole. Scale bars, 7 pm (left) or 3.5 pm (right). U2OS cells were used; ETP, etoposide; NOC, nocodazole; MTs, microtubules.
[0071] FIG. 6L shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6L shows time-lapse microscopy of LMNB1 and the microtubule plus-end-tracking protein EB1 highlighting growing microtubule plus ends within a growing LMNB1 tubule (arrows). The EB1 filaments disappeared before LMNB1 tubule reversal. Imaging was initiated immediately following a 1 h ETP treatment in the presence of the drug. Insets show contrasted magnifications of the EB1 -marked LMNB1 tubules, facilitating visualization. Scale bar, 5 pm.
[0072] FIG. 6M shows experimental approaches and characterization of etoposide- induced LMNB1 tubules and their dependence on microtubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 6M shows the effects of nocodazole and vinblastine on etoposide-induced LMNB1 tubules. ETP, etoposide; NOC, nocodazole; VNBL, Vinblastine; Data are shown as the mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0073] FIG. 7A shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7A shows representative images of 53BP1 foci association with etoposide-induced LMNB1 tubules. Scale bars, 3 pm (left) and 1 pm (right).
[0074] FIG. 7B shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7B shows coimmunoprecipitation demonstrating etoposide-induced interactions between endogenous 53BP1 and LMNB1.
[0075] FIG. 7C shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7C shows representative timelapse images and quantifications indicating the faster resolution of 53BP1 foci associated with LMNB1 tubules (two left most arrows) compared to non-tubule-associated foci (two right most arrows). Cells were treated with ETP for 1 h, subjected to a 1 h wash, and then imaged. Scalebar, 5 m. Data are shown as the mean; n = 8 foci per type and timepoint from 4 independent biological replicates; multiple unpaired / -tests with Welch’s correction (above graph) and two- tailed Wilcoxon matched-pairs signed rank test (next to braket right of graph).
[0076] FIG. 7D shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7D shows live-cell time-lapse imaging demonstrating the natural reversal of an etoposide-induced LMNB1 tubule (arrow) in the presence of the drug. Note the chromatin changes surrounding the LMNB1 tubule as it reverses. Scale bar, 3 pm.
[0077] FIG. 7E shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7E shows treatment with the microtubule polymerization inhibitors nocodazole (NOC) or vinblastine (VINBL) induces 53BP1 foci further in the presence of etoposide. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0078] FIG. 7F shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7F shows representative images of RAD51 foci associated with etoposide-induced LMNB1 tubules. Scale bars, 2 pm.
[0079] FIG. 7G shows expanded characterization of LMNB1 tubules-DSB links, in an exemplary embodiment of the disclosure. FIG. 7G shows STRING network analysis indicating connections between nuclear envelope components (top), kinesins (bottom), and the major DDR kinases ATM, ATR, and DNAPK (right). Shown is a full STRING network including physical and functional evidence with the thickness of connections reflecting the associated level of confidence.
[0080] FIG. 7H shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7H shows immunoblots confirming the induction of ' / H2AX in etoposide-treated cells. Vinculin served as a loading control.
[0081] FIG. 71 shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 71 shows Immunoblots confirming the activation of the DDR kinases ATR (pCHKl), ATM (pCHK2), and DNAPK(pDNAPK) by etoposide and the inhibition of the activation using DDR kinase inhibitors (ATRi, ATMi, or DNAPKi).
[0082] FIG. 7 J shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7 J shows the effect of knocking down various DNA repair factors on baseline and etoposide-induced LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0083] FIG. 7K shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7K shows the effect of knocking down various DNA repair factors on baseline and etoposide-induced LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0084] FIG. 7L shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7L shows immunoblots confirming the knockdown of KU70.
[0085] FIG. 7M shows expanded characterization of LMNB1 tubules-DSB links in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 7M shows immunoblots confirming the effect of knocking down NBS1, RAD50, and RNF8.
[0086] FIG. 8A shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8A shows levels of ' / H2AX in U2OS cells treated with etoposide at the indicated concentrations. Data are shown as mean ± s.d.; n = 4 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0087] FIG. 8B shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8B shows levels of LMNB1 tubules in U2OS cells treated with etoposide at the indicated concentrations. Data are shown as mean ± s.d.; n = 4 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0088] FIG. 8C shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8C shows representative images in HeLa and IMR90 cells. Scale bar, 5 pm.
[0089] FIG. 8D shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8D quantifications showed that etoposide induces LMNB1 tubules as assessed by the tubular score in the different cell types indicated. Data are shown as mean ± s.d.; n = 3 biologically independent replicates, two- tailed Mann-Whitney test.
[0090] FIG. 8E shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8E quantifications showed that etoposide induces LMNB1 tubules as assessed by the number of tubules crossing the nuclear midplane in the different cell types indicated. Data are shown as mean ± s.d.; n = 3 biologically independent replicates, two-tailed unpaired Etest.
[0091] FIG. 8F shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8F quantifications showed that etoposide induces LMNB1 tubules as assessed by the tubular width in the indicated cell lines. Data are shown as mean ± s.d.; n = 3 biologically independent replicates, two-tailed Mann- Whitney test.
[0092] FIG. 8G shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8G shows quantification of total 53BP1 levels and LMNB1 tubules in cells treated with the DNA damaging agent etoposide, microtubule inhibitor nocodazole (NOC), CDK / transcription-inhibiting flavopiridol (FVP), or proteasome inhibitor MG132. Data are shown as mean ± s.d.; n = 3 biologically independent replicates, one-way ANOVA with Sidak’s multiple comparisons test.
[0093] FIG. 8H shows induction of LMNB1 tubules under different experimental conditions, in an exemplary embodiment of the disclosure. FIG. 8H shows quantification of total 53BP1 levels and LMNB1 tubules in cells treated with the DNA damaging agent etoposide, microtubule inhibitor nocodazole (NOC), CDK / transcription-inhibiting flavopiridol (FVP), or proteasome inhibitor MG132. Data are shown as mean ± s.d.; n = 3 biologically independent replicates each with three technical replicates, one-way ANOVA with Sidak’s multiple comparisons test.
[0094] FIG. 9A shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9A shows immunoblots confirming the knockdown of SUN1, SUN2, NUP153, NUP98, KIF5B, and KIFC3 using small-interfering RNAs (siRNA). Actin served as loading control.
[0095] FIG. 9B shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9B shows representative images from proximity ligation assays (PLA) evaluating the effect of etoposide treatment on the proximity of 53BP1 to LMNB1 or SUN1. Nuclear PLA signals are quantified in FIG. 2C, and intemal / boundary PLA ratios are shown here. Scale bar, 5 pm.
[0096] FIG. 9C shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9C shows immunofluorescence analysis. Data are shown as the mean ± s.d.; n = 3, two-tailed unpaired / -test.
[0097] FIG. 9D shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9D shows immunofluorescence analysis showing that NUP153 knockdown does not alter SUN1 levels. Data are shown as the mean ± s.d.; n = 3, two-way ANOVA with Dunnett’s multiple comparisons test.
[0098] FIG. 9E shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9E shows immunofluorescence analysis demonstrating that NUP 153 knockdown does not alter SUN1 localization. Scale bars, 5 pm.
[0099] FIG. 9F shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9F shows immunofluorescence-based quantifications confirming NUP50 knockdown. Data are shown as the mean ± s.d.; n =, two-tailed unpaired / -test.
[0100] FIG. 9G shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9G shows effect of NUP50 on the formation of LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3, two-way ANOVA with Sidak’s multiple comparisons test.
[0101] FIG. 9H shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9H shows immunofluorescence-based quantifications confirming LMNB1 knockdown. Data are shown as the mean ± s.d.; n = 3, two-tailed unpaired / -test.
[0102] FIG. 91 shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 91 shows effect of LMNB1 on the formation of tubules as marked by an antibody for LMNA / C. Scale bars, 10 pm; data are shown as the mean ± s.d.; n = 3, two-way ANOVA with Sidak’s multiple comparisons test.
[0103] FIG. 9 J shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9J shows immunoblots confirming the expression of exogenous wild-type and mutant KIF5B.
[0104] FIG. 9K shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9K shows representative images showing the localization of LMNB1 together with wild-type or mutant KIF5B. Tubules were observed in etoposide-treated cells expressing wild-type but not mutant KIF5B. Wild-type KIF5B localized to the LMNB1 tubules (arrows).
[0105] FIG. 9L shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9L shows quantification of etoposide-dependent LMNB1 tubules formation (left) and 53BP1 foci (right) in cells expressing wild-type or mutant KIF5B. Data are shown as the mean ± s.d.; n = 3; two-way ANOVA with Sidak’s multiple comparisons test. Scale bar, 5 pm.
[0106] FIG. 9M shows controls related to the characterization of factors modulating nuclear envelope tubules in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 9M shows representative images of a-Tubulin-positive LMNB1 tubules (arrows) and quantifications showing the effect of DDR kinase inhibitors on the ability of etoposide to induce LMNB1 tubules. ETP-dependent percent changes are shown in the first row of percentages right above the bars, and DDR kinase inhibitor-dependent percent changes to the induction compared to control (CTL) are shown in the upper row of percentages above the bars; data are shown as the mean ± s.d.; n = 3 biologically independent replicates each with two technical replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0107] FIG. 10A shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10A shows Immunoblots showing the effect of etoposide, etoposide removal (ETP + wash), and AT ATI knockdown on the levels of Ac-aTub and aTub with vinculin control.
[0108] FIG. 10B shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10B shows RT-qPCR-based confirmation of the knockdown of indicated factors. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0109] FIG. 10C shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10C shows knockdown of the indicated factors did not alter the distribution of cells in the cell cycle. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0110] FIG. 10D shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10D shows quantification and representative images from neutral comet assays demonstrating that the knockdown of AT ATI, KIF5B, or NUP153 increases the levels of ETP-induced DNA damage and decreases the rate of DNA repair. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test. Scale bar, 100 pm.
[0111] FIG. 10E shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10E shows quantification of 53BP1 foci numbers over time demonstrating that SUN1 knockdown increases the number of etoposide- induced DNA damage foci and decreases the rate of DNA repair. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0112] FIG. 10F shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10F shows quantification of 53BP1 foci sizesover time demonstrating that SUN1 knockdown increases the size of etoposide-induced DNA damage foci at the 6 h wash timepoint. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with Sidak’s multiple comparisons test.
[0113] FIG. 10G shows controls related to the characterization of factors modulating nuclear envelope tubules, repair kinetics, and repair foci behaviors in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 10G shows a scatter plot comparing 53BP1 foci number (Nb.) and size (S) distribution in control and SUN1 knockdown cells for the ETP+wash (6h) condition with means shown in the table above. Data are mean ± s.d.; n = 3 biologically independent replicates, two-way ANOVA with multiple comparisons test.
[0114] FIG. 11A shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11 A shows schematic illustrating the ER-mCherry-LacI-Fokl-DD (Fokl-DSB) reporter system.
[0115] FIG. 11B shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 1 IB shows colocalization of the induced Fokl-DSB with 53BP1. Arrows show colocalizing Fokl-DSB and 53BP1 foci, respectively. Scale bar, 10 pm.
[0116] FIG. 11C shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11C shows chromatin immunoprecipitation indicating the enrichment of 53BP1 at the induced Fokl-DSB site. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; one-way ANOVA with Sidak’s multiple comparisons test.
[0117] FIG. 11D shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11D shows phosphorylated CHK2 (pCHK2) immunoblotting confirming that Fokl-DSB induction or treatment with the drug enoxacin (ENO) induces the DNA damage response. Vinculin served as loading control.
[0118] FIG. HE shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. HE shows Confirmation of siRNA-mediated protein knockdowns usingimmunofluorescence. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-tailed unpaired / -test with Welch’s correction.
[0119] FIG. 11F shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 1 IF shows Knockdown of SUN1 or SUN2 decreased the percentage of tubulepositive cells following Fokl-DSB induction. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0120] FIG. 11G shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11G shows the effect of disrupting LINC, NPC, or kinesin proteins on LMNB1 tubular diameter following Fokl-DSB activation. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0121] FIG. 11H shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11H shows the disruption of LINC, NPC, or kinesin proteins linked to dsbNET formation increases the distance between the Fokl-DSB and nuclear edge. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Dunnett’s multiple comparisons test.
[0122] FIG. Ill shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. Ill shows cell cycle stage profding of cells following the knockdown of indicated factors. No statistically significant changes were detected within the short timeframe of these experiments. Data are shown as the mean ± s.d.; n = 4 biologically independent replicates; two-way ANOVA with Dunnett’s multiple comparisons test.
[0123] FIG. 11J shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 11J shows treatment with the histone deacetylase inhibitor SAHA is not redundant with SUN1 knockdown in terms of increasing the distance between Fokl-DSB and the nuclear edge. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0124] FIG. 11K shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. UK confirms the disruption of actin using the drug Latrunculin-B (LATB). Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Sidak’s multiple comparisons test.
[0125] FIG. 11L shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 11L confirms the disruption of actin using the drug Latrunculin-B (LATB). Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-tailed Mann Whitney test.
[0126] FIG. 11M shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 11M shows that disrupting actin partly disrupts the ability of etoposide to induce LMNB1 tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0127] FIG. UN shows additional controls related to targeted DSB induction, tubule formation, damage capture, and actin in U2OS cells, in an exemplary embodiment of the disclosure. FIG. UN shows the expression of the nuclear actin-disrupting NLS-Actin-R62D, but not the control NLS-Actin, partially repressed etoposide-induced tubules. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0128] FIG. 12A shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. Visualizing one end of the Fokl-DSB using sgRNAs (sgDSB) and GFP-dCas9 confirmed that the long and split Fokl- DSB shapes represent less connected DSB ends. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates each with three technical replicates, two-way ANOVA with multiple comparisons test.
[0129] FIG. 12B shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12B shows immunoblots confirming the similar expression of GFP-dCas9 in cells with Fokl-DSB- targeting sgRNAs (sgDSB) or non-targeting sgRNA (sgNT) control.
[0130] FIG. 12C shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12C shows the knockdown of the DSB ends-tethering NBS1 or RAD50, but not treatment with the silent chromatin-disrupting and histone deacetylase inhibitor SAHA, increases the percentage of cells with a split DSB. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates each with two technical replicates, two-way ANOVA with Dunnett’s multiple comparisons test.
[0131] FIG. 12D shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12D shows ChIP indicating that the knockdown of SUN1 or KIF5B decreases the ability of etoposide to induce the enrichment of the DSB end-tethering factor XRCC4 at the Fokl-DSB site. 2-6-5 cells were used; data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0132] FIG. 12E shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12E shows XRCC4 levels are stable following the knockdown of SUN1 or KIF5B.
[0133] FIG. 12F shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12F shows Enoxacin enlarges the 53BP1 focus surrounding the Fokl-DSB. Scale bar, 1 pm.
[0134] FIG. 12G shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12G shows Enoxacin enlarges the 53BP1 focus surrounding the Fokl-DSB. Data are shown as the mean ± s.d.; n = 3 biologically independent replicates; two-tailed Mann-Whitney test.
[0135] FIG. 12H shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 12H shows Enoxacin enlarges and fully restores the colocalization of the Fokl-DSB with 53BP1. Data are shown as the mean ± s.d.; \n = 3 biologically independent replicates; two-way ANOVA with Dunnett’s multiple comparisons test.
[0136] FIG. 121 shows additional controls related to DSB end tethering and DNA repair in 2-6-5 cells, in an exemplary embodiment of the disclosure. FIG. 121 shows the effectof LINC protein knockdowns and enoxacin treatment on LMNB1 tubular diameter in cells without or with Fokl-DSB activation. Data from FIG. 11G are reshown here as they were part of the same experiments and for comparison. Data are shown as the mean ± s.d; n = 3 biologically independent; two-way ANOVA with Sidak’s multiple comparisons test.
[0137] FIG. 12J shows additional controls related to DSB end tethering and DNA repair in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 12J shows the knockdown of KIF5B or SUN1 decreased DNA repair as assessed using a chromosomally- integrated HR reporter. The knockdown of BRCA1 served as positive control. Data are shown as the mean ± s.d.; n = 9 (siCTL, siKIF5B) or n = 6 (siBRCAl) biologically independent replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0138] FIG. 12K shows additional controls related to DSB end tethering and DNA repair in U2OS cells, in an exemplary embodiment of the disclosure. FIG. 12K shows the knockdown of KIF5B or SUN1 decreased DNA repair as assessed using a chromosomally- integrated NHEJ reporter. The knockdown of XRCC4 served as positive control. Data are shown as the mean ± s.d.; n = 3 technical replicates; two-way ANOVA with Tukey’s multiple comparisons test.
[0139] FIG. 13 A shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13 A shows SUN1 protein schematic indicating the N- terminal lamina / chromatin-binding domain (left) and the C-terminal SUN domain (right). Also shown are the confirmed post-translational modification sites of SUN1 from the UniProtein (middle) and PhosphoSite (bottom) databases.
[0140] FIG. 13B shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13B shows immunoblot showing decreased endogenous SUN1 protein levels upon siRNA-mediated knockdown.
[0141] FIG. 13C shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13C shows immunoblot demonstrating expression of the various SUN1 and control chimeric fusion proteins. Proteins of expected sizes are below the asterisks.
[0142] FIG. 13D shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13D shows schematic of fusion proteins used, their ability to localize to the tubules and associate with the Fokl-DSB. ONM, outer nuclear membrane; INM, inner nuclear membrane; LMN, nuclear lamina.
[0143] FIG. 13E shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13E shows immunoblot demonstrating the decreased levels of all endogenous SUN1 forms following siRNA-mediated knockdown.
[0144] FIG. 13F shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13F shows immunoblots of endogenous SUN1 proteins from vehicle or etoposide-treated cells.
[0145] FIG. 13G shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13G shows immunoblots of endogenous SUN2 proteins from vehicle or etoposide-treated cells.
[0146] FIG. 13H shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 13H shows etoposide treatment increases the phosphoserine signal co-immunoprecipitating with SUN1 (SUN1 IP). The blots in FIG. 13H and FIG. 131 are part of the same experiment.
[0147] FIG. 131 shows chimeric SUN1 fusion protein constructs and changes to the expression of endogenous SUN1 and SUN2 following etoposide treatment, in an exemplary embodiment of the disclosure. FIG. 131 shows etoposide treatment does not increase the ubiquitin signal co-immunoprecipitating with SUN1 (SUN1 IP).
[0148] FIG. 14A shows the tubulin code responding to etoposide treatment and recovery, in an exemplary embodiment of the disclosure. FIG. 14A shows representative Western immunoblots of acetylated, detyrosinated, tyrosinated and polyglutamylated tubulinlevels at various timepoints of etoposide (lOOpM) treatment in U2OS cells. yH2Ax was used as a marker of DNA damage induction.
[0149] FIG. 14B shows the tubulin code responding to etoposide treatment and recovery, in an exemplary embodiment of the disclosure. FIG. 14B shows quantifications of acetylated, detyrosinated, tyrosinated and polyglutamylated tubulin levels at various timepoints of etoposide (lOOpM) treatment in U2OS cells. yH2Ax was used as a marker of DNA damage induction. Quantifications were normalized to alpha tubulin. N=3 biologically independent replicates, one-way ANOVA with Tukey’s multiple comparisons test.
[0150] FIG. 14C shows the tubulin code responding to etoposide treatment and recovery, in an exemplary embodiment of the disclosure. FIG. 14C shows representative Western immunoblots of acetylated, detyrosinated and polyglutamylated tubulin levels at various timepoints post-l hour-etoposide (lOOpM) treatment in U2OS cells.
[0151] FIG. 14D shows the tubulin code responding to etoposide treatment and recovery, in an exemplary embodiment of the disclosure. FIG. 14D shows quantification of acetylated, detyrosinated and polyglutamylated tubulin levels at various timepoints post-1 hour-etoposide (lOOpM) treatment in U2OS cells. Quantifications were normalized to alpha tubulin. N=3 biologically independent replicates, one-way ANOVA with Tukey’s multiple comparisons test.
[0152] FIG. 15A shows irradiation and zeocin treatment inducing changes in the tubulin code and inducing nuclear envelope tubules, in an exemplary embodiment of the disclosure. FIG. 15A shows percent dsbNETs positive U2OS cells and 53BP1 foci number upon vehicle (DMSO) or 1 hr zeocin (400pg / mL) treatment (Zeo) and 2 hr post-zeocin wash (Wash). N=3 biologically independent replicates, one-way ANOVA with Tukey’s multiple comparisons test.
[0153] FIG. 15B shows irradiation and zeocin treatment inducing changes in the tubulin code and inducing nuclear envelope tubules, in an exemplary embodiment of the disclosure. FIG. 15B shows representative Western immunoblots of acetylated, detyrosinated, tyrosinated and polyglutamylated tubulin levels at various timepoints of zeocin (400pg / mL) treatment in U2OS cells. yH2Ax was used as a marker of DNA damage induction.
[0154] FIG. 15C shows irradiation and zeocin treatment inducing changes in the tubulin code and inducing nuclear envelope tubules, in an exemplary embodiment of the disclosure. FIG. 15C shows quantifications of acetylated, detyrosinated, tyrosinated and polyglutamylated tubulin levels at various timepoints of zeocin (400pg / mL) treatment in U2OS cells. yH2Ax was used as a marker of DNA damage induction. Quantifications were normalized to alpha tubulin. N=3 biologically independent replicates, one-way ANOVA with Tukey’s multiple comparisons test.
[0155] FIG. 15D shows irradiation and zeocin treatment inducing changes in the tubulin code and inducing nuclear envelope tubules, in an exemplary embodiment of the disclosure. FIG. 15D shows percent dsbNETs positive U2OS cells (left) and 53BP1 foci number (right) 1 hr and 6 hr post irradiation. N=3 biologically independent replicates, one-way ANOVA with Tukey’s multiple comparisons test.
[0156] FIG. 15E shows irradiation and zeocin treatment inducing changes in the tubulin code and inducing nuclear envelope tubules, in an exemplary embodiment of the disclosure. FIG. 15E shows representative Western immunoblots of acetylated tubulin levels 1 hr and 6 hr post 5 Gy irradiation (IR) in U2OS cells. Two replicates are shown.
[0157] FIG. 16A shows detyrosinated microtubules localizing to nuclear envelope tubules and are required for dsbNETs formation, in an exemplary embodiment of the disclosure. FIG. 16A shows representative images of detyrosinated microtubules colocalizing with laminBl -marked nuclear envelope tubules in etoposide treated U2OS cells. Colocalizations are highlighted with white arrowheads. Scale bar = 10pm.
[0158] FIG. 16B shows detyrosinated microtubules localizing to nuclear envelope tubules and are required for dsbNETs formation, in an exemplary embodiment of the disclosure. FIG. 16B shows quantification of etoposide-induced nuclear envelope tubules that colocalize with acetylated and detyrosinated microtubules (MT) in U2OS cells. N=3 biologically independent experiments, two-sided t-test.
[0159] FIG. 16C shows detyrosinated microtubules localizing to nuclear envelope tubules and are required for dsbNETs formation, in an exemplary embodiment of the disclosure. FIG. 16C shows representative Western immunoblots of acetylated and detyrosinated tubulin in U2OS cells pre-treated with vehicle (DMSO) or EPOY (20pM, 3 hrs) before etoposide (ETP) treatment (lOOpM, 1 hr).
[0160] FIG. 16D shows detyrosinated microtubules localizing to nuclear envelope tubules and are required for dsbNETs formation, in an exemplary embodiment of the disclosure. FIG. 16D shows percentage of dsbNETs positive U2OS cells and 53BP1 foci number in vehicle and EPOY pre-treatment conditions. N=3 biologically independent experiments, one-way ANOVA with Tukey’s multiple comparisons test.
[0161] FIG. 17A shows ATAT1 interacting with DNAPKcs, in an exemplary embodiment of the disclosure. FIG. 17A shows a volcano plot of the Log2 fold change of GFP- ATATl / GFP-Ctl. ATAT1 and PRKDC (DNAPKcs) are highlighted on the plots. The vertical FC bars represent the Log2 Fold change of + / - 2. The horizontal q=0.01 bar represents a False Discovery Rate (FDR) of 0.01. Multiple unpaired t-tests with the Benjamini, Krieger, and Yekutieli method.
[0162] FIG. 17B shows ATAT1 interacting with DNAPKcs, in an exemplary embodiment of the disclosure. FIG. 17B shows the difference between the mean spectral counts of GFP-ATAT1 minus GFP-Ctl. AT ATI and PRKDC (DNAPKcs) are highlighted on the plots. Multiple unpaired t-tests with the Benjamini, Krieger, and Yekutieli method.
[0163] FIG. 17C shows ATAT1 interacting with DNAPKcs, in an exemplary embodiment of the disclosure. FIG. 17C show representative Western immunoblots of coimmunoprecipitation of GFP-ATAT1 and DNAPKcs in HEK293T cells transfected with GFP vector or GFP-ATAT1 treated with vehicle (DMSO) or etoposide (ETP, 100 pM 1 hr).
[0164] FIG. 18A shows KIF5B or KIFC3 coexpression with DDR genes and DNA repair pathway signatures across cancers, in an exemplary embodiment of the disclosure. FIG. 18A shows a heatmap illustrating unsupervised hierarchical clustering of Pearson correlation coefficients (PCCs) between KIFC3 or KIF5B expression and the indicated genes coding for NHEJ factors (TP53BP1,XRCC5,XRCC4) or LMNB1 (a), across cancer types (tumor numbers are shown; BRCA, breast cancer; see Table 1 for full cancer names). Nominal significant PCCs are indicated by asterisks (inset).
[0165] FIG. 18B shows KIF5B or KIFC3 coexpression with DDR genes and DNA repair pathway signatures across cancers, in an exemplary embodiment of the disclosure. FIG. 18B shows heatmap illustrating unsupervised hierarchical clustering of PCCs between KIFC3 or KIF5B expression and the indicated genes coding for proteins representing different DNA repair pathways (NHEJ: TP53BP1,XRCC&, HR: RAD51, RBBP8. altEJ: POLQ, LIG3), acrosscancer types (tumor numbers are shown; BRCA, breast cancer; see Table 1 for full cancer names). Nominal significant PCCs are indicated by asterisks (inset).
[0166] FIG. 18C shows KIF5B or KIFC3 coexpression with DDR genes and DNA repair pathway signatures across cancers, in an exemplary embodiment of the disclosure. FIG. 18C shows forest plots of KIFC3 or KIF5B coexpression analysis against the NHEJ signature. Significant negative and positive PCCs are depicted in filled squares. Non-filled squares are not statistically significant.
[0167] FIG. 18D shows KIF5B or KIFC3 coexpression with DDR genes and DNA repair pathway signatures across cancers, in an exemplary embodiment of the disclosure. FIG. 18D shows forest plots of KIFC3 or KIF5B coexpression analysis against HR signature. Significant negative and positive PCCs are depicted in filled squares. Non-filled squares are not statistically significant.
[0168] FIG. 18E shows KIF5B or KIFC3 coexpression with DDR genes and DNA repair pathway signatures across cancers, in an exemplary embodiment of the disclosure. FIG. 18E shows forest plots of KIFC3 or KIF5B coexpression analysis against the altEJ signature. Significant negative and positive PCCs are depicted in filled squares. Non-filled squares are not statistically significant.
[0169] FIG. 19A shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19A shows human breast cancer cases exhibit nuclear grooves. Representative images of cases of human breast carcinoma with indicated mutations were from The Cancer Genome Atlas (TCGA). Arrows highlight nuclear grooves reminiscent of nuclear envelope tubules uncovered herein in cell culture.
[0170] FIG. 19B shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19B shows quantification indicating the number of grooves per nucleus in different human breast cancer cases (n = 10 cases for each of the BRCA1 and BRCA2 mutants).
[0171] FIG. 19C shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19C shows immunoblots confirming the knockdown of BRCA1 in MDA-MB-231 TNBC cells.
[0172] FIG. 19D shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19D shows immunoblots confirming the knockdown of KIF5B in MDA-MB-231 or MDA-MB-436 TNBC cells.
[0173] FIG. 19E shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19E shows immunoblots confirm the knockdown of KIFC3 in MDA-MB-231 or MDA-MB-436 TNBC cells.
[0174] FIG. 19F shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19F shows the effects of KIF5B or KIFC3 knockdown on LMNB1 tubules in MDA-MB-231 (231) or MDA-MB-436 (436) cells treated with etoposide (ETP, 100 pM, 1 h) or olaparib (PARPi, 2 pM, 24 h). Data are shown as mean ± s.d., n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0175] FIG. 19G shows that tumor sections from breast cancer patients exhibit nuclear tubules and also shows the analysis of dsbNETs and DSBs in etoposide- or olaparib-treated breast cancer cells, in an exemplary embodiment of the disclosure. FIG. 19G shows effects of KIF5B or KIFC3 knockdown on 53BP1 foci number in MDA-MB-231 (231) or MDA-MB- 436 (436) cells treated with etoposide (ETP, 100 pM, 1 h) or olaparib (PARPi, 2 pM, 24 h). Data are shown as mean ± s.d., n = 3 biologically independent replicates, two-way ANOVA with Tukey’s multiple comparisons test.
[0176] FIG. 20A shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20A shows representative images and quantifications showing the effect ofKIF5B or KIFC3 knockdown on the levels of misjoined chromosome structures in MDA-MB- 436 cells treated with vehicle or PARPi (2 pM, 16 h). Shown is the mean ± s.d., n = 50 metaphase spreads per condition. Two-way ANOVA with Tukey’s multiple comparisons test.
[0177] FIG. 20B shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20B shows quantifications and representative images showing the effect of KIF5B or KIFC3 knockdown on the level of senescence-associated P-galactosidase (SA-|3- GAL) in MDA-MB-436 cells. Shown is the mean ± s.d., n = 3 biologically independent replicates. Scale bar, 100 pm. Two-way ANOVA with Tukey’s multiple comparisons test.
[0178] FIG. 20C shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20C shows the effect of KIF5B or KIFC3 knockdown on MDA-MB-436 xenograft tumors in terms of volumetric growth. Shown is the mean ± s.d., n = 5 mice per knockdown. Two-tailed paired / -test.
[0179] FIG. 20D shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20D shows the effect of KIF5B or KIFC3 knockdown on MDA-MB-436 xenograft tumors in terms of the end-point tumor mass. Shown is the mean ± s.d., n = 5 mice per knockdown. Unpaired / -test.
[0180] FIG. 20E shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20E shows synthetic lethality effect or score (mean ± s.d.) for the indicated genes when combined with BRCA1 wild-type (n = 68) or mutant (n = 8) breast and ovarian cancer cell lines. CRISPR screen data were accessed via DepMap. Two-tailed Mann-Whitney test.
[0181] FIG. 20F shows cancer-related analyses of chromosomes, senescence, and growth, and the assessment of the DSB-Progerin link, in an exemplary embodiment of the disclosure. FIG. 20F shows the effect of expressing LMNA or the premature aging-causing Progerin on LMNB1 tubule formation and the number of 53BPl-marked DSBs in the absence or presence of etoposide (100 pM, 1 h) in U2OS cells. Two-way ANOVA with Sidak’s multiple comparisons test.
[0182] FIG. 21A shows pan-cancer ATAT1 and acetylated tubulin expression, in an exemplary embodiment of the disclosure. FIG. 21A shows Kaplan-Meier plots of survival probability based on AT ATI mRNA expression (top) and acetylated tubulin protein expression (below) from the TCGA Pan-Cancer (PANCAN) cohort visualized using Xenabrowser. High expression is the lower line on each graph.
[0183] FIG. 21B shows pan-cancer ATAT1 and acetylated tubulin expression, in an exemplary embodiment of the disclosure. FIG. 21B shows ATAT1 mRNA expression and acetylated tubulin protein expression across cancers in the TCGA PANCAN cohort visualized using Xenabrowser. Cancer types shown on the graph from bottom to top axis are indicated at the top of each graph from left to right.
[0184] FIG. 21C shows pan-cancer ATAT1 and acetylated tubulin expression, in an exemplary embodiment of the disclosure. FIG. 21C shows pharmacogenomics analysis of ATAT1 gene expression vs. drug response with p < 0.05 in breast cancer cell lines. Data were obtained from the Broad Institute’s Cancer Therapeutics Response Portal.
[0185] FIG. 22A shows ATAT1 inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22A shows percentage of dsbNETs positive U2OS cells pre-treated with predicted ATAT1 inhibitors. Cells were pre-treated with the drugs for 24 hrs before 1 hr 100 pM etoposide (ETP) treatment (dark bars).
[0186] FIG. 22B shows AT ATI inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22B shows a representative Western immunoblot of acetylated tubulin levels (top) of U2OS cells treated with the candidate AT ATI inhibitors for 24 hr. 1 = Methotrexate, 2 = Folic acid, 3 = Mangafodipir, 4 = Pralatrexate, 5 = Copanlisib, 6 = Hesperidin, 7 = Pemetrexed.
[0187] FIG. 22C shows ATAT1 inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22C shows a representative Western immunoblot of acetylated tubulin level (top) of U2OS cells pre-treated with vehicle (DMSO) or varying concentrations of Mangafodipir for 24 hrs, before 1-hr treatment with vehicle (DMSO) or lOOpM etoposide (ETP).
[0188] FIG. 22D shows ATAT1 inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22D shows quantification of acetylatedtubulin level of U20S cells pre-treated with vehicle (DMSO) or 50 pM Mangafodipir for 24 hrs, before 1-hr treatment with vehicle (DMSO) or lOOpM etoposide (ETP).
[0189] FIG. 22E shows AT ATI inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22E shows percentage of dsbNETs positive cells and 53BP1 foci number in cells pre-treated with 50 pM Mangafodipir for 24 hrs before 1-hr etoposide treatment.
[0190] FIG. 22F shows AT ATI inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22F shows representative Western immunoblots of acetylated tubulin levels of cells pre-treated with various concentrations of Ceftolozane for 24 hrs before etoposide treatment.
[0191] FIG. 22G shows AT ATI inhibitors that impair the formation of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 22G shows representative Western immunoblots of acetylated tubulin levels of cells pre-treated with various concentrations of Latrunculin B for 1 hr before etoposide treatment.
[0192] FIG. 23A shows model for the formation, structure, and function of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 23A shows that upon the induction of endogenous or exogenous DNA damage, the DDR signaling kinases ATM, DNAPK, and ATR intersect with ATAT1 -dependent acetylation of aTubulin on lysine 40 (K40) within the lumen of microtubule filaments, especially near the tips of the tubules. The modified microtubules better cooperate with plus-end-directed kinesin-1 KIF5B and kinesin-3 KIF13B, LINC proteins SUN1 and SUN2, and NPC basket components NUP153 and NUP50. This allows the microtubules to stably push onto the cytoplasmic face of the nuclear envelope, delivering it via the resulting nucleus-infiltrating tubules, or dsbNETs, to DSBs throughout nuclear space. The dsbNETs associate with DSBs away from or onto nuclear actin filaments, which partly promote dsbNETs-DSB association and partially stabilize the tubules. The dsbNETs are transient, and their reversal is mediated by the microtubule minus-end-directed kinesin-14 KIFC3. The dsbNETs can bring the nuclear envelope and its resident proteins to DSBs located within the nucleus, providing the nuclear envelope-dependent support necessary to reconnect the ends of a DSB to each other. The dsbNETs can also shorten the distance DSBs travel in a random or directed manner to access the nuclear envelope.
[0193] FIG. 23B shows model for the formation, structure, and function of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 23B shows that under standard conditions, dsbNETs promote accurate DSB repair, limiting chromosome defects and ensuring cell survival.
[0194] FIG. 23C shows model for the formation, structure, and function of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 23 C shows that in BRCA1 -deficient breast cancer cells treated with PARPi, the capacity of these life-saving drugs to kill cancer cells is mediated in part by dsbNETs.
[0195] FIG. 23D shows model for the formation, structure, and function of dsbNETs, in an exemplary embodiment of the disclosure. FIG. 23D shows the expression of the HGPS- causing Progerin is sufficient to increase DSB and dsbNET levels, which can be further increased upon exposure to the genotoxic agent etoposide.DETAILED DESCRIPTIONI, Definitions
[0196] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art.
[0197] In understanding the scope of the present disclosure, the term “comprising” and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The foregoing also applies to words having similar meanings such as the terms, “including”, “having” and their derivatives. The term “consisting” and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and / or steps, but exclude the presence of other unstated features, elements, components, groups, integers and / or steps. The term “consisting essentially of’, as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and / or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and / or steps.
[0198] Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±5% of the modified term if this deviation would not negate the meaning of the word it modifies.
[0199] As used in this disclosure, the singular forms “a”, “an” and “the” include plural references unless the content clearly dictates otherwise.
[0200] In embodiments comprising an “additional” or “second” component, the second component as used herein is chemically different from the other components or first component. A “third” component is different from the other, first, and second components, and further enumerated or “additional” components are similarly different.
[0201] The term “and / or” as used herein means that the listed items are present, or used, individually or in combination. In effect, this term means that “at least one of’ or “one or more” of the listed items is used or present.
[0202] The recitation of numerical ranges by endpoints herein includes all numbers and fractions subsumed within that range (e.g. 1 to 5 includes for example 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term “about”.
[0203] The term “DSB-capturing nuclear envelope tubules”, abbreviated dsbNETs, as used herein, refers to structures within human cell nuclei that facilitate the repair of DNA double-strand breaks (DSBs), crucial for maintaining genome stability and cell survival. Formed in response to DSBs through DNA damage response (DDR) signaling and microtubule cooperation, dsbNETs incorporate components of the nuclear envelope, including the inner and outer nuclear membranes and the nuclear lamina. These structures enable the efficient repair of DSBs by localizing the nuclear envelope to or near damaged DNA sites, a process vital for overcoming the limited mobility of human DSBs. Under non-disease states, dsbNETs is temporary in nature to promote DNA repair and not further increase the levels of DNA damage. However, when dsbNETs is excessively induced, i.e., where the weakened nuclear lamina and naturally increased DNA damage levels result in the hyper-increased induction of dsbNETs both in the absence and presence of other DNA damage sources, it can lead to pathology. As well, when dsbNETs is persistently induced, i.e., where the dsbNETs is induced but fail toreverse, this failure to reverse the dsbNETs can also induce DNA damage leading to pathology. The instant discovery of dsbNETs highlights the dynamic nature of the nuclear envelope in adapting to cellular needs for DNA repair, defining its role in disease and aging, and underscoring its critical function in genome integrity.
[0204] The term "dsbNETs regulator", as used herein, refers to any molecule, protein, or genetic element that influences the formation, function, or stability of dsbNETs. These regulators can either promote or impede the processes involved in dsbNETs dynamics, including their assembly around sites of DNA damage, interaction with DNA repair machinery, and subsequent disassembly after repair completion. dsbNETs regulators play crucial roles in maintaining genomic stability by ensuring efficient and accurate repair of DNA double-strand breaks through the proper functioning of dsbNETs. Their regulation is vital for cell survival, preventing genomic instability, which can lead to cancer and other diseases, and also impact on aging.
[0205] The term “dsbNETs modulator”, as used herein, refers to any agent that can affect the function of a dsbNETs regulator, including inhibiting or downregulating the function and / or activity of the dsbNETs regulator. A dsbNET modulator can be in the form of any intervening agent described herein, such as small molecules, agent involved in antisense techniques, CRISPR, and antibodies.
[0206] The term "dsbNETs-associated pathology", as used herein, refers to any condition or disease state that arises from, or is exacerbated by, abnormalities in the formation, regulation, or function of dsbNETs. This includes conditions where impaired dsbNETs activity leads to inefficient or incorrect DNA double-strand break (DSB) repair, resulting in abnormalities in the expression of or mutations in the dsbNETs regulators, genomic instability, accumulation of genetic mutations, and increased susceptibility to cancer and premature aging, other conditions or disorders related to defective cell growth and survival mechanisms, and other conditions or disorders related to defects in dsbNETs regulators. For example, cancer can involve ineffective or erroneous repair of DSBs due to dysfunctional dsbNETs, which could contribute to oncogenesis or cancer progression. In another example, cancer with background defects in oncogenes, tumor suppressor genes, or different DNA repair genes, can show increased dependence on dsbNETs for survival. In addition, compromised or excessivedsbNETs function can contribute to and / or accelerate cellular aging processes, influencing the onset of age-related pathologies.
[0207] The term "cancer", as used herein, refers to a broad group of diseases characterized by the uncontrolled growth and spread of abnormal cells in the body. These cells can form tumors, invade adjacent tissues, and metastasize to distant sites, causing damage to the body's normal functions. Cancer can arise in almost any tissue or organ, each type displaying unique characteristics, behaviors, and responses to treatment. The disease's development is driven by genetic mutations that disrupt normal cell growth regulation, leading to unchecked proliferation and survival of cells that would otherwise be scheduled for apoptosis, senescence, cell death. Genome organization and stability play a significant role in the development of cancer. DsbNETs, as key elements in maintaining genome organization and stability, have a profound impact on cancer.
[0208] The term "aging", as used herein, refers to the complex biological process involving the gradual decline of physical, cognitive, and physiological functions over time. Characterized by a decrease in the body's ability to maintain homeostasis, repair tissue damage, and respond to environmental stresses, aging manifests through various signs such as the appearance of wrinkles, loss of skin elasticity, reduction in muscle mass and bone density, and a decline in cognitive abilities. Additionally, aging is associated with an increased risk of chronic diseases, including cardiovascular diseases, diabetes, and cancer. Genome organization and stability are pivotal in the aging process. DsbNETs, essential for genome organization and stability, significantly influence aging.
[0209] The term "premature aging", as used herein, refers to the early onset of symptoms and signs commonly associated with the aging process, including but not limited to, the development of wrinkles, early graying of hair, reduced physical stamina, and the premature emergence of age-related health conditions. This phenomenon results in accelerated physiological changes and health impacts beyond what is expected for a given age. Premature aging is affected by the organization and stability of the genome. As crucial components in genome organization and stability, dsbNETs impact the onset of premature aging. Also, premature aging can arise from mutations in the nuclear lamina, an important dsbNETs regulator.
[0210] The term “Clustered Regularly Interspaced Short Palindromic Repeats” or "CRISPR," as used herein, refers to a genome editing system that enables precise modification of DNA within living organisms. CRISPR are segments of prokaryotic DNA containing short, repetitive base sequences. This system comprises Cas (CRISPR-associated) proteins of which the most commonly used Cas protein is Cas9, which acts as a molecular scissor to make cuts in DNA at specific locations. Other variants like Cas 12a and Cas 13 have unique properties and applications. CRISPR also comprises Guide RNA (gRNA) which is a short synthetic RNA sequence designed to be complementary to a specific DNA sequence in the genome. The gRNA directs the Cas protein to the exact location in the DNA where an edit is intended. Together, these components form a complex that can precisely target and cut DNA strands, allowing for the removal, insertion, or alteration of genetic sequences. This targeted approach enables modifying gene function and correcting genetic mutations, which are useful in therapeutic interventions in a dsbNETs-associated pathology or condition.
[0211] The term "antibody", as used herein, is intended to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, and antigen binding fragments thereof. The antibody can be from recombinant sources and / or produced in transgenic animals. The term “antigen-binding fragment” or "antibody fragment" as used herein is intended to include without limitations Fv (a molecule comprising the VL and VH), single chain Fv (scFV; a molecule comprising the VL and VH connected by a peptide linker), Fab, Fab', F(ab')2, dsFv, ds-scFv, single domain antibodies (sdAB; molecules comprising a single variable domain having 3 or less CDRs, such as VHH, VH, VL, and IgNAR antigen binding variable domain (VNAR)), and multivalent presentations of these. Also included are dimers, minibodies, diabodies, and multimers thereof, bi-specific and multi-specific antigen binding fragments, and domain antibodies. Antibodies can be fragmented using conventional techniques. For example, F(ab')2 fragments can be generated by treating the antibody with pepsin. The resulting F(ab')2 fragment can be treated to reduce disulfide bridges to produce Fab' fragments. Papain digestion can lead to the formation of Fab fragments. Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, sdAB, dimers, minibodies, diabodies, bispecific antigen binding fragments and other fragments can also be synthesized by recombinant techniques.
[0212] Antibodies to a dsbNETs regulator described herein can be prepared using techniques known in the art such as those described by Kohler and Milstein, Nature 256, 495 (1975) and in U.S. Patent Nos. RE 32,011; 4,902,614; 4,543,439; and 4,411,993, which areincorporated herein by reference. (See also Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyses, Plenum Press, Kennet, McKeam, and Bechtol (eds.), 1980, and Antibodies: A Laboratory Manual, Harlow and Lane (eds.), Cold Spring Harbor Laboratory Press, 1988, which are also incorporated herein by reference). Within the context of the present disclosure, antibodies are understood to include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, antigen binding fragments (e.g., Fab, and F(ab')2) and recombinantly produced binding partners.
[0213] A single domain antibody (sdAB) has a single monomeric variable antibody domain. Similar to a whole antibody, it is able to bind selectively to a specific antigen. Because sdAB has a molecular weight of only 12-15 kDa, it is much smaller than conventional antibodies (150-160 kDa) which are composed of two heavy protein chains and two light chains, and even smaller than Fab fragments (~50 kDa, one light chain and half a heavy chain) and single-chain variable fragments (~25 kDa, two variable domains, one from a light and one from a heavy chain) (see Harmsen MM and De Haard HJ (2007). "Properties, production, and applications of camelid single-domain antibody fragments". Applied Microbiology and Biotechnology. 77 (1): 13-22; herein incorporated by reference). The first sdAB were engineered from heavy-chain antibodies found in camelids, which are called VHH fragments. The Camelidae family includes camels and llamas. Single-domain camelid antibodies have been shown to be as specific as a regular antibody and are more robust in some cases. As well, they are easily isolated using the same phage panning procedure used for traditional antibodies, allowing them to be cultured in vitro in large concentrations. The smaller size and single domain make these antibodies easier to transform into bacterial cells for bulk production.
[0214] Other methods are known in the art, for example, for producing polyclonal antibodies in a host, such as a rabbit or goat, by immunizing the host with the immunogen or immunogen fragment, generally with an adjuvant and, if necessary, coupled to a carrier; antibodies to the immunogen are collected from the sera. Further, the polyclonal antibody can be absorbed such that it is monospecific. That is, the sera can be absorbed against related immunogens so that no cross-reactive antibodies remain in the sera rendering it monospecific.
[0215] To produce monoclonal antibodies, antibody producing cells (lymphocytes) can be harvested from an immunized animal and fused with myeloma cells by standard somatic cell fusion procedures thus immortalizing these cells and yielding hybridoma cells. Suchtechniques are well known in the art, (e.g, the hybridoma technique originally developed by Kohler and Milstein (Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256:495-497, 1975) as well as other techniques such as the human B-cell hybridoma technique (Kozbor, D, and Roder, J: The production of monoclonal antibodies from human lymphocytes. Immunology Today 4:3 72-79, 1983), the EBV-hybridoma technique to produce human monoclonal antibodies (Cole et al. Monoclonal Antibodies in Cancer Therapy (1985) Allen R. Bliss, Inc., pages 77-96) and screening of combinatorial antibody libraries (Huse, W.D. et al, “Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda” Science 246:4935 1275-1282, 1989). Hybridoma cells can be screened immunochemically for production of antibodies specifically reactive with the protein or fragment thereof and the monoclonal antibodies can be isolated.
[0216] Chimeric antibody derivatives, i.e., antibody molecules that combine a non-hu- man animal variable region and a human constant region are also contemplated within the scope of the disclosure. Chimeric antibody molecules can include, for example, the antigen binding domain from an antibody of a mouse, rat, llama, or other species, with human constant regions. Conventional methods can be used to make chimeric antibodies containing the immunoglobulin variable region which recognizes the target (See, for example, Morrison et al. (Chimeric Human Antibody Molecules: Mouse Antigen-Binding Domains with Human Constant Region Domains. PNAS 81:21 6851-6855, 1984), and Takeda et al. (Construction of chimaeric processed immunoglobulin genes containing mouse variable and human constant region sequences. Nature 314:452-454), and the patents of Cabilly et al., U.S. Patent No. 4,816,567; Boss et al., U.S. Patent No. 4,816,397; Tanaguchi et al., European Patent Publication EP171496; European Patent Publication 0173494, United Kingdom patent GB 2177096B).
[0217] Monoclonal or chimeric antibodies specifically reactive with a target as described herein can be further humanized by producing human constant region chimeras, in which parts of the variable regions, particularly the conserved framework regions of the antigen-binding domain, are of human origin and only the hypervariable regions are of non-human origin. Such immunoglobulin molecules can be made by techniques known in the art, (e.g, Teng et al. (Construction and Testing of Mouse-Human Heteromyelomas for Human Monoclonal Antibody Production. PNAS 80:12 7308-7312, 1983), Kozbor et al., supra; Olsson et al. (Methods in Enzymol, 92:3-16 1982) and PCT Publication WO92 / 06193 or EP 0239400).Humanized antibodies can also be commercially produced (Scotgen Limited, 2 Holly Road, Twickenham, Middlesex, Great Britain).
[0218] For producing recombinant antibodies (see generally Huston et al, 1991; Johnson and Bird, 1991; Memaugh and Memaugh, 1995), messenger RNAs from antibody producing B-lymphocytes of animals, or hybridoma are reverse-transcribed to obtain complementary DNAs (cDNAs). Antibody cDNA, which can be full or partial length, is amplified and cloned into a phage or a plasmid. The cDNA can be a partial length of heavy and light chain cDNA, separated or connected by a linker. The antibody, or antigen binding fragment, is expressed using a suitable expression system to obtain recombinant antibody. Antibody cDNA can also be obtained by screening pertinent expression libraries.II. Methods and Uses
[0219] The present disclosure describes dsbNETs and regulators thereof, and modulators such as inhibitors or downregulators to the dsbNETs regulators that are useful for treating a dsbNETs-associated pathology or condition.
[0220] According, provided herein is a method of treating a dsbNETs-associated pathology or condition in a subject in need thereof, comprising administering a therapeutically effective amount of a dsbNETs modulator in the subject, wherein dsbNETs repair or misrepair damaged DNA or wherein excessive or persistent dsbNETs levels trigger DNA damage or increase genome instability. Also provided is use of a dsbNETs modulator for treating a dsbNETs-associated pathology or condition in a subject in need thereof, wherein dsbNETs repair or misrepair damaged DNA or wherein excessive or persistent dsbNETs levels trigger DNA damage or increase genome instability. Further provided is use of a dsbNETs modulator in the manufacture of a medicament for treating a dsbNETs-associated pathology or condition in a subject in need thereof, wherein dsbNETs repair or misrepair damaged DNA or wherein excessive or persistent dsbNETs levels trigger DNA damage or increase genome instability. Even further provided is a dsbNETs modulator for use in treating a dsbNETs-associated pathology or condition in a subject in need thereof, wherein dsbNETs repair or misrepair damaged DNA or wherein excessive or persistent dsbNETs levels trigger DNA damage or increase genome instability. In some embodiments, the dsbNETs modulator comprises an inhibitor, downregulator, or activator of a dsbNETs regulator. In some embodiments, thedsbNETs-associated pathology or condition is cancer, aging, or premature aging. In some embodiments, the dsbNETs-associated pathology or condition is Bladder Urothelial Carcinoma (BLCA); Breast invasive carcinoma (BRCA); Cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC); Chronic lymphocytic leukemia (CLLE); Colon adenocarcinoma (COAD); Esophageal carcinoma (ESCA); Glioblastoma multiforme (GBM), Head and Neck squamous cell carcinoma (HNSC); Kidney renal clear cell carcinoma (KIRC); Acute Myeloid Leukemia (LAML); Liver hepatocellular carcinoma (LIHC); Lung adenocarcinoma (LUAD); Lung squamous cell carcinoma (LUSC); Malignant lymphoma (MALY); Neuroblastoma (NBL); Ovarian serous cystadenocarcinoma (OV); Pancreatic adenocarcinoma (PAAD); Prostate adenocarcinoma (PRAD); Retinoblastoma (RT); Skin Cutaneous Melanoma (SKCM); Stomach adenocarcinoma (STAD); Testicular Germ Cell Tumors (TGCT); Thyroid carcinoma (THCA); Uterine Corpus Endometrial Carcinoma (UCEC); Wilm's tumor (WT); or as in Table 1. In some embodiments, the dsbNETs-associated pathology or condition is Acquired partial lipodystrophy; Actinic Keratosis; Adenocarcinoma; Adenoid cystic carcinoma; Adult-Onset Autosomal Dominant Leukodystrophy with Autonomic Symptoms; Aging; Amyotrophic lateral sclerosis; Ataxia Early-Onset with Oculomotor Apraxia and Hypoalbuminemia; Ataxia-Telangiectasia; Ataxia-Telangiectasia-Like Disorder 1; Autosomal dominant adult-onset demyelinating leukodystrophy; Autosomal dominant Charcot Marie Tooth disease type 2E; Autosomal dominant Emery -Dreifuss muscular dystrophy (EDMD2); Autosomal dominant primary microcephaly-26; Autosomal dominant primary microcephaly -27; Autosomal Recessive Deafness 84a; Autosomal recessive intellectual developmental disorder-47; Autosomal recessive nonsyndromic hearing loss-84A (DFNB84A); Autosomal Recessive Non-Syndromic Intellectual Disability; Basal and Squamous Cell Carcinomas; Bladder cancer; Brain cancer; Breast cancer; Cardiomyopathy, Dilated, 1A; Charcot-Marie-Tooth disease type 2E; Charcot-Marie-Tooth Disease; Chondrosarcoma; Chromosome 2q35 Duplication Syndrome; Chronic Actinic Dermatitis; Chronic Bilirubin Encephalopathy; Classical Hodgkin lymphoma; Colorectal cancer; Congenital Fibrosis of the Extraocular Muscles; Congenital Hydrocephalus; Dilated cardiomyopathy; Emery-Dreifuss muscular dystrophy-2; Nuclear envelopathy; Esophageal Cancer; Familial Cutaneous Telangiectasia and Cancer Syndrome; Familial cutaneous telangiectasia and oropharyngeal predisposition cancer syndrome; Familial Isolated Restrictive Cardiomyopathy; Familial restrictive cardiomyopathy-6; Fanconi anemia complementation group C; FrontotemporalDementia; Gastric cancer; Glial tumor; Glioblastoma; Glioma Susceptibility 1; Glioma; Goldberg-Shprintzen Syndrome; Hepatocellular Carcinoma; Hereditary Breast Ovarian Cancer Syndrome; Histiocytosis; Hutchinson-Gilford Progeria Syndrome; Hydrocephalus, Congenital; Immune deficiency disease; Infertility; Inflammatory Myofibroblastic Tumor; Inherited Cancer- Predisposing Syndrome; Invasive Bladder Transitional Cell Carcinoma; Kearns-Sayre Syndrome; Keratosis; Laminopathy; Leukemia; Lissencephaly; LMNA-related congenital muscular dystrophy; LMNB1 -Related Autosomal Dominant Leukodystrophy; Lung Cancer Susceptibility 3; Lung cancer; Lung carcinomas; Lung Combined Large Cell Neuroendocrine Carcinoma; Lung Sarcomatoid Carcinoma; Lymphoma, Hodgkin, Classic; Meester-Loeys Syndrome; Melanoma; Microcephaly with or without chorioretinopathy, lymphedema or intellectual disability; Microcephaly; Multiple sclerosis; Myocardial infarction; Neuroblastoma; Nijmegen Breakage Syndrome; Nijmegen Breakage Syndrome-Like Disorder; Nonencapsulated Sclerosing Carcinoma; Nonpapillary Renal Cell Carcinoma; Nonpapillary Renal Cell Carcinoma; Occipital Lobe Neoplasm; Ovarian cancer; Pancreatic cancer; Papilloma; Parkinson's disease; Peritoneal Serous Adenocarcinoma; Premature aging; Progressive myoclonic epilepsy type 9; Prostate cancer; Retinitis Pigmentosa 63; Retinitis Pigmentosa; Retinoblastoma; Seckel Syndrome; Severe Combined Immunodeficiency; Skin carcinoma; Small Cell Cancer of the Lung (a.k.a. Small Cell Lung Cancer); Spherocytosis; Spinocerebellar Ataxia Autosomal Recessive with Axonal Neuropathy 2; Squamous cell carcinoma; Syndromic microphthalmia-13; Synostosis; Tatton-Brown-Rahman Syndrome; Telangiectasis; Testicular cancer; Testicular disease; Thymoma; Wiskott-Aldrich Syndrome; Zellweger Syndrome; Metastatic disease; or as shown in Table 2.
[0221] In some embodiments, the dsbNETs regulator is selected from the group consisting of Actin, ARP2, ARP3, ATAT1 (a.k.a. alpha-TATl or aTATl), ATM, ATR, DNAPK (a.k.a. DNA-PK, DNA-PKcs), FMN1, FMN2, HATs (histone acetyl transferases), HDACs (histone deacetylases), Kinesin-1 (KIF5A, KIF5B, or KIF5C; referred to as KIF5A / B / C), Kinesin-5 (KIF11), Kinesin-3 (KIF13B), Kinesin-6 (KIF20A), Kinesin-8 (KIF18A), Kinesin-13 (KIF2C), Kinesin-14A (KIFC1), Kinesin-14B (KIFC3), KIF5B-ALK, KIF5B-EGFR, KIF5B-RET, KU70, LMNA / C, LMNB1, LMNB2, microtubules (including TUB proteins, such as TUBA1B and TUBA4A), MRE11, NAT10, NBS1, PARP, Progerin, RAD50, SUN1, SUN2, MYH10, SENP2, NUMEN / ENDOD1, RNF4, VASH1, VASH2, SVBP, a dsbNETs regulator as shown in Table 2, or a combination of the foregoing.
[0222] In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an Actin inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an ARP2 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an ARP3 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an ATM inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an ATR inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an DNAPK inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an FMN1 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an FMN2 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a HATs (histone acetyl transferases) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a HDACs (histone deacetylases) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is aKinesin-1 (KIF5A / B / C) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-5 (KIF11) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-3 (KIF13B) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-6 (KIF20A) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-8 (KIF18A) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-13 (KIF2C) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-14A (KIFC1) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Kinesin-14B (KIFC3) inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a KIF5B-ALK inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a KIF5B-EGFR inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a KIF5B-RET inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a KU70 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an LMNA / C inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an LMNB1 inhibitor ordownregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an LMNB2 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a microtubules inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a TUB protein inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a TUBA1B inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a TUBA4A inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an MRE11 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a NAT10 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is an NBS1 inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a PARP inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a Progerin inhibitor or downregulator. In some embodiments, the inhibitor or downregulator of dsbNETs regulator is a RAD50 inhibitor or downregulator.
[0223] In some embodiments, the treatment of dsbNETs-associated pathology or condition comprises use or administering 4SC-205 (AEGIS), Adociasulfates, Afatinib, Alectinib, Anacardic Acid, ART0380, ATRN-119, AZ82, AZD0156, AZD1390, AZD4877, AZD6738, BAY1895344, Belinostat (PXD101), Berzosertib, Blascorid (Pirexyl), Brigatinib, BTB-1, C60211, C646, C75, Cabazitaxel, Cabozantinib, Camonsertib, CBP-93872, Ceftolozane, Ceritinib, Chaetoglobosin A, CK-312, CK-666, CK-689, CK-869, colchicine, Compound L, Copanlisib, Crizotinib, Curcumin, CW069, Cytochalasin B, Cytochalasin D, Cytochalasin E, Valproic acid, Dimethyl enastr on, Docetaxel, DPQ, EB-47, Enfortumab vedotin, Ensartinib, Entinostat (MS-275), Entrectinib, Eribulin, Erlotinib, aFamesyltransferase inhibitor, Panobinostat (LBH-589), Filanesib (ARRY-520), Folic Acid, Gefitinib, Gossypol, Hesperidin, IC486241, IC86621, IC87361, Ispinesib, Romidepsin (FK228), Ixabepilone, KIF18A-IN-1, KIFC3 blocking Peptide, kinesin-derived angiogenesis inhibitor (KAI), KU- 0060648, Latrunculin-A, Latrunculin-B, Lenvatinib, Litrinosib, Lonafamib, Lorlatinib, LY294002, Olaparib, M1774, M3541, M4076, Mangafodipir, Metformin, Methotrexate, MG149, Mirin, Monastrol, NK314, Nocodazole, NU1025, NU7026, NU7163, NU7427, NU7441, Oftasceine, OK1305, Osimertinib, Panobinostat, Paprotrain, PARP Inhibitor XIV, Pemetrexed, PJ34, Pralatrexate, Pravastatin, Progerin, aProgerini inhibitor, PU139, Quercetin,Remodelin, Rimacalib, RP-3500, Rucaparib, RXDX-105, Sarizotan, Selpercatinib, SMIFH2, Sovilnesib, SR31527 chloride, STL127705, STLC (S-trityl-L-cysteine), SU11752, TAE684, Talazoparib, Paclitaxel, Tirbanibulin, Trastuzumab emtansine, Tubacin, Tubastatin A, UCM- 13207, Vandetanib, Vanillin, Vimentin, Vinblastine, VLS-1488, VX-803, VX-970, Wiskostatin, Wortmannin, XRD-0394, Niraparib, Oledronic acid, SAHA (Vorinostat), CCW16, ZHAWOC8697, SENP2-IN-1, NSC 632839, 1,2,5-Oxadiazoles, GM-90257, GM- 90631, or EPOY, or any combination thereof, in a subject. In some embodiments, the Belinostat is Belodap™, the Valproic acid is Depacon™, the Famesyltransferase inhibitor is Tipifamib or Lonafamib, the Panobinostat is Farydak™, the Romidepsin is Istodax™, the Olaparib is Lynparza™, the Progerin inhibitor is Progerinin™ (SLC-D011), the Rucaparib is Rubraca™, the Talazoparib is Talzena™, the Paclitaxel is Taxol™, and / or the Niraparib is Zejula™.
[0224] In some embodiments, the treatment of cancer comprises use or administering of 4SC-205 (AEGIS) in a subject. In some embodiments, the treatment of cancer comprises use or administering of Adociasulfates in a subject. In some embodiments, the treatment of cancer comprises use or administering of Afatinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Alectinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Anacardic Acid in a subject. In some embodiments, the treatment of cancer comprises use or administering of ART0380 in a subject. In some embodiments, the treatment of cancer comprises use or administering of ATRN-119 in a subject. In some embodiments, the treatment of cancer comprises use or administering of AZ82 in a subject. In some embodiments, the treatment of cancer comprises use or administering of AZD0156 in a subject. In some embodiments, the treatment of cancer comprises use or administering of AZD1390 in a subject. In some embodiments, the treatment of cancer comprises use or administering of AZD4877 in a subject. In some embodiments, the treatment of cancer comprises use or administering of AZD6738 in a subject. In some embodiments, the treatment of cancer comprises use or administering of BAY1895344 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Belinostat (PXD101) in a subject. In some embodiments, the Belinostat is Belodap™. In some embodiments, the treatment of cancer comprises use or administering of Berzosertib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Blascorid (Pirexyl) in a subject. In some embodiments, the treatment of cancer comprises use or administering of Brigatinib in a subject. In some embodiments, the treatmentof cancer comprises use or administering of BTB-1 in a subject. In some embodiments, the treatment of cancer comprises use or administering of C60211 in a subject. In some embodiments, the treatment of cancer comprises use or administering of C646 in a subject. In some embodiments, the treatment of cancer comprises use or administering of C75 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Cabazitaxel in a subject. In some embodiments, the treatment of cancer comprises use or administering of Cabozantinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Camonsertib in a subject. In some embodiments, the treatment of cancer comprises use or administering of CBP-93872 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Ceftolozane in a subject. In some embodiments, the treatment of cancer comprises use or administering of Ceritinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Chaetoglobosin A in a subject. In some embodiments, the treatment of cancer comprises use or administering of CK 666 in a subject. In some embodiments, the treatment of cancer comprises use or administering of CK-312 in a subject. In some embodiments, the treatment of cancer comprises use or administering of CK-666 in a subject. In some embodiments, the treatment of cancer comprises use or administering of CK-689 in a subject. In some embodiments, the treatment of cancer comprises use or administering of CK-869 in a subject. In some embodiments, the treatment of cancer comprises use or administering of colchicine in a subject. In some embodiments, the treatment of cancer comprises use or administering of Compound L in a subject. In some embodiments, the treatment of cancer comprises use or administering of Copanlisib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Crizotinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Curcumin in a subject. In some embodiments, the treatment of cancer comprises use or administering of CW069 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Cytochalasin B in a subject. In some embodiments, the treatment of cancer comprises use or administering of Cytochalasin D in a subject. In some embodiments, the treatment of cancer comprises use or administering of Cytochalasin E in a subject. In some embodiments, the treatment of cancer comprises use or administering of Valproic acid in a subject. In some embodiments, the Valproic acid is Depacon™. In some embodiments, the treatment of cancer comprises use or administering of Dimethylenastron in a subject. In some embodiments, the treatment of cancer comprises use or administering ofDocetaxel in a subject. In some embodiments, the treatment of cancer comprises use or administering of DPQ in a subject. In some embodiments, the treatment of cancer comprises use or administering of EB-47 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Enfortumab vedotin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Ensartinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Entinostat (MS-275) in a subject. In some embodiments, the treatment of cancer comprises use or administering of Entrectinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Eribulin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Erlotinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of a Famesyltransferase inhibitor in a subject. In some embodiment, the Famesyltransferase inhibitor is Tipifamib or Lonafamib. In some embodiments, the treatment of cancer comprises use or administering of Panobinostat (LBH- 589) in a subject. In some embodiments, the Panobinostat is Farydak™. In some embodiments, the treatment of cancer comprises use or administering of Filanesib (ARRY-520) in a subject. In some embodiments, the treatment of cancer comprises use or administering of Folic Acid in a subject. In some embodiments, the treatment of cancer comprises use or administering of Gefitinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Gossypol in a subject. In some embodiments, the treatment of cancer comprises use or administering of Hesperidin in a subject. In some embodiments, the treatment of cancer comprises use or administering of IC486241 in a subject. In some embodiments, the treatment of cancer comprises use or administering of IC86621 in a subject. In some embodiments, the treatment of cancer comprises use or administering of IC87361 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Ispinesib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Romidepsin (FK228) in a subject. In some embodiments, the Romidepsin is Istodax™. In some embodiments, the treatment of cancer comprises use or administering of Ixabepilone in a subject. In some embodiments, the treatment of cancer comprises use or administering of KIF18A-IN-1 in a subject. In some embodiments, the treatment of cancer comprises use or administering of KIFC3 blocking Peptide in a subject. In some embodiments, the treatment of cancer comprises use or administering of kinesin-derived angiogenesis inhibitor (KAI) in a subject. In some embodiments, the treatment of cancer comprises use or administering of KU-0060648 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Latrunculin-A in a subject. In some embodiments, the treatment of cancer comprises use or administering of Latrunculin-B in a subject. In some embodiments, the treatment of cancer comprises use or administering of Lenvatinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Litrinosib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Lonafamib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Lorlatinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of LY294002 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Olaparib in a subject. In some embodiments, the Olaparib is Lynparza™. In some embodiments, the treatment of cancer comprises use or administering of M1774 in a subject. In some embodiments, the treatment of cancer comprises use or administering of M3541 in a subject. In some embodiments, the treatment of cancer comprises use or administering of M4076 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Mangafodipir in a subject. In some embodiments, the treatment of cancer comprises use or administering of Metformin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Methotrexate in a subject. In some embodiments, the treatment of cancer comprises use or administering of MG149 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Mirin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Monastrol in a subject. In some embodiments, the treatment of cancer comprises use or administering ofNK314 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Nocodazole in a subject. In some embodiments, the treatment of cancer comprises use or administering of NU1025 in a subject. In some embodiments, the treatment of cancer comprises use or administering of NU7026 in a subject. In some embodiments, the treatment of cancer comprises use or administering ofNU7163 in a subject. In some embodiments, the treatment of cancer comprises use or administering of NU7427 in a subject. In some embodiments, the treatment of cancer comprises use or administering of NU7441 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Oftasceine in a subject. In some embodiments, the treatment of cancer comprises use or administering of OKI 305 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Osimertinib in a subject. In some embodiments,the treatment of cancer comprises use or administering of Panobinostat in a subject. In some embodiments, the treatment of cancer comprises use or administering of Paprotrain in a subject. In some embodiments, the treatment of cancer comprises use or administering of PARP Inhibitor XIV in a subject. In some embodiments, the treatment of cancer comprises use or administering of Pemetrexed in a subject. In some embodiments, the treatment of cancer comprises use or administering of PJ34 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Pralatrexate in a subject. In some embodiments, the treatment of cancer comprises use or administering of Pravastatin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Progerin in a subject. In some embodiments, the treatment of cancer comprises use or administering of a Progerini inhibitor in a subject. In some embodiments, the Progerini inhibitor is Progerinin™ (SLC- D011). In some embodiments, the treatment of cancer comprises use or administering of PU139 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Quercetin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Remodelin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Rimacalib in a subject. In some embodiments, the treatment of cancer comprises use or administering of RP-3500 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Rucaparib in a subject. In some embodiments, the Rucaparib is Rubraca™. In some embodiments, the treatment of cancer comprises use or administering of RXDX-105 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Sarizotan in a subject. In some embodiments, the treatment of cancer comprises use or administering of Selpercatinib in a subject. In some embodiments, the treatment of cancer comprises use or administering of SMIFH2 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Sovilnesib in a subject. In some embodiments, the treatment of cancer comprises use or administering of SR31527 chloride in a subject. In some embodiments, the treatment of cancer comprises use or administering of STL127705 in a subject. In some embodiments, the treatment of cancer comprises use or administering of STLC (S-trityl-L-cysteine) in a subject. In some embodiments, the treatment of cancer comprises use or administering of SU11752 in a subject. In some embodiments, the treatment of cancer comprises use or administering of TAE684 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Talazoparib. In some embodiments, the Talazoparib is Talzena™. In some embodiments, thetreatment of cancer comprises use or administering of Paclitaxel in a subject. In some embodiments, the Paclitaxel is Taxol™. In some embodiments, the treatment of cancer comprises use or administering of Tirbanibulin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Trastuzumab emtansine in a subject. In some embodiments, the treatment of cancer comprises use or administering of Tubacin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Tubastatin A in a subject. In some embodiments, the treatment of cancer comprises use or administering of UCM- 13207 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Vandetanib in a subject. In some embodiments, the treatment of cancer comprises use or administering of Vanillin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Vimentin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Vinblastine in a subject. In some embodiments, the treatment of cancer comprises use or administering of VLS- 1488 in a subject. In some embodiments, the treatment of cancer comprises use or administering of VX-803 in a subject. In some embodiments, the treatment of cancer comprises use or administering of VX-970 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Wiskostatin in a subject. In some embodiments, the treatment of cancer comprises use or administering of Wortmannin in a subject. In some embodiments, the treatment of cancer comprises use or administering of XRD-0394 in a subject. In some embodiments, the treatment of cancer comprises use or administering of Niraparib in a subject. In some embodiments, the Niraparib is Zejula™. In some embodiments, the treatment of cancer comprises use or administering of Zoledronic acid in a subject. In some embodiments, the treatment of cancer comprises use or administering of SAHA (Vorinostat) in a subject. In some embodiments, the SAHA is Zolinza™. In some embodiments, the treatment of cancer comprises use or administering of CCW16 in a subject. In some embodiments, the treatment of cancer comprises use or administering of ZHAWOC8697 in a subject. In some embodiments, the treatment of cancer comprises use or administering of SENP2-IN-1 in a subject. In some embodiments, the treatment of cancer comprises use or administering of NSC 632839 in a subject. In some embodiments, the treatment of cancer comprises use or administering of 1,2,5-Oxadiazoles in a subject. In some embodiments, the treatment of cancer comprises use or administering of GM-90257 in a subject. In some embodiments, the treatment of cancer comprises use or administering of GM-90631 in asubject. In some embodiments, the treatment of cancer comprises use or administering of EPOY in a subject. In some embodiments, the treatment of cancer further comprises use or administering of chemotherapy, radiation, cisplatin, an inhibitor of ATM, an inhibitor of ATR, an inhibitor of DNAPK, or an inhibitor of PARP. In some embodiments, the dsbNETs- associated pathology or condition is cancer, and the method comprises administering an inhibitor or downregulator of a dsbNETs regulator in a subject, provided that the method does not include the administering of one or more of 3-ABA, 4SC-205 (AEGIS), Afatinib, Alectinib, Anacardic Acid, ART0380, ATRN-119, AZ82, AZD0156, AZD1390, AZD4877, AZD6738, BAY1895344, Belodap (Belinostat, PXD101), Berzosertib, Blascorid (Pirexyl), Brigatinib, BTB-1, C60211, C646, C75, Cabazitaxel, Cabozantinib, Camonsertib (RP-3500), CBP-93872, Ceftolozane, Ceralasertib (AZD), Ceritinib, Chaetoglobosin A, CK 666, CK-312, CK-689, CK-869, colchicine, Compound L, Crizotinib, Curcumin, CW069, Cytochalasin B, Cytochalasin D, Cytochalasin E, Depacon (Calproic acid), Dimethyl enastr on, Docetaxel, EB- 47, Enfortumab vedotin, Ensartinib, Entinostat (MS-275), Entrectinib, Eribulin, Erlotinib, Famesyltransferase inhibitors (e.g., Tipifamib, Lonafamib), Farydak (Panobinostat, LBH- 589), Filanesib (ARRY-520), Folic Acid, Gefitinib, Gossypol, Hesperidin, IC486241, IC87361, Ispinesib, Istodax (Romidepsin, FK228), Ixabepilone, KIF18A-IN-1 , KIFC3 blocking Peptide, kinesin-derived angiogenesis inhibitor (KAI) , KU-0060648, Latrunculin-A, Latrunculin-B, Lenvatinib, Litrinosib, Lorlatinib, LY294002, Lynparza (Olaparib), M1774, M3541, M4076, Mangafodipir, Metformin, MG149, Mirin, Monastrol, Nocodazole, NU1025, NU7026, NU7163, NU7427, NU7441, Oftasceine, Osimertinib, Panobinostat, Paprotrain, PARP Inhibitor XIV, Pemetrexed, PJ34, Pravastatin, PU139, Quercetin, Remodelin, Rimacalib, RP-3500, Rubraca (Rucaparib), RXDX-105, Sarizotan, Saruparib (AZD5305), Selpercatinib, SMIFH2, Sovilnesib, SR31527 chloride, STL127705, STLC (S-trityl-L- cysteine), SU11752, TAE684, Talzena (Talazoparib), Taxol (Paclitaxel), Tirbanibulin, Trastuzumab emtansine, Tubacin, Tubastatin A, Vandetanib, Vanillin, Vinblastine, VLS-1488, VX-803, VX-970, Wiskostatin, Wortmannin, XRD-0394, Zejula (Niraparib), Zoledronic acid, Zolinza (Vorinostat, SAHA), SENP2-IN-1, NSC 632839, 1,2,5-Oxadiazoles, GM-90257, and / or GM-90631 in the subject.
[0225] In some embodiments, the treatment of aging comprises use or administering of 4SC-205 (AEGIS) in a subject. In some embodiments, the treatment of aging comprises use or administering of Adociasulfates in a subject. In some embodiments, the treatment of agingcomprises use or administering of Afatinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Alectinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Anacardic Acid in a subject. In some embodiments, the treatment of aging comprises use or administering of ART0380 in a subject. In some embodiments, the treatment of aging comprises use or administering of ATRN-119 in a subject. In some embodiments, the treatment of aging comprises use or administering of AZ82 in a subject. In some embodiments, the treatment of aging comprises use or administering of AZD0156 in a subject. In some embodiments, the treatment of aging comprises use or administering of AZD1390 in a subject. In some embodiments, the treatment of aging comprises use or administering of AZD4877 in a subject. In some embodiments, the treatment of aging comprises use or administering of AZD6738 in a subject. In some embodiments, the treatment of aging comprises use or administering of BAY1895344 in a subject. In some embodiments, the treatment of aging comprises use or administering of Belinostat (PXD101) in a subject. In some embodiments, the Belinostat is Belodap™. In some embodiments, the treatment of aging comprises use or administering of Berzosertib in a subject. In some embodiments, the treatment of aging comprises use or administering of Blascorid (Pirexyl) in a subject. In some embodiments, the treatment of aging comprises use or administering of Brigatinib in a subject. In some embodiments, the treatment of aging comprises use or administering of BTB-1 in a subject. In some embodiments, the treatment of aging comprises use or administering of C60211 in a subject. In some embodiments, the treatment of aging comprises use or administering of C646 in a subject. In some embodiments, the treatment of aging comprises use or administering of C75 in a subject. In some embodiments, the treatment of aging comprises use or administering of Cabazitaxel in a subject. In some embodiments, the treatment of aging comprises use or administering of Cabozantinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Camonsertib in a subject. In some embodiments, the treatment of aging comprises use or administering of CBP-93872 in a subject. In some embodiments, the treatment of aging comprises use or administering of Ceftolozane in a subject. In some embodiments, the treatment of aging comprises use or administering of Ceritinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Chaetoglobosin A in a subject. In some embodiments, the treatment of aging comprises use or administering of CK 666 in a subject. In some embodiments, the treatment of aging comprises use or administeringof CK-312 in a subject. In some embodiments, the treatment of aging comprises use or administering of CK-666 in a subject. In some embodiments, the treatment of aging comprises use or administering of CK-689 in a subject. In some embodiments, the treatment of aging comprises use or administering of CK-869 in a subject. In some embodiments, the treatment of aging comprises use or administering of colchicine in a subject. In some embodiments, the treatment of aging comprises use or administering of Compound L in a subject. In some embodiments, the treatment of aging comprises use or administering of Copanlisib in a subject. In some embodiments, the treatment of aging comprises use or administering of Crizotinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Curcumin in a subject. In some embodiments, the treatment of aging comprises use or administering of CW069 in a subject. In some embodiments, the treatment of aging comprises use or administering of Cytochalasin B in a subject. In some embodiments, the treatment of aging comprises use or administering of Cytochalasin D in a subject. In some embodiments, the treatment of aging comprises use or administering of Cytochalasin E in a subject. In some embodiments, the treatment of aging comprises use or administering of Valproic acid in a subject. In some embodiments, the Valproic acid is Depacon™. In some embodiments, the treatment of aging comprises use or administering of Dimethyl enastron in a subject. In some embodiments, the treatment of aging comprises use or administering of Docetaxel in a subject. In some embodiments, the treatment of aging comprises use or administering of DPQ in a subject. In some embodiments, the treatment of aging comprises use or administering of EB- 47 in a subject. In some embodiments, the treatment of aging comprises use or administering of Enfortumab vedotin in a subject. In some embodiments, the treatment of aging comprises use or administering of Ensartinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Entinostat (MS-275) in a subject. In some embodiments, the treatment of aging comprises use or administering of Entrectinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Eribulin in a subject. In some embodiments, the treatment of aging comprises use or administering of Erlotinib in a subject. In some embodiments, the treatment of aging comprises use or administering of a Famesyltransferase inhibitor in a subject. In some embodiment, the Famesyltransferase inhibitors is Tipifamib or Lonafamib. In some embodiments, the treatment of aging comprises use or administering of Panobinostat (LBH-589) in a subject. In some embodiments, the Panobinostat is Farydak™. In some embodiments, the treatment of aging comprises use oradministering of Filanesib (ARRY-520) in a subject. In some embodiments, the treatment of aging comprises use or administering of Folic Acid in a subject. In some embodiments, the treatment of aging comprises use or administering of Gefitinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Gossypol in a subject. In some embodiments, the treatment of aging comprises use or administering of Hesperidin in a subject. In some embodiments, the treatment of aging comprises use or administering of IC486241 in a subject. In some embodiments, the treatment of aging comprises use or administering of IC86621 in a subject. In some embodiments, the treatment of aging comprises use or administering of IC87361 in a subject. In some embodiments, the treatment of aging comprises use or administering of Ispinesib in a subject. In some embodiments, the treatment of aging comprises use or administering of Romidepsin (FK228) in a subject. In some embodiments, the Romidepsin is Istodax™. In some embodiments, the treatment of aging comprises use or administering of Ixabepilone in a subject. In some embodiments, the treatment of aging comprises use or administering of KIF18A-IN-1 in a subject. In some embodiments, the treatment of aging comprises use or administering of KIFC3 blocking Peptide in a subject. In some embodiments, the treatment of aging comprises use or administering of kinesin- derived angiogenesis inhibitor (KAI) in a subject. In some embodiments, the treatment of aging comprises use or administering of KU-0060648 in a subject. In some embodiments, the treatment of aging comprises use or administering of Latrunculin-A in a subject. In some embodiments, the treatment of aging comprises use or administering of Latrunculin-B in a subject. In some embodiments, the treatment of aging comprises use or administering of Lenvatinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Litrinosib in a subject. In some embodiments, the treatment of aging comprises use or administering of Lonafamib in a subject. In some embodiments, the treatment of aging comprises use or administering of Lorlatinib in a subject. In some embodiments, the treatment of aging comprises use or administering of LY294002 in a subject. In some embodiments, the treatment of aging comprises use or administering of Olaparib in a subject. In some embodiments, the Olaparib is Lynparza™. In some embodiments, the treatment of aging comprises use or administering of M1774 in a subject. In some embodiments, the treatment of aging comprises use or administering of M3541 in a subject. In some embodiments, the treatment of aging comprises use or administering of M4076 in a subject. In some embodiments, the treatment of aging comprises use or administering of Mangafodipir ina subject. In some embodiments, the treatment of aging comprises use or administering of Metformin in a subject. In some embodiments, the treatment of aging comprises use or administering of Methotrexate in a subject. In some embodiments, the treatment of aging comprises use or administering of MG149 in a subject. In some embodiments, the treatment of aging comprises use or administering of Mirin in a subject. In some embodiments, the treatment of aging comprises use or administering of Monastrol in a subject. In some embodiments, the treatment of aging comprises use or administering of NK314 in a subject. In some embodiments, the treatment of aging comprises use or administering of Nocodazole in a subject. In some embodiments, the treatment of aging comprises use or administering of NU1025 in a subject. In some embodiments, the treatment of aging comprises use or administering of NU7026 in a subject. In some embodiments, the treatment of aging comprises use or administering of NU7163 in a subject. In some embodiments, the treatment of aging comprises use or administering of NU7427 in a subject. In some embodiments, the treatment of aging comprises use or administering of NU7441 in a subject. In some embodiments, the treatment of aging comprises use or administering of Oftasceine in a subject. In some embodiments, the treatment of aging comprises use or administering of OKI 305 in a subject. In some embodiments, the treatment of aging comprises use or administering of Osimertinib in a subject. In some embodiments, the treatment of aging comprises use or administering of Panobinostat in a subject. In some embodiments, the treatment of aging comprises use or administering of Paprotrain in a subject. In some embodiments, the treatment of aging comprises use or administering of P ARP Inhibitor XIV in a subject. In some embodiments, the treatment of aging comprises use or administering of Pemetrexed in a subject. In some embodiments, the treatment of aging comprises use or administering of PJ34 in a subject. In some embodiments, the treatment of aging comprises use or administering of Pralatrexate in a subject. In some embodiments, the treatment of aging comprises use or administering of Pravastatin in a subject. In some embodiments, the treatment of aging comprises use or administering of Progerin in a subject. In some embodiments, the treatment of aging comprises use or administering of a Progerini inhibitor in a subject. In some embodiments, the Progerini inhibitor is Progerinin™ (SLC-D011). In some embodiments, the treatment of aging comprises use or administering of PU139 in a subject. In some embodiments, the treatment of aging comprises use or administering of Quercetin in a subject. In some embodiments, the treatment of aging comprises use or administering of Remodelin in a subject. In some embodiments, thetreatment of aging comprises use or administering of Rimacalib in a subject. In some embodiments, the treatment of aging comprises use or administering of RP-3500 in a subject. In some embodiments, the treatment of aging comprises use or administering of Rucaparib in a subject. In some embodiments, the Rucaparib is Rubraca™. In some embodiments, the treatment of aging comprises use or administering of RXDX-105 in a subject. In some embodiments, the treatment of aging comprises use or administering of Sarizotan in a subject. In some embodiments, the treatment of aging comprises use or administering of Selpercatinib in a subject. In some embodiments, the treatment of aging comprises use or administering of SMIFH2 in a subject. In some embodiments, the treatment of aging comprises use or administering of Sovilnesib in a subject. In some embodiments, the treatment of aging comprises use or administering of SR31527 chloride in a subject. In some embodiments, the treatment of aging comprises use or administering of STL127705 in a subject. In some embodiments, the treatment of aging comprises use or administering of STLC (S-trityl-L- cysteine) in a subject. In some embodiments, the treatment of aging comprises use or administering of SU11752 in a subj ect. In some embodiments, the treatment of aging comprises use or administering of TAE684 in a subject. In some embodiments, the treatment of aging comprises use or administering of Talazoparib. In some embodiments, the Talazoparib is Talzena™. In some embodiments, the treatment of aging comprises use or administering of Paclitaxel in a subject. In some embodiments, the Paclitaxel is Taxol™. In some embodiments, the treatment of aging comprises use or administering of Tirbanibulin in a subject. In some embodiments, the treatment of aging comprises use or administering of Trastuzumab emtansine in a subject. In some embodiments, the treatment of aging comprises use or administering of Tubacin in a subject. In some embodiments, the treatment of aging comprises use or administering of Tubastatin A in a subject. In some embodiments, the treatment of aging comprises use or administering of UCM-13207 in a subject. In some embodiments, the treatment of aging comprises use or administering of Vandetanib in a subject. In some embodiments, the treatment of aging comprises use or administering of Vanillin in a subject. In some embodiments, the treatment of aging comprises use or administering of Vimentin in a subject. In some embodiments, the treatment of aging comprises use or administering of Vinblastine in a subject. In some embodiments, the treatment of aging comprises use or administering of VLS-1488 in a subject. In some embodiments, the treatment of aging comprises use or administering of VX-803 in a subject. In some embodiments, the treatmentof aging comprises use or administering of VX-970 in a subject. In some embodiments, the treatment of aging comprises use or administering of Wiskostatin in a subject. In some embodiments, the treatment of aging comprises use or administering of Wortmannin in a subject. In some embodiments, the treatment of aging comprises use or administering of XRD- 0394 in a subject. In some embodiments, the treatment of aging comprises use or administering of Niraparib in a subject. In some embodiments, the Niraparib is Zejula™. In some embodiments, the treatment of aging comprises use or administering of Zoledronic acid in a subject. In some embodiments, the treatment of aging comprises use or administering of SAHA (Vorinostat) in a subject. In some embodiments, the SAHA is Zolinza™. In some embodiments, the treatment of aging comprises use or administering of CCW16 in a subject. In some embodiments, the treatment of aging comprises use or administering of ZHAWOC8697 in a subject. In some embodiments, the treatment of aging comprises use or administering of SENP2-IN-1 in a subject. In some embodiments, the treatment of aging comprises use or administering of NSC 632839 in a subject. In some embodiments, the treatment of aging comprises use or administering of 1,2,5-Oxadiazoles in a subject. In some embodiments, the treatment of aging comprises use or administering of GM-90257 in a subject. In some embodiments, the treatment of aging comprises use or administering of GM-90631 in a subject. In some embodiments, the treatment of aging comprises use or administering of EPOY in a subject. In some embodiments, the treatment of aging further comprises use or administering of chemotherapy, radiation, cisplatin, an inhibitor of ATM, an inhibitor of ATR, an inhibitor of DNAPK, or an inhibitor of PARP. In some embodiments, the dsbNETs- associated pathology or condition is aging, and the method comprises administering an inhibitor or downregulator of a dsbNETs regulator in a subject, provided that the method does not include the administering of one or more of 3 -ABA, Anacardic Acid, ART0380, AZDI 390, BAY1895344, Belodap (Belinostat, PXD101), BTB-1, C646, C75, Ceftolozane, colchicine, Curcumin, Cytochalasin B, Depacon (Calproic acid), Entinostat (MS-275), Famesyltransferase inhibitors (e.g., Tipifamib), Famesyltransferase inhibitors (e.g., Lonafamib), Folic Acid, Gefitinib, Gossypol, Hesperidin, Istodax (Romidepsin, FK228), KIFC3 blocking Peptide, Latrunculin-A, Latrunculin-B, Lenvatinib, LY294002, Lynparza (Olaparib), Metformin, Monastrol, Nocodazole, OK1305, Pemetrexed, PJ34, Progerin, Progerinin (SLC-D011), Quercetin, Remodelin, Sarizotan, TAE684, Taxol (Paclitaxel), Tubacin, Tubastatin A,Vanillin, Vimentin, Wortmannin, Zoledronic acid, Zolinza (Vorinostat, SAHA), and / or SENP2-IN-1 in the subject.
[0226] In some embodiments, the treatment of premature aging comprises use or administering of 4SC-205 (AEGIS) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Adociasulfates in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Afatinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Alectinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Anacardic Acid in a subject. In some embodiments, the treatment of premature aging comprises use or administering of ART0380 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of ATRN-119 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of AZ82 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of AZD0156 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of AZDI 390 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of AZD4877 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of AZD6738 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of BAY1895344 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Belinostat (PXD101) in a subject. In some embodiments, the Belinostat is Belodap™. In some embodiments, the treatment of premature aging comprises use or administering of Berzosertib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Blascorid (Pirexyl) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Brigatinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of BTB-1 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of C60211 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of C646 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of C75 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Cabazitaxel in a subject. In some embodiments, the treatment of premature aging comprises use or administering ofCabozantinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Camonsertib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CBP-93872 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Ceftolozane in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Ceritinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Chaetoglobosin A in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CK 666 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CK-312 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CK-666 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CK-689 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CK-869 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of colchicine in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Compound L in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Copanlisib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Crizotinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Curcumin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of CW069 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Cytochalasin B in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Cytochalasin D in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Cytochalasin E in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Valproic acid in a subject. In some embodiments, the Valproic acid is Depacon™. In some embodiments, the treatment of premature aging comprises use or administering of Dimethylenastron in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Docetaxel in a subject. In some embodiments, the treatment of premature aging comprises use or administering of DPQ in a subject. In some embodiments, the treatment of premature aging comprises use or administering of EB-47 in a subject. In some embodiments, the treatment of premature agingcomprises use or administering of Enfortumab vedotin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Ensartinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Entinostat (MS-275) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Entrectinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Eribulin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Erlotinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of a Famesyltransferase inhibitor in a subject. In some embodiment, the Famesyltransferase inhibitors is Tipifamib or Lonafamib. In some embodiments, the treatment of premature aging comprises use or administering of Panobinostat (LBH-589) in a subject. In some embodiments, the Panobinostat is Farydak™. In some embodiments, the treatment of premature aging comprises use or administering of Filanesib (ARRY-520) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Folic Acid in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Gefitinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Gossypol in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Hesperidin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of IC486241 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of IC86621 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of IC87361 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Ispinesib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Romidepsin (FK228) in a subject. In some embodiments, the Romidepsin is Istodax™. In some embodiments, the treatment of premature aging comprises use or administering of Ixabepilone in a subject. In some embodiments, the treatment of premature aging comprises use or administering of KIF18A- IN-1 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of KIFC3 blocking Peptide in a subject. In some embodiments, the treatment of premature aging comprises use or administering of kinesin-derived angiogenesis inhibitor (KAI) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of KU-0060648 in a subject. In some embodiments, the treatment of prematureaging comprises use or administering of Latrunculin-A in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Latrunculin-B in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Lenvatinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Litrinosib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Lonafamib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Lorlatinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of LY294002 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Olaparib in a subject. In some embodiments, the Olaparib is Lynparza™. In some embodiments, the treatment of premature aging comprises use or administering of M1774 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of M3541 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of M4076 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Mangafodipir in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Metformin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Methotrexate in a subject. In some embodiments, the treatment of premature aging comprises use or administering of MG149 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Mirin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Monastrol in a subject. In some embodiments, the treatment of premature aging comprises use or administering ofNK314 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Nocodazole in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NU1025 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NU7026 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NU7163 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NU7427 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NU7441 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Oftasceine in a subject. In some embodiments, the treatment of premature aging comprises use oradministering of OKI 305 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Osimertinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Panobinostat in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Paprotrain in a subject. In some embodiments, the treatment of premature aging comprises use or administering of P ARP Inhibitor XIV in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Pemetrexed in a subject. In some embodiments, the treatment of premature aging comprises use or administering of PJ34 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Pralatrexate in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Pravastatin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Progerin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of a Progerini inhibitor in a subject. In some embodiments, the Progerini inhibitor is Progerinin™ (SLC- D011). In some embodiments, the treatment of premature aging comprises use or administering of PU139 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Quercetin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Remodelin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Rimacalib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of RP-3500 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Rucaparib in a subject. In some embodiments, the Rucaparib is Rubraca™. In some embodiments, the treatment of premature aging comprises use or administering of RXDX-105 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Sarizotan in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Selpercatinib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of SMIFH2 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Sovilnesib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of SR31527 chloride in a subject. In some embodiments, the treatment of premature aging comprises use or administering of STL127705 in a subject. In some embodiments, the treatment of premature aging comprises use or administering ofSTLC (S-trityl-L-cysteine) in a subject. In some embodiments, the treatment of premature aging comprises use or administering of SU11752 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of TAE684 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Talazoparib. In some embodiments, the Talazoparib is Talzena™. In some embodiments, the treatment of premature aging comprises use or administering of Paclitaxel in a subject. In some embodiments, the Paclitaxel is Taxol™. In some embodiments, the treatment of premature aging comprises use or administering of Tirbanibulin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Trastuzumab emtansine in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Tubacin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Tubastatin A in a subject. In some embodiments, the treatment of premature aging comprises use or administering of UCM- 13207 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Vandetanib in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Vanillin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Vimentin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Vinblastine in a subject. In some embodiments, the treatment of premature aging comprises use or administering of VLS- 1488 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of VX-803 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of VX-970 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Wiskostatin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Wortmannin in a subject. In some embodiments, the treatment of premature aging comprises use or administering of XRD-0394 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of Niraparib in a subject. In some embodiments, the Niraparib is Zejula™. In some embodiments, the treatment of premature aging comprises use or administering of Zoledronic acid in a subject. In some embodiments, the treatment of premature aging comprises use or administering of SAHA (Vorinostat) in a subject. In some embodiments, the SAHA is Zolinza™. In some embodiments, the treatment of premature aging comprises use or administering of CCW16 in a subject. In some embodiments, the treatmentof premature aging comprises use or administering of ZHAWOC8697 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of SENP2-IN- 1 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of NSC 632839 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of 1,2,5-Oxadiazoles in a subject. In some embodiments, the treatment of premature aging comprises use or administering of GM-90257 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of GM- 90631 in a subject. In some embodiments, the treatment of premature aging comprises use or administering of EPOY in a subject. In some embodiments, the treatment of premature aging further comprises use or administering of chemotherapy, radiation, cisplatin, an inhibitor of ATM, an inhibitor of ATR, an inhibitor of DNAPK, or an inhibitor of PARP. In some embodiments, the dsbNETs-associated pathology or condition is premature aging, and the method comprises administering an inhibitor or downregulator of a dsbNETs regulator in a subject, provided that the method does not include the administering of one or more of 3-ABA, Anacardic Acid, ART0380, AZD1390, AZD6738, BAY1895344, BTB-1, C646, C75, Cytochalasin B, Entinostat (MS-275), Famesyltransferase inhibitors (e.g., Tipifamib, Lonafamib), Gossypol, Latrunculin-A, LY294002, Lynparza (Olaparib), M1774, Metformin, Nocodazole, PJ34, Pravastatin, Progerin, Progerinin (SLC-D011), Quercetin, Remodelin, Taxol (Paclitaxel), UCM-13207, Vanillin, Vimentin, Vinblastine, and / or Zoledronic acid in the subject.
[0227] In some embodiments, the dsbNETs regulator is ATAT1, wherein the dsbNETs inhibitor or downregulator is Mangafodipir, Hesperidin, Folic Acid, Pemetrexed, Ceftolozane, Oftasceine, Vimentin, Methotrexate, Pralatrexate, or Copanlisib, and wherein the dsbNETs- associated pathology or condition is Type 1 Spherocytosis, Testicular Disease, Congenital Hydrocephalus, cancer, aging, or premature aging. In some embodiments, the cancer is breast cancer, colorectal cancer, or pancreatic cancer.
[0228] In some embodiments, the method or use comprises CRISPR inhibiting or downregulating a dsbNETs regulator described herein. In some embodiments, the CRISPR inhibiting or downregulating comprises disruption of a target. In some embodiments, the disruption is carried out using one or more DNA-binding nucleic acids, such as disruption via an RNA-guided endonuclease (RGEN). For example, the disruption can be carried out using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated(Cas) proteins. CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g. tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a "direct repeat" and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), and / or other sequences and transcripts from a CRISPR locus.
[0229] The CRISPR / Cas nuclease or CRISPR / Cas nuclease system can include a noncoding RNA molecule (guide) RNA, which sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9), with nuclease functionality (e.g., two nuclease domains). One or more elements of a CRISPR system can derive from a type I, type II, or type III CRISPR system, e.g, derived from a particular organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.
[0230] In some embodiments, a Cas nuclease and gRNA (including a fusion of crRNA specific for the target sequence and fixed tracrRNA) are introduced into the cell. In general, target sites at the 5' end of the gRNA target the Cas nuclease to the target site, e.g, the gene, using complementary base pairing. The target site can be selected based on its location immediately 5' of a protospacer adjacent motif (PAM) sequence, such as typically NGG, or NAG. In this respect, the gRNA is targeted to the desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. In general, a CRISPR system is characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence. Typically, "target sequence" generally refers to a sequence to which a guide sequence is designed to have complementarity, where hybridization between the target sequence and a guide sequence promotes the formation of a CRISPR complex. Full complementarity is not necessarily required, provided there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex.
[0231] The CRISPR system can induce double stranded breaks (DSBs) at the target site, followed by disruptions as discussed herein. In other embodiments, Cas9 variants, deemed "nickases," are used to nick a single strand at the target site. Paired nickases can be used, e.g., to improve specificity, each directed by a pair of different gRNAs targeting sequences suchthat upon introduction of the nicks simultaneously, a 5' overhang is introduced. In some embodiments, catalytically inactive Cas9 is fused to a heterologous effector domain such as a transcriptional repressor or activator, to affect gene expression.
[0232] The target sequence can comprise any polynucleotide, such as DNA or RNA polynucleotides. The target sequence cany be located in the nucleus or cytoplasm of the cell, such as within an organelle of the cell. A sequence or template that can be used for recombination into the targeted locus comprising the target sequences is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In some embodiments, an exogenous template polynucleotide can be referred to as an editing template. In some embodiments, the recombination is homologous recombination.
[0233] As relating to an endogenous CRISPR system, formation of the CRISPR complex (comprising the guide sequence hybridized to the target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands in or near (e.g. within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from) the target sequence. The tracr sequence, which can comprise or consist of all or a portion of a wild-type tracr sequence (e.g. about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracr sequence), can also form part of the CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or a portion of a tracr mate sequence that is operably linked to the guide sequence. The tracr sequence has sufficient complementarity to a tracr mate sequence to hybridize and participate in formation of the CRISPR complex, such as at least 50%, 60%, 70%, 80%, 90%, 95% or 99% of sequence complementarity along the length of the tracr mate sequence when aligned.
[0234] One or more vectors driving expression of one or more elements of the CRISPR system can be introduced into the cell such that expression of the elements of the CRISPR system direct formation of the CRISPR complex at one or more target sites. Components can also be delivered to cells as proteins and / or RNA. For instance, a Cas enzyme, a guide sequence linked to a tracr-mate sequence, and a tracr sequence could each be operably linked to separate regulatory elements on separate vectors. In the alternative, two or more of the elements expressed from the same or different regulatory elements, can be combined in a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The vector can comprise one or more insertion sites,such as a restriction endonuclease recognition sequence (also referred to as a "cloning site"). In some embodiments, one or more insertion sites are located upstream and / or downstream of one or more sequence elements of one or more vectors. When multiple different guide sequences are used, a single expression construct can be used to target CRISPR activity to multiple different, corresponding target sequences within a cell.
[0235] A vector can comprise a regulatory element operably linked to an enzymecoding sequence encoding the CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslO, Csy 1, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmri, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof These enzymes are known; for example, the amino acid sequence of S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2.
[0236] The CRISPR enzyme can be Cas9 (e.g, from S. pyogenes or S. pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence. The vector can encode a CRISPR enzyme that is mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from S. pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). In some embodiments, a Cas9 nickase can be used in combination with guide sequence(s), e.g, two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce NHEJ or HDR.
[0237] In some embodiments, an enzyme coding sequence encoding the CRISPR enzyme is codon optimized for expression in particular cells, such as eukaryotic cells. The eukaryotic cells can be those of or derived from a particular organism, such as a mammal, including but not limited to human, mouse, rat, rabbit, dog, or non-human primate. Codon optimization refers to a process of modifying a nucleic acid sequence for enhanced expressionin the host cells of interest by replacing at least one codon of the native sequence with codons that are more frequently or most frequently used in the genes of that host cell while maintaining the native amino acid sequence. Various species exhibit particular bias for certain codons of a particular amino acid. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of translation of messenger RNA (mRNA), which is in turn believed to be dependent on, among other things, the properties of the codons being translated and the availability of particular transfer RNA (tRNA) molecules. The predominance of selected tRNAs in a cell is generally a reflection of the codons used most frequently in peptide synthesis. Accordingly, genes can be tailored for optimal gene expression in a given organism based on codon optimization.
[0238] A guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more.
[0239] Alignment can be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g. the Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif), SOAP (http: / / soap.genomics.org.cn), and Maq (http: / / maq.sourceforge.net).
[0240] In some embodiments, the CRISPR is specific for inhibiting or downregulating a dsbNETs regulator shown in Table 2.
[0241] In some embodiments, the method or use comprises an antisense technique for inhibiting or downregulating a dsbNETs regulator described herein. In some embodiments, the anti-sense technique comprises RNA interference (RNAi), short interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes are used to selectively suppress or repress expression of the gene. siRNA technology is RNAi which employs a double-stranded RNA molecule having a sequence homologous with the nucleotide sequence of mRNA which is transcribed from the gene, and a sequence complementary with the nucleotide sequence. siRNA ishomologous / complementary with one region of mRNA which is transcribed from the gene, or can be siRNA including a plurality of RNA molecules which are homologous / complementary with different regions. In some embodiments, the siRNA is comprised in a polycistronic construct. In some embodiments, the siRNA comprises a sequence as shown in Table 4. In some embodiments, the siRNA comprises a sequence specific for downregulating a dsbNETs regulator shown in Table 2. In some embodiments, the siRNA or shRNA targets AT ATI. In some embodiments, the siRNA targets AT ATI. In some embodiments, the siRNA comprises SEQ ID NOs: 24 and 25. In some embodiments, the siRNA or shRNA targets KIF5B. In some embodiments, the shRNA comprises SEQ ID NOs: 38 and 39. In some embodiments, the siRNA or shRNA targets VASH1. In some embodiments, the siRNA or shRNA targets VASH2. In some embodiments, the siRNA or shRNA targets SVBP.
[0242] In some embodiments, a nucleic acid encoding the DNA-targeting molecule, complex, or combination, is administered or introduced to the cell. The nucleic acid is administered or for use in the form of an expression vector, such as a viral expression vector. In some embodiments, the expression vector is a retroviral expression vector, an adenoviral expression vector, a DNA plasmid expression vector, or an AAV expression vector. In some embodiments, one or more polynucleotides encoding the disruption molecule or complex, such as the DNA-targeting molecule, is delivered to the cell. In some embodiments, the delivery is by delivery of one or more vectors, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, is delivered to the cell.
[0243] In some embodiments, the polypeptides are synthesized in situ in the cell as a result of the introduction of polynucleotides encoding the polypeptides into the cell. In some embodiments, the polypeptides could be produced outside the cell and then introduced thereto. Methods for introducing a polynucleotide construct into animal cells are known and include, as non-limiting examples stable transformation methods wherein the polynucleotide construct is integrated into the genome of the cell. In some embodiments, transient transformation method comprises polynucleotide construct that is not integrated into the genome of the cell, and virus mediated methods. In some embodiments, the polynucleotides can be introduced into the cell by for example, recombinant viral vectors (e.g. retroviruses, adenoviruses), liposome and the like. In some embodiments, transient transformation methods include microinjection, electroporation, or particle bombardment. In some embodiments, the polynucleotides are included in vectors, more particularly plasmids or virus, in view of being expressed in the cells.
[0244] In some embodiments, viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of a CRISPR, ZFP, ZFN, TALE, and / or TALEN system to cells in culture, or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g. a transcript of a vector described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle, such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.
[0245] Methods of non-viral delivery of nucleic acids include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, poly cation or lipidmucleic acid conjugates, naked DNA, artificial virions, and agent-enhanced uptake of DNA. Lipofection is described in (e.g., US5049386 and and 4897355, herein incorporated by reference) and lipofection reagents are sold commercially (e.g, Transfectam™ and Lipofectin™).
[0246] In some embodiments, delivery is via the use of RNA or DNA viral based systems for the delivery of nucleic acids. In some embodiments, viral vectors are administered directly to a subject in vivo or they can be used to treat cells in vitro or ex vivo, and then administered to a subject. Viral -based systems in some embodiments include retroviral, lentivirus, adenoviral, adeno-associated and herpes simplex virus vectors for gene transfer.
[0247] In some embodiments, the method or use comprises an antibody or an antigenbinding fragment thereof that specifically binds to a dsbNETs regulator described herein or inhibiting or downregulating the dsbNETs regulator. In some embodiments, the antibody or an antigen-binding fragment thereof is specific for binding to a dsbNETs regulator shown in Table 2.
[0248] In some embodiments, the dsbNETs modulator are administered or for use through a variety of routes including oral, rectal, transdermal, subcutaneous, intravenous, intramuscular, and intranasal, or via intratracheal instillation or aerosol inhalation.
[0249] Also provided is a method for treating a pathology or a condition in which the dsbNETs either repair or misrepair damaged DNA or in which excessively induced or pertistent dsbNETs trigger DNA damage in a subject in need thereof. In an embodiment, the method comprises administering a therapeutically effective amount of a therapeutic agent to thesubject. In an embodiment, the therapeutic agent comprises an inhibitor or a suppressor of a dsbNETs regulator described herein. In an embodiment, the therapeutic agent comprises a siRNA, CRISPR, or antibody targeting a dsbNETs regulator, a LINC complex protein (such as SUN1 / 2 and SYNE1-4), LMNA / C, or any protein described herein.
[0250] In various embodiments, any of the features or components of any embodiments, examples, figures, or tables discussed above or herein can be combined, and such combinations are encompassed within the scope of the present disclosure. Any specific value discussed above or herein can be combined with another related value discussed above or herein to recite a range with the values representing the upper and lower ends of the range, and such ranges are encompassed within the scope of the present disclosure. A therapeutic agent for use in any of the methods discussed herein, or use of a therapeutic agent in the manufacture of a medicament for use in any of the methods discussed herein are also encompassed within the scope of this disclosure.
[0251] Hereinafter are provided examples of specific embodiments and implementations for performing the methods and uses of the present disclosure. The examples are provided for illustrative purposes only, and are not intended to limit the scope of the present disclosure in any way:EXAMPLEMETHODSCell lines and reagents
[0252] U2OS, IMR-90, HEK293T, and HeLa cells (cat# CCL-2, ATCC) were cultured in Dulbecco’s modified Eagle medium (DMEM, Wisent Bioproducts) supplemented with 10% fetal bovine serum (FBS, Wisent Bioproducts) and 1% penicillin / streptomycin. MDA-MB-231 and MDA-MB-436 were cultured in DMEM supplemented with 10% fetal bovine serum and 1% penicillin / streptomycin (Wisent Bioproducts). MCF10A cells were cultured in DMEM / F12 media supplemented with 17% FBS, 100 pg / mL EGF, 1 mg / mL hydrocortisone, 1 mg / mL cholera toxin, 10 mg / mL insulin, and 1% penicillin / streptomycin. U2OS-derived ER-mCheny- LacI-Fokl-DD (Fokl-DSB) 2-6-5 cells24were grown in DMEM supplemented with 10% FBS, 1% penicillin / streptomycin, 2 pg / mL puromycin, and 200 pg / mL hygromycin. All cell lines were frequently tested for mycoplasma using My co Alert Plus Mycoplasma Detection Kit (cat# LT07-218, Lonza). The DR-GFP and EJ5 U2OS cells25were cultured in DMEM without sodium pyruvate supplemented with 10% FBS and 1% penicillin / streptomycin. Commercially available wild-type (cat# 118380, Addgene) and R62D-mutant (cat# 118381, Addgene) Actin plasmids as well as wild-type (cat# 20291, Addgene) and G606G:GGC>GGT-mutant (cat# 20292, Addgene) LMNA plasmids26,27were used. The lists of antibodies, sgRNAs, siRNAs, shRNAs, primers, and plasmids are in Tables 3-8.
[0253] Etoposide (cat# E7657, LKT laboratories)28'30was added at 100 pM or indicated concentrations for Ih, and cells were incubated until harvesting. Etoposide wash experiments consisted of removing the etoposide-containing media and adding fresh drug-free media for 2 h. Nocodazole (cat# 487928-10MG, Sigma; cat#1228 Tocris) was added at 50 pM for Ih alone or Ih prior to the addition of etoposide or DMSO vehicle control. Unless otherwise indicated, treatments were 100 pM etoposide for 1 h (ETP), 1 h etoposide followed by removal of the drug for 2 h (ETP+wash), and 1 h nocodazole followed by a 1 h etoposide condition (NOC + ETP). Also used is the condition where nocodazole is added for 1 h and then removed for 1 h before conducting a 1 h etoposide treatment (NOC+wash+ETP). For the NOC+ETP condition, keeping or removing nocodazole before the addition of etoposide yielded equivalent results. Additional treatments were as follows. Vinblastine (cat# V1377-10MG, Sigma-Aldrich) was added at 100 nM. DNA-PK inhibition was achieved by adding NU7026 (cat# 2828, Tocris) at 10 pM. Inventors added the PARP inhibitor olaparib (AZD2281, cat# SI 060, Selleckchem) at 1 pM, ATR inhibitor berzosertib (VE-822, cat# S7102, Selleckchem) at 5 pM, and ATM inhibitor (AZD1390, cat# S8680, Selleckchem) at 5 pM. The histone deacetylase inhibitor SAHA (Vorinostat, cat#SML0061-MG5, Millipore Sigma) was used at 10 pM for 24 h. The actin polymerization inhibitor Latrunculin-B (cat# ab 144291, Abeam) was added at 20 pM for 1 h to U2OS cells and at 0.5 or 1 pM for 1 h to 2-6-5 cells24.
[0254] Fokl-DSB was induced in 2-6-5 cells via a 1 h treatment with 1 pM Shield-1 ligand (cat# AOB1848, AOBIOUS) and 1 pM of 4-hydroxytamoxifen (cat# S7827, Selleckchem)24,31. To enlarge 53BP1 foci, 2-6-5 cells were treated with 50 pM Enoxacin (cat# S1756, Selleckchem) for 24 h prior to DSB induction. To assess the correlation between DSB levels and LMNB1 tubules under different settings, U2OS cells were treated with 100 pM etoposide (cat# E7657, LKT laboratories) for 1 h, 50 pM nocodazole (cat# 487928-10MG, Sigma) for 1 h, 2 pM flavopiridol (cat# sc-202157, Santa Cruz) for 3 h, or 10 pM MG132 (cat# 13697-25, Cayman Chemical Co) for 3 h.Knockdowns and lentiviral preparation
[0255] To transiently knockdown factors of interest, cells were transfected for 72 h with 20-30 nM of corresponding siRNAs (Table 5). The siRNAs were transfected using Lipofectamine RNAiMAX Transfection Reagent (cat# 13778150, ThermoFisher). For lentiviral preparation, HEK293T cells were co-transfected using GenJet™ (cat# SL00488, SignaGen Laboratories) lipofection with Tet-pLKO-puro (cat# #21915, Addgene) shRNA- containing lentiviral constructs or a scrambled lentiviral construct (cat# 162011, Addgene) together with psPAX-2 (cat# 12260, Addgene) and pMD2.G (cat# #12259, Addgene). MDA- MB-231 and MDA-MB-436 cells were transduced 48-72 h post-HEK293T transfection with Tet-pLKO-puro lentiviruses containing shRNAs targeting human KIF5B or KIFC3 (TRCN0000338580, TRCN0000271534; Table 5). Transduced cells were maintained in 2 pg / mL puromycin and DMEM supplemented with 10% tetracycline-free FBS. shRNA knockdown was induced with 100 ng / mL doxycycline treatment for 96 h. All knockdowns were successfully confirmed using immunoblotting, which also confirmed the specificity of the antibodies.Cell cycle analysis
[0256] Cell cycle stage was determined by exposing cells for 2 h to 5-ethynyl-2'- deoxyuridine (EdU), using the Click-iT™ EdU Cell Proliferation Kit for Imaging, Alexa Fluor™ 488 dye (cat# Cl 0337, ThermoFisher) and following the manufacturer’s instructions.Fixed-cell microscopy
[0257] Immunofluorescence was performed as previously described32,33. Briefly, cells were seeded on glass coverslips, treated with the desired drug protocols, and fixed for 10 min using 4% formaldehyde or paraformaldehyde. Cells were washed in PBS and permeabilized for 10 min with 0.5% Triton X-100. Only for the purpose of nuclear F-actin staining via Phalloidin-iFluor reagent 488 (cat# abl 76753, Abeam), the cells were permeabilized for 20 min at room temperature. Upon permeabilization, cells were washed in PBS / 0.01% Tween (PBST) and kept overnight in 20% Glycerol / PBS. Cells were then washed with PBST and blocked for a minimum of 30 minutes in 4% BSA. Cells were incubated overnight at 4°C with a 1:500 dilution primary antibody in 1% BSA. The cells were then washed in PBST and incubated with a secondary antibody at a dilution of 1:1000 in 1% BSA for a minimum of Ih at room temperature. Cells were then washed in PBST, counterstained for 5 min with DAPI(cat# DI 306, Thermo Fisher), washed in PBS and mounted on glass slides with mowiol (cat# 81381, Sigma-Aldrich). Three-dimensional super-resolution imaging with 0.125 pm or 0.2 pm intervals was performed on a LSM880 with Airyscan fast detection system (Zeiss, SickKids imaging facility), and the oil immersion objective Plan-Apochromat 63x / 1.4 oil DIC M27. ZEN black edition software edition 2.3 (Zeiss) was used for acquisition. All images shown were acquired in sensitivity-versus-resolution (SR) mode with 8 bits. Confocal three- dimensional imaging and z-slices of 0.25 pm, 0.3 pm, 0.5 pm or 0.5 pm step sizes was performed on a Leica TCS sp8 Lightning Confocal / STED microscope coupled to LasX software (Leica) using a 63x (1.4) oil-immersion objective (SickKids imaging facility), or an in-house Nikon Eclipse Ti2 C2+ confocal microscope coupled to NIS-Elements AR software (Nikon) and lOOx (1.25) or 60x (0.85) OFN25 oil objectives.Live-cell microscopy
[0258] Cells were cultured on Poly-D-Lysine coated 35 mm glass-bottom dishes (cat# P35G-1.5-14-C, MatTek). The SiR-Tubulin stain (Cytoskeleton CY-SC002)34and NucBlue™ (Hoechst 33342, cat# R37605, ThermoFischer) were used to visualize microtubules and DNA, respectively. To visualize the nuclear lamina, cells were transfected transiently with a GFP- LMNB1 plasmid, a kind gift from J. Lammerding (Cornell University). Super-resolution confocal imaging was performed using the Zeiss LSM880 Airyscan confocal microscope, and standard confocal imaging was performed using the Nikon AIR confocal microscope with a resonant scanner (AOMF imaging facility). Both microscopes were equipped with an incubation module at 37°C and 5% CO2. Airyscan data files were acquired in sensitivity- versus-resolution (SR) mode with 8 bits, 0.125 pm or 0.2 pm z-slices, and fitted zoom level with the oil immersion objective Plan-Apochromat 63x / 1.4 oil DIC M27. A 32-channel gallium arsenide phosphide photomultiplier tube (GaAsP-PMT) area detector (Airyscan) collected a pinhole-plane image at every scan position. The Airyscan detector system enhances sensitivity 4-8-fold and resolution beyond the diffraction limit of light of up to 1.7-fold (-130 nm) compared to standard confocal microscopes35,36. For all acquisitions, -5-10* less laser power was used compared to standard confocal microscopy. The ZEN black edition software edition 2.3 (Zeiss) was used for acquisition. Time-lapse live cell imaging was performed at 5 min intervals for 1 h with the same lens and 0.125 pm z-slices, SR mode, with the Zeiss LSM880 Airyscan confocal microscope. 405 nm laser was used to visualize DAPI, 488 nm was used to visualize GFP, and 561 nm laser was used to visualize mCherry.
[0259] Nikon AIR images were acquired with Plan-Apochromat, nano-crystal, 60x / l .4 NA, oil immersion lens. Two standard photomultiplier (PMT) detectors, two Gallium Arsenide Phosphide (GaAsP) high-sensitivity detectors, and the MCL nano-drive allowed high-quality of live cell samples. Nikon Element software was used for acquisition. 640 nm laser was used to visualize Cy5 (microtubule) signal. 405nm and 488nm lasers were used for visualizing DAPI and GFP signals, respectively. To better visualize differences in the distribution of signals in live cells, BitPlane Imaris 9.7 was used to map the red channel (SiR-Tubulin, 647 nm laser) from base red colour to Fire mapped colour and to map LMNB1 signal (GPF-LMNB1) from green base color to Jet mapped colour.Image analyses and reconstructions
[0260] BitPlane Imaris 9.7 or 10.0 and ImageJ / FIJI software were used for single-cell image analysis3,37,38. Airyscan35,36data files were first de-convoluted and processed in ZEN black (Zeiss) software. Maximum intensity projections were optimized using BitPlane Imaris 9.7 or 10.0 Image Proc function. Pixel intensity display settings were automatically or manually optimized using a thresholding method based on image quality and local contrast using BitPlane Imaris 9.7 or 10.0 Baseline Subtraction function followed by a Gaussian smoothing filter at a value of one.
[0261] For three-dimensional nuclear reconstruction and quantification of dsbNETs and DSB levels, the analyses were as follows. To quantify the tubular score or degree of invagination of LaminBl in a single nucleus, DAPI-stained DNA and LMNB1 signals were reconstructed in three dimensions visualizing the invaginated signal and the boundary signal separately using the Surfaces MatLAB Xtension and masking function where every z-plane in a single nucleus (30-85 z-slices) was contoured manually to ensure optimal separation of boundary and internal LMNB1 signal to detect LMNB1 nuclear tubules. For each three- dimensionally reconstructed surface, the surface area was quantified using the BitPlane Imaris 9.7 detailed Statistics function. The tubular score or invagination ratio was then quantified as the total LMNB1 surface area divided by the total DNA surface area marked by DAPI. Additionally, z-stacks of LMNB1 stained cells were segmented via machine learning-based analysis using LabKit39, which is a machine-learning pixel classification tool that can be used as a FIJI plug-in. Training data images were manually labeled to train classifiers to segment boundary and tubular LMNB1. The segmentations were imported into BitPlane Imaris 10.0and defined as surfaces. The tubular score was calculated by dividing the total LabKit segmentation surface area, which included the boundary and invaginated LMNB1, by the DAPI surface area.
[0262] Cells were considered tubules-positive when two or more tubules extending deeper than the radius of the nucleus were detected using BitPlane Imaris 9.7 Section function. Alternatively, z-stacks of stained cells were analyzed using the Orthogonal Views function on ImageJ / FIJI. Using BitPlane Imaris 9.7 Section, cells were considered positive for nucleusreshaping microtubules if the latter were detected at the mid-plane of the three-dimensional z- stack to ensure that only nuclear microtubules were selected. 53BP1 foci were counted using the Spots MatLAB Xtension of Imaris or Difference of Gaussians (DoG) and Analyze Particles functions on ImageJ / FIJI. To determine the association of 53BP1 foci with LMNB1 tubules, the foci were three-dimensionally reconstructed using the Spots MatLAB Xtension in BitPlane Imaris 9.7 with the Different Spot Sizes option turned on to ensure capturing the actual size of each focus, followed by scoring the number of foci at or away from the tubules using the Find Spots Close to Surface MatLAB Xtension. The threshold was set to a value smaller than the average diameter of voxels at 0.3 pm, which was determined based on the average diameter of the 53BP1 foci (0.70 ± 0.21 m, total of 1117 randomly selected foci) and the average diameter of 110 nuclei from randomly selected U2OS cells (13.0 ± 2.8 pm). Less than 1% of cells showed nuclear envelope failure, severe DSB clustering with one to two large 53BP1 foci occupying a third to half the nucleus, or severe nuclear envelope blebbing. Such cells were excluded from the three-dimensionally reconstructed 53BP1 foci analyses so as not to introduce noise in the quantification. Across this study, etoposide-dependent dsbNETs induction was robust and exhibited cell-type-specific effects with average induction levels of ~2.8 fold in U2OS or 2-6-5 cells and ~1.7 fold in MDA-MB cells.
[0263] For the Fokl-DSB reporter system, image analyses were as follows. Colocalization of the single-DSB foci with 53BP1 foci in 2-6-5 cells was performed in BitPlane Imaris 10.0 using the Spots function by setting the lowest spot diameter value to 2, followed by visual confirmation of colocalization in single cells and colocalization value data extraction. DSB mCherry foci shape and counts were determined using the three-dimensional single-cell analysis in BitPlane Imaris 10.0. The distance between the single DSB foci and the nuclear edge (marked via LMNB1 IF) was measured in ImageJ / FIJI89using the Straight Selection Tool by assessing the shortest distance from the DSB to the nuclear edge in three-dimensions.Single-cell analysis of the colocalization between the single DSB foci and LMNB1 was determined from the superimposed mCherry-DSB and LMNB1 IF channels in ImageJ / FIJI.
[0264] Nuclear envelope tubule width measurements were performed as previously described90. Briefly, 3D-confocal images of selected cell lines stained for LMNB1 were analyzed in ImageJ / FIJI by detecting nuclear envelope tubules in the XZ plane and measuring tubule diameters using the Straight Selection Tool. Overall, inventors have quantified dsbNETs using multiple approaches, including the tubular score from reconstructed nuclei, artificial intelligence (Al)-based tubular score measurement from imaging stacks, percent tubules- positive cells, tubular width, and tubular bodies crossing the nuclear midplane. Due to the interconnectedness of the tubules in etoposide-treated cells, inventors could not determine the precise number of individual tubules. Also, due to the dynamic nature of dsbNETs and repair foci in vivo, inventors could not image or reconstruct the full network of dsbNETs in single nuclei in vivo as inventors have done for single nuclei in fixed cells.CRISPR / dCas9-based DSB imaging
[0265] The ends of a single DSB were visualized by inducing the lesion in the reporter 2-6-5 cells. DSB induction in reporter cells via a Ih treatment with IpM Shield-1 ligand (cat# AOB1848, AOBIOUS) and 1 pM 4-Hy dr oxy tamoxifen (cat# S7827, Selleckchem) results in the recruitment of the LacI repressor fused to mCherry and the nuclease domain of endonuclease FokI to the Lac operator (LacO) array located on the 5’ end of the single DSB reporter locus. The 3’ end of the single DSB reporter locus was also independently visualized via transient transfection of GFP-dCas9 and sgRNAs targeting the |3-Globin transgene located downstream of the LacO array. Cells were transfected with the sgRNAs and GFP-dCas9- expressing plasmid as previously described40. Cells were first transfected with sgRNAs and a GFP-dCas9 expressing plasmid for 48 h and subsequently treated for 1 h with 1 pM Shield- 1 ligand (cat# AOB1848, AOBIOUS) and 1 pM 4-Hydroxytamoxifen (cat# S7827, Selleckchem). Cells were transfected with non-targeting control sgRNA (True Guide Syn. SgRNA Negative Control, Non-Targeting, Invitrogen A35526; Lot: 2102041) or with three custom targeting sgRNAs (Invitrogen, Table 4).Chimeric protein engineering
[0266] EGFP-SUN1 was synthesized and cloned into the pcDNA3.1+ plasmid (Invitrogen) using Nhel and Xhol restriction sites. Full-length KU70 was fused to EGFP andSUN1 that lacks the lamina domain (SUN1AN). This 4,905-nucleotide gene (KU70-EGFP- SUN1AN) was synthesized and cloned into the pcDNA3.1+ plasmid (Invitrogen) using Nhel and Xhol restriction sites. Sequence coding for a simian virus 40 (SV40) nuclear localization signal (NLS) was engineered between KU70 and EGFP. To ensure protein flexibility, a (GGGS)4 linker was inserted between KU70 wdNLS. GGS linkers were also inserted between NLS and EGFP, and between EGFP and SUN IAN. Both NLS-EGFP-SUN1 and KU70-EGFP- SUN1AN contain a silent mutation on amino acid 425 of SUN1, conferring resistance to an siRNA with the CCGTGTTGAACTGGGCAAGCA (SEQ ID NO: 54) target sequence. KU70- EGFP and EGFP -SUN IAN were generated by digesting the KU70-EGFP-SUN / / IN-containing plasmid with Hpal & Xhol, and Nhel & AflII, respectively. The oligos AACTGAC and TCGAGTCAGTT (SEQ ID NO: 55), and CTAGCGCCACCATGC (SEQ ID NO: 56) and TTAAGCATGGTGGCG (SEQ ID NO: 57) were annealed and cloned into the digested plasmid using T4 ligase for KU70-EGFP and EGFP-SUN1AN, respectively.Coimmunoprecipitation
[0267] Cells were seeded 48 h prior to treatment with the DMSO vehicle control or etoposide for Ih at 80% confluency. Cells were harvested by trypsinization and lysed for 1 h with RIPA buffer with protease inhibitor. Lysates were incubated for 30 min with Benzonase (cat# E1014-5KU, Sigma) and cleared by centrifugation for 10 min at 4°C. 1 mg lysate was pre-cleared with Dynabeads™ protein G (cat# 10004D, Thermo Fisher) for 1 h with rotation at 4°C. 50 pL of pre-cleared lysate was removed for input. 50 pL of Dynabeads™ were washed in IP buffer (10 mM Tris pH 7.4, 1 mM EDTA, 1 mM EGTA, 150 mM NaCl, 0.5% NP-40, 0.2 mM sodium orthovanadate, and protease inhibitor), and incubated with an antibody for LMNB1 (cat# 16048, Abeam), SUN1 (cat# 24568-I-AP, ProteinTech), or rabbit IgG (cat# ab!71870, Abeam) for 1 h with rotation at 4°C. Antibody-conjugated beads were washed twice with IP buffer and incubated with the pre-cleared lysate for 2 h with rotation at 4°C. Beads were washed five times with IP buffer and the antibody-protein complexes eluted with 3X Laemmli buffer at 95°C for 5 min.Immunoblotting
[0268] Cells were lysed with RIPA buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.5 mM EGTA, 1 % Triton X-100, 0.1 % sodium deoxy cholate, 0.1 % SDS 140 mM NaCl, protease inhibitor (Roche)) for Ih on ice and vortexing every 10 min. Lysates were cleared bycentrifugation for 10 min at 4°C. Protein concentration was determined using the Bradford assay (Bio-Rad), and samples were diluted to equal protein concentration with RIPA buffer. Samples were boiled in 3X Laemmli buffer (187.5 mM Tris pH 6.8, 6% w / v SDS, 30% glycerol, 150 mM DTT, 0.03% bromophenol blue), run on 8% SDS-poly acrylamide gels or 4- 20% Tris-Glycine gradient gels (Invitrogen Novex), and transferred to nitrocellulose membranes. Membranes were blocked in 5% skim milk for Ih at RT and incubated overnight at 4°C with primary antibodies diluted in 1% skim milk. Membranes were washed three times with TBT+0.1% Tween-20 (TBST) and incubated with IgG secondary antibodies for Ih at RT. Membranes were then washed five times with TBST and incubated for 5 min with ECL substrate (Clarity Western ECL substrate, Bio-Rad) in the dark. Membranes were developed using the ChemiDoc™ imaging system (Bio-Rad).Chromatin pulldowns
[0269] Chromatin immunoprecipitation (ChIP) was performed as previously described32. Briefly, 20xl06cells were washed in IX PBS and fixed for 10 min with 1% FA / 1X PBS. The fixation reaction was quenched with a 125 mM Glycine solution for 5 min on ice. The cells were washed in ice-cold IX PBS, and the cells were resuspended in lysis buffer (5 mM PIPES, 85 mM KC1, 0.5% NP40) for 15 min on ice. After lysis, the resuspended cells were centrifuged and resuspended in nuclear lysis buffer (50mM Tris-Hcl, lOmM EDTA, 1% EDTA). Subsequently, the lysate was sonicated (Branson 250 Digital Sonifier) for 6 cycles (ON: 20s; OFF: 120s; amplitude: 40%) in order to achieve a chromatin size between 150-500 bp. The chromatin was then divided and diluted in IP-dilution buffer (16.7 mM Tris-HCl, 0.01% SDS, 1.1% Triton, 1.2 mM EDTA, 167 mMNaCl) for antibody incubation overnight at 4°C. After antibody incubation, Dynabeads Protein G (cat # 10004D, Invitrogen) were added to the chromatin-antibody complexes and incubated for 2 h 4°C. The IPs were washed in Low- salt (20 mM Tris-HCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 150 mM NaCl), High-salt (20 mM Tris-HCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 500 mM NaCl), Li-Cl (lOmM Tris-HCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 250 mM LiCl) and TE buffer (10 mM Tris-HCl pH 8, ImM EDTA). Finally, the DNA was eluted in IP-elution buffer (1% SDS, 100 mM NaHCO3) and de-crosslinking was performed at 65°C overnight. RNase A digestion was then performed at room temperature for 30 min followed by a Proteinase K digestion at 45°C for 2 h. The DNA was extracted using the Geneaid Gel / PCR DNA extraction kit, and qPCR was performed.RNA extraction and reverse transcription
[0270] Cells grown to 70-80% confluence were washed with RNase-free PBS prior to RNA isolation using Qiagen RNeasy mini Kit (cat# 74104). 1 pg of total RNA was treated with 1 pL of 1 OX DNase-I reaction buffer, 1 pL of DNase I Amp grade (1 U / pL; ThermoFisher; cat# 18068015) and incubated for 15 min at room temperature. The reaction was quenched with 1 pL of 25 mM EDTA and incubated for 10 min at 65°C. 10 pL of the reactions were carried out using 10 mM dNTPs, 50 pM random hexamers (cat# SO142, Invitrogen), 500 ng total RNA, 5X First-Strand Buffer, 100 mM DTT, 40 U / pL RNaseOUT (cat# 10777019, Invitrogen) and 200 U / pL M-MLV reverse transcriptase (cat# 28025013, Invitrogen) according to manufacturer’s instructions, at 25°C for 10 min, 37°C for 60 min, and 70°C for 15 min. The RT reaction was diluted 1:5 and 4 pL and used in qPCR amplification. qPCR reactions were performed at 95°C for 5 min, 60°C for 30 sec, followed by 39 cycles of 95°C for 5 sec and 60°C for 30 sec. Results were analyzed using the following formula: AACt = 2A-(ACt(SiTARGET) - ACt(siCTR)), where ACt Ct( transcript of interest) “ Ct(vinculin).HR and NHEJ reporters
[0271] U2OS cells bearing a single copy integration of the reporters DR-GFP or EJ5 were used as previously described25. 350,000 cells were reverse transfected with 30 nM siRNA in 6-well plates using RNAiMax. Cells were re-seeded and 48 h post-siRNA transfection, cells were transfected with 1 pg of I-Scel plasmid (cat# 26477, Addgene) and 0.5 pg of RFP (cat# 13032, Addgene) using Lipofectamine 3000 (cat# L3000015, ThermoFisher). Cells were also re-transfected with 30 nM siRNA using RNAiMax. The following day, DR-GFP cells were reseeded in 12-well plates and EJ5 cells were seeded on coverslips in 24-well plates. 72 h posttransfection, DR-GFP cells were harvested, run on the BD LSRfortessa cell analyzer, and analyzed using FlowJo 10 software. EJ5 cells were fixed, counterstained with DAPI, and mounted on slides with Mowiol. EJ5 cells were imaged using Nikon Eclipse Ti2 C2+ confocal microscope, and GFP and RFP positive cells were analyzed using FIJI.Neutral comet assay
[0272] The Comet assay was performed using the Comet Assay Kit (cat# ab238544, Abeam) according to the manufacturer’s instructions. Briefly, cells were treated with DMSO or 100 pM etoposide and harvested immediately after 1 h of treatment or 1 h post-etoposide wash. Cells were incubated at 37°C under 5% CO2 during treatments. 1x105cells werecombined with low melting agarose at 37°C at a ratio of 1:5. Slides were immersed in lysis buffer for 1 hour at 4°C and were subjected to electrophoresis at 1 V / cm for 35 min. Slides were dried in 70% ethanol and stained with Vista Green DNA Dye (1: 10000) for 15 min. Images were captured on a Nikon Eclipse Ti2 C2+ confocal microscope using a 20X objective. Comets were analyzed using CometAnalyser41.Proximity ligation assay
[0273] Cells were seeded, permeabilized, and fixed as described above for immunofluorescence. The proximity ligation assay (PLA) experiments were performed according to the Duolink® PLA protocol. Briefly, coverslips were blocked with Duolink® blocking buffer at 37°C for 1 h. Coverslips were incubated overnight with primary antibodies used at 1:500 dilution. Coverslips were washed and incubated with anti -rabbit plus and antimouse minus Duolink® PLA probes (cat# DUO92101, Sigma- Aldrich) at 37°C for 1 h. The Duolink® In Situ Detection Reagents Red (cat# DUO92101, Sigma- Aldrich) were used to perform the PLA reaction. Coverslips were counterstained with DAPI and mounted with Mowiol. Images were captured on a Nikon Eclipse Ti2 C2+ confocal microscope and analyzed using FIJI.Senescence assessment
[0274] MDA-MB-436 were fixed and stained using the Senescence [3-galactosidase Staining Kit (cat# 9860, Cell Signaling) following the manufacturer’s instructions. Cells were visualized using the Leica DMIL microscope (Leica) with the Leica MC170HD camera and the LAS EZ imaging software.Metaphase chromosome spreads
[0275] MDA-MB-436 cells harboring doxycyline-inducible shCTL, shKIF5B, or shKIFC3 were seeded in 6-cm plates. 48 h post-seeding, cells were treated with DMSO or 2 pM olaparib for 16 h. The cells were then treated with 0.1 pg / mL KaryoMAX™ Colcemid™ Solution (cat# 15212012, Gibco™) for 3 h at 37°C and 5% CO2. Harvested cells were resuspended in pre-warmed 0.056 M KC1 hypotonic solution for 20 min at 37°C. The cells were then pelleted and resuspended by the dropwise addition of 5 mL ice-cold fixative (3:1 methanol to glacial acetic acid). The fixed cells were incubated on ice for 1 h before centrifugation and resuspension in fresh fixative. Cells were incubated overnight at 4°C infixative and then resuspended in fresh fixative two more times. Cells were then resuspended in 200-500 pl of fresh fixative and dropped on glass slides over a 70°C water bath. Slides were dried vertically at 37°C for 30 min. DAPI was added, and the spreads were imaged at 100X with a Leica DM4000B fluorescent microscope.Growth curves and colony formation
[0276] To assess long-term growth and determine growth curves in standard cultures, experiments were conducted as previously described with modifications42. Briefly, for growth curves, 1x104MDA-MB-231 or 5x104MDA-MB-436 cells with doxycycline-inducible shCTL, shKIF5B, or shKIFC3 were seeded in 6-well plates. Every 2-3 days, the cells were counted using the Beckman Vi-CELL XR Cell Viability Analyzer for 11 days. For long-term colony-forming assays, shCTL, shKIF5B, and shKIFC3 doxycycline-induced knockdown MDA-MB-231 (5xl02) or MDA-MB-436 (5xl03) cells were seeded in six-well plates and cultured for 10-21 days. Colonies were stained with crystal violet and scored with ImageJ / FIJI. To assess growth in PARPi, 5x104MDA-MB-436 cells with either shCTL, shKIF5B, or shKIFC3 induced by doxycycline were seeded in 12-well plates. The next day, the indicated PARPi concentrations or vehicle control were added. Media was replenished after 4 days, and the cells were counted after seven days of growth using the Beckman Vi-CELL XR Cell Viability Analyzer.Mouse xenotransplantation
[0277] All procedures were approved by and performed in compliance with the guidelines of the University of Toronto Animal Care Committee and the Princess Margaret Cancer Centre. Equal parts of MDA-MB-436 cells (1.5 x 106) and Matrigel (cat# 354248, Coming) matrix were injected into inguinal mammary fat pads of 12-14-week-old NOD / SCID / IL2Rgammanu11(NSG) mice (Jackson Laboratory, strain 005557). Tumor volumes ((length x width2) / 2) were monitored regularly using caliper measurements for up to 55 days. Mice were euthanized by CO2 inhalation when the tumor size reached the ethical endpoint, in accordance with animal care facility rules.Analysis of human tumors
[0278] Representative whole slide images of breast cancer specimens were obtained as follows: the cBioPortal (http: / / www.cbioportal.org) was used to search the Cancer GenomeAtlas (TCGA) PanCancer Atlas for breast tumours containing mutations in BRCA1, BRCA2, or PIK3CA. A list of potential cases was generated, and then the whole slide image was identified on the TCGA website (https: / / www.cancer.gov / tcga). In each case, a representative high-power magnification image was obtained from a representative area of the tumour (formalin-fixed paraffin-embedded sections; stained with Haematoxylin & Eosin; approximate magnification x400). Three representative areas were subsequently randomly selected for nuclear groove quantification; in each of these areas, a total of 10 nuclei were examined for quantification of membrane clefting. Care was taken to avoid processing and tissue artifacts such as chatter.Bioinformatics
[0279] TCGA RNA-seq data43were obtained from the Genomic Data Commons Data Portal (https: / / portal.gdc.cancer.gov) and corresponded to fragments per kilobase of transcript per million mapped reads upper quartile (FPKM-UQ). Pediatric tumor data from the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) project (cancer types: Wilms tumor (WT), rhabdoid tumor (RT), and neuroblastoma (NBL)). The Molecular Taxonomy of Breast Cancer International Consortium (METABRIC) data were obtained preprocessed and normalized from the cBioPortal (http: / / www.cbioportal.org / pubhc- portal / ). The data for chronic lymphocytic leukemia (CLLE) and malignant lymphoma (MALY) were obtained preprocessed and normalized from the ICGC Data Portal (https: / / dcc.icgc.org / ). The HR and NHEJ pathway gene signatures were obtained from a curation study44and overlapping genes between signatures were excluded from the analysis (HR = 43 and NHEJ = 11 genes. The altEJ signature has been previously described45. The normalized gene signature scores were based on single sample Gene Set Expression Analysis (ssGSEA) computed using the Gene Set Variation Analysis (GSVA) software package46. The forest plots and heatmaps were computed using the foresplot and circlize*1and ComplexHeatmap packages in R software. CRISPR-Cas9 loss-of-function screening data across established cancer cell lines were obtained from the Cancer Dependency Map (DepMap; https: / / depmap.0rg / p0rtal / h0me / # / )49. For STRING network analysis50, an initial exploratory interaction network composed of a selected list of 92 proteins including DDR signaling kinases, nuclear envelope proteins, kinesin motors, and tubulin variants revealed three connected clusters. Based on these findings, a secondary network highlighting the connections between the nuclear envelope, DDR, and kinesins was created using the settings of full network,confidence, all active interaction sources, minimum required interaction score of 0.400, and a K-means clustering of 5.Table 1: TCGA cancer types in this disclosure.Table 2: Summary of dsbNETs regulators: names and classes of dsbNETs regulators, roles of the regulators (promoters or repressors), whether the role of the regulators was tested or predicted, inhibitors of the regulator, and Malacards search results, including the top three diseases, and top three cancers.Table 2 continuedTable 2 continuedTable 2 continuedTable 2 continuedTable 2 continuedTable 2 continuedTable 2 continuedTable 3: Main antibodies used in this disclosure.Table 4: sgRNAs used in this disclosure.Table 5: siRNA and shRNA sequences used in this disclosure.Table 6: Fokl-DSB-related primers used in this disclosure.Table 7: RT-qPCR primers used in this disclosure.| Primer | Sequence (5’-»3’)Table 8: Plasmid used in this disclosure.The dsbNETs and their role in DNA repair and health
[0280] Inventors first induced DSBs using the topoisomerase II-inhibiting chemotherapeutic etoposide to study the nuclear envelope during DNA repair. Inventors visualized the nuclear envelope-associated lamina via Lamin-Bl (LMNB1) in osteosarcoma cells using immunofluorescence, three-dimensional super-resolution microscopy, and in silico reconstruction of volume surfaces. Within 30 min or one hour of a 100 pM etoposide treatment, LMNB1 -marked tubules emerged from around the nucleus, infiltrating it (FIG. 1A-C; FIG. 6A-H; ETP or etoposide hereafter refers to a one-hour etoposide treatment unless otherwise indicated). Removing etoposide for two hours or pre-treating cells with the microtubule dynamics inhibitor nocodazole for an hour repressed etoposide-induced LMNB1 tubules without altering the distribution of cells in different cell cycle stages (FIG. 1A, FIG. IB, FIG. 1C; FIG. 61). Etoposide induced LMNB1 tubules during the Gi and S / G2 phase of the cell cycle (FIG. ID). The LMNB1 tubules surrounded cytoplasmic microtubules displacing chromatin in live and fixed cells (FIG. IE; FIG. 6J, FIG. 6K). Live-cell imaging in the presence of etoposide showed microtubule filaments marked with the plus-end protein EB1 extending within elongating LMNB1 tubules, which reverted shortly after the disappearance of the EB1 -marked filaments (FIG. 6L). Like nocodazole, treating cells with the microtubule dynamics inhibitor vinblastine prevented etoposide from inducing LMNB1 tubules (FIG. 6M). The LMNB1 tubules colocalized with DSBs marked by the NHEJ protein TP53-binding protein 1 (53BP1) (FIG. 1F-H; FIG. 7A). DSBs associated with LMNB1 at the tubules more than the nuclear boundary (FIG. IF). Also, co-immunoprecipitation revealed that LMNB1 pulled down 53BP1 following etoposide treatment, revealing increased interactions between the endogenous proteins (FIG. 7B). Etoposide removal resulted in the tubules’ reversal, coinciding with decreased 53BP1 foci numbers, showing the coordination of DSB and tubule levels (FIG. 1A- C,F-H; compare conditions 1, 3, and 4 from the left in FIG. IB and G). Indeed, time-lapse imaging showed 53BP1 -marked DSBs resolved faster at LMNB1 tubules than away from them (FIG. 7C). During time-lapse microscopy in the presence of etoposide, inventors observed the natural reversal of etoposide-induced tubules paralleled by the resealing of chromatin (FIG. 7D). Also, repressing tubule formation via pre-treatment with nocodazole or vinblastine exacerbated etoposide-induced DSB accumulations (FIG. 1A-C,F-H; FIG. 6M and 7E). Etoposide still induced tubules associated with 53BP1 foci in nocodazole-treated cells as long as the latter drug was removed, and cells were allowed to recover for an hour before etoposide treatment (FIG. 1A-C,F-H; FIG. 6A). Similarly, etoposide-induced DSBs marked by the RAD51 HR protein co-localized with LMNB1 tubules (FIG. 7F).
[0281] Considering the association of LMNB1 tubules with 53BP1 and RAD51 (FIG. 7A,F) and the induction of the tubules in Gi and S / G2 stages of the cell cycle (FIG. ID), inventors assessed LMNB1 tubules after inhibiting the DDR kinases. The latter are the HR- related ATR, NHEJ-related DNAPK, and general DDR regulator ATM. Beyond their well- characterized role in DNA repair, these kinases are linked to nuclear envelope proteins ormicrotubule-associated kinesins (FIG. 7G). Indeed, etoposide-induced tubule levels robustly decreased upon ATM or DNAPK inhibition and mildly decreased following ATR inhibition (FIG. II; FIG. 7H,I). Higher dependence on ATM and DNAPK can reflect a closer association of the tubules with these kinases. ATR, an essential serine / threonine kinase, can also operate separately from the DDR to promote baseline tubule levels in the absence of exogenous damage sources, partly masking a potentially greater role in tubule formation. Also, disrupting endogenous DSB repair by knocking down the DNA repair factors KU70, RAD50, or NBS1 was sufficient to induce the tubules (FIG. 7J-M). Thus, diverse DNA damage sources can induce LMNB1 tubulation. DNAPK, ATM, and ATR can induce the tubules in response to DNA damage. The tubules, generated in Gi or S / G2 cell cycle stages, infiltrate chromatin, capturing DSBs marked by NHEJ or HR proteins.
[0282] DSBs and LMNB1 tubules were efficiently induced at all etoposide concentrations tested (FIG. 8A,B). Etoposide triggered LMNB1 tubules in different cell types, including non-cancerous cells (FIG. 8C-F). Also, treating cells with the cyclin-dependent kinase and transcription inhibitor flavopiridol or the proteasome inhibitor MG132 moderately yet proportionally increased the levels of 53BP1 foci and LMNB1 tubules (FIG. 8G,H). So, LMNB1 tubules are triggered in all cell types tested and respond to different treatments directly or indirectly causing DNA damage.
[0283] To determine if LMNB1 -positive tubules and their impact on DSBs are influenced by nuclear envelope-embedded factors linked to genome stability12,22,51, inventors studied LINC, kinesin, and NPC proteins. In addition to being LMNB1 -positive, tubules harbored the INM-marking LINC subunit SUN2, ONM-marking LINC subunit SYNE1 (a.k.a. Nesprin-1), and the NPC-indicating NUP98 (FIG. 2A). Given the placement of the lamina, INM, and ONM at the tubules, inventors dubbed them DSB-capturing nuclear envelope tubules (dsbNETs). Knockdown of the LINC subunits SUN1 or SUN2 decreased dsbNETs induction by etoposide and increased the accumulation of 53BPl-marked DSBs (FIG. 2B; FIG. 9A). Despite the induction of 53BP1 foci upon SUN1 or SUN2 knockdown, dsbNETs depended more on SUN1 than SUN2 proteins, showing that they ensure genome stability via at least partly independent processes (FIG. 2B). Inventors detected baseline interactions of 53BP1 with LMNB1 or SUN1 throughout the nucleus with a preference for the nuclear interior (FIG. 2C; FIG. 9B). Etoposide treatment further increased the levels of these interactions (FIG. 2C; FIG. 9B). In addition to LINC, NPCs are nuclear envelope constituents promoting genome stabilityvia various mechanisms51,52. The NPC central channel trafficking protein NUP98 is linked to genome stability53,54, and the NPC basket component NUP153 promotes genome stability through different processes such as 53BP1 nuclear import55. NUP153 knockdown strongly repressed dsbNETs and induced ' / H2AX but not 53BP1 foci in cells treated with etoposide (FIG. 2D,E; FIG. 9A). NUP153 knockdown did not alter SUN1 levels or localization to LMNB1 tubules in etoposide-treated cells, and knockdown of the NUP153-interacting NPC basket component NUP50 also prevented dsbNETs induction upon etoposide treatment (FIG. 9C-G). In contrast, NUP98 knockdown induced 53BP1 foci and dsbNETs, indicating this NPC protein promotes genome stability separately from the tubules (FIG. 2D). Moreover, LMNB1 knockdown prevented the formation of LMNA / C-marked dsbNETs upon etoposide treatment (FIG. 9H,I). These results reveal that lamina, SUN, and NPC proteins promote dsbNETs. Although inventors cannot entirely exclude the possibility that trafficking through NPCs promotes dsbNETs, they did not require the NUP98 trafficking protein53.
[0284] Considering the dependence of dsbNETs on microtubules (FIG. 1A-C,E; FIG. 6F-M), kinesin-mediated relocation of DSBs along intranuclear microtubule filaments to the nuclear periphery for repair in yeast7,9,11, and role of kinesins in mammalian DSB mobility and repair15, inventors asked whether kinesins regulate dsbNETs. Cytoplasmic microtubules are generally laid with their static or minus-end at the microtubule-organizing center and their dynamic or plus-end towards the cell membrane or ONM12,56. So, inventors considered plusend and minus -end-directed kinesins as promoters and repressors of dsbNETs, excluding kinesins with critical mitotic roles7,15,57. Knockdown of the microtubule plus-end-directed kinesin-1 protein KIF5B repressed dsbNETs and induced 53BP1 foci upon etoposide treatment (FIG. 2F; FIG. 9A). KIF5B localized to etoposide-induced LMNB1 tubules (FIG. 9J,K). KIF5B-(T92N) is a motor rigor mutant that binds to but fails to release from or mobilize onto microtubules58. Expressing KIF5B-(T92N), but not wild-type KIF5B, prevented dsbNETs induction and boosted 53BP1 foci numbers following etoposide treatment (FIG. 9J-L). Unlike KIF5B disruption, knockdown of the microtubule minus-end-directed kinesin-14 protein KIFC3 did not limit the induction of dsbNETs but still exacerbated DSB accumulation (FIG. 2F; FIG. 9A). Notably, KIFC3 knockdown compromised the reversal of dsbNETs upon etoposide removal (FIG. 2G), consistent with a contribution to repair via the timely reversal of the tubules and with their transient nature (FIG. 6L and 7D). These data so far indicate thatSUN1, SUN2, NUP153, NUP50, and KIF5B cooperate with microtubules to promote the formation of transient dsbNETs that are reversed via KIFC3 to promote DNA repair.
[0285] Next, inventors aimed to decipher the nuclear-cytoplasmic communication underlying tubulation. Inhibiting ATM, ATR, and DNAPK decreased the ability of etoposide to induce microtubule-positive LMNB1 tubules (FIG. 9M). The acetylation of lysine 40 on a- Tubulin (Ac-aTub) by ATAT1 within the microtubule filaments’ lumen promotes Kinesin-1 recruitment and allows them to bend without breaking59'61. Inventors detected Ac-aTub foci at the tips of etoposide-induced LMNB1 tubules (FIG. 2H). Etoposide increased Ac-aTub levels, which decreased following the drug’s removal (FIG. 21, lanes 1-3). ATM, ATR, or DNAPK inhibition countered the ability of etoposide to induce Ac-aTub (FIG. 21). AT ATI knockdown repressed Ac-aTub levels, preventing the induction of dsbNETs and exacerbating 53BP1- marked DSB levels upon etoposide treatment (FIG. 2J; FIG. 10A-B). Of note, knockdown of the kinesin-3 protein KIF13B, which cooperates with and promotes KIF5B function, fully repressed dsbNETs (FIG. 2J; FIG. I OB)6263. Also, disruption of the perinuclear DSB-tethering factor Period 1 (PERI) partly repressed dsbNETs, increasing DSB levels (FIG. 2J; FIG. 10B)64. Knockdown of AT ATI, KIF13B, or PERI did not alter cell cycle distributions (FIG. 10C). Moreover, similar to the knockdown of KIF5B or NUP153, ATAT1 knockdown increased the levels of free DSB ends and lowered the rate of DNA repair (FIG. 10D). Of note, SUN1 knockdown similarly reduced DNA repair kinetics assessed by 53BP1 foci resolution (FIG. 10E). SUN1 knockdown did not alter 53BP1 foci size upon etoposide treatment, but enlarged the foci six hours post-drug removal, showing persistent DSBs cluster20,64’65or hyper-engage the DDR at that stage (FIG. 10F,G). These findings reveal that DDR kinases intersect with AT ATI -dependent Ac-aTub. Cooperation between acetylated microtubules, LINC and NPC factors, and kinesins KIF5B, KIF13B, and KIFC3 regulates dsbNETs.
[0286] Inventors next asked whether triggering DNA damage at a single genomic locus induces dsbNETs. Inventors used a mCheny -tagged FokI endonuclease reporter DSB (Fokl- DSB) to trigger the lesions at a single chromosomal locus (FIG. 11 A; see Methods). Inventors confirmed Fokl-DSB induction by the emergence of a mCherry focus colocalizing with 53BP1 in single cells, 53BP1 enrichment onto Fokl-DSB chromatin, and CHK2 phosphorylation (FIG. 11B-D). Cells with an induced Fokl-DSB exhibited nuclear envelope tubules that were less extensive compared to those induced by etoposide (FIG. 3A-D; compare FIG. 3A,C to FIGs.6B,C and 8D). The Fokl-DSB-induced LMNB1 tubules were still repressed by nocodazole (FIG. 3B-D). Also, Fokl-DSB co-localized with LMNB1 more at the tubules than the nuclear edge (FIG. 3E). Amongst cells where inventors did not capture the break right at the tubular or boundary envelope, the average tubule-to-DSB distance was still relatively short (FIG. 3A,E). Knockdown of SUN1, SUN2, NUP153, or KIF5B repressed Fokl-DSB-induced dsbNETs and increased the distance between the DNA lesion and LMNB1 (FIG. 3F; FIG. 11E-I). Moreover, SUN1 knockdown increased the distance between the DSB and nuclear edge at least partly independently of histone deacetylase inhibition (FIG. 11 J). This observation shows that the impact of SUN1 on DSB positioning does not simply reflect a decrease in perinuclear silent chromatin. Notably, the DSB localized to nuclear actin filaments contacting LMNB1 tubules in 46.7±3.8% of cells, showing relatively stable actin-DSB interactions can promote transient DSB-tubule connections (FIG. 3G). Indeed, disrupting actin polymerization using latrunculin- B partly decreased the localization of the DSB at LMNB1 tubules (FIG. 3H; FIG. UK). Amongst cells with Fokl-DSB at an actin filament contacting a LMNB1 tubule, the proportion of cells with the DSB at the free end of the filament decreased over time (FIG. 31). This is consistent with DSB mobilization along damage-induced nuclear filaments towards the envelope9,10,14. In addition, the Fokl-DSB was often linked to a complex network of nuclear LMNB1 tubules and actin filaments, showing the latter can stabilize dsbNETs (FIG. 3J). Latrunculin-B partly decreased Fokl-DSB-induced tubules (FIG. 3K; FIG. 11L). Similarly, disrupting actin polymerization pharmacologically or using the nuclear actin-disrupting NLS- Actin-R62D partially repressed etoposide-induced tubules (FIG. 11M,N)66. So, DNA damage at a single chromosomal locus can trigger dsbNETs-DSB contacts, which are partly promoted by nuclear actin filaments delivering the DSB to the tubules or physically stabilizing dsbNETs.
[0287] To gain insight into the mechanistic role of dsbNETs at the DNA lesion, inventors closely examined the structure of the mCherry -marked DSB site. Knockdown of SUN1 or SUN2 increased the percentage of Fokl-DSB foci with long or split shapes (FIG. 3L,M(left)). 53BP1 co-localized with long and split foci, confirming their engagement with repair (FIG. 3L). The split DSBs had one lobe protruding from 53BP1 foci (FIG. 3L). Marking one DSB end using sequence-specific short guide RNAs and catalytically dead Cas9 fused to a green fluorescent protein (dCas9-GFP) labeled round DSBs fully and elongated or split DSBs on one side (FIG. 12A,B). Knockdown of the DSB ends tethering NBS1 or RAD50, but not pharmacologically disrupting silent chromatin, induced DSB ends splitting (FIG. 12C). SUN1or KIF5B knockdown limited the DSB induction-dependent enrichment of XRCC4 at the lesion (FIG. 12D,E). These results confirm that non-spherical DSB shapes reflect disconnected or loosely connected break ends, consistent with the gradual alignment of DSB ends during repair67,68. The present findings show that dsbNETs help sequester DSB ends within the 53BP1 repair focus, facilitating DSB ends reconnection. So, inventors inventors envisaged that enlarging 53BP1 repair centers can reconnect DSB ends in LINC-deficient cells. Indeed, expanding the size of 53BP1 foci using enoxacin69in SUN1 or SUN2 deficient cells reconnected DSB ends (FIG. 3M; FIG. 12F-H), bypassing the need for dsbNETs (FIG. 3N; FIG. 121). The present findings show dsbNETs help reconnect DSB ends, sequestering them within the repair center. Disrupting SUN proteins compromises dsbNETs, disconnecting DSB ends, which escape the repair focus. Enlarging the repair focus bypasses the need for dsbNETs, reconnecting break ends in LINC-deficient cells. Enoxacin can limit DSB end splitting in dsbNET-deficient cells via additional repair-promoting effects.
[0288] To evaluate the impact of disrupting dsbNETs on the repair of different single damaged loci, inventors employed additional chromosomally-integrated reporters assessing HR or NHEJ (see Methods). As expected, the knockdown of BRCA1 and XRCC4 decreased HR and NHEJ, respectively (FIG. 12J,K). Knockdown of the dsbNETs -promoting KIF5B decreased HR and NHEJ (FIG. 12J,K). These results indicate that dsbNETs promote the repair of DSBs induced using diverse endogenous or exogenous DNA damage sources.
[0289] The SUN 1 N-terminal region mediates interactions with the nuclear lamina and chromatin (FIG. 13A)12’15. Therefore, inventors engineered and expressed an enhanced GFP- tagged SUN1 that was either full-length (GFP-SUN1) or lacking the lamina and chromatin interaction domain (GFP-SUN1AN) (FIG. 4A; FIG. 13B,C). The truncated SUN1 lacks the lamina and chromatin-binding domain but retains SUN and transmembrane domains mediating LINC assembly and localization, respectively70. Inventors included a chimeric protein fusing GFP-SUN1AN to the KU70 NHEJ protein, which is not required for tubulation (FIG. 7J), creating KU70-GFP-SUN1AN. Inventors also used KU70-GFP alone as an additional control. Although inventors engineered all SUN 1 fusions to resist a siRNA targeting endogenous SUN 1 (FIG. 13B, FIG. 13C), expression of full-length or truncated SUN1 fusions was well tolerated by Fokl-DSB cells only in the presence of endogenous SUN1. So, inventors used the chimeric proteins in Fokl-DSB cells harboring endogenous SUN1. The GFP-SUN1, GFP-SUN1AN, or KU70-GFP-SUN1AN similarly localized around LMNB1 at the nuclear edge while KU70-GFPwas nucleoplasmic, as expected (FIG. 4A). Although LMNB1 -marked tubules formed upon expressing each of the chimeric proteins (FIG. 4B,C), relative to the GFP-SUN1 chimera, GFP- SUN1AN and KU70-GFP-SUN1AN did not efficiently localize to LMNBl-marked tubules (FIG. 4D). This observation is consistent with the tubules’ dependence on endogenous SUN1 (FIG. 3F; FIG. 11 G) and indicates that the chromatin / lamina-interacting domain of GFP-tagged SUN1 either provides it with access to or retains it within LMNBl-marked tubules.
[0290] Compared to GFP-SUN1, expression of GFP-SUN1AN but not KU70-GFP- SUN1 AN increased the distance between the DSB and nuclear edge (FIG. 4E). Also compared to GFP-SUN1, GFP-SUN1AN decreased DSB-LMNB1 colocalization at the tubules and nuclear boundary (FIG. 4F). Notably, fusing GFP-SUN1AN to KU70 restored DSB-LMNB1 colocalization at the boundary but not the tubules (FIG. 4F). In addition, cells expressing GFP- SUN1, GFP-SUN1AN, or KU70-GFP-SUN1AN all showed more split and long DSB shapes (FIG. 4G), indicating that the overexpression of any SUN 1 -containing chimeric protein limits SUNl’s ability to connect DSB ends. These findings indicate that the N-terminal domain of SUN1 allows it to localize to dsbNETs and is required for the protein’s ability to capture DSBs (FIG. 13D). Also, fusing truncated SUN1 to KU70 restores the protein’s ability to capture DSBs only at the nuclear boundary (FIG. 13D). So, connecting SUN1AN to KU70 and the ensuing restoration of SUN1 AN-DSB interactions is not sufficient to license SUN1 AN for entry into the tubules. These results highlight a crucial role for the lamina / chromatin-interacting domain of SUN1 in licensing it for entry into the tubules.
[0291] Of note, immunoblotting revealed that SUN1 migrates to differently sized bands repressible by SUN1 knockdown (FIG. 13E). Also, etoposide altered the relative abundance of the different SUN1 bands, indicating complex protein regulation during DNA repair (FIG. 13F). In contrast, etoposide lowered SUN2 expression (FIG. 13G). These observations indicate a potential reconfiguration of SUN1 and SUN2-containing complexes during repair. Notably, etoposide treatment increased the general protein phosphoserine signal but not the ubiquitylation signal co-immunoprecipitating with SUN1 (FIG. 13H,I). The present data show that SUN1 or its binding partners can be subject to serine phosphorylation as part of complex LINC reconfigurations during DNA repair.
[0292] Inventors then further explored the connection between tubulin and dsbNET formation. Tubulin and microtubules can undergo a number of post-translational modificationscollectively known as the “tubulin code”. Much like the histone code, the tubulin code can modify the structural properties of microtubules and regulate the types of proteins that interact with microtubules71. Three components of the tubulin code include acetylated a-Tubulin (Ac- aTub), detyrosynated a-Tubulin (DeY-aTub), and polyglutamylated a-tubulin and P-tubulin (polyQ-Tub). Tubulin acetylation occurs on lysine 40 (K40) of alpha-tubulin, weakening the interactions between adjacent microtubule protofilaments and making microtubules more flexible and less prone to breakage60. Detyrosination involves the removal of a terminal tyrosine residue of the c-terminal tail of a-Tubulin71. Detyrosination occurs over time on microtubule filaments and is a marker of stable microtubules preferentially bound by plus-end directed kinesin motor proteins72. Finally, polyglutamylation involves the addition of glutamate residues on the c-terminal tails of a-tubulin and P-tubulin71. Varying degrees of polyglutamylation can result in different protein interactions, where relatively higher levels promoting kinesin-1 processivity and relatively lower levels recruiting microtubule-severing enzymes73,74. Collectively, these tubulin modifications can respond to physiological or environmental changes, so inventors were interested in investigating if the induction of DNA damage can result in changes in this broader tubulin code.
[0293] Inventors observed a gradual increase in Ac-aTub and DeY-aTub levels detected as early as 10 to 15 minutes of etoposide addition (FIG. 14A, FIG. 14B). There were no significant changes in polyQ-Tub levels in up to 60 minutes of etoposide treatment (FIG. 14A, FIG14B). Following a one-hour etoposide treatment and removal of the DNA-damaging agent, the levels of acetylated, detyrosinated, and polyglutamylated tubulin steadily declined over a two-hour-long period (FIG. 14C, FIG. 14D). In addition to etoposide, inventors assessed the effects of two other DNA-damaging agents, zeocin and irradiation (IR), which each induce damage via distinct processes. Notably, Zeocin and IR induced dsbNETs in a manner proportionate to the DNA damage induced by each agent (FIG. 15 A, FIG. 15D). Similar to etoposide treatment, zeocin treatment resulted in a gradual increase in the levels of acetylated and detyrosinated tubulin, but not polyglutamylated tubulin (FIG. 15B, FIG. 15C). IR increased dsbNET and acetylated tubulin levels at one hour post-IR treatment when DSB levels peaked, and acetylated tubulin and dsbNET levels declined as DSB levels decreased at six hours post- IR treatment (FIG. 15D, FIG. 15E). Taken together, inventors’ findings indicate that DNA damage induces reversible increases in acetylated and detyrosinated tubulin levels, while polyglutamylated tubulin levels change and decrease primarily as cells recover from damage.
[0294] Inventors already showed above that acetylated microtubules localize with dsbNETs. Similar to acetylated microtubules, inventors observed that detyrosinated microtubules co-localize with nuclear envelope tubules when cells are treated with etoposide (FIG. 16A, FIG. 16B). To assess the importance of detyrosinated microtubules in promoting dsbNETs formation, inventors used the inhibitor EPOY, which inhibits the Vasohibin-1 (VASH1) and Small Vasohibin Binding Protein (SVBP) complex (VASH1 / SVBP; and its equivalent VASH2 / SVBP) that catalyzes microtubule detyrosination71. Treatment with EPOY strongly reduced detyrosinated Tubulin levels (FIG. 16C), repressed dsbNET formation (FIG. 16D (left)), and increased etoposide-induced DSBs levels (FIG. 16D (right)). Therefore, detyrosinated microtubules are required for the formation of dsbNETs in response to DNA damage.
[0295] Alpha-tubulin acetyltransferase 1 (ATAT1) is the only acetyltransferase known to acetylate K40 of alpha-tubulin75. Inventors have shown herein that ATAT1 is required for the formation of dsbNETs and that loss of ATAT1 leads to an accumulation of etoposide- induced DSBs as well as a delay in the repair of DSBs (FIG. 2J, FIG. 10A, FIG. 10B, FIG. 10C and FIG. 10D). Moreover, inventors observed that the etoposide-induced increase of K40 tubulin acetylation was impaired when cells were pre-treated with DDR kinase inhibitors (FIG. 21 and FIG. 9M). Inventors’ unbiased analysis of published raw mass spectrometry datasets76focusing on GFP-ATAT1 as bait protein showed an interaction of DNAPKcs (FIG. 17A, FIG. 17B). Inventors validated this interaction in experiments showing the co-immunoprecipitation of DNAPKcs with GFP-ATAT1 in the absence and presence of DNA damage (FIG. 17C). These findings show that ATAT1 can constitutively bind to DNAPKcs, enabling DNA damage-induced activation of DNAPKcs to hyper-activate AT ATI.
[0296] Considering the higher DNA damage levels in cancer, inventors explored the impact of dsbNETs on different cancers (Table 1). Given that dsbNETs are induced by KIF5B and reversed by KIFC3, inventors compared the expression of these dsbNETs regulators to the expression of DNA repair factors across cancer RNA-Seq datasets (see Methods). KIF5B and KIFC3 expression positively and negatively correlated with that of DNA repair proteins involved in different repair pathways across cancers, respectively (FIG. 18A, FIG. 18B). KIF5B expression positively correlated with an NHEJ gene expression signature in 92% (23 / 25) of cancers, while KIFC3 expression negatively correlated with the same signature in 84% (21 / 25) (FIG. 5A; FIG. 18C). Bias towards a positive correlation c KIF5B and negativecorrelation of KIFC3 with the NHEJ signature was more pronounced than with HR or alternative end-joining (altEJ) DNA repair signatures (FIG. 5 A, FIG. 5B, FIG. 18C, FIG. 18D, and FIG. 18E). Breast cancer showed bias towards a positive correlation of KIF5B and a negative correlation (A KI FC 3 for HR and especially NHEJ (FIG. 5A-B). These results indicate cancer cells can better tolerate their high DNA damage load by coordinating the expression of DNA repair factors and dsbNETs regulators. Moreover, human breast tumor sections with mutations in the HR-mediating breast and ovarian cancer genes BRCA1 or BRCA2 showed nuclei with nuclear membrane grooves (FIG. 19A, FIG. 19B). These features resemble nuclear membrane grooves observed on histopathologic examination of several tumor types, including adult granulosa cell tumor, papillary thyroid carcinoma, and Langerhans cell histiocytosis77,78. This characteristic is a valuable diagnostic clue for pathologists, but the pathophysiology leading to this morphologic attribute remains unclear.
[0297] Therefore, inventors explored connections between dsbNETs and breast cancer in cell culture. Inventors used aggressive triple-negative breast cancer (TNBC) cells with wildtype (MDA-MB-231) or mutant (MDA-MB-436) BRCA1 as well as non-tumorigenic MCF10A mammary epithelial cells. Inventors detected microtubule-positive LMNB1 tubules in all cell types, especially upon treatment with etoposide (FIG. 5C). BRCA1 -mutant cells lack HR, overrely on NHEJ and other repair pathways, and are preferentially killed by the clinically approved PARP inhibitor (PARPi) olaparib, which induces deleterious misjoined chromosomes15,79,80. Unlike etoposide (FIG. 5C), the induction of microtubule-positive LMNB1 tubules by olaparib was more pronounced in / / / ( A / -mutant TNBC cells compared to BRCA1 -proficient TNBC or MCF10A cells (FIG. 5D). Moreover, transient knockdown of BRCA1 in MDA-MB-231 cells increased tubulation upon olaparib treatment (FIG. 5E; FIG. 19C). So BRCA1 deficiency exacerbates dsbNETs induction in TNBC cells upon exposure to olaparib more than to etoposide.
[0298] To assess the impact of dsbNETs on breast cancer cells, inventors inducibly knocked down KIF5B or KIFC3 in MDA-MB-231 and MDA-MB-436 cells (FIG. 19D, FIG. 19E). Knockdown of KIF5B but not KIFC3 abrogated dsbNETs induction by etoposide or olaparib (FIG. 19F). Also, depletion of KIF5B or KIFC3 increased etoposide- and olaparib- induced DSB levels in short-term cultures (FIG. 19G). / / / / ( A / -mutant breast cancer cells are sensitive to PARPi, but the development of resistance to this life-saving class of drugs can underly clinical relapse80. Thus, there exists a need to identify mechanisms potentiatingsensitivity to PARPi. Disrupting KIF5B but not KIFC3 decreased the sensitivity of MDA-MB- 436 cells to PARPi in long-term cultures (FIG. 5F; 7 days). Similarly, the ability of PARPi to eventually induce toxic misjoined chromosomes in BRC Al -deficient cells decreased following the knockdown of KIF5B (-56.6%) but not KIFC3 (FIG. 20A). So, the transient formation of dsbNETs within 24 h of DNA damage onset lowers DSB levels in cells treated with etoposide or PARPi, through the action of NHEJ. However, the ability of PARPi to induce toxic chromosomes in HR / BRCA1 -deficient cells relies on KIF5B and dsbNETs. Indeed, the ability of PARPi to induce deleterious chromosome structures via NHEJ in BRC Al -deficient murine cells also depends on SUN1, SUN2, and microtubules12,15.
[0299] Inventors then assessed the impact of depleting the kinesins on long-term cancer cell growth without exogenous DNA damage. Knockdown of KIF5B or KIFC3 did not alter cell growth in the short-term (2-4 days) but eventually lowered growth (6-11 days), especially in 7> / ?( L4 / -mutant MDA-MB-436 cells (FIG. 5G). Assessing the long-term ability of cells to grow into colonies yielded similar results (FIG. 5H). Also, knockdown of KIF5B or KIFC3 induced senescence in MDA-MB-436 cells (FIG. 20B). Moreover, knockdown of either kinesin decreased the ability of MDA-MB-436 cells to form tumors in mouse xenografts (FIG. 51, FIG. 20C, FIG. 20D). Reanalysis of genomic DepMap CRISPR screens confirmed a synthetic lethal interaction between BRCA1 and KIF5B (FIG. 20E; see Methods). Together with prior studies7,15, these data indicate that disrupting dsbNETs alone decreases accurate repair, inducing ectopic repair that eventually hinders cell growth. Under BRCA1 deficiency, the ability of PARPi to induce cancer cell-killing aberrant chromosomes via NHEJ partly depends on dsbNETs-inducing factors, including KIF5B, SUN1 / 2, and microtubules.
[0300] Considering the above links between dsbNETs and cancer, disruption of the nuclear lamina in aging, and higher Ac-aTub levels in premature aging, inventors explored the intersection of premature aging, DNA damage, and dsbNETs12,81. LMNA mutations can lead to the expression of a Progerin mutant protein causing Hutchinson-Gilford progeria syndrome (HGPS), a severe premature aging disorder12,81. Progerin is associated with nuclear envelope deformations and genome instability. Expression of Progerin, but not wild-type LMNA, increased the baseline levels of 53BP1 foci and LMNB1 tubules (FIG. 20F). DSB and tubule levels were higher in cells expressing Progerin and treated with etoposide than in cells exposed to Progerin or etoposide separately (FIG. 20F). So, Progerin-expressing cells can be in a hyperactive or perpetual state of nuclear-cytoplasmic DNA damage response.
[0301] Kaplan Meier analysis of the TCGA Pan-Cancer (PANCAN) cohort revealed that high ATAT1 mRNA expression and high acetylated tubulin protein level correlate with low patient survival probability (FIG. 21 A). ATAT1 mRNA and acetylated tubulin protein are highly expressed across different cancers (FIG. 21B), including aggressive breast and ovarian cancers (BRCA, OV)82,83. Of note, of the upper 50% of cancers with elevated ATAT1 expression, 37.5% of cancers also ranked in the upper 50% of cancers for AcTubl alpha protein expression levels (FIG. 21B). These cancers were Brain Lower Grade Glioma (LGG), Glioblastoma Multiforme (GBM), Uterine Carcinosarcoma (UCS), Uterine Corpus Endometrial Carcinoma (UCEC), Pheochromocytoma and Paraganglioma (PCPG), and Cholangiocarcinoma (CHOL). Importantly, pharmacogenomic analysis of breast cancer cell lines notably revealed that cells with high ATAT1 expression had higher sensitivity to the DNAPK inhibitor KU0060648 (FIG. 21 C). Taken together, these findings indicate that ATATl-overexpressing cancers likely over-rely on DNAPKcs-ATATl interactions and subsequent increases in AcTubalpha levels. Therefore, inhibiting the interaction between AT ATI and DNAPKcs or the overlapping function of each of these proteins in the DDR may provide a viable therapeutic approach exploiting an important vulnerability of different cancer cell types.
[0302] Inventors tested potential ATAT1 inhibitors and their impact on dsbNET formation in etoposide-treated cells. Inventors found that folic acid, mangafodipir, and hesperidin strongly impaired dsbNET formation without strongly increasing the baseline tubule-positive cells (FIG. 22A). Interestingly, although mangafodipir minimally reduced acetylated tubulin levels in vehicle-treated cells (FIG. 22B, FIG. 22D), pre-treatment with mangafodipir impaired etoposide induced tubulin hyperacetylation (FIG. 22C, FIG. 22D). Mangafodipir treatment impaired dsbNETs induction and consequently led to the accumulation of etoposide-induced DSBs (FIG. 22E). Ceftolozane, another predicted ATAT1 inhibitor84, also impaired etoposide-induced tubulin hyperacetylation, though to a lesser extent than mangafodipir (FIG. 22F). In addition, inventors were interested in exploring the effect of Latrunculin B, an actin depolymerization agent, on the tubulin hyperacetylation response to DNA damage. Inventors have also shown herein above that actin fdaments can promote the dsbNETs response to DNA damage. Pre-treatment with increasing concentrations of Latrunculin B impaired the tubulin hyperacetylation response to etoposide treatment (FIG. 22G), showing that actin polymerization can reinforce tubulin acetylation. Alternatively,Latrunculin B can interfere with tubulin acetylation in an unknown process. Overall, candidate AT ATI inhibitors can impair the tubulin hyperacetylation response to DNA damage.
[0303] These results show that cells respond to DNA damage with increases in markers of stable microtubules, specifically acetylation and detyrosination. As cells recover from damage, tubulin acetylation, detyrosination, and polyglutamylation levels steadily decline. As has been demonstrated for acetylated microtubules, detyrosinated microtubules localize with dsbNETs and are required for their formation in response to DNA damage. To gain more mechanistic insight on the signaling involved in the dsbNETs response, inventors analyzed mass spectrometry data of ATAT1 and found that it interacts with the DDR kinase DNAPK. The importance of this interaction was supported by pharmacogenomic data indicating that breast cancer cells highly expressing AT ATI are more sensitive to DNAPKcs inhibition. Finally, testing computationally predicted inhibitors of ATAT1 revealed small molecules that repress DNA damage-induced tubulin hyperacetylation and impede the dsbNET response to DNA damage. Thus, the tubulin code is modified following DNA damage to dsbNET formation and targeting tubulin-modifying factors such as ATAT1 or VASH1 / SVBP constitutes putative therapeutic avenues to target various cancers or other dsbNET-linked conditions.
[0304] Inventors present dsbNETs and their regulators and roles in DNA repair, impacting cancer and aging (FIG. 5J; FIG. 23). These findings point to a nuclear-cytoplasmic arm of the DDR, where the checkpoint kinases promote Ac-aTub as part of a set of changes to the tubulin code, allowing microtubules to induce dsbNETs. DDR kinases can modify dsbNETs regulators as SUN1 physically interacts with DNAPK and can be modified during repair85. DDR kinases can be further activated by forces exerted on the nucleus, as observed for ATR at membranes under mechanical stress86, establishing a loop sustaining dsbNETs during repair. Future studies should further decipher cytoplasmic responses to nuclear DNA damage, impacting health. Indeed, the HGPS-causing Progerin compromises the nuclear envelope’s ability to resist microtubule forces, dysregulating dsbNETs-dependent DNA repair. This could create a cycle where DSBs excessively induce dsbNETs and vice-versa. Indeed, Ac-aTub levels are elevated in HGPS cells, whose premature aging phenotypes are repressed upon the inhibition of NAT10, another Ac-aTub-depositing acetyltransferase81.
[0305] Inventors propose a unifying model for DSB-nuclear envelope interactions. In yeast and flies, higher DSB mobility allows the lesions to readily diffuse or be transported onto filaments to the envelope at the nuclear edge for repair4'13. Overcoming the lower mobility of human DSBs21'23, dsbNETs can bring the envelope to, or closer to, DSBs. Yet, many mammalian DSBs and DSB-like aberrant telomeres exhibit long-range mobility or clustering16'20. Also, inventors captured -53% of human DSBs at dsbNETs. So, a sizable pool of DSBs can still be targeted to the nuclear edge or repaired away from the envelope. The solid support provided to DSBs by dsbNETs is reminiscent of the perinuclear tethering of sister chromatids ensuring yeast lifespan-sustaining equal recombination during DNA replication3,37. So, dsbNETs or similar DNA-capturing nuclear envelope tubules can support diverse molecular pathways.
[0306] Current models suggest the interphase nucleus in healthy cells is relatively smooth but can be severely deformed in settings including aging and aggressive cancers12. In contrast, inventors show the interphase nucleus can rapidly and drastically contort to protect cells. Overall, the present study redefines subject matter of the nuclear structure-function relationship, which impact on health and disease.
[0307] The inventors’ model is supported by the ability of the human nuclear envelope to promote genome stability87'89. For instance, the transmembrane nuclease NUMEN, which specifically promotes NHEJ and limits HR, is enriched at the nuclear boundary and intranuclear lamin signals87. Also, evolutionarily conserved factors linked to the SUMOylation of proteins at the yeast nuclear envelope during repair via different pathways are enriched at the nuclear envelope and localize to and promote the repair of DSBs throughout the human nucleus2,7,68,90'101. For example, yeast KU70 SUMOylation and function is regulated by the SUMO protease Ulpl, which is enriched at the Nup84 and Nup60 NPC factors91,92. An equivalent human SUMO protease, SENP2, localizes to the nuclear envelope via interaction with NUP153 and promotes NHEJ and HR repair93'95. The function of human XRCC4 during NHEJ repair is also linked to SUMOylation96,97. In another example, the non-perinuclear-enriched RNF4, the human equivalent of the yeast DNA repair-promoting and NPC-associated Slx5 / 8 SUMO E3 ligase, is recruited to DSBs and promotes NHEJ and HR throughout the nucleus98'101. Jointly, the inventors finding of dsbNETs and these studies show that the human nuclear envelope and its proteome mediate NHEJ and HR repair.
[0308] While the present disclosure has been described with reference to examples, it is to be understood that the scope of the claims should not be limited by the embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
[0309] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety. Where a term in the present disclosure is found to be defined differently in a document incorporated herein by reference, the definition provided herein is to serve as the definition for the term.FULL CITATIONS FOR DOCUMENTS REFERRED TO IN THE DISCLOSURE1. Hustedt, N. & Durocher, D. The control of DNA repair by the cell cycle. Nat. Cell Biol. 19, 1-9 (2016).2. Nagai, S. et al. Functional targeting of DNA damage to a nuclear pore-associated SUMO- dependent ubiquitin ligase. Science 322, 597-602 (2008).3. Mekhail, K., Seebacher, J., Gygi, S. P. & Moazed, D. Role for perinuclear chromosome tethering in maintenance of genome stability. Nature 456, 667-670 (2008).4. Chiolo, I. et al. Double-strand breaks in heterochromatin move outside of a dynamic HP la domain to complete recombinational repair. Cell 144, 732-744 (2011).5. Dion, V., Kalck, V., Horigome, C., Towbin, B. D. & Gasser, S. M. Increased mobility of double-strand breaks requires Mecl, Rad9 and the homologous recombination machinery. Nat. Cell Biol. 14, 502-509 (2012).6. Mine-Hattab, J. & Rothstein, R. Increased chromosome mobility facilitates homology search during recombination. Nat. Cell Biol. 14, 510-517 (2012).7. Chung, D. K. et al. Perinuclear tethers license telomeric DSBs for a broad kinesin- and NPC-dependent DNA repair process. Nat. Commun. 6, 7742 (2015).8. Ryu, T. et al. Heterochromatic breaks move to the nuclear periphery to continue recombinational repair. Ato. Cell Biol. 17, 1401-1411 (2015).9. Oshidari, R. et al. Nuclear microtubule fdaments mediate non-linear directional motion of chromatin and promote DNA repair. Nat. Commun. 9, 2567 (2018).10. Caridi, C. P. et al. Nuclear F-actin and myosins drive relocalization of heterochromatic breaks. Nature 559, 54-60 (2018).11. Oshidari, R., Mekhail, K. & Seeber, A. Mobility and Repair of Damaged DNA: Random or Directed? Trends Cell Biol. 30, 144-156 (2020).12. Shokrollahi, M. & Mekhail, K. Interphase microtubules in nuclear organization and genome maintenance. Trends Cell Biol. 31, 721-731 (2021).13. Stanic, M. & Mekhail, K. Integration of DNA damage responses with dynamic spatial genome organization. Trends Genet. 38, 290-304 (2022).14. Oshidari, R. et al. DNA repair by Rad52 liquid droplets. Nat. Commun. 11, 695 (2020).15. Lottersberger, F., Karssemeijer, R. A., Dimitrova, N. & de Lange, T. 53BP1 and the LINC Complex Promote Microtubule-Dependent DSB Mobility and DNA Repair. Cell 163, 880- 893 (2015).16. Jakob, B., Splinter, J., Durante, M. & Taucher-Scholz, G. Live cell microscopy analysis of radiation-induced DNA double-strand break motion. Proc. Natl. Acad. Sci. USA 106, 3172-3177 (2009).17. Cho, N. W., Dilley, R. L., Lampson, M. A. & Greenberg, R. A. Interchromosomal homology searches drive directional ALT telomere movement and synapsis. Cell 159, 108- 121 (2014).18. Aymard, F. et al. Genome- wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nat. Struct. Mol. Biol. 24, 353-361 (2017).19. Amould, C. et al. Chromatin compartmentalization regulates the response to DNA damage. Nature 623, 183-192 (2023).20. Zagelbaum, J. et al. Multiscale reorganization of the genome following DNA damage facilitates chromosome translocations via nuclear actin polymerization. Nat. Struct. Mol. Biol. 30, 99-106 (2023).21. Soutoglou, E. et al. Positional stability of single double-strand breaks in mammalian cells. Nat. Cell Biol. 9, 675-682 (2007).Misteli, T. & Soutoglou, E. The emerging role of nuclear architecture in DNA repair and genome maintenance. Nat. Rev. Mol. Cell Biol. 10, 243-254 (2009). Tsouroula, K. et al. Temporal and Spatial Uncoupling of DNA Double Strand Break Repair Pathways within Mammalian Heterochromatin. Mol. Cell 63, 293-305 (2016). Shanbhag, N. M., Rafalska-Metcalf, I. U., Balane-Bolivar, C., Janicki, S. M. & Greenberg, R. A. ATM-dependent chromatin changes silence transcription in cis to DNA doublestrand breaks. Cell 141, 970-981 (2010). Gunn, A. & Stark, J. M. I-Scel-based assays to examine distinct repair outcomes of mammalian chromosomal double strand breaks. Methods Mol. Biol. 920, 379-391 (2012). Scaffidi, P. & Misteli, T. Reversal of the cellular phenotype in the premature aging disease Hutchinson-Gilford progeria syndrome. Nat. Med. 11, 440-445 (2005). Viita, T. et al. Nuclear actin interactome analysis links actin to KAT14 histone acetyl transferase and mRNA splicing. J. Cell Sci. 132 (2019). Muslimovic, A., Nystrom, S., Gao, Y. & Hammarsten, O. Numerical analysis of etoposide induced DNA breaks. PLoS One 4, e5859 (2009). Hoa, N. N. et al. Mrel 1 Is Essential for the Removal of Lethal Topoisomerase 2 Covalent Cleavage Complexes. Mol. Cell 64, 1010 (2016). Quennet, V., Beucher, A., Barton, O., Takeda, S. & Lobrich, M. CtIP and MRN promote non-homologous end-joining of etoposide-induced DNA double-strand breaks in Gl. Nucleic Acids Res. 39, 2144-2152 (2011). Noordermeer, S. M. et al. The shieldin complex mediates 53BP1 -dependent DNA repair. Nature 560, 117-121 (2018). Abraham, K. J. et al. Nucleolar RNA polymerase II drives ribosome biogenesis. Nature 585, 298-302 (2020). Marini, B. et al. Nuclear architecture dictates HIV-1 integration site selection. Nature 521, 227-231 (2015). Lukinavicius, G. et al. Fluorogenic probes for live-cell imaging of the cytoskeleton. Nat. Methods 11, 731-733 (2014). Maass, P. G. et al. Spatiotemporal allele organization by allele-specific CRISPR live-cell imaging (SNP-CLING). Nat. Struct. Mol. Biol. 25, 176-184 (2018). Wu, X. & Hammer, J. A. ZEISS Airyscan: Optimizing Usage for Fast, Gentle, SuperResolution Imaging. Methods Mol. Biol. 2304, 111-130 (2021). Chan, J. N. et al. Perinuclear cohibin complexes maintain replicative life span via roles at distinct silent chromatin domains. Dev. Cell 20, 867-879 (2011). Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat. Methods 9, 676-682 (2012). Arzt, M. et al. LABKIT: Labeling and Segmentation Toolkit for Big Image Data. Front. Comput. Sci. 4, 777728 (2022). Khosraviani, N., Abraham, K. J., Chan, J. N. Y. & Mekhail, K. Protocol to use RNaseHl- based CRISPR to modulate locus-associated R-loops. STAR Protoc. 3, 101734 (2022). Beleon, A. et al. CometAnalyser: A user-friendly, open-source deep-learning microscopy tool for quantitative comet assay analysis. Comput. Struct. Biotechnol. J. 20, 4122-4130 (2022). Patel, P. S. et al. Excessive transcription-replication conflicts are a vulnerability of BRCA1 -mutant cancers. Nucleic Acids Res. (2023). Cancer Genome Atlas, N. Comprehensive molecular portraits of human breast tumours. Nature 490, 61-70 (2012).Knijnenburg, T. A. et al. Genomic and Molecular Landscape of DNA Damage Repair Deficiency across The Cancer Genome Atlas. Cell Rep. 23, 239-254 e236 (2018). Liu, Q. et al. Loss of TGFbeta signaling increases alternative end-joining DNA repair that sensitizes to genotoxic therapies across cancer types. Sci. Transl. Med. 13 (2021). Hanzelmann, S., Castelo, R. & Guinney, J. GSVA: gene set variation analysis for microarray and RNA-seq data. BMC Bioinformatics 14, 7 (2013). Gu, Z., Gu, L., Eils, R., Schlesner, M. & Brors, B. circlize Implements and enhances circular visualization in R. Bioinformatics 30, 2811-2812 (2014). Gu, Z., Eils, R. & Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 32, 2847-2849 (2016). Ghandi, M. et al. Next-generation characterization of the Cancer Cell Line Encyclopedia. Nature 569, 503-508 (2019). Szklarczyk, D. et al. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res. 51, D638-D646 (2023). Mekhail, K. & Moazed, D. The nuclear envelope in genome organization, expression and stability. Nat. Rev. Mol. Cell Biol. 11, 317-328 (2010). Pascual-Garcia, P. & Capelson, M. The nuclear pore complex and the genome: organizing and regulatory principles. Curr. Opin. Genet. Dev. 67, 142-150 (2021). Radu, A., Moore, M. S. & Blobel, G. The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex. Cell 81, 215-222 (1995). Puthiyaveetil, A. G., Reilly, C. M., Pardee, T. S. & Caudell, D. L. Non-homologous end joining mediated DNA repair is impaired in the NUP98-HOXD13 mouse model for myelodysplastic syndrome. Leuk. Res. 37, 112-116 (2013). Moudry, P. et al. Nucleoporin NUP153 guards genome integrity by promoting nuclear import of 53BP1. Cell Death Differ . 19, 798-807 (2012). Dammermann, A., Desai, A. & Oegema, K. The minus end in sight. Curr. Biol. 13, R614- 624 (2003). Hirokawa, N., Noda, Y., Tanaka, Y. & Niwa, S. Kinesin superfamily motor proteins and intracellular transport. Nat. Rev. Mol. Cell Biol. 10, 682-696 (2009). Wiesner, C., Faix, J., Himmel, M., Bentzien, F. & Linder, S. KIF5B and KIF3A / KIF3B kinesins drive MT1-MMP surface exposure, CD44 shedding, and extracellular matrix degradation in primary macrophages. Blood 116, 1559-1569 (2010). Fortran, D., Schaedel, L., Xu, Z., Thery, M. & Nachury, M. V. Tubulin acetylation protects long-lived microtubules against mechanical ageing. Nat. Cell Biol. 19, 391-398 (2017). Xu, Z. et al. Microtubules acquire resistance from mechanical breakage through intralumenal acetylation. Science 356, 328-332 (2017). Reed, N. A. et al. Microtubule acetylation promotes kinesin- 1 binding and transport. Curr. Biol. 16, 2166-2172 (2006). Arpag, G. et al. Motor Dynamics Underlying Cargo Transport by Pairs of Kinesin- 1 and Kinesin-3 Motors. Biophys J. 116, 1115-1126 (2019). Serra-Marques, A. et al. Concerted action of kinesins KIF5B and KIF13B promotes efficient secretory vesicle transport to microtubule plus ends. Elife 9 (2020). Le Bozec, B. et al. Circadian PERIOD complex regulates TC-DSB repair through anchoring to the nuclear envelope. Preprint at https: / / www.biorxiv.org / content / 10.1101 / 2023.05.ll.540338vl (2023).Amould, C. et al. Loop extrusion as a mechanism for formation of DNA damage repair foci. Nature 590, 660-665 (2021). Schrank, B. R. et al. Nuclear ARP2 / 3 drives DNA break clustering for homology-directed repair. Nature 559, 61-66 (2018). Reid, D. A. et al. Organization and dynamics of the nonhomologous end-joining machinery during DNA double-strand break repair. Proc. Natl. Acad. Sci. USA 112, E2575-2584 (2015). Zhao, B. et al. The essential elements for the noncovalent association of two DNA ends during NHEJ synapsis. Nat. Commun. 10, 3588 (2019). Gioia, U. et al. Pharmacological boost of DNA damage response and repair by enhanced biogenesis of DNA damage response RNAs. Sci. Rep. 9, 6460 (2019). Sosa, B. A., Rothballer, A., Kutay, U. & Schwartz, T. U. LINC complexes form by binding of three KASH peptides to domain interfaces of trimeric SUN proteins. Cell 149, 1035- 1047 (2012). Janke, C. & Magi era, M. M. The tubulin code and its role in controlling microtubule properties and functions. Nat. Rev. Mol. Cell Biol. 21, 307-326 (2020). Eshun-Wilson, L. et al. Effects of a-tubulin acetylation on microtubule structure and stability. Proceedings of the National Academy of Sciences 116, 10366-10371 (2019). Sirajuddin, M., Rice, L. M. & Vale, R. D. Regulation of microtubule motors by tubulin isotypes and posttranslational modifications. Nat Cell Biol 16, 335-344 (2014). Valenstein, M. L. & Roll-Mecak, A. Graded Control of Microtubule Severing by Tubulin Glutamylation. Cell 164, 911-921 (2016). Iuzzolino, A., Pellegrini, F. R., Rotili, D., Degrassi, F. & Trisciuoglio, D. The a-tubulin acetyltransferase AT ATI: structure, cellular functions, and its emerging role in human diseases. Cell. Mol. Life Sci. 81, 193 (2024). Seetharaman, S. et al. Microtubules tune mechanosensitive cell responses. Nat. Mater. 21, 366-377 (2022) St Claire, K. et al. Langerhans cell histiocytosis: A great imitator. Clin. Dermatol. 38, 223- 234 (2020). Omori, M. et al. Cytologic features of ovarian granulosa cell tumors in pleural and ascitic fluids. Diagn. Cytopathol. 43, 581-584 (2015). Bunting, S. F. et al. 53BP1 inhibits homologous recombination in Brcal -deficient cells by blocking resection of DNA breaks. Cell 141, 243-254 (2010). Dias, M. P., Moser, S. C., Ganesan, S. & Jonkers, J. Understanding and overcoming resistance to PARP inhibitors in cancer therapy. Nat. Rev. Clin. Oncol. 18, 773-791 (2021). Larrieu, D., Britton, S., Demir, M., Rodriguez, R. & Jackson, S. P. Chemical inhibition of NAT10 corrects defects of laminopathic cells. Science 344, 527-532 (2014). Kwon, A. et al. Potent Small-Molecule Inhibitors Targeting Acetylated Microtubules as Anticancer Agents Against Triple-Negative Breast Cancer. Biomedicines 8, 338 (2020). Boggs, A. E. et al. a-Tubulin Acetylation Elevated in Metastatic and Basal-like Breast Cancer Cells Promotes Microtentacle Formation, Adhesion, and Invasive Migration. Cancer Research 75, 203-215 (2015). Hsu, N.-Y., Pathak, N., Chen, Y.-T., Hsu, Y.-C. & Yang, J.-M. Pharmacophore anchor models of ATAT1 to discover potential inhibitors and lead optimization. Computational Biology and Chemistry 93, 107513 (2021). Lei, K. et al. Inner nuclear envelope proteins SUN1 and SUN2 play a prominent role in the DNA damage response. Curr. Biol. 22, 1609-1615 (2012).Kumar, A. et al. ATR mediates a checkpoint at the nuclear envelope in response to mechanical stress. Cell 158, 633-646 (2014). Chen, B. et al. Transmembrane nuclease NUMEN / END0D1 regulates DNA repair pathway choice at the nuclear periphery. Nat. Cell Biol. 25, 1004-1016 (2023). Lemaitre, C. et al. Nuclear position dictates DNA repair pathway choice. Genes Dev. 28, 2450-63 (2014). Lamm, N. et al. Nuclear F-actin counteracts nuclear deformation and promotes fork repair during replication stress. Nat. Cell Biol. 22, 1460-1470 (2020). Therizols, P. et al. Telomere tethering at the nuclear periphery is essential for efficient DNA double strand break repair in subtel omeric region. J. Cell Biol. 172, 189-99 (2006). Palancade, B. et al. Nucleoporins prevent DNA damage accumulation by modulating Ulpl -dependent sumoylation processes. Mol. Biol. Cell 18, 2912-23 (2007). Hang, L.E. et al. Regulation of Ku-DNA association by Yku70 C-terminal tail and SUMO modification. J Biol Chem 289, 10308-10317 (2014). Garvin, A. J. et al. The deSUMOylase SENP2 coordinates homologous recombination and nonhomologous end joining by independent mechanisms. Genes Dev. 33, 333-347 (2019). Hang, J. & Dasso, M. Association of the human SUMO-1 protease SENP2 with the nuclear pore. J. Biol. Chem. 277, 19961-6 (2002). Zhang, H., Saitoh, H. & Matunis, M.J. Enzymes of the SUMO modification pathway localize to filaments of the nuclear pore complex. Mol. Cell. Biol. 22, 6498-508 (2002). Yurchenko, V., Xue, Z. & Sadofsky, M.J. SUMO modification of human XRCC4 regulates its localization and function in DNA double-strand break repair. Mol. Cell. Biol. 26, 1786-94 (2006). Cabello-Lobato, M.J. et al. Microarray screening reveals two non-conventional SUMO- binding modules linked to DNA repair by non-homologous end-joining. Nucleic Acids Res. 50, 4732-4754 (2022). Galanty, Y., Belotserkovskaya, R., Coates, J. & Jackson, S.P. RNF4, a SUMO-targeted ubiquitin E3 ligase, promotes DNA double-strand break repair. Genes Dev. 26, 1179-95 (2012). Galanty, Y. et al. Mammalian SUMO E3-ligases PIAS1 and PIAS4 promote responses to DNA double-strand breaks. Nature 462, 935-9 (2009). Li, Y.J., Stark, J.M., Chen, D.J., Ann, D.K. & Chen, Y. Role of SUMO: SIM-mediated protein-protein interaction in non-homologous end joining. Oncogene 29, 3509-18 (2010). Yin, Y. et al. SUMO-targeted ubiquitin E3 ligase RNF4 is required for the response of human cells to DNA damage. Genes Dev. 26, 1196-208 (2012).
Claims
Claims:
1. A method of treating a dsbNETs-associated pathology or condition in a subject in need thereof, comprising administering a therapeutically effective amount of a dsbNETs modulator in the subject, wherein dsbNETs repair or misrepair damaged DNA or wherein excessively induced or persistent dsbNETs trigger DNA damage.
2. The method of claim 1, wherein the dsNETs modulator is an inhibitor or downregulator of a dsbNETs regulator.
3. The method of claim 2, wherein the dsbNETs regulator is selected from the group consisting of ATAT1 (a.k.a. alpha-TATl or aTATl), VASH1, VASH2, SVBP, Kinesin-1 (KIF5A, KIF5B, or KIF5C; referred to as KIF5A / B / C), Actin, ARP2, ARP3, ATM, ATR, DNAPK (a.k.a. DNA-PK, DNA-PKcs), FMN1, FMN2, HATs (histone acetyl transferases), HDACs (histone deacetylases), Kinesin-5 (KIF11), Kinesin-3 (KIF13B), Kinesin-6 (KIF20A), Kinesin-8 (KIF18A), Kinesin-13 (KIF2C), Kinesin-14A (KIFC1), Kinesin-14B (KIFC3), KIF5B-ALK, KIF5B-EGFR, KIF5B-RET, KU70, LMNA / C, LMNB1, LMNB2, microtubules (including TUB proteins, such as TUBA1B and TUBA4A), MRE11, NAT10, NBS1, PARP, Progerin, RAD50, SUN1, SUN2, MYH10, SENP2, NUMEN / END0D1, RNF4, a dsbNETs regulator as shown in Table 2, or a combination of the foregoing.
4. The method of claim 3, wherein the microtubles are TUB proteins.
5. The method of claim 4, wherein the TUB proteins are TABA1B or TUBA4A.
6. The method of any one of claims 1-5, wherein the dsbNETs-associated pathology or condition is cancer, aging, or premature aging, and the method comprises administering Mangafodipir, Hesperidin, Folic Acid, Pemetrexed, Ceftolozane, Oftasceine, Vimentin, Methotrexate, Pralatrexate, Copanlisib, GM-90257, GM-90631, EPOY, 4SC-205 (AEGIS), Adociasulfates, Afatinib, Alectinib, Anacardic Acid, ART0380, ATRN-119, AZ82, AZD0156, AZD1390, AZD4877, AZD6738, BAY1895344, Belinostat (PXD101), Berzosertib, Blascorid (Pirexyl), Brigatinib, BTB-1, C60211, C646, C75, Cabazitaxel, Cabozantinib, Camonsertib, CBP-93872, Ceritinib, Chaetoglobosin A, CK 666, CK-312, CK-666, CK-689, CK-869, colchicine, Compound L, Crizotinib, Curcumin, CW069, Cytochalasin B, Cytochalasin D, Cytochalasin E, Valproic acid, Dimethyl enastr on, Docetaxel, DPQ, EB-47, Enfortumabv edotin, Ensartinib, Entinostat (MS-275), Entrectinib, Eribulin, Erlotinib, aFamesyltransferase inhibitor, Panobinostat (LBH-589), Filanesib (ARRY-520), Gefitinib, Gossypol, IC486241, IC86621, IC87361, Ispinesib, Romidepsin (FK228), Ixabepilone, KIF18A-IN-1, KIFC3 blocking Peptide, kinesin-derived angiogenesis inhibitor (KAI), KU-0060648, Latrunculin-A, Latrunculin-B, Lenvatinib, Litrinosib, Lonafamib, Lorlatinib, LY294002, Olaparib, M1774, M3541, M4076, Metformin, MG149, Mitin, Monastrol, NK314, Nocodazole, NU1025, NU7026, NU7163, NU7427, NU7441, OK1305, Osimertinib, Panobinostat, Paprotrain, PARP Inhibitor XIV, PJ34, Pravastatin, Progerin, a Progerini inhibitor, PU139, Quercetin, Remodelin, Rimacalib, RP-3500, Rucaparib, RXDX-105, Sarizotan, Selpercatinib, SMIFH2, Sovilnesib, SR31527 chloride, STL127705, STLC (S-trityl-L-cysteine), SU11752, TAE684, Talazoparib, Paclitaxel, Tirbanibulin, Trastuzumab emtansine, Tubacin, Tubastatin A, UCM- 13207, Vandetanib, Vanillin, Vinblastine, VLS-1488, VX-803, VX-970, Wiskostatin, Wortmannin, XRD-0394, Niraparib, oledronic acid, SAHA (Vorinostat), CCW16, ZHAWOC8697, SENP2-IN-1, NSC 632839, 1,2,5-Oxadiazoles, or any combination thereof, in a subject.
5. The method of claim 4, wherein the Belinostat is Belodap™, the Valproic acid is Depacon™, the Famesyltransferase inhibitor is Tipifamib or Lonafamib, the Panobinostat is Farydak™, the Romidepsin is Istodax™, the Olaparib is Lynparza™, the Progerini inhibitor is Progerinin™ (SLC-D011), the Rucaparib is Rubraca™, the Talazoparib is Talzena™, the Paclitaxel is Taxol™, and / or the Niraparib is Zejula™.
7. The method of claim 2, wherein the dsbNETs regulator is ATAT1, wherein the dsbNETs inhibitor or downregulator is Mangafodipir, Hesperidin, Folic Acid, Pemetrexed, Ceftolozane, Oftasceine, Vimentin, Methotrexate, Pralatrexate, Copanlisib, GM-90257, GM- 90631, or any combination thereof, and wherein the dsbNETs-associated pathology or condition is cancer, aging, pre-mature aging, Type 1 Spherocytosis, Testicular Disease, or Congenital Hydrocephalus.
8. The method of claim 7, wherein the cancer is breast cancer, colorectal cancer, or pancreatic cancer.
9. The method of claim 3, wherein the dsbNETs modulator is an siRNA, shRNA, CRISPR, or antibody specifically targeting the dsbNETs regulator.