Simplified type i crispr-cas effector complex and use thereof

By constructing the I-F2 CRISPR-Cas system of Cas7, Cas6 and Cas5 fusion proteins and crRNA, the problems of multiple components and insufficient functions in eukaryotic cells are solved, and efficient gene editing and transcriptional regulation are achieved, and disease treatment potential is achieved.

WO2025156264A1PCT designated stage Publication Date: 2025-07-31INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/074258
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-01-26
Publication Date
2025-07-31

AI Technical Summary

Technical Problem

The existing type I CRISPR-Cas system has many components in eukaryotic cells, which is not conducive to delivery. The I-F2 type system cannot function in eukaryotic cells, making it difficult to build efficient gene editing and transcriptional regulation tools.

Method used

By screening and fusion of deaminase, glycosylase or reverse transcriptase and CRISPR-Cas effector proteins, a streamlined I-F2 type CRISPR-Cas effector complex, including Cas7, Cas6 and Cas5 fusion proteins, binds to crRNA to achieve gene editing and transcriptional regulation functions.

Benefits of technology

Efficient gene single-base editing and transcriptional regulation are achieved in eukaryotic cells, providing the type I CRISPR-Cas system with the least components, with universal applicability and high efficiency, and has the potential for disease treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2024074258-APPB-I100001
    Figure PCTCN2024074258-APPB-I100001
  • Figure PCTCN2024074258-APPB-I100002
    Figure PCTCN2024074258-APPB-I100002
  • Figure PCTCN2024074258-APPB-I100003
    Figure PCTCN2024074258-APPB-I100003
Patent Text Reader

Abstract

The present application belongs to the technical field of genetic engineering, and discloses a simplified Type I CRISPR-Cas effector complex and a use thereof. The technical problem to be solved by the present application is how to screen a simplified I-F2 type effector complex to construct an efficient new tool. To this end, the present application provides a gene editing composition, the gene editing composition, in combination with crRNA, achieving a gene editing function for a CRISPR-Cas effector protein Cas7, Cas6, or Cas5 fused with a deaminase. By determining the linking of an adenine deaminase to the N-terminus of a Cas5 subunit and using crRNA to target a target editing region, a wide editing window of approximately 30nt is obtained, achieving nearly 30% editing efficiency. Furthermore, high levels of base editing are achieved for disease-related targets in eukaryotic cells, indicating the universal applicability and high efficiency of the I-F2 type CRISPR-Cas system provided by the present application in eukaryotic cells, and demonstrating the potential for disease treatment.
Need to check novelty before this filing date? Find Prior Art

Description

A streamlined type I CRISPR-Cas effector complex and its applications Technical Field

[0001] The present application belongs to the field of genetic engineering technology, and specifically relates to a streamlined type I CRISPR-Cas effector complex and its application. Background Art

[0002] The CRISPR-Cas system has been widely used as a tool for gene editing and transcriptional regulation. Type I CRISPR-Cas systems are the most widely distributed, and recent studies have shown that Type I systems can efficiently perform gene editing and transcriptional regulation in eukaryotic cells, including human cells. The Type I system effector complex previously used for eukaryotic cell editing or transcriptional regulation consists of 4 or 5 subunits, and the gene coding frame is larger than Cas9 (about 1300aa), which is not conducive to delivery. If the diversity of Type I systems is fully explored and streamlined systems are screened out, it will be possible to obtain Type I tools with simple composition and easy delivery. On the other hand, compared with the single effector protein of Group 2, the multi-subunit effector complex of Group 1 has greater plasticity.

[0003] The I-F2 type system (formerly also called the I-Fv type system) has the smallest type I effector protein with the fewest components discovered so far (Nat Rev Microbiol, 2020, 18(2):67-83), but it has been reported in the past that it cannot function in eukaryotic cells (Nat Commun 2020, 11(1):3136). We have previously discovered a streamlined I-F2 type Cascade complex, which contains only three subunits. By fusing the VPR transcription activator to the Cascade component, we successfully constructed a tool that can be used for transcriptional regulation in eukaryotic cells (patent application number 202211702167.3).

[0004] B-cell lymphoma / leukemia 11A (BCL11A), also known as environmentally friendly viral integration site 9 homolog (EVI9) or COUP-TF interacting protein 1 (CTIP1), is a 102-kb gene encoding a zinc-finger transcription factor located on the short arm of human chromosome 2. BCL11A primarily regulates the conversion of fetal hemoglobin to adult hemoglobin, playing a key role in the development and progression of β-hemoglobin disorders such as sickle cell disease and β-thalassemia. It is also an oncogenic factor for B-cell malignancies. Recent studies have revealed that BCL11A also plays a crucial role in the malignant processes of solid tumors, including cell proliferation and resistance to apoptosis, invasion, and metastasis, but the specific mechanisms remain unclear.

[0005] Invention Disclosure

[0006] The technical problem to be solved by this application is: how to screen out streamlined I-F2-type effector complexes that are functional in eukaryotic cells and construct efficient new tools by fusing different functional elements.

[0007] To this end, the present application provides a gene editing composition, which is a CRISPR-Cas effector protein (Cas7, Cas6 or Cas5) fused with a deaminase, a glycosylase or a reverse transcriptase and crRNA to achieve the function of gene editing. Specifically, the effector protein fusion deaminase or glycosylase can achieve the single-base editing function of the gene. The effector protein fusion reverse transcriptase (such as Moloney murine leukemia virus (M-MLV) reverse transcriptase) enzyme can be used as a lead editor to effectively achieve all 12 base conversions under conditions independent of DSB and donor DNA.

[0008] The present application provides a gene editing composition, the gene editing composition

[0009] Comprising a protein composition and crRNA, wherein the protein composition is selected from any one of the following:

[0010] A1), Cas7, Cas6, and TadA8e-Cas5 fusion proteins;

[0011] A2), the Cas7, the Cas6 and the Cas5-TadA8e fusion protein;

[0012] A3), TadA8e-Cas7 fusion protein, the Cas6 and the Cas5;

[0013] [Corrected 18.11.2024 according to Rule 91] A4), Cas7-TadA8e fusion protein, said Cas6 and said Cas5;

[0014] The TadA8e-Cas5 fusion protein is a fusion protein obtained by connecting the deaminase to the N-terminus of the Cas5;

[0015] The Cas5-TadA8e fusion protein is a fusion protein obtained by connecting the deaminase to the C-terminus of the Cas5;

[0016] The TadA8e-Cas7 fusion protein is a fusion protein obtained by connecting the deaminase to the N-terminus of the Cas7;

[0017] The Cas7-TadA8e fusion protein is a fusion protein obtained by connecting the deaminase to the C-terminus of the Cas7;

[0018] The Cas7 is selected from any one of B1) to B3):

[0019] B1), a protein having an amino acid sequence of SEQ ID No. 11 (Cas7L175F);

[0020] B2) A protein related to Cas7 obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in B1) having more than 80% identity with the protein shown in B1);

[0021] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2);

[0022] The Cas6 is selected from any one of B4) to B6):

[0023] B4), a protein having an amino acid sequence of SEQ ID No. 5;

[0024] B5) A protein related to Cas6 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B4) having more than 80% identity with the protein shown in B4);

[0025] B6) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B4) or B5);

[0026] The Cas5 is selected from any one of B7) to B9):

[0027] B7), a protein having an amino acid sequence of SEQ ID No. 6;

[0028] B8) A protein related to Cas5 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B7) having more than 80% identity with the protein shown in B7);

[0029] B9) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B7) or B8).

[0030] Furthermore, the base editing composition has at least one of the following uses:

[0031] D1), regulatory gene base editing;

[0032] D2) preparing products for regulating gene base editing;

[0033] D3), ​​single base editing of regulatory genes;

[0034] D4) Prepare products for regulating single-base editing of genes.

[0035] Furthermore, the deaminase is selected from cytidine deaminase, adenosine deaminase or glycosylase.

[0036] Furthermore, the deaminase is selected from any one of the following:

[0037] B10), a protein having an amino acid sequence of positions 11-176 of SEQ ID No. 10;

[0038] B11) and B10) amino acid sequences obtained by substitution and / or deletion and / or addition of amino acid residues, and proteins having an identity of 80% or more to the protein shown in B10) and related to deaminases;

[0039] B12) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B10) or B11).

[0040] Furthermore, the deaminase can be linked to the C-terminus or N-terminus of Cas5 or Cas7 via a peptide bond.

[0041] Furthermore, the deaminase can also be connected to the C-terminus or N-terminus of Cas5 or Cas7 via a connecting peptide.

[0042] Furthermore, the amino acid sequence of the connecting peptide is positions 177-208 of SEQ ID No. 10.

[0043] Furthermore, the TadA8e-Cas5 fusion protein is any one of the following:

[0044] B13), a protein having an amino acid sequence of SEQ ID No. 10;

[0045] B14) and B13) wherein the amino acid sequence is substituted and / or deleted and / or added to obtain a protein having more than 80% identity with the protein shown in B13) and related to the TadA8e-Cas5 fusion protein;

[0046] B15), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B13) or B14);

[0047] Furthermore, the Cas5-TadA8e fusion protein is any one of the following:

[0048] B16), a protein having an amino acid sequence of SEQ ID No. 13;

[0049] B17) and B16) amino acid sequences obtained by substitution and / or deletion and / or addition of amino acid residues, which have more than 80% identity with the protein shown in B16) and are related to the Cas5-TadA8e fusion protein;

[0050] B18), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B16) or B17);

[0051] Furthermore, the TadA8e-Cas7 fusion protein is any one of the following:

[0052] B19), a protein having an amino acid sequence of SEQ ID No. 15;

[0053] B20) and B19) amino acid sequences obtained by substitution and / or deletion and / or addition of amino acid residues, which have more than 80% identity with the protein shown in B19) and are related to the TadA8e-Cas7 fusion protein;

[0054] B21), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B19) or B20);

[0055] Furthermore, the Cas7-TadA8e fusion protein is any one of the following:

[0056] B22), a protein having an amino acid sequence of SEQ ID No. 17;

[0057] B23) A protein related to the Cas7-TadA8e fusion protein obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in B22) having more than 80% identity with the protein shown in B22);

[0058] B24) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B22) or B23).

[0059] In some embodiments of the present application, the deaminase is adenosine deaminase, and the amino acid sequence of the adenosine deaminase is SEQ ID No. 10, positions 11-176. In some embodiments of the present application, the deaminase forms a fusion protein with the Cas5 or Cas7 via the connecting peptide.

[0060] In some embodiments of the present application, the deaminase is linked to the N-terminus of the Cas5 via a linker peptide to form a TadA-Cas5 fusion protein. The amino acid sequence of the TadA-Cas5 fusion protein is SEQ ID No. 10, wherein positions 1-10 of SEQ ID No. 10 are the amino acid sequence of penetratin 1, positions 11-176 are the amino acid sequence of TadA, positions 177-208 are the amino acid sequence of the linker peptide, and positions 209-574 are the amino acid sequence of Cas5.

[0061] In some embodiments of the present application, the deaminase is linked to the C-terminus of Cas5 via a linker peptide to form a Cas5-TadA fusion protein. The amino acid sequence of the Cas5-TadA is SEQ ID No. 13, wherein positions 1-10 of SEQ ID No. 13 are the amino acid sequence of penetratin 1, positions 11-376 are the amino acid sequence of Cas5, positions 377-395 are the amino acid sequence of the linker peptide, and positions 396-561 are the amino acid sequence of TadA.

[0062] In some embodiments of the present application, the deaminase is linked to the N-terminus of the Cas7 via a linker peptide to form a TadA-Cas7 fusion protein. The amino acid sequence of the TadA-Cas7 is SEQ ID No. 15, wherein positions 1-19 of SEQ ID No. 15 are the transmembrane peptide, positions 20-185 are the amino acid sequence of TadA, positions 186-227 are the amino acid sequence of the linker peptide, and positions 228-563 are the amino acid sequence of Cas7.

[0063] In some embodiments of the present application, the deaminase is linked to the C-terminus of Cas7 via a linker peptide to form a Cas7-TadA fusion protein. The amino acid sequence of the Cas7-TadA is SEQ ID No. 17, wherein positions 1-11 of SEQ ID No. 17 are the transmembrane peptide, positions 12-347 are the amino acid sequence of Cas7, positions 348-370 are the amino acid sequence of the linker peptide, and positions 371-563 are the amino acid sequence of TadA.

[0064] The present application also provides a biological material related to the above-mentioned gene editing composition, wherein the biological material is any of the following:

[0065] C1), a nucleic acid molecule encoding the above-mentioned protein composition and / or a nucleic acid molecule encoding the above-mentioned crRNA;

[0066] C2), an expression cassette containing the nucleic acid molecule described in C1);

[0067] C3), a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2);

[0068] C4), a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3);

[0069] C5), a transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2), or a transgenic plant or animal cell line containing the recombinant vector described in C3);

[0070] C6), a transgenic animal cell line containing the nucleic acid molecule described in C1), or a transgenic animal cell line containing the expression cassette described in C2), or a transgenic animal cell line containing the recombinant vector described in C3).

[0071] Furthermore, the nucleic acid molecule encoding the above-mentioned protein composition described in C1) is any one of the following:

[0072] g1), the encoding gene is a DNA molecule of positions 1810-3501 of SEQ ID No. 9 (encoding TadA-Cas5);

[0073] g2), a DNA molecule encoding the gene SEQ ID No. 9 (encoding Cas7L175F-CAS6-TadA-Cas5);

[0074] g3), the encoding gene is a DNA molecule of SEQ ID No. 12, positions 1810-3462 (encoding Cas5-TadA);

[0075] g4), a DNA molecule encoding the gene SEQ ID No. 12 (encoding Cas7L175F-CAS6-Cas5-TadA);

[0076] g5), the encoding gene is a DNA molecule of positions 64-1695 of SEQ ID No. 14 (encoding TadA-Cas7L175F);

[0077] [Corrected 18.11.2024 according to Rule 91] g7), the encoding gene is a DNA molecule of positions 40-1614 of SEQ ID No. 16 (encoding Cas7L175F-TadA);

[0078] g7), the encoding gene is a DNA molecule of positions 40-1614 of SEQ ID No. 16 (encoding TadA-Cas7L175F);

[0079] g8), a DNA molecule encoding a gene of SEQ ID No. 16 (encoding Cas7L175F-TadA-CAS6-Cas5).

[0080] In some embodiments of the present application, the backbone sequence of the nucleic acid molecule encoding the crRNA is SEQ ID No. 1, positions 252-323. SEQ ID No. 1, positions 252-279 and 296-323 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When used, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1.

[0081] Furthermore, in one example of the present application, the crRNA is transcribed by a U6 promoter. The nucleotide sequence of the U6 promoter is positions 1-249 of SEQ ID No. 1.

[0082] In the first embodiment of the present application, the present application designs a universal template hU6-MosBbsI for crRNA expression cassettes. hU6-MosBbsI is a DNA molecule having a nucleotide sequence of SEQ ID No. 1, wherein positions 1-249 of SEQ ID No. 1 are hU6 promoter sequences, positions 252-279 and positions 296-323 of SEQ ID No. 1 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When applied, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 to obtain a DNA molecule expressing crRNA targeting the target gene.

[0083] The present application also provides applications of the above-mentioned gene editing composition and / or the above-mentioned biomaterial, which may be any of the following:

[0084] D1) Application in regulating gene base editing;

[0085] D2) Application in the preparation of products for regulating gene base editing;

[0086] D3) Application in regulating gene single base editing;

[0087] D4) Application in the preparation of products for regulating single-base editing of genes;

[0088] D5) Use in the treatment of thalassemia and sickle cell anemia;

[0089] D6) Use in the preparation of products for the treatment of thalassemia and sickle cell anemia.

[0090] The present application also provides a product for gene editing, which contains the above-mentioned gene editing composition and / or the above-mentioned biological material.

[0091] The present application also provides a method for gene base editing, which comprises introducing the above-mentioned composition and / or the above-mentioned biological material and / or the above-mentioned product into a recipient cell to achieve base editing of a specific gene in the cell.

[0092] Furthermore, the product may be a reagent or kit with gene editing function.

[0093] Furthermore, the base editing can be single-base editing by a specific deaminase.

[0094] Furthermore, the recipient cell may be a eukaryotic cell.

[0095] The present application also provides a protein composition (effector protein of the CRISPR / Cas system), wherein the protein composition comprises Cas7, Cas6 and Cas5,

[0096] The Cas7 may be selected from any one of the following:

[0097] B1), a protein having an amino acid sequence of SEQ ID No. 11 (Cas7L175F);

[0098] B2) A protein related to Cas7 obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in B1) having more than 80% identity with the protein shown in B1);

[0099] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2);

[0100] The Cas6 may be selected from any one of B4) to B6):

[0101] B4), a protein having an amino acid sequence of SEQ ID No. 5;

[0102] B5) A protein related to Cas6 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B4) having more than 80% identity with the protein shown in B4);

[0103] B6) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B4) or B5);

[0104] The Cas5 may be selected from any one of B7) to B9):

[0105] B7), a protein having an amino acid sequence of SEQ ID No. 6;

[0106] B8) A protein related to Cas5 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B7) having more than 80% identity with the protein shown in B7);

[0107] B9) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B7) or B8).

[0108] Furthermore, the protein composition has at least one of the following uses:

[0109] E1), prepare gene base editing products,

[0110] E2), preparing products for regulating gene transcription levels,

[0111] E3) Preparation of products for epigenetic modification of genes;

[0112] E4), preparing gene shearing (or cutting) and / or ligation products.

[0113] The present application also provides a protein-nucleic acid composition, which comprises the above-mentioned protein composition and RNA.

[0114] Fusion of transcriptional regulatory factors with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used to regulate the transcription level of genes. Fusion of deaminases (such as cytidine deaminase or adenosine deaminase) or glycosylases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for base editing of genes. Fusion of reverse transcriptases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can form a lead editor for base editing of genes. Epigenetic modification proteins with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for epigenetic modification of genes. Fusion of nucleases or single-chain nickases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for gene cutting.

[0115] Furthermore, the protein nucleic acid composition has at least one of the following uses:

[0116] F1), gene base editing,

[0117] F2), prepare gene base editing products,

[0118] F3), regulating gene transcription levels,

[0119] F4), preparing products for regulating gene transcription levels,

[0120] F5), gene epigenetic modification,

[0121] F6) Preparation of epigenetic modification products;

[0122] F7), gene shearing (or cutting) and / or ligation,

[0123] F8) Prepare gene shearing (or cutting) and / or ligation products.

[0124] The present application also provides a biological material related to the above protein composition or protein nucleic acid composition, and the biological material can be selected from any one of the following:

[0125] G1), a nucleic acid molecule encoding the above-mentioned protein composition and / or a nucleic acid molecule encoding the above-mentioned RNA;

[0126] G2), an expression cassette containing the nucleic acid molecule described in G1);

[0127] G3), a recombinant vector containing the nucleic acid molecule described in G1), or a recombinant vector containing the expression cassette described in G2);

[0128] G4), a recombinant microorganism containing the nucleic acid molecule described in G1), or a recombinant microorganism containing the expression cassette described in G2), or a recombinant microorganism containing the recombinant vector described in G3);

[0129] G5), a transgenic plant cell line containing the nucleic acid molecule described in G1), or a transgenic plant cell line containing the expression cassette described in G2), or a transgenic plant or animal cell line containing the recombinant vector described in G3);

[0130] G6), a transgenic animal cell line containing the nucleic acid molecule described in G1), or a transgenic animal cell line containing the expression cassette described in G2), or a transgenic animal cell line containing the recombinant vector described in G3).

[0131] Furthermore, the nucleic acid molecule encoding the effector protein in G1) may be any of the following:

[0132] g9), the encoding gene is a DNA molecule of positions 40-1047 of SEQ ID No. 9 (encoding Cas7L175F);

[0133] g10), a DNA molecule encoding a gene of SEQ ID No. 9, 1132-1725 (encoding Cas6);

[0134] g11), the encoding gene is a DNA molecule of SEQ ID No. 9 2404-3501 (encoding Cas5).

[0135] Furthermore, the RNA molecule targets a target gene.

[0136] Furthermore, the RNA molecule can be selected from: one, two or three of crRNA, pegRNA and sgRNA.

[0137] In certain embodiments, the RNA molecule may be crRNA. In some embodiments of the present application, the template sequence of the nucleic acid molecule encoding the crRNA is SEQ ID No.1, positions 252-323. SEQ ID No.1, positions 252-279 and 296-323 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When applied, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No.1.

[0138] Furthermore, in one example of the present application, the crRNA is transcribed by a U6 promoter. The nucleotide sequence of the U6 promoter is positions 1-249 of SEQ ID No. 1.

[0139] In the first embodiment of the present application, the present application designs a universal template hU6-MosBbsI for crRNA expression cassettes. hU6-MosBbsI is a DNA molecule having a nucleotide sequence of SEQ ID No. 1, wherein positions 1-249 of SEQ ID No. 1 are hU6 promoter sequences, positions 252-279 and positions 296-323 of SEQ ID No. 1 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When applied, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 to obtain a DNA molecule expressing crRNA targeting the target gene.

[0140] The present application also provides the use of the above-mentioned protein composition and / or the above-mentioned protein-nucleic acid composition and / or the above-mentioned biomaterial in any of the following:

[0141] H1), application in gene base editing,

[0142] H2) Application in the preparation of gene base editing products,

[0143] H3), application in regulating gene transcription level,

[0144] H4), application in the preparation of products regulating gene transcription levels,

[0145] H5), application in gene epigenetic modification,

[0146] H6) Application in the preparation of products for epigenetic modification of genes;

[0147] H7), application in gene shearing (or cutting) and / or ligation,

[0148] H8) Application in the preparation of products for gene shearing (or cutting) and / or ligation.

[0149] Fusion of transcriptional regulatory factors with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used to regulate the transcription level of genes. Fusion of deaminases (such as cytidine deaminase or adenosine deaminase) or glycosylases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for base editing of genes. Fusion of reverse transcriptases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can form a lead editor for base editing of genes. Epigenetic modification proteins with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for epigenetic modification of genes. Fusion of nucleases or single-chain nickases with the effector proteins (Cas5, Cas6 or Cas7) of the CRISPR / Cas system can be used for gene cutting.

[0150] In this application, the product may be a reagent or a kit.

[0151] Furthermore, fusion of a deaminase (e.g., cytidine deaminase, adenosine deaminase, or glycosylase) to the effector protein (Cas5, Cas6, or Cas7) of the CRISPR / Cas system can be used for base editing of genes. Specifically, fusion of a deaminase to the effector protein (Cas5, Cas6, or Cas7) of the CRISPR / Cas system can be used for single-base editing of genes.

[0152] Furthermore, the deaminase can be linked to the C-terminus or N-terminus of Cas5 or Cas7.

[0153] Furthermore, the deaminase can be connected to the C-terminus or N-terminus of Cas5 or Cas7 via a connecting peptide.

[0154] The present application also provides a gene transcription regulatory composition, which includes a protein composition and crRNA, and the protein composition includes a Cas7 fusion protein, the Cas6, and the Cas5; the Cas7 fusion protein is obtained by connecting a transcription regulatory factor and the Cas7.

[0155] The Cas7 is selected from any one of the following:

[0156] B1), a protein having an amino acid sequence of SEQ ID No. 11 (Cas7L175F);

[0157] B2) A protein related to Cas7 obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in B1) having more than 80% identity with the protein shown in B1);

[0158] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2);

[0159] The Cas6 is selected from any one of B4) to B6):

[0160] B4), a protein having an amino acid sequence of SEQ ID No. 5;

[0161] B5) A protein related to Cas6 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B4) having more than 80% identity with the protein shown in B4);

[0162] B6) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B4) or B5);

[0163] The Cas5 is selected from any one of B7) to B9):

[0164] B7), a protein having an amino acid sequence of SEQ ID No. 6;

[0165] B8) A protein related to Cas5 obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B7) having more than 80% identity with the protein shown in B7);

[0166] B9) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B7) or B8).

[0167] Transcriptional regulation refers to the alteration of gene expression levels by changing the rate of transcription. Transcriptional regulation controls when transcription occurs and how much RNA is produced. Genes transcribed by RNA polymerase can be regulated by at least five mechanisms: ① Specificity factors alter RNA polymerase's specificity for a particular promoter or set of promoters, increasing or decreasing the likelihood of RNA polymerase binding to these promoters (e.g., the sigma factor used in prokaryotic transcription). ② Repressor factors bind to non-coding sequences on the DNA strand adjacent to or overlapping the promoter region, hindering RNA polymerase access to the strand and thereby inhibiting gene expression. ③ General transcription factors position RNA polymerase at the start of the protein-coding sequence, releasing the polymerase to transcribe mRNA. ④ Activator factors enhance the interaction of RNA polymerase with specific promoters, promoting gene expression. Activator factors achieve this by enhancing RNA polymerase's attraction to promoters, either through interactions with RNA polymerase subunits or indirectly by altering DNA structure. ⑤ Enhancers are sites located on the DNA helix that bind to activating factors to bend the DNA so that specific promoters are directed toward the initiation complex.

[0168] Furthermore, the transcriptional regulatory factor may be a transcriptional activator, a transcriptional repressor, or a transcriptional enhancer.

[0169] In some embodiments of the present application, the gene transcription regulation may be gene transcription activation. The gene transcription activation is obtained by connecting the gene transcription activator VPR to the Cas7 to obtain a fusion protein. The fusion protein, the Cas6, the Cas5, and the crRNA constitute a CRISPR / Cas system with transcription activation function.

[0170] Furthermore, the transcriptional regulatory factor may be a transcriptional activator, and the transcriptional activator may be selected from any one of the following:

[0171] H1), a protein having an amino acid sequence of positions 368-878 of SEQ ID No. 4;

[0172] H2) A protein related to a transcriptional activator obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in H1) having an identity of more than 80% with the protein shown in H1);

[0173] H3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of H1) or H2).

[0174] Furthermore, the transcription activator can be linked to the C-terminus or N-terminus of Cas7, Cas6 or Cas5.

[0175] Furthermore, the transcription activator can be connected to the C-terminus or N-terminus of Cas7.

[0176] Furthermore, the transcription activator can be connected to the C-terminus of Cas7.

[0177] Furthermore, the transcription activator can be connected to the C-terminus of Cas7 via a connecting peptide.

[0178] Furthermore, in the gene transcription regulating composition,

[0179] The Cas7 fusion protein is any one of the following:

[0180] I1), a protein having an amino acid sequence of SEQ ID No. 4;

[0181] I2) A protein related to the Cas7 fusion protein obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in I1) having more than 80% identity with the protein shown in I1);

[0182] I3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of I1) or I2).

[0183] In some embodiments of the present application, the Cas7 and the VPR are connected via the connecting peptide to form a Cas7-VPR fusion protein, and the amino acid sequence of the Cas7-VPR fusion protein is SEQ ID No. 4. Positions 1-11 of SEQ ID No. 4 are the amino acid sequence of the membrane-penetrating peptide, positions 12-347 of SEQ ID No. 4 are the amino acid sequence of the Cas7, positions 348-367 of SEQ ID No. 4 are the amino acid sequence of the connecting peptide, and positions 368-878 of SEQ ID No. 4 are the amino acid sequence of the VPR.

[0184] Furthermore, the gene transcription regulating composition has at least one of the following uses:

[0185] L1), application in gene transcription regulation;

[0186] L2) Application in the preparation of products for gene transcription regulation.

[0187] The present application also provides a biological material related to the above-mentioned gene transcription regulatory composition, and the biological material can be any of the following:

[0188] J1), a nucleic acid molecule encoding the above-mentioned protein composition and / or a nucleic acid molecule encoding the above-mentioned crRNA;

[0189] J2), an expression cassette containing the nucleic acid molecule described in J1);

[0190] J3), a recombinant vector containing the nucleic acid molecule described in J1), or a recombinant vector containing the expression cassette described in J2);

[0191] J4), a recombinant microorganism containing the nucleic acid molecule described in J1), or a recombinant microorganism containing the expression cassette described in J2), or a recombinant microorganism containing the recombinant vector described in J3);

[0192] J5), a transgenic plant cell line containing the nucleic acid molecule described in J1), or a transgenic plant cell line containing the expression cassette described in J2), or a transgenic plant or animal cell line containing the recombinant vector described in J3);

[0193] J6) a transgenic animal cell line containing the nucleic acid molecule described in J1), or a transgenic animal cell line containing the expression cassette described in J2), or a transgenic animal cell line containing the recombinant vector described in J3).

[0194] Furthermore, the nucleic acid molecule encoding the above-mentioned protein composition described in J1) is any one of the following:

[0195] g12), the encoding gene is a DNA molecule of positions 40-2640 of SEQ ID No. 18 (encoding Cas7 L175F VPR);

[0196] g13), a DNA molecule encoding the gene SEQ ID No. 18 (encoding Cas7 L175F VPR-Cas6-Cas5);

[0197] g14), the encoding gene is a DNA molecule of SEQ ID No. 3 positions 40-2640 (encoding Cas7 VPR);

[0198] g15), a DNA molecule encoding a gene of SEQ ID No. 3 (encoding Cas7 VPR-Cas6-cas5).

[0199] Furthermore, the biomaterial has at least one of the following uses:

[0200] L1), application in gene transcription regulation;

[0201] L2) Application in the preparation of products for gene transcription regulation.

[0202] In some embodiments of the present application, the backbone sequence of the nucleic acid molecule encoding the crRNA is SEQ ID No. 1, positions 252-323. SEQ ID No. 1, positions 252-279 and 296-323 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When used, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1.

[0203] Furthermore, in one example of the present application, the crRNA is transcribed by a U6 promoter. The nucleotide sequence of the U6 promoter is positions 1-249 of SEQ ID No. 1.

[0204] In the first embodiment of the present application, the present application designs a universal template hU6-MosBbsI for crRNA expression cassettes. hU6-MosBbsI is a DNA molecule having a nucleotide sequence of SEQ ID No. 1, wherein positions 1-249 of SEQ ID No. 1 are hU6 promoter sequences, positions 252-279 and positions 296-323 of SEQ ID No. 1 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When applied, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 to obtain a DNA molecule expressing crRNA targeting the target gene.

[0205] The present application also provides applications of the aforementioned gene transcription regulating composition and / or the aforementioned biomaterial, the applications including:

[0206] K1), application in gene transcription regulation;

[0207] K2) Application in the preparation of products for gene transcription regulation.

[0208] The present application also provides a product for regulating gene transcription, wherein the product contains the above-mentioned gene transcription regulating composition and / or the above-mentioned biological material.

[0209] Furthermore, the product may be a reagent or kit having a transcriptional regulatory function.

[0210] The present application also provides a method for gene transcription regulation, which comprises introducing the above-mentioned gene transcription regulation composition and / or the above-mentioned biological material or the above-mentioned product into a recipient cell to achieve transcriptional activation of a specific gene in the cell.

[0211] The present application also provides a protein, which is Cas7L175F. The Cas7L175F can be selected from any one of the following:

[0212] B1), a protein having an amino acid sequence of SEQ ID No. 11 (Cas7L175F);

[0213] B2) A protein related to Cas7 obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in B1) having more than 80% identity with the protein shown in B1);

[0214] B3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2);

[0215] The present application also provides a biological material related to the above-mentioned Cas7L175F, which may be any of the following:

[0216] M1), a nucleic acid molecule encoding the above-mentioned protein (Cas7L175F);

[0217] M2), an expression cassette containing the nucleic acid molecule described in M1);

[0218] M3), a recombinant vector containing the nucleic acid molecule described in M1), or a recombinant vector containing the expression cassette described in M2);

[0219] M4), a recombinant microorganism containing the nucleic acid molecule described in M1), or a recombinant microorganism containing the expression cassette described in M2), or a recombinant microorganism containing the recombinant vector described in M3);

[0220] M5), a transgenic plant cell line containing the nucleic acid molecule described in M1), or a transgenic plant cell line containing the expression cassette described in M2), or a transgenic plant or animal cell line containing the recombinant vector described in M3);

[0221] M6), a transgenic animal cell line containing the nucleic acid molecule described in M1), or a transgenic animal cell line containing the expression cassette described in M2), or a transgenic animal cell line containing the recombinant vector described in M3).

[0222] Furthermore, in the biological material, the nucleic acid molecule M1) can be selected from any one of the following:

[0223] g12), the encoding gene is a DNA molecule of positions 40-2640 of SEQ ID No. 18 (encoding Cas7 L175F VPR);

[0224] g13) and a nucleic acid molecule that is 80% or more identical to g12) and encodes the above protein.

[0225] In the present application, the recipient cell may be a eukaryotic cell.

[0226] Furthermore, the crRNA described in this application targets specific genes, thereby achieving a "positioning" effect.

[0227] In the present application, the 80% or greater identity may be 80%, 85%, 90% or greater identity.

[0228] The 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or greater identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or greater identity may be at least 96%, 97%, 98%, or 99% identity.

[0229] The linkages in the proteins described in this application can be achieved through peptide bonds.

[0230] As used herein, a protein tag refers to a polypeptide or protein that is fused with a target protein using in vitro DNA recombination techniques to facilitate expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, a His protein tag, an MBP protein tag, an HA protein tag, a myc protein tag, a GST protein tag, and / or a SUMO protein tag.

[0231] The product described in this application can be a reagent or a kit.

[0232] In some embodiments of the present application, the template sequence of the nucleic acid molecule encoding the crRNA is SEQ ID No. 1, positions 252-323. SEQ ID No. 1, positions 252-279 and 296-323 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When used, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1.

[0233] Furthermore, in one example of the present application, the crRNA is transcribed by a U6 promoter. The nucleotide sequence of the U6 promoter is positions 1-249 of SEQ ID No. 1.

[0234] In the first embodiment of the present application, the present application designs a universal template hU6-MosBbsI for crRNA expression cassettes. hU6-MosBbsI is a DNA molecule having a nucleotide sequence of SEQ ID No. 1, wherein positions 1-249 of SEQ ID No. 1 are hU6 promoter sequences, positions 252-279 and positions 296-323 of SEQ ID No. 1 are repeat sequences, and positions 282-293 are two BbsI enzyme recognition sites. When applied, the spacer fragment of the target gene replaces the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 to obtain a DNA molecule expressing crRNA targeting the target gene.

[0235] In the present application, the 80% or greater identity may be 80%, 85%, 90% or greater identity.

[0236] The 80% or greater identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or greater identity may be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The greater than 95% identity may be at least 95%, 96%, 97%, 98% or 99% identity.

[0237] Beneficial technical effects:

[0238] The I-F2 type system of the Moraxella osloensis CCUG 350 strain, whose effector proteins include Cas5, Cas6, and Cas7 (the Cas5 and Cas7 proteins of the I-F2 system have no significant homology with other reported Cas proteins). The Cas5 gene size in this system is 1101bp, the Cas6 gene size is 597bp, and the Cas7 gene size is 1011bp, totaling 2709bp. The I-F2 type CRISPR-Cas system disclosed in this application is the smallest type I effector protein with the fewest components. By introducing a point mutation to obtain Cas7L175F, we obtained the optimized I-F2 type CRISPR-Cas system function.

[0239] The I-F2 CRISPR-Cas system also includes a crRNA targeting the upstream region of the gene promoter. Our laboratory designed a universal template for the crRNA expression cassette, hU6-MosBbsI. hU6-MosBbsI is a DNA molecule with the nucleotide sequence of SEQ ID No. 1, in which positions 1-249 of SEQ ID No. 1 represent the hU6 promoter sequence, positions 252-279 and 296-323 of SEQ ID No. 1 represent repeat sequences, and positions 282-293 represent two BbsI enzyme recognition sites. When used, the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 is replaced with a spacer fragment of the target gene to obtain a DNA molecule that transcribes the crRNA targeting the target gene.

[0240] Fusion of transcriptional regulatory factors to effector proteins (Cas5, Cas6 or Cas7) can be used to regulate the transcription level of genes. Fusion of deaminases (such as cytidine deaminase or adenosine deaminase) or glycosylases to effector proteins (Cas5, Cas6 or Cas7) can be used for single-base editing of genes. Fusion of reverse transcriptases to effector proteins (Cas5, Cas6 or Cas7) can form lead editors for base editing of genes. Epigenetic modification proteins to effector proteins (Cas5, Cas6 or Cas7) can be used for epigenetic modification of genes. Fusion of nucleases or single-chain nicking enzymes to effector proteins (Cas5, Cas6 or Cas7) can be used for gene cutting.

[0241] The core component of the I-F2 type CRISPR-Cas system disclosed in this application is a tool for achieving base editing at the target in eukaryotic cells. It is the smallest type I effector protein with the fewest components. In the examples provided in this application, deaminases (taking adenine TadA8e as an example) are fused to the N-terminus and C-terminus of Cas5 and Cas7L175F proteins (L175F point mutations), respectively. It is determined that adenine deaminase TadA8e is coupled to the N-terminus of the Cas5 subunit, and the target editing region is targeted by crRNA. A unique wide editing window of about 30nt is obtained, and nearly 30% editing efficiency is obtained at A9 and A27 of the editing window. A higher level of base editing is achieved for disease-related targets in eukaryotic cells, indicating that the I-F2 type CRISPR-Cas system provided in this application has universal applicability and high efficiency in eukaryotic cells and has disease treatment potential.

[0242] Fusion expression of Cas7L175F with the VPR transcriptional activator significantly boosted transcriptional activation. Furthermore, extending the spacer resulted in transcriptional activation efficiencies comparable to or even superior to those achieved by the dCas9-VPR tool at the ASCL1 and IL1B target sites, demonstrating the universal applicability and high efficiency of the modified I-F2 CRISPR-Cas system provided in this application in eukaryotic cells. In some embodiments of the present application, Cas7L175F, Cas6, Cas5 and transcriptional regulatory factors in the I-F2 type CRISPR-Cas system connected to a transcription activator are expressed in eukaryotic cells in the form of the same transcript, and the coding sequence is numbered as SEQ ID No. 18. Positions 1-9 of SEQ ID No. 18 are kozak sequences, positions 10-39 encode penetrating peptide 1, positions 40-1047 encode Cas7L175F, positions 1048-1107 encode connecting peptide 1, positions 1108-2640 encode VPR, positions 2641-2694 encode T2A-1, positions 2695-2724 encode penetrating peptide 2, positions 2725-3318 encode Cas6, positions 3319-3372 encode T2A-2, positions 3373-3402 encode penetrating peptide 3, and positions 3403-4500 encode Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with the DNA molecule having the nucleotide sequence shown in SEQ ID No. 18, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged, to obtain the pcDNA3.1-cmv-Cas7L175FVPR plasmid. The pcDNA3.1-cmv-Cas7L175FVPR plasmid can express three proteins, namely, Cas7L175F-VPR fusion protein, Cas6 and Cas5. The amino acid sequence of the Cas7L175F-VPR fusion protein is SEQ ID No. 19, wherein positions 1-11 of SEQ ID No. 19 are the amino acid sequence of penetrating peptide 1, positions 12-347 of SEQ ID No. 19 are the amino acid sequence of Cas7, positions 348-367 of SEQ ID No. 19 are the amino acid sequence of connecting peptide 1, and positions 368-878 of SEQ ID No. 19 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No. 5, the amino acid sequence of Cas5 is SEQ ID No. 6. Cas7L175F-VPR fusion protein, Cas6 and Cas5 form a complex with crRNA to exert transcriptional regulatory function. BRIEF DESCRIPTION OF THE DRAWINGS

[0243] Figure 1 is a schematic diagram of pcDNA3.1-cmv-Cas7-VPR and pcDNA3.1-hU6-crRNA plasmids.

[0244] Figure 2 is a graph showing the experimental results of Example 2 of the present application. A graph showing the transcriptional activation effects of crRNAs of different lengths.

[0245] Figure 3 is a diagram showing the experimental results of Example 3 of the present application, showing the transcriptional activation effect of Cas7VPR L175F.

[0246] Figure 4 is a graph showing the experimental results of Example 4 of the present application, comparing the transcriptional activation levels of Cas7VPR L175F combined with 50nt spacer length crRNA and dCas9-VPR.

[0247] Figure 5 is a schematic diagram of pcDNA3.1-cmv-5NABE-P2AGFP, pcDNA3.1-cmv-5CABE-P2AGFP, pcDNA3.1-cmv-7NABE-P2AGFP, pcDNA3.1-cmv-7CABE-P2AGFP and pcDNA3.1-hU6-crRNA plasmids.

[0248] Figure 6 is a graph showing the experimental results of Example 5 of the present application. 5 NABE tool editing efficiency results at disease treatment-related targets.

[0249] Figure 7 is a graph showing the experimental results of Example 4 of the present application, showing the base editing efficiency of TadA8e fused to different subunits.

[0250] Best Mode for Carrying Out the Invention

[0251] The present application is further described in detail below in conjunction with specific embodiments. The examples provided are only for the purpose of illustrating the present application and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvements by those skilled in the art and do not in any way limit the present application.

[0252] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0253] The quantitative tests in the following examples were repeated three times unless otherwise specified, and the results were averaged.

[0254] 1) Strains, cell lines, and plasmids

[0255] Escherichia coli DH5α / EC DH5α was a product of Beijing Qingke Biotechnology Co., Ltd., catalog number: TSC01;

[0256] The HEK293T cell line is a product of the National Biomedical Experimental Cell Resource Bank (recorded as 293T in the cell bank).

[0257] Plasmid pcDNA3.1(+) is an Invitrogen product with catalog number V79020, and is represented by pcDNA3.1 in the examples.

[0258] Plasmid pcDNA3.1-P2AGFP is a Genscript product, and SEQ ID No. 20 is the complete sequence of the plasmid.

[0259] 2) Solution and culture medium

[0260] 100 g / L ampicillin (Amp) solution: Weigh 10 g of ampicillin powder, add 100 mL of ddH2O, mix thoroughly, and after the ampicillin is completely dissolved, filter through a 0.22 μm sterile water filter membrane. Dispense into 1.5 mL EP tubes and store in a -20°C refrigerator until needed.

[0261] LB medium: Weigh 10 g of sodium chloride, 10 g of tryptone, and 5 g of yeast extract, add distilled water, stir to dissolve, and dilute to 1 L. Autoclave at 121°C for 20 min. For solid culture media, add 1.2% agar powder. The final ampicillin concentration in LB medium containing ampicillin (Amp) resistance is 100 μg / mL.

[0262] DMEM medium is a Gibco product with the product number C11995.

[0263] 10% FBS DMEM medium: Add 50 mL FBS, 5 mL 100× streptomycin, penicillin and double-antibody solution, 5 mL GlutaMAX solution, and 5 mL 100× non-essential amino acid solution to 500 mL DMEM medium.

[0264] 3) Enzymes and reagents

[0265] DNA restriction endonucleases, T4 DNA ligase, and proteinase K were purchased from New England Biolabs (USA). 2× Rapid Taq Master Mix used for PCR amplification was purchased from Novozymes Biotech (China). 100 bp and 1 kb dsDNA molecular weight standards were purchased from Bomed (China). PBS buffer was purchased from Gibco. The gel recovery kit was purchased from Nanjing Novozymes Biotech Co., Ltd. The high-purity plasmid miniprep kit was purchased from Tiangen Biotech (Beijing) Co., Ltd. Yeast extract and tryptone were purchased from Oxoid (USA). Agar powder was purchased from Shanghai Huixing Biochemical Reagent Co., Ltd. Ampicillin sodium was purchased from Solebol (Solutions). Agarose was purchased from Sigma-Aldrich (USA). Trypsin 25200056, trypan blue solution 15250061, 100× streptomycin-penicillin double antibody solution, GlutaMAX solution, 100× non-essential amino acid solution, and bovine serum (FBS) were products of Thermo Fisher Scientific (China) Co., Ltd. Gene synthesis was performed by Nanjing GenScript Biotechnology Co., Ltd. All other solid reagents (unless otherwise noted) were products of Shanghai Hushi Company, and all liquid reagents (unless otherwise noted) were products of Beijing Chemical Plant.

[0266] The following examples were processed using Graphpad Prism statistical software. The experimental results are expressed as mean ± standard deviation and tested using One-way ANOVA. * indicates a significant difference (P < 0.05), ** indicates a very significant difference (P < 0.01), and *** indicates an extremely significant difference (P < 0.001).

[0267] Example 1: Engineering Modification of I-F2 System

[0268] The I-F2 type system of the Moraxella osloensis CCUG 350 strain, whose effector proteins include Cas5, Cas6, and Cas7 (the Cas5 and Cas7 proteins of the I-F2 system have no significant homology with other reported Cas proteins). The Cas5 gene size in this system is 1101 bp, the Cas6 gene size is 597 bp, and the Cas7 gene size is 1011 bp, totaling 2709 bp. The I-F2 type CRISPR-Cas system disclosed in this application is the smallest type I effector protein with the fewest components.

[0269] The I-F2 CRISPR-Cas system also includes a crRNA targeting the upstream region of the gene promoter. Our laboratory designed a universal template for the crRNA expression cassette, hU6-MosBbsI. hU6-MosBbsI is a DNA molecule with the nucleotide sequence of SEQ ID No. 1, in which positions 1-249 of SEQ ID No. 1 represent the hU6 promoter sequence, positions 252-279 and 296-323 of SEQ ID No. 1 represent repeat sequences, and positions 282-293 represent two BbsI enzyme recognition sites. When used, the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 is replaced with a spacer fragment of the target gene to obtain a DNA molecule that transcribes the crRNA targeting the target gene.

[0270] Fusion of transcriptional regulatory factors to effector proteins (Cas5, Cas6 or Cas7) can be used to regulate the transcription level of genes. Fusion of deaminases (such as cytidine deaminase or adenosine deaminase) or glycosylases to effector proteins (Cas5, Cas6 or Cas7) can be used for single-base editing of genes. Fusion of reverse transcriptases to effector proteins (Cas5, Cas6 or Cas7) can form lead editors for base editing of genes. Fusion of epigenetic modification proteins to effector proteins (Cas5, Cas6 or Cas7) can be used for epigenetic modification of genes. Fusion of nucleases or single-chain nicking enzymes to effector proteins (Cas5, Cas6 or Cas7) can be used for gene cutting.

[0271] The I-F2 type CRISPR-Cas system of Moraxella osloensis CCUG 350 includes Cas7, Cas6, Cas5 and a transcriptional regulatory factor coupled to the Cas protein. In the embodiment provided in the present application, the transcriptional regulatory factor is a transcription activator VPR, which is connected to the C-terminus of Cas7 via a connecting peptide. In the I-F2 type CRISPR-Cas system connected to the transcription activator, Cas7, Cas6, Cas5 and the transcriptional regulatory factor are expressed in eukaryotic cells in the form of the same transcript, and its coding sequence is SEQ ID No.3 positions 10-4500. After the coding sequence is transcribed, the internal T2A sequence will be cut, and three proteins, namely Cas7-VPR fusion protein, Cas6 and Cas5, will be produced from one transcription product. Positions 1-9 of SEQ ID No. 3 are the Kozak sequence, positions 10-39 encode penetrant 1, positions 40-1047 encode Cas7, positions 1048-1107 encode connecting peptide 1, positions 1108-2640 encode VPR, positions 2641-2694 encode T2A-1, positions 2695-2724 encode penetrant 2, positions 2725-3318 encode Cas6, positions 3319-3372 encode T2A-2, positions 3373-3402 encode penetrant 3, and positions 3403-4500 encode Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with the DNA molecule whose nucleotide sequence is shown in SEQ ID No.3, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged, to obtain the pcDNA3.1-cmv-Cas7VPR plasmid. The pcDNA3.1-cmv-Cas7VPR plasmid (A in FIG1 ) can express three proteins, namely, Cas7-VPR fusion protein, Cas6 and Cas5. The amino acid sequence of the Cas7-VPR fusion protein is SEQ ID No.4, wherein positions 1-11 of SEQ ID No.4 are the amino acid sequence of penetrating peptide 1, positions 12-347 of SEQ ID No.4 are the amino acid sequence of Cas7, positions 348-367 of SEQ ID No.4 are the amino acid sequence of connecting peptide 1, and positions 368-878 of SEQ ID No.4 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No.5, and the amino acid sequence of Cas5 is SEQ ID No. 6. Cas7-VPR fusion protein, Cas6, and Cas5 form a complex with crRNA to exert transcriptional regulatory functions.

[0272] By introducing a point mutation to generate Cas7L175F, we achieved optimized I-F2 CRISPR-Cas system functionality. Fusion expression of Cas7L175F with the VPR transcriptional activator significantly enhanced transcriptional activation. Furthermore, by extending the spacer, we achieved comparable or even superior transcriptional activation efficiencies to those achieved by the dCas9-VPR tool at the ASCL1 and IL1B target sites, demonstrating the universal applicability and high efficiency of the modified I-F2 CRISPR-Cas system provided in this application in eukaryotic cells. In some embodiments of the present application, Cas7L175F, Cas6, Cas5 and transcriptional regulatory factors in the I-F2 type CRISPR-Cas system connected to a transcription activator are expressed in eukaryotic cells in the form of the same transcript, and the coding sequence is numbered as SEQ ID No. 18. Positions 1-9 of SEQ ID No. 18 are kozak sequences, positions 10-39 encode penetrating peptide 1, positions 40-1047 encode Cas7L175F, positions 1048-1107 encode connecting peptide 1, positions 1108-2640 encode VPR, positions 2641-2694 encode T2A-1, positions 2695-2724 encode penetrating peptide 2, positions 2725-3318 encode Cas6, positions 3319-3372 encode T2A-2, positions 3373-3402 encode penetrating peptide 3, and positions 3403-4500 encode Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with the DNA molecule having the nucleotide sequence shown in SEQ ID No. 18, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged, to obtain the pcDNA3.1-cmv-Cas7L175FVPR plasmid. The pcDNA3.1-cmv-Cas7L175FVPR plasmid can express three proteins, namely, Cas7L175F-VPR fusion protein, Cas6 and Cas5. The amino acid sequence of the Cas7L175F-VPR fusion protein is SEQ ID No. 19, wherein positions 1-11 of SEQ ID No. 19 are the amino acid sequence of penetrating peptide 1, positions 12-347 of SEQ ID No. 19 are the amino acid sequence of Cas7, positions 348-367 of SEQ ID No. 19 are the amino acid sequence of connecting peptide 1, and positions 368-878 of SEQ ID No. 19 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No. 5, the amino acid sequence of Cas5 is SEQ ID No. 6. Cas7L175F-VPR fusion protein, Cas6 and Cas5 form a complex with crRNA to exert transcriptional regulatory function.

[0273] The core component of the I-F2 type CRISPR-Cas system disclosed in this application is a tool for achieving base editing at the target in eukaryotic cells. It is the smallest type I effector protein with the fewest components. In the examples provided in this application, deaminases (taking adenine TadA8e as an example) are fused to the N-terminus and C-terminus of Cas5 and Cas7L175F proteins (L175F point mutations), respectively. It is determined that adenine deaminase TadA8e is coupled to the N-terminus of the Cas5 subunit, and the target editing region is targeted by crRNA. A unique wide editing window of about 30nt is obtained, and nearly 30% editing efficiency is obtained at A9 and A27 of the editing window. A higher level of base editing is achieved for disease-related targets in eukaryotic cells, indicating that the I-F2 type CRISPR-Cas system provided in this application has universal applicability and high efficiency in eukaryotic cells and has disease treatment potential.

[0274] The I-F2 type CRISPR-Cas system single-base editing tool based on the modified Moraxella osloensis CCUG 350 includes Cas7L175F, Cas6, Cas5 and an adenine deaminase coupled to the Cas protein. In the embodiment provided in the present application, the adenine deaminase is TadA8e, which is connected to the N-terminus or C-terminus of Cas5 or Cas7L175F. In the I-F2 type CRISPR-Cas system connected to adenine deaminase, Cas7L175F, Cas6, Cas5 and TadA8e are expressed in eukaryotic cells in the form of the same transcript. One of the I-F2 type CRISPR-Cas systems connected to adenine deaminase is named 5NABE, which consists of Cas7L175F, Cas6, TadA8e-Cas5 fusion protein, and the coding sequence of 5NABE is SEQ ID No.9, positions 7-3501. Positions 40-1047 of SEQ ID No. 9 encode Cas7L175F, positions 1132-1725 of SEQ ID No. 9 encode Cas6, positions 1810-2307 of SEQ ID No. 9 encode TadA8e, positions 2404-3501 of SEQ ID No. 9 encode Cas5, positions 3502-3567 of SEQ ID No. 9 encode P2A, and positions 3568-4284 of SEQ ID No. 9 encode GFP. Cas7L175F is the protein whose amino acid sequence is SEQ ID No. 11. Cas6 is the protein whose amino acid sequence is SEQ ID No. 5. The amino acid sequence of the TadA8e-Cas5 fusion protein is SEQ ID No. 10. Positions 11-185 of SEQ ID No. 10 are the amino acid sequence of TadA8e. Positions 186-208 of SEQ ID No. 10 are the amino acid sequence of the connecting peptide. SEQ ID No. 10, positions 209-574 are the amino acid sequence of Cas5 (SEQ ID No. 10, positions 209-574 are the same as SEQ ID No. 6).

[0275] Example 2: Effects of different lengths of crRNA transcriptional activation tools in the I-F2 CRISPR-Cas system

[0276] Taking the IL1B gene and ASCL1 gene in HEK293T cells as an example, the specific operations are as follows:

[0277] 2.1. Construction of crRNA expression plasmids pcDNA3.1-hU6-crRNA-IL1B of different lengths targeting the IL1B gene promoter region and protein expression plasmids pcDNA3.1-cmv-Cas7VPR

[0278] (A) Annealing to synthesize spacer fragments with sticky ends

[0279] Our laboratory previously constructed the crRNA expression vector backbone, pcDNA3.1-hU6-crRNA. This crRNA expression vector backbone, pcDNA3.1-hU6-crRNA, replaces the fragment between the MluI and BbsI restriction sites in the pcDNA3.1 vector with a DNA molecule with the nucleotide sequence of SEQ ID No. 1, while maintaining the rest of the nucleotide sequence of the pcDNA3.1 vector unchanged. This creates the pcDNA3.1-hU6-crRNA plasmid. The pcDNA3.1-hU6-crRNA plasmid contains the hU6 promoter and two Mos repeat sequences, with a BbsI restriction site between the repeat sequences. In specific applications, it is necessary to target the IL1B gene, IL1B-S26-F and IL1B-S26-R, IL1B-S32-F and IL1B-S32-R, IL1B-S38-F and IL1B-S38-R, IL1B-S44-F and IL1B-S44-R, IL1B-S50-F and IL1B-S50-R, IL1B-S56-F and IL1B-S56-R, ASCL1-S26-F and ASCL1-S26-R, ASCL1-S32-F and ASCL1-S32-R, ASCL1-S38-F and ASCL1-S38-R, ASCL1- Primers S44-F and ASCL1-S44-R, ASCL1-S50-F and ASCL1-S50-R, and ASCL1-S56-F and ASCL1-S56-R (Table 1) were annealed to synthesize annealing products IL1B-S26, IL1B-S32, IL1B-S38, IL1B-S44, IL1B-S50, IL1B-S56, ASCL1-S26, ASCL1-S32, ASCL1-S38, ASCL1-S44, ASCL1-S50, and ASCL1-S56, respectively. These annealing products are spacer fragments with sticky ends (targeting the IL1B gene). The primer annealing reaction system was as follows: 2.2 μL 10× NEB buffer 2, 10 μL forward primer (100 μM), and 10 μL reverse primer (100 μM). The primer annealing program was as follows: 95°C for 5 min; 94.5°C-1°C / 30 s for 70 cycles; and constant temperature storage at 24.5°C.

[0280] (B) Construction of pcDNA3.1-hU6-crRNA-IL1B and pcDNA3.1-hU6-crRNA-ASCL1 plasmids with different crRNA lengths

[0281] The constructed crRNA vector backbone (pcDNA3.1-hU6-crRNA) was digested with BbsI restriction enzyme. The digestion system (100 μL) was as follows: 10 μL 10× Cut Smart Buffer, 2 μg plasmid vector, 2 μL BbsI, and ddH2O was added to 100 μL. The reaction was incubated at 37°C for 12 h. The plasmid vector digestion products were then excised and recovered from the gel. Annealing products of IL1B-S26, IL1B-S32, IL1B-S38, IL1B-S44, IL1B-S50, IL1B-S56, ASCL1-S26, ASCL1-S32, ASCL1-S38, ASCL1-S44, ASCL1-S50, and ASCL1-S56 were then ligated with the digested vector fragment using T4 ligase. The ligation reaction system (10 μL) was as follows: 7 μL of annealed spacer fragment, 1 μL of pcDNA3.1-hU6-crRNA, 1 μL of 10×T4 DNA ligase Buffer, and 1 μL of T4 DNA ligase. The reaction was carried out at 25°C for 1 hour. The ligation product was transformed into EC In DH5α competent cells, culture at 37°C overnight. After single clones grew, colony PCR was performed using primers pcDNA-seq-F / pcDNA-seq-R (Table 2). PCR-positive colonies were inoculated into 15 mL of LB liquid medium containing Amp (final concentration 100 mg / L) resistance and cultured overnight. The plasmid was extracted and sequenced to obtain the pcDNA3.1-hU6-crRNA plasmid (as in 1B). The obtained pcDNA3.1-hU6-crRNA plasmids were named: pcDNA3.1-hU6-crRNA-IL1BS26, pcDNA3.1-hU6-crRNA-IL1BS32, and pcDNA3.1-hU6-crRNA -IL1BS38, pcDNA3.1-hU6-crRNA-IL1BS44, pcDNA3.1-hU6-crRNA-IL1BS50, pcDNA3.1-hU6-crRNA-IL1BS56, pcDNA3.1-hU6-crRNA-ASCL1S26, pcDNA3.1-hU 6-crRNA-ASCL1S32, pcDNA3.1-hU6-crRNA-ASCL1S38, pcDNA3.1-hU6-crRNA-ASCL1S44, pcDNA3.1-hU6-crRNA-ASCL1S50, pcDNA3.1-hU6-crRNA-ASCL1S56.

[0282] The structure of pcDNA3.1-hU6-crRNA-IL1BS26 is as follows: a DNA molecule having the nucleotide sequence of positions 5-30 of primer IL1BS26-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0283] The structure of pcDNA3.1-hU6-crRNA-IL1BS32 is as follows: a DNA molecule whose nucleotide sequence is the 5-36th position of the primer IL1BS32-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0284] The structure of pcDNA3.1-hU6-crRNA-IL1BS38 is as follows: a DNA molecule having the nucleotide sequence of positions 5-42 of primer IL1BS38-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0285] The structure of pcDNA3.1-hU6-crRNA-IL1BS44 is as follows: a DNA molecule having the nucleotide sequence of positions 5-48 of primer IL1BS44-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0286] The structure of pcDNA3.1-hU6-crRNA-IL1BS50 is as follows: a DNA molecule whose nucleotide sequence is the 5-54th position of the primer IL1BS50-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0287] The structure of pcDNA3.1-hU6-crRNA-IL1BS56 is as follows: a DNA molecule having the nucleotide sequence of positions 5-60 of primer IL1BS56-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0288] The structure of pcDNA3.1-hU6-crRNA-ASCL1S26 is as follows: a DNA molecule having the nucleotide sequence of positions 5-30 of primer ASCL1S26-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0289] The structure of pcDNA3.1-hU6-crRNA-ASCL1S32 is as follows: a DNA molecule having the nucleotide sequence of positions 5-36 of primer ASCL1S32-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0290] The structure of pcDNA3.1-hU6-crRNA-ASCL1S38 is as follows: a DNA molecule having the nucleotide sequence of positions 5-42 of primer ASCL1S38-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0291] The structure of pcDNA3.1-hU6-crRNA-ASCL1S44 is as follows: a DNA molecule having the nucleotide sequence of positions 5-48 of primer ASCL1S44-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0292] The structure of pcDNA3.1-hU6-crRNA-ASCL1S50 is as follows: a DNA molecule having the nucleotide sequence of positions 5-54 of primer ASCL1S50-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0293] The structure of pcDNA3.1-hU6-crRNA-ASCL1S56 is as follows: a DNA molecule having the nucleotide sequence of positions 5-60 of primer ASCL1S56-F is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0294] The primer sequences involved in Examples 2, 3, and 4 are shown in Table 1, and the underlined parts are sticky ends.

[0295] Table 1 Primer sequences used in Examples 2, 3, and 4

[0296] (C) Construction of pcDNA3.1-cmv-Cas7VPR plasmid

[0297] The human codon-optimized Cas7VPR fragment of the I-F2 system of Moraxella osloensis CCUG 350 strain was synthesized by a reagent company. The fragment between the KpnI and XhoI restriction enzyme recognition sites of the backbone vector pcDNA3.1 backbone plasmid was replaced with Cas7VPR, while the other nucleotide sequences of the plasmid pcDNA3.1 remained unchanged. The resulting recombinant expression vector was pcDNA3.1-cmv-Cas7VPR.

[0298] The nucleotide sequence of the Cas7VPR fragment is shown in SEQ ID No. 3, in which positions 1-9 of SEQ ID No. 3 are the kozak sequence, positions 10-39 encode the cell-penetrating peptide 1, positions 40-1047 encode Cas7, positions 1048-1107 encode the connecting peptide 1, positions 1108-2640 encode the VPR, positions 2641-2694 encode the T2A-1, positions 2695-2724 encode the cell-penetrating peptide 2, positions 2725-3318 encode the Cas6, positions 3319-3372 encode the T2A-2, positions 3373-3402 encode the cell-penetrating peptide 3, and positions 3403-4500 encode the Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with a DNA molecule having a nucleotide sequence shown in SEQ ID No. 3, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged to obtain the pcDNA3.1-cmv-Cas7VPR plasmid.

[0299] The pcDNA3.1-cmv-Cas7VPR plasmid (A in FIG1 ) can express three proteins, namely Cas7-VPR fusion protein, Cas6 and Cas5. The amino acid sequence of the Cas7-VPR fusion protein is SEQ ID No.4, wherein SEQ ID No.4 positions 1-11 are the amino acid sequence of membrane-penetrating peptide 1, SEQ ID No.4 positions 12-347 are the amino acid sequence of Cas7, SEQ ID No.4 positions 348-367 are the amino acid sequence of connecting peptide 1, and SEQ ID No.4 positions 368-878 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No.5, and the amino acid sequence of Cas5 is SEQ ID No.6. Cas7-VPR fusion protein, Cas6 and Cas5 form a complex with crRNA to perform transcriptional regulation.

[0300] 2.2. Co-transfection of crRNA expression plasmid and protein expression plasmid into HEK293T cells

[0301] (A) Cell culture and passaging

[0302] 1 mL of cells frozen at -80℃ was added to a 10 cm cell culture dish with 10 mL of 10% FBS DMEM medium and cultured in a 37℃ 5% CO2 incubator. The medium was changed the next day. After 48 hours, the cells were digested with trypsin, centrifuged and resuspended in culture medium. After counting the cells, 2×10 6 The cells were used as seed solution and added into a new 10 cm cell culture dish containing 10 mL 10% FBS DMEM medium for passaging.

[0303] (B) Transfection

[0304] On the morning before transfection, 3 × 10 5 The cells were plated at a density of 1 / 400 μg / ml and cultured in a 37°C incubator containing 5% CO2 for 20-24 hours. Microscopic observation showed that the cell confluence was most suitable at 70%-80%. 0.8 ug crRNA expression plasmid and 1.2 ug protein expression plasmid were transfected according to the experimental groups in Table 2. Three biological replicates were set up, and after shaking and mixing, 2 μL PEI was added and mixed. The cells were incubated at room temperature for 15 minutes, and 550 μL 2% FBS DMEM medium was added. The medium in the 12-well plate was discarded, and the above-mentioned complex was added dropwise to adhere to the wall. After the cells were returned to the incubator for 6 hours, the complex was discarded, and 1 mL 10% FBS DMEM medium was added and cultured for 48 hours.

[0305] Table 2 Experimental groups for identifying the effects of different crRNA lengths on transcriptional activation efficiency

[0306] 2.3. Quantitative analysis of target gene transcription expression by qRT-PCR

[0307] In order to quantitatively analyze the transcriptional expression of target genes in cells, qRT-PCR assay was performed.

[0308] (A) Extraction of total cellular RNA (using AG21017 kit)

[0309] Aspirate the culture medium and wash the cells once with 1× PBS. Add 330 μL of lysis buffer RLS (50× DTT solution added to Buffer RLS) to an appropriate amount of cultured cells. Gently shake the culture dish to ensure that the Buffer RLS solution is evenly distributed on the cell surface. Use a pipette to repeatedly pipette to detach the cells, then transfer the lysate containing the cells to a centrifuge tube and let the lysate stand at room temperature for 2 minutes. Add an equal volume of 70% ethanol to the tissue lysate or the above filtrate and mix thoroughly by pipetting. If obvious sticky material or precipitation is present, pipette several times to break up the precipitation. Immediately transfer the above mixture and precipitation to the Universal RNA Mini Column, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. Add 600 μL of Buffer RWA to the tube, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. Add 650 μL of Buffer RWB to the tube, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. Prepare DNase according to the table below. I reaction solution and mix thoroughly. Add 50 μL of DNase I reaction solution (4 μL DNase I (RNase-free), 5 μL 10× DNase I Buffer, 41 μL RNase-free water) to the center of the Universal RNA Mini Column membrane and let it stand at room temperature for 15 minutes to digest the genomic DNA. Add 350 μL of Buffer RWB to the center of the membrane in the above tube, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. Add 650 μL of Buffer RWB to the tube, centrifuge at 12,000 rpm at room temperature for 1 minute, and discard the filtrate. Place the Universal RNA Mini Column in a new 2 mL collection tube and centrifuge at 12,000 rpm at room temperature for 2 minutes. Place the column in a new RNase-free tube and add 50 μL of RNase-free water to the center of the membrane. Let it stand at room temperature for 5 minutes, then centrifuge at 12,000 rpm at room temperature for 2 minutes to elute the RNA. Measure the concentration of the dissolved RNA and store at -80°C.

[0310] (B) RNA concentration determination

[0311] Take 2 μL of RNA sample and measure directly using Nanodrop 1000 spectrophotometer (Thermo Fisher Scientific). OD260 / 280 should be around 2.0.

[0312] (C) Reverse transcription (RK20429 kit)

[0313] Add 1 μg of RNA to a 1.5 mL RNase-free EP tube and bring the volume up to 15 μL with RNase-free water. Denature at 65°C for 5 minutes and immediately place on ice for 2 minutes. Add 4 μL of 5× ABScript III RT Mix and 1 μL of 20× gDNA Remover Mix, mix well, and incubate at 37°C for 2 minutes, then at 55°C for 15 minutes. Inactivate the reverse transcriptase at 85°C for 3 minutes.

[0314] (D) Primer amplification efficiency detection

[0315] Real-time PCR reactions were performed on a Bio-rad C1000 CFX96 Real-Time PCR System using reverse-transcribed cDNA as a template in triplicate, 2-fold serial dilutions. The reaction system consisted of 10 μL of KAPA SYBR FAST qPCR master mix (2×), 0.4 μL of forward primer IL1B-QF (10 μM), 0.4 μL of reverse primer IL1B-QR (10 μM), 2 μL of cDNA template, 0.4 μL of dye, and 6.8 μL of ddH2O.

[0316] The reaction conditions are: 95°C for 5 minutes, 95°C for 10 seconds, and 60°C for 30 seconds, for 40 cycles. A standard curve is plotted and the amplification efficiency is calculated. If the primer amplification efficiency is between 90% and 110%, the primer can be used for subsequent experiments.

[0317] (E) qRT-PCR assay

[0318] Real-time PCR reactions were performed in triplicate on a Bio-rad C1000 CFX96 Real-Time PCR System using reverse-transcribed cDNA as template. The reaction system and conditions were the same as in step (D). qRT-PCR primers were IL1B-QF / IL1B-QR and ASCL-QF / ASCL-QR, respectively, as listed in Table 1. GAPDH was used as an internal control. Statistical analysis of the data was performed, and bar graphs were plotted.

[0319] The experimental results are shown in Figure 2. The results show that in the I-F2 effector complex (Cascade), the VPR transcription activator is fused to the Cas7 subunit, targeting the upstream region of the promoter region of the gene in HEK293T cells. The gene transcription amount is significantly upregulated. As the crRNA is extended, the transcription activation level gradually increases. When the spacer length in the crRNA is 50nt, the tool works best.

[0320] Example 3: Point mutation of the Cas7 subunit in the Cascade protein to improve the effectiveness of the transcriptional activation tool

[0321] Taking the IL1B gene and ASCL1 gene in HEK293T cells as an example, the specific operations are as follows:

[0322] (1) Construction of crRNA expression plasmid pcDNA3.1-hU6-crRNA targeting gene promoter region and protein expression plasmid pcDNA3.1-cmv-Cas7L175FVPR

[0323] The crRNA expression plasmids pcDNA3.1-hU6-crRNA-IL1BS32 and pcDNA3.1-hU6-crRNA-ASCL1S32 are the same as 2.1 in Example 2.

[0324] The protein expression plasmid of the pcDNA3.1-cmv-Cas7L175FVPR point mutation was constructed based on the pcDNA3.1-cmv-Cas7VPR backbone, and the 562-564CTG bases in SEQ ID No. 3 were replaced with TTC bases, that is, the amino acid L at position 175 in the encoded Cas7 protein was replaced with amino acid F. The replaced coding sequence is numbered as SEQ ID No. 18, where positions 1-9 of SEQ ID No. 18 are the kozak sequence, positions 10-39 encode the cell-penetrating peptide 1, positions 40-1047 encode Cas7L175F, positions 1048-1107 encode the connecting peptide 1, positions 1108-2640 encode VPR, positions 2641-2694 encode T2A-1, positions 2695-2724 encode the cell-penetrating peptide 2, positions 2725-3318 encode Cas6, positions 3319-3372 encode T2A-2, positions 3373-3402 encode the cell-penetrating peptide 3, and positions 3403-4500 encode Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with the DNA molecule whose nucleotide sequence is shown in SEQ ID No. 18, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged to obtain the pcDNA3.1-cmv-Cas7L175FVPR plasmid.

[0325] The pcDNA3.1-cmv-Cas7L175FVPR plasmid can express three proteins: the Cas7L175F-VPR fusion protein, Cas6, and Cas5. The amino acid sequence of the Cas7L175F-VPR fusion protein is SEQ ID No. 19, wherein positions 1-11 of SEQ ID No. 19 are the amino acid sequence of penetratin 1, positions 12-347 of SEQ ID No. 19 are the amino acid sequence of Cas7 L175F, positions 348-367 of SEQ ID No. 19 are the amino acid sequence of connecting peptide 1, and positions 368-878 of SEQ ID No. 19 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No. 5, and the amino acid sequence of Cas5 is SEQ ID No. 6. The Cas7L175F-VPR fusion protein, Cas6, and Cas5 form a complex with crRNA to exert transcriptional regulatory functions.

[0326] (2) Co-transfection of crRNA expression plasmid and protein expression plasmid into HEK293T cells

[0327] Different crRNA expression plasmids and protein expression plasmid pcDNA3.1-cmv-Cas7VPR were co-transfected into HEK293T cells according to the experimental groups shown in Table 3. The specific co-transfection experimental procedures and post-transfection HEK293T cell culture were referred to Section 2.2 of Example 2. The total amount of crRNA expression plasmid was 0.8 μg, and the amount of protein expression plasmid was 1.2 μg. The experiment was set up in triplicate.

[0328] Table 3 Experimental groups for identifying the effects of different lengths of crRNA on transcriptional activation efficiency

[0329] (3) qRT-PCR quantitative analysis of target gene transcription expression

[0330] The relative expression levels of each gene in each group of HEK293T cells were determined by referring to the method shown in 2.3 of Example 2.

[0331] The experimental results are shown in Figure 3. Point mutations in the Cas7 protein in Cascade enhance target binding activity, significantly improving the tool's transcriptional activation. This strategy can further enhance gene transcription levels.

[0332] Example 4: The mutated Cascade combined with crRNA containing a 50nt spacer can efficiently activate gene transcription, and the transcription level is comparable to that of the dCas9-VPR tool

[0333] Taking the IL1B gene and ASCL1 gene in HEK293T cells as an example, the specific operations are as follows:

[0334] (1) Construction of crRNA expression plasmid pcDNA3.1-hU6-crRNA targeting gene promoter region and protein expression plasmid pcDNA3.1-cmv-Cas7L175FVPR

[0335] The crRNA expression plasmids pcDNA3.1-hU6-crRNA-IL1BS50 and pcDNA3.1-hU6-crRNA-ASCL1S50 are the same as 2.1 in Example 2.

[0336] The preparation of the protein expression plasmid of pcDNA3.1-cmv-Cas7L175FVPR point mutation was the same as that in 3.1 of Example 3.

[0337] (2) Construction of sgRNA expression plasmid pcDNA3.1-hU6-sgRNA targeting gene promoter region and protein expression plasmid pcDNA3.1-cmv-dCas9VPR

[0338] Our laboratory previously constructed the crRNA expression vector backbone, pcDNA3.1-hU6-sgRNA (Figure 1, D). The sgRNA expression vector backbone, pcDNA3.1-hU6-sgRNA, was constructed by replacing the fragment between the MluI and BbsI restriction sites in the pcDNA3.1 vector with a DNA molecule with the nucleotide sequence of SEQ ID No. 2, while maintaining the remaining nucleotide sequences of the pcDNA3.1 vector. This resulted in the pcDNA3.1-hU6-sgRNA plasmid. The pcDNA3.1-hU6-sgRNA plasmid contains the hU6 promoter and the sgRNA scaffold, separated by a BbsI restriction site. For targeting the IL1B and ASCL1 genes, the sgRNA-IL1B-F and sgRNA-IL1B-R, and sgRNA-ASCL1-F and sgRNA-ASCL1-R primers (Table 1) were annealed to synthesize annealing products, which consist of spacer fragments with sticky ends. The primer annealing reaction system was as follows: 2.2 μL 10× NEB buffer 2, 10 μL forward primer (100 μM), and 10 μL reverse primer (100 μM). The primer annealing program was as follows: 95°C for 5 min, followed by 70 cycles of 94.5°C-1°C / 30 s, and then stored at 24.5°C.

[0339] The constructed crRNA vector backbone (pcDNA3.1-hU6-sgRNA) was digested with BbsI restriction enzyme. The digestion system (100 μL) was as follows: 10 μL 10× Cut Smart Buffer, 2 μg plasmid vector, 2 μL BbsI, and ddH2O added to 100 μL. Incubate at 37°C for 12 h. The plasmid vector digestion products were excised from a gel and recovered. The annealed products of sgRNA-IL1B and sgRNA-ASCL1 were ligated to the digested vector fragment using T4 ligase. The ligation reaction system (10 μL) was as follows: 7 μL of annealed spacer fragment, 1 μL pcDNA3.1-hU6-sgRNA, 1 μL 10× T4 DNA ligase buffer, and 1 μL T4 DNA ligase. Incubate at 25°C for 1 h. The ligation product was transformed into EC DH5α competent cells and cultured overnight at 37°C. After single clones grew, colony PCR was performed using primer pair pcDNA-seq-F / pcDNA-seq-R (Table 2). PCR-positive colonies were inoculated into 15 mL of LB liquid medium containing Amp (final concentration 100 mg / L) resistance and cultured overnight. The plasmid was extracted and sequenced to obtain the pcDNA3.1-hU6-sgRNA plasmid (as shown in Figure 1, D). The obtained pcDNA3.1-hU6-sgRNA plasmids were named: pcDNA3.1-hU6-sgRNA-IL1B and pcDNA3.1-hU6-sgRNA-ASCL1.

[0340] The human codon-optimized dCas9VPR fragment was synthesized by a reagent company. The fragment between the KpnI and XhoI restriction enzyme recognition sites of the backbone vector pcDNA3.1 was replaced with dCas9VPR, while the other nucleotide sequences of the plasmid pcDNA3.1 remained unchanged. The resulting recombinant expression vector was pcDNA3.1-cmv-dCas9VPR (Figure 1C).

[0341] The nucleotide sequence of the dCas9VPR fragment is shown in SEQ ID No. 7. Positions 1-9 of SEQ ID No. 7 are kozak sequences, positions 10-30 encode penetrant 1, positions 54-4155 encode dCas9, positions 4156-4212 encode connecting peptides, and positions 4213-5748 encode VPR. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with a DNA molecule having a nucleotide sequence shown in SEQ ID No. 7, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged, to obtain the pcDNA3.1-cmv-dCas9VPR plasmid.

[0342] The pcDNA3.1-cmv-dCas9VPR plasmid can express the dCas9-VPR fusion protein. The amino acid sequence of the dCas9-VPR fusion protein is SEQ ID No. 8, wherein positions 1-8 of SEQ ID No. 8 are the amino acid sequence of the cell-penetrating peptide 1, positions 17-1383 are the amino acid sequence of dCas9, positions 1384-1402 are the amino acid sequence of the connecting peptide, and positions 1403-1914 are the amino acid sequence of VPR.

[0343] (3) pcDNA3.1-hU6-crRNA and pcDNA3.1-cmv-Cas7L175FVPR, pcDNA3.1-hU6-sgRNA and pcDNA3.1-cmv-dCas9VPR co-transfected HEK293T cells

[0344] Different crRNA expression plasmids and protein expression plasmid pcDNA3.1-cmv-Cas7VPR were co-transfected into HEK293T cells according to the experimental groups shown in Table 4. The specific co-transfection experimental procedures and post-transfection HEK293T cell culture were referred to Section 2.2 of Example 2. The total amount of crRNA or sgRNA expression plasmid was 0.8 μg, and the amount of protein expression plasmid was 1.2 μg. The experiment was set up in triplicate.

[0345] Table 4 Experimental groups for identifying the effects of different lengths of crRNA on transcriptional activation efficiency

[0346] (3) qRT-PCR quantitative analysis of target gene transcription expression

[0347] The relative expression levels of the genes in the HEK293T cells of each group in Table 4 were determined by referring to the method shown in 2.3 of Example 2.

[0348] The experimental results, shown in Figure 4, show that point mutations in the Cas7 protein in Cascade, combined with a 50nt spacer crRNA, can effectively enhance target gene transcription. Compared to the dCas9VPR tool, the targeted activation effect is comparable or even superior.

[0349] Example 5: The TadA8e tool fused to different subunits of the I-F2 CRISPR-Cas system has a wide bimodal editing window

[0350] 5.1. By linking TadA8e to the C-terminus or N-terminus of Cas5 or Cas7 (L175F) of Mos350Cascade, we created four ABEs, named 5CABE, 5NABE, 7CABE, and 7NABE. The base editing window was evaluated by targeting a region within the NIBAN gene that has an alternating 5'ANAN-3' sequence. This region can be targeted by two crRNAs, resulting in adenines being located at almost every odd (target NIBAN1) or even (target NIBAN2) position, collectively covering positions 4-27 and 30-32 in the target region, thereby helping to determine the editing window.

[0351] The nucleotide sequence of the target NIBAN1 is (5′-3′, numbered as SEQ ID No. 57): CTCTACACACACACAGACACACACACACTTAG;

[0352] The nucleotide sequence of the target NIBAN2 is (5'-3', numbered as SEQ ID No. 58): TCTACACACACACAGACACACACACACTTAGA.

[0353] Construction of crRNA expression plasmids pcDNA3.1-hU6-crRNA-NIBAN1 and pcDNA3.1-hU6-crRNA-NIBAN2 targeting the NIBAN gene and protein expression plasmids pcDNA3.1-cmv-5NABE-P2AGFP, pcDNA3.1-cmv-5CABE-P2AGFP, pcDNA3.1-cmv-7NABE-P2AGFP, and pcDNA3.1-cmv-7CABE-P2AGFP

[0354] (1) The crRNA expression plasmids pcDNA3.1-hU6-crRNA-NIBAN1 and pcDNA3.1-hU6-crRNA-NIBAN2 were the same as those in 2.1 of Example 2.

[0355] The structure of pcDNA3.1-hU6-crRNA-NIBAN1 is as follows: a DNA molecule whose nucleotide sequence is the 5-36th position of the primer NIBAN-F1 is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0356] The structure of pcDNA3.1-hU6-crRNA-NIBAN2 is as follows: a DNA molecule whose nucleotide sequence is the 5-36th position of the primer NIBAN-F2 is inserted between two repeat sequences of the vector pcDNA3.1-hU6-crRNA, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged to obtain a recombinant expression vector.

[0357] (2) Construction of pcDNA3.1-cmv-5NABE-P2AGFP, pcDNA3.1-cmv-5CABE-P2AGFP, pcDNA3.1-cmv-7NABE-P2AGFP, and pcDNA3.1-cmv-7CABE-P2AGFP plasmids

[0358] The human codon-optimized 5NABE, 5CABE, 7NABE, and 7CABE fragments of the I-F2 system of Moraxella osloensis CCUG 350 strain were synthesized by a reagent company. 5NABE was used to replace the fragment between the KpnI and XbaI restriction enzyme recognition sites of the backbone vector pcDNA3.1-P2AGFP plasmid, while keeping the other nucleotide sequences of the plasmid pcDNA3.1-P2AGFP unchanged. The resulting recombinant expression vector is pcDNA3.1-cmv-5NABE-P2AGFP.

[0359] The construction methods of pcDNA3.1-cmv-5CABE-P2AGFP, pcDNA3.1-cmv-7NABE-P2AGFP and pcDNA3.1-cmv-7CABE-P2AGFP were similar to those of pcDNA3.1-cmv-5NABE-P2AGFP, with the only difference being that 5NABE was replaced by 5CABE, 7NABE or 7CABE, respectively.

[0360] The nucleotide sequence of the 5NABE fragment is SEQ ID No. 9, wherein positions 1-9 of SEQ ID No. 9 are kozak sequences, positions 10-39 of SEQ ID No. 9 encode penetratin 1, positions 40-1047 of SEQ ID No. 9 encode Cas7, positions 1048-1101 of SEQ ID No. 9 encode T2A-1, positions 1102-1131 of SEQ ID No. 9 encode penetratin 2, positions 1132-1725 of SEQ ID No. 9 encode Cas6, positions 1726-1779 of SEQ ID No. 9 encode T2A-2, positions 1780-1809 of SEQ ID No. 9 encode penetratin 3, positions 1810-2307 of SEQ ID No. 9 encode TadA, positions 2308-2403 of SEQ ID No. 9 encode a connecting peptide, positions 2404-3501 of SEQ ID No. 9 encode Cas5, and positions 1710-2307 of SEQ ID No. 9 encode a connecting peptide. No.9, nucleotides 3502-3567, encode P2A, and nucleotides 3568-4284 encode GFP. The DNA molecule having the nucleotide sequence shown in SEQ ID No. 9 was used to replace the fragment between the KpnI and XbaI restriction sites of the pcDNA3.1P2AGFP vector (the small fragment between the KpnI and XbaI restriction sites), while keeping the other nucleotide sequences of the pcDNA3.1-P2AGFP vector unchanged, to obtain the pcDNA3.1-cmv-5NABE-P2AGFP plasmid.

[0361] The pcDNA3.1-cmv-5NABE-P2AGFP plasmid (A in FIG5 ) can express three proteins, namely TadA-Cas5 fusion protein, Cas6 and Cas7. The amino acid sequence of the TadA-Cas5 fusion protein is SEQ ID No. 10, wherein SEQ ID No. 10 positions 1-10 are the amino acid sequence of membrane-penetrating peptide 1, SEQ ID No. 10 positions 11-176 are the amino acid sequence of TadA, SEQ ID No. 10 positions 177-208 are the amino acid sequence of the connecting peptide, and SEQ ID No. 10 positions 209-574 are the amino acid sequence of Cas5. The amino acid sequence of Cas6 is SEQ ID No. 5, and the amino acid sequence of Cas7 is SEQ ID No. 11. The TadA-Cas5 fusion protein, Cas6 and Cas7 form a complex to perform base editing function.

[0362] The nucleotide sequence of the 5CABE fragment is SEQ ID No. 12, wherein positions 1-9 of SEQ ID No. 12 are kozak sequences, positions 10-39 of SEQ ID No. 12 encode penetratin 1, positions 40-1047 of SEQ ID No. 12 encode Cas7, positions 1048-1101 of SEQ ID No. 12 encode T2A-1, positions 1102-1131 of SEQ ID No. 12 encode penetratin 2, positions 1132-1725 of SEQ ID No. 12 encode Cas6, positions 1726-1779 of SEQ ID No. 12 encode T2A-2, positions 1780-1809 of SEQ ID No. 12 encode penetratin 3, positions 1810-2907 of SEQ ID No. 12 encode Cas5, positions 2908-2964 of SEQ ID No. 12 encode a connecting peptide, and positions 2967-2970 of SEQ ID No. 12 encode a connecting peptide. Positions 2965-3462 of SEQ ID No. 12 encode TadA, positions 3463-3534 of SEQ ID No. 12 encode P2A, and positions 3535-4251 encode GFP. The DNA molecule having the nucleotide sequence of SEQ ID No. 12 was used to replace the fragment between the KpnI and XbaI restriction sites of the pcDNA3.1P2AGFP vector (the small fragment between the KpnI and XbaI restriction sites), while keeping the other nucleotide sequences of the pcDNA3.1-P2AGFP vector unchanged, to obtain the pcDNA3.1-cmv-5CABE-P2AGFP plasmid.

[0363] The pcDNA3.1-cmv-5CABE-P2AGFP plasmid (A in FIG5 ) can express three proteins, namely Cas7, Cas6, and Cas5-TadA fusion proteins, wherein the amino acid sequence of Cas7 is SEQ ID No.11, the amino acid sequence of Cas6 is SEQ ID No.5, and the amino acid sequence of Cas5-TadA is SEQ ID No.13, wherein positions 1-10 of SEQ ID No.13 are the amino acid sequence of penetratin 1, positions 11-376 of SEQ ID No.13 are the amino acid sequence of Cas5, positions 377-395 of SEQ ID No.13 are the amino acid sequence of the connecting peptide, and positions 396-561 of SEQ ID No.13 are the amino acid sequence of TadA. Cas7, Cas6, and Cas5-TadA fusion proteins form a complex to perform base editing functions.

[0364] The nucleotide sequence of the 7NABE fragment is shown in SEQ ID No. 14, wherein positions 1-9 of SEQ ID No. 14 are kozak sequences, positions 10-63 of SEQ ID No. 14 encode penetratin 1, positions 64-561 of SEQ ID No. 14 encode TadA, positions 562-657 of SEQ ID No. 14 encode a connecting peptide, positions 658-1695 of SEQ ID No. 14 encode Cas7, positions 1696-1749 of SEQ ID No. 14 encode T2A-1, positions 1750-1779 of SEQ ID No. 14 encode penetratin 2, positions 1780-2373 of SEQ ID No. 14 encode Cas6, positions 2374-2427 of SEQ ID No. 14 encode T2A-2, positions 2428-2457 of SEQ ID No. 14 encode penetratin 3, positions 2458-3555 of SEQ ID No. 14 encode Cas5, and positions 2470-2587 of SEQ ID No. 14 encode Cas6. Positions 3556-3621 of ID No. 14 encode P2A, and positions 3622-4338 encode GFP. The DNA molecule having the nucleotide sequence shown in SEQ ID No. 14 was used to replace the fragment between the KpnI and XbaI restriction sites of the pcDNA3.1P2AGFP vector (the small fragment between the KpnI and XbaI restriction sites), while keeping the other nucleotide sequences of the pcDNA3.1-P2AGFP vector unchanged, to obtain the pcDNA3.1-cmv-7NABE-P2AGFP plasmid.

[0365] PcDNA3.1-cmv-7NABE-P2AGFP plasmid (A in FIG5 ) can express three proteins, namely TadA-Cas7 fusion protein, Cas6 and Cas5. The amino acid sequence of TadA-Cas7 is SEQ ID No.15, wherein SEQ ID No.15 positions 1-19 are membrane-penetrating peptides, SEQ ID No.15 positions 20-185 are the amino acid sequence of TadA, SEQ ID No.15 positions 186-227 are the amino acid sequence of the connecting peptide, and SEQ ID No.15 positions 228-563 are the amino acid sequence of Cas7. The amino acid sequence of Cas6 is SEQ ID No.5, and the amino acid sequence of Cas5 is SEQ ID No.6. TadA-Cas7 fusion protein, Cas6 and Cas5 form a complex to perform base editing function.

[0366] The nucleotide sequence of the 7CABE fragment is shown in SEQ ID No. 16, wherein positions 1-9 of SEQ ID No. 16 are kozak sequences, positions 10-39 of SEQ ID No. 16 encode penetrant 1, positions 40-1047 of SEQ ID No. 16 encode Cas7, positions 1048-1116 of SEQ ID No. 16 encode a connecting peptide, positions 1117-1614 of SEQ ID No. 16 encode TadA, positions 1615-1668 of SEQ ID No. 16 encode T2A-1, positions 1669-1698 of SEQ ID No. 16 encode penetrant 2, positions 1699-2292 of SEQ ID No. 16 encode Cas6, positions 2293-2346 of SEQ ID No. 16 encode T2A-2, positions 2347-2376 of SEQ ID No. 16 encode penetrant 3, and positions 2377-2380 of SEQ ID No. 16 encode TadA. Positions 2377-3474 of SEQ ID No. 16 encode Cas5, positions 3475-3546 of SEQ ID No. 16 encode P2A, and positions 3547-4263 encode GFP. The DNA molecule having the nucleotide sequence of SEQ ID No. 16 was used to replace the fragment between the KpnI and XbaI restriction sites of the pcDNA3.1P2AGFP vector (the small fragment between the KpnI and XbaI restriction sites), while keeping the other nucleotide sequences of the pcDNA3.1-P2AGFP vector unchanged, to obtain the pcDNA3.1-cmv-7CABE-P2AGFP plasmid.

[0367] The pcDNA3.1-cmv-7CABE-P2AGFP plasmid (A in FIG5 ) can express three proteins, namely Cas7-TadA fusion protein, Cas6 and Cas5. The amino acid sequence of Cas7-TadA is SEQ ID No.17, wherein SEQ ID No.17 positions 1-11 are transmembrane peptides, SEQ ID No.17 positions 12-347 are the amino acid sequence of Cas7, SEQ ID No.17 positions 348-370 are the amino acid sequence of the connecting peptide, and SEQ ID No.17 positions 371-563 are the amino acid sequence of TadA. The amino acid sequence of Cas6 is SEQ ID No.5, and the amino acid sequence of Cas5 is SEQ ID No.6. Cas7-TadA fusion protein, Cas6 and Cas5 form a complex to perform base editing function.

[0368] 5.2. Co-transfection of crRNA expression plasmid and protein expression plasmid into HEK293T cells

[0369] Different crRNA expression plasmids and protein expression plasmids were co-transfected into HEK293T cells according to the experimental groups shown in Table 5. The specific co-transfection experimental procedures and post-transfection HEK293T cell culture were referred to Section 2.2 of Example 2. The total amount of crRNA expression plasmid was 0.8 μg, and the amount of protein expression plasmid was 1.2 μg. The experiment was repeated three times.

[0370] Table 5 Experimental groups for identifying TadA editing windows for different subunit fusions

[0371] 5.3. Flow cytometry sorting and collection of GFP-positive cells

[0372] Successfully transfected cells can express GFP and emit green fluorescence. In order to enrich the successfully transfected cells and detect the corresponding effect of the tool, the transfected cells are flow cytometry sorted.

[0373] (A) Sample processing

[0374] Aspirate the culture medium from the 12-well plate, rinse once with 500 μL PBS and discard. Add 500 μL of trypsin to digest the cells. After 3-5 minutes, add 500 μL of 10% FBS DMEM medium to terminate the reaction. Remove any cells from the bottom of the well plate and transfer to a 1.5 mL EP tube. Centrifuge at 1200 rpm for 5 minutes to collect the cells at the bottom of the tube. Resuspend the cells in 200 μL PBS and filter through a 70 μm cell strainer. Place the processed sample on ice pending loading.

[0375] (B) Flow cytometry

[0376] Load negative cells that do not emit light at all. Using a 488nm laser, circle events that match the cell size with P1, remove adherent multicellular clusters with P2 and P3, and circle the range where the FITC value does not include negative cells with P4. Next, load the sorted samples, collecting 10,000 GFP-positive cells per sample and placing them on ice.

[0377] (C) Lysed cells

[0378] Centrifuge the collected cells at 1500 rpm for 5 minutes and discard the supernatant. Add 30 μL of lysis buffer and incubate at 37°C for 1 hour and then at 85°C for 20 minutes. Freeze the lysed sample at -80°C or perform PCR analysis.

[0379] Lysis buffer was prepared by adding 1 μL of proteinase K to 1 mL of lysis buffer and mixing well to obtain the lysis buffer. The formula for 1 L of lysis buffer was as follows: 10 mL of 1 M Tris-HCl (pH 7.5) was mixed with 5 mL of 10% (weight / volume) SDS solution, and double-distilled water was added to a final volume of 1 L.

[0380] 5.4. PCR target region fragments and NGS detection of base editing efficiency

[0381] Design primers with different barcodes. See Table 6 for sequence information. Mix different samples for sequencing. See Table 6 for the correspondence between primers and samples. The PCR system is as follows:

[0382] The reaction conditions were: 95°C for 5 min; 95°C for 10 s; 56°C for 20 s; and 72°C for 12 s, for 30 cycles. PCR products of appropriate sizes were excised and recovered by electrophoresis on a 2% agarose gel. The excised gel was added to 3 times the gel volume of Buffer GDP and completely dissolved in a 65°C water bath. One gel volume of isopropanol was added and mixed. The gel solution was transferred to an adsorption column and centrifuged at 12,000 rpm for 30 s. 300 μL of Buffer GDP was added, the solution was allowed to stand for 1 min, and then centrifuged at 12,000 rpm for 30 s. 700 μL of Buffer GW was added, and the solution was centrifuged at 12,000 rpm for 30 s. After this step, the filtrate was discarded, the solution was centrifuged at 12,000 rpm for 2 min, 30 μL of ddH2O was added, the solution was allowed to stand at room temperature for 2 min, and then centrifuged at 12,000 rpm for 2 min. The recovered DNA fragment solution was frozen at -20°C.

[0383] 200 ng of each of the barcoded samples (NT (Nontarget) 1, NT2, NT3, T (Target) 1-1, T1-2, T1-3, T2-1, T2-2, and T2-3) were mixed and sent to AZENTA for sequencing. The returned sequencing data were analyzed using CRISPResso2 software to analyze the efficiency of base editing, where the A·T base at position 5 (position 1, the first base at the 5' end of the spacer) was replaced with a G. For example, the editing efficiency of the A base (A5) at position 5 (position 1, the first base at the 5' end of the spacer) in the target region was calculated as the number of reads with a G at position 5 divided by the total number of reads in the sample.

[0384] The experimental results are shown in Figure 7, with the editing windows of different fusion proteins plotted against the bases A at different positions within the target region as the horizontal axis and the editing efficiency as the vertical axis. The results show that all four tools, fused to the TadA8e adenine deaminase at either the C-terminus or N-terminus of Cas5 or Cas7, substituted A·T with G·C within the target region. The editing efficiency exhibited a bimodal pattern within the 4-32 nt editing window, while the non-target control showed almost no significant editing. 5NABE achieved peak editing efficiency at bases A9 and A27, with A27 showing a 30.4% efficiency; 5CABE achieved peak editing efficiency at bases A6 and A26, with A6 showing a 21.4% efficiency; 7NABE achieved peak editing efficiency at bases A11 and A26, with A26 showing an 11.5% efficiency; and 7CABE achieved peak editing efficiency at bases A13 and A26, with A13 showing a 21.1% efficiency. The 5NABE tool exhibited the highest base editing efficiency. A wide editing window can increase the targetable range and is also conducive to destroying functional sequences (such as destroying viral infection-related genes or transcriptional inhibitory genes for disease treatment) and performing gene screening (such as for crop breeding).

[0385] Example 6: I-F2 CRISPR-Cas system 5NABE tool targets the BCL11A enhancer region to achieve base editing, with potential application in disease treatment

[0386] 6.1. Construction of crRNA expression plasmid pcDNA3.1-hU6-crRNA and protein expression plasmid pcDNA3.1-cmv-5NABE-P2AGFP targeting the GATA1 binding site in the enhancer region of the BCL11A gene

[0387] BCL11A is a transcription factor that represses the expression of γ-globin and fetal hemoglobin in erythroid cells. Therefore, targeted inhibition of BCL11A could theoretically reactivate γ-globin expression and thereby treat thalassemia and sickle cell anemia. A base change in the GATA1 binding site within the BCL11A gene enhancer significantly reduces gene expression, thereby relieving the repression of fetal hemoglobin expression and achieving the goal of disease treatment.

[0388] The GATA1 binding site of the BCL11A gene of HEK293T cells located near positions 9 and 27 in the spacer region was selected as the target, and two target fragments were synthesized by annealing BC-F1 and BC-R1, and BC-F2 and BC-R2 in Table 6, respectively.

[0389] The steps of crRNA expression plasmid pcDNA3.1-hU6-crRNA were referred to 2.1 in Example 2, and the annealing primer sequences used were shown in Table 6. Two pcDNA3.1-hU6-crRNA plasmids were constructed and named: pcDNA3.1-hU6-crRNA-BC1 and pcDNA3.1-hU6-crRNA-BC2.

[0390] pcDNA3.1-hU6-crRNA-BC1 is a recombinant expression vector obtained by replacing the fragment between the two repeat sequences of the vector pcDNA3.1-hU6-crRNA with a DNA molecule whose nucleotide sequence is the 5-36th position of the primer BC-F1, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged;

[0391] pcDNA3.1-hU6-crRNA-BC2 is a recombinant expression vector obtained by replacing the fragment between the two repeat sequences of the vector pcDNA3.1-hU6-crRNA with a DNA molecule whose nucleotide sequence is the 5-36th position of the primer BC-F2, while keeping the other nucleotide sequences of the vector pcDNA3.1-hU6-crRNA unchanged;

[0392] 6.2. Construction of protein expression plasmid pcDNA3.1-cmv-5NABE-P2AGFP was the same as 5.1 in Example 5.

[0393] The primer sequences involved in Examples 5 and 6 are shown in Table 6, where the underlined portion is the sticky end and the wavy portion is the barcode.

[0394] Table 6 Primer sequences used in Examples 5 and 6

[0395] 6.3. Co-transfection of HEK293T cells with pcDNA3.1-hU6-crRNA plasmid and pcDNA3.1-cmv-5NABE-P2AGFP

[0396] Different crRNA expression plasmids and protein expression plasmids pcDNA3.1-cmv-5NABE-P2AGFP were co-transfected into HEK293T cells according to the experimental groups shown in Table 7. For the specific co-transfection experimental steps and the culture of HEK293T cells after transfection, refer to Section 2.2 of Example 2. The amount of crRNA expression plasmid targeting the BCL11A gene was 0.8 μg, and the amount of protein expression plasmid was 1.2 μg. The experiment was repeated three times.

[0397] Table 7 Experimental groups of HEK293T cells co-transfected with crRNA expression plasmids and protein expression plasmids of different targets

[0398] (3) Flow cytometry sorting to collect GFP-positive cells, PCR target region fragments, and NGS detection of base editing efficiency

[0399] The base editing efficiency of the 5NABE tool at the target of the BCL11A gene in HEK293T cells was determined by referring to the methods shown in 5.3 and 5.4 of Example 5, wherein the primer sequences with different barcodes are shown in Table 6.

[0400] The experimental results are shown in Figure 6. The results in Figure 6 demonstrate varying degrees of base editing efficiency for A bases within the target region, with virtually no significant editing observed in the non-target control. The editing efficiency for the A·T to G·C base pair substitution at GATA1 binding site A24 in target 1 was 31.2%, while the editing efficiency for the A·T to G·C base pair substitution at GATA1 binding site A6 in target 2 was 49.6%. The A·T to G·C base pair substitution was highly efficient across the target region.

[0401] Table 8 Other important sequences in this application

[0402] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experiments, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In short, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including changes that depart from the disclosed scope in the present application and are made using conventional techniques known in the art.

[0403] Industrial Applications

[0404] The I-F2 type system of the Moraxella osloensis CCUG 350 strain, whose effector proteins include Cas5, Cas6, and Cas7 (the Cas5 and Cas7 proteins of the I-F2 system have no significant homology with other reported Cas proteins). The Cas5 gene size in this system is 1101bp, the Cas6 gene size is 597bp, and the Cas7 gene size is 1011bp, totaling 2709bp. The I-F2 type CRISPR-Cas system disclosed in this application is the smallest type I effector protein with the fewest components. By introducing a point mutation to obtain Cas7L175F, we obtained the optimized I-F2 type CRISPR-Cas system function.

[0405] The I-F2 CRISPR-Cas system also includes a crRNA targeting the upstream region of the gene promoter. Our laboratory designed a universal template for the crRNA expression cassette, hU6-MosBbsI. hU6-MosBbsI is a DNA molecule with the nucleotide sequence of SEQ ID No. 1, in which positions 1-249 of SEQ ID No. 1 represent the hU6 promoter sequence, positions 252-279 and 296-323 of SEQ ID No. 1 represent repeat sequences, and positions 282-293 represent two BbsI enzyme recognition sites. When used, the nucleotide sequence between the two repeat sequences of SEQ ID No. 1 is replaced with a spacer fragment of the target gene to obtain a DNA molecule that transcribes the crRNA targeting the target gene.

[0406] Fusion of transcriptional regulatory factors to effector proteins (Cas5, Cas6 or Cas7) can be used to regulate the transcription level of genes. Fusion of deaminases (such as cytidine deaminase or adenosine deaminase) or glycosylases to effector proteins (Cas5, Cas6 or Cas7) can be used for single-base editing of genes. Fusion of reverse transcriptases to effector proteins (Cas5, Cas6 or Cas7) can form lead editors for base editing of genes. Epigenetic modification proteins to effector proteins (Cas5, Cas6 or Cas7) can be used for epigenetic modification of genes. Fusion of nucleases or single-chain nicking enzymes to effector proteins (Cas5, Cas6 or Cas7) can be used for gene cutting.

[0407] The core component of the I-F2 type CRISPR-Cas system disclosed in this application is a tool for achieving base editing at the target in eukaryotic cells. It is the smallest type I effector protein with the least components. In the examples provided in this application, deaminases (taking adenine TadA8e as an example) are fused to the N-terminus and C-terminus of Cas5 and Cas7L175F proteins (L175F point mutations), respectively. It is determined that adenine deaminase TadA8e is coupled to the N-terminus of the Cas5 subunit, and the target editing region is targeted by crRNA. A unique wide editing window of about 30nt is obtained, and nearly 30% editing efficiency is obtained at A9 and A27 of the editing window. A high level of base editing is achieved for disease-related targets in eukaryotic cells, indicating that the I-F2 type CRISPR-Cas system provided in this application has universal applicability and high efficiency in eukaryotic cells. The wide editing window can increase the targetable range, and is also conducive to destroying functional sequences (such as destroying viral infection-related genes or transcriptional inhibitory genes for disease treatment) and performing gene screening (such as for crop breeding).

[0408] Fusion expression of Cas7L175F with the VPR transcriptional activator significantly boosted transcriptional activation. Furthermore, extending the spacer resulted in transcriptional activation efficiencies comparable to or even superior to those achieved by the dCas9-VPR tool at the ASCL1 and IL1B target sites, demonstrating the universal applicability and high efficiency of the modified I-F2 CRISPR-Cas system provided in this application in eukaryotic cells. In some embodiments of the present application, Cas7L175F, Cas6, Cas5 and transcriptional regulatory factors in the I-F2 type CRISPR-Cas system connected to a transcription activator are expressed in eukaryotic cells in the form of the same transcript, and the coding sequence is numbered as SEQ ID No. 18. Positions 1-9 of SEQ ID No. 18 are kozak sequences, positions 10-39 encode penetrating peptide 1, positions 40-1047 encode Cas7L175F, positions 1048-1107 encode connecting peptide 1, positions 1108-2640 encode VPR, positions 2641-2694 encode T2A-1, positions 2695-2724 encode penetrating peptide 2, positions 2725-3318 encode Cas6, positions 3319-3372 encode T2A-2, positions 3373-3402 encode penetrating peptide 3, and positions 3403-4500 encode Cas5. The fragment between the KpnI and XhoI restriction sites of the pcDNA3.1 vector (the small fragment between the KpnI and XhoI restriction sites) was replaced with the DNA molecule having the nucleotide sequence shown in SEQ ID No. 18, while keeping the other nucleotide sequences of the pcDNA3.1 vector unchanged, to obtain the pcDNA3.1-cmv-Cas7L175FVPR plasmid. The pcDNA3.1-cmv-Cas7L175FVPR plasmid can express three proteins, namely, Cas7L175F-VPR fusion protein, Cas6 and Cas5. The amino acid sequence of the Cas7L175F-VPR fusion protein is SEQ ID No. 19, wherein positions 1-11 of SEQ ID No. 19 are the amino acid sequence of penetrating peptide 1, positions 12-347 of SEQ ID No. 19 are the amino acid sequence of Cas7, positions 348-367 of SEQ ID No. 19 are the amino acid sequence of connecting peptide 1, and positions 368-878 of SEQ ID No. 19 are the amino acid sequence of VPR. The amino acid sequence of Cas6 is SEQ ID No. 5, the amino acid sequence of Cas5 is SEQ ID No. 6. Cas7L175F-VPR fusion protein, Cas6 and Cas5 form a complex with crRNA to exert transcriptional regulatory function.

[0409] The present application has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present application, and without the need to carry out unnecessary experiments, the present application can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present application provides specific embodiments, it should be understood that further improvements can be made to the present application. In short, according to the principles of the present application, the present application is intended to include any changes, uses or improvements to the present application, including changes that depart from the disclosed scope in the present application and are made using conventional techniques known in the art.

Claims

1. [Corrected according to Rule 91 on 18.11.2024] A gene editing composition, characterized in that, The gene editing composition includes a protein composition and crRNA, and the protein composition is selected from any one of the following: A1), Cas7, Cas6, and TadA8e-Cas5 fusion protein; A2), the Cas7, the Cas6, and Cas5-TadA8e fusion protein; A3), TadA8e-Cas7 fusion protein, the Cas6, and the Cas5; A4), Cas7-TadA8e fusion protein, the Cas6, and the Cas5; The TadA8e-Cas5 fusion protein is a fusion protein obtained by connecting a deaminase to the N-terminus of the Cas5; The Cas5-TadA8e fusion protein is a fusion protein obtained by connecting the deaminase to the C-terminus of the Cas5; The TadA8e-Cas7 fusion protein is a fusion protein obtained by connecting the deaminase to the N-terminus of the Cas7; The Cas7-TadA8e fusion protein is a fusion protein obtained by connecting the deaminase to the C-terminus of the Cas7; The Cas7 is selected from any one of B1) to B3): B1), a protein with an amino acid sequence of SEQ ID No. 11 (Cas7L175F); B2), a protein related to Cas7 with more than 80% identity to the protein shown in B1) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B1); B3), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B1) or B2); The Cas6 is selected from any one of B4) to B6): B4), a protein with an amino acid sequence of SEQ ID No. 5; B5), a protein related to Caso with more than 80% identity to the protein shown in B4) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B4); B6), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B4) or B5); The Cas5 is selected from any one of B7) to B9): B7), a protein with an amino acid sequence of SEQ ID No. 6; B8), a protein related to Cas5 with more than 80% identity to the protein shown in B7) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B7); B9), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B7) or B8).

2. The gene editing composition according to claim 1, wherein The deaminase is selected from any one of the following: B10), a protein with an amino acid sequence from positions 11 to 176 of SEQ ID No. 10; B11), a protein related to the deaminase with more than 80% identity to the protein shown in B10) obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B10); B12), a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of B10) or B11).

3. The gene editing composition according to claim 1 or 2, wherein The TadA8e-Cas5 fusion protein is any one of the following: B13), a protein with the amino acid sequence of SEQ ID No. 10; B14), a protein related to the TadA8e-Cas5 fusion protein, which has more than 80% identity with the protein shown in B13) and is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B13); B15), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B13) or B14); The Cas5-TadA8e fusion protein is any one of the following: B16), a protein with the amino acid sequence of SEQ ID No. 13; B17), a protein related to the Cas5-TadA8e fusion protein, which has more than 80% identity with the protein shown in B16) and is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B16); B18), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B16) or B17); The TadA8e-Cas7 fusion protein is any one of the following: B19), a protein with the amino acid sequence of SEQ ID No. 15; B20), a protein related to the TadA8e-Cas7 fusion protein, which has more than 80% identity with the protein shown in B19) and is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B19); B21), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B19) or B20); The Cas7-TadA8e fusion protein is any one of the following: B22), a protein with the amino acid sequence of SEQ ID No. 17; B23), a protein related to the Cas7-TadA8e fusion protein, which has more than 80% identity with the protein shown in B22) and is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B22); B24), a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B22) or B23).

4. A biological material, characterized in that, The biological material is any one of the following: C1), a nucleic acid molecule encoding the protein composition described in any one of claims 1-3 and / or a nucleic acid molecule encoding the crRNA described in claim 1; C2), an expression cassette containing the nucleic acid molecule described in C1); C3), a recombinant vector containing the nucleic acid molecule described in C1), or a recombinant vector containing the expression cassette described in C2); C4), a recombinant microorganism containing the nucleic acid molecule described in C1), or a recombinant microorganism containing the expression cassette described in C2), or a recombinant microorganism containing the recombinant vector described in C3); C5), a transgenic plant cell line containing the nucleic acid molecule described in C1), or a transgenic plant cell line containing the expression cassette described in C2), or a transgenic animal and plant cell line containing the recombinant vector described in C3). C6), a transgenic animal cell line containing the nucleic acid molecule described in C1), or a transgenic animal cell line containing the expression cassette described in C2), or a transgenic animal cell line containing the recombinant vector described in C3).

5. [Corrected according to Rule 91 on 18.11.2024] The biomaterial according to claim 4, characterized in that: The nucleic acid molecule encoding the protein composition according to any one of claims 1-3 described in C1) is any one of the following: g1), the encoding gene is the DNA molecule at positions 1810-3501 of SEQ ID No. 9 (encoding TadA-Cas5); g2), the encoding gene is the DNA molecule of SEQ ID No. 9 (encoding Cas7L175F-CAS6-TadA-Cas5); g3), the encoding gene is the DNA molecule at positions 1810-3462 of SEQ ID No. 12 (encoding Cas5-TadA); g4), the encoding gene is the DNA molecule of SEQ ID No. 12 (encoding Cas7L175F-CAS6-Cas5-TadA); g5), the encoding gene is the DNA molecule at positions 64-1695 of SEQ ID No. 14 (encoding TadA-Cas7L175F); g6), the encoding gene is the DNA molecule of SEQ ID No. 14 (encoding TadA-Cas7L175F-CAS6-Cas5); g7), the encoding gene is the DNA molecule at positions 40-1614 of SEQ ID No. 16 (encoding Cas7L175F-TadA); g8), the encoding gene is the DNA molecule of SEQ ID No. 16 (encoding Cas7L175F-TadA-CAS6-Cas5).

6. Use of the gene editing composition according to any one of claims 1-3 and / or the biological material according to claim 4 or 5, wherein the use is any one of the following: D1), use in regulating gene base editing; D2), use in preparing a product for regulating gene base editing; D3), use in regulating gene single-base editing; D4), use in preparing a product for regulating gene single-base editing; D5), use in treating thalassemia and sickle cell anemia; D6), use in preparing a product for treating thalassemia and sickle cell anemia.

7. A product for gene editing, the product containing the gene editing composition according to any one of claims 1-3 and / or the biological material according to claim 4 or 5.

8. A method for gene base editing, the method comprising introducing the composition according to any one of claims 1-3 and / or the biological material according to claim 4 or 5 or the product according to claim 7 into a recipient cell to achieve base editing of a specific gene in the cell.

9. A protein composition (effector protein of the CRISPR / Cas system), characterized in that the protein composition comprises Cas7, Cas6 and Cas5, the Cas7 is selected from any one of the following: B1), a protein with the amino acid sequence of SEQ ID No. 11 (Cas7L175F); A protein that has more than 80% identity with the protein shown in B1) and is related to Cas7, which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B2) or B1); A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B1) or B2); The Cas6 is selected from any one of B4) to B6): B4) A protein with the amino acid sequence of SEQ ID No. 5; B5) A protein that has more than 80% identity with the protein shown in B4) and is related to Cas6, which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B4); B6) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B4) or B5); The Cas5 is selected from any one of B7) to B9): B7) A protein with the amino acid sequence of SEQ ID No. 6; B8) A protein that has more than 80% identity with the protein shown in B7) and is related to Cas5, which is obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in B7); B9) A fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B7) or B8).

10. Protein nucleic acid composition, characterized in that, The protein nucleic acid composition includes the protein composition according to claim 9 and RNA.

11. A biological material, characterized in that, The biological material is selected from any one of the following: G1) A nucleic acid molecule encoding the protein composition according to claim 9 or 10 and / or a nucleic acid molecule encoding the RNA according to claim 10; G2) An expression cassette containing the nucleic acid molecule described in G1); G3) A recombinant vector containing the nucleic acid molecule described in G1), or a recombinant vector containing the expression cassette described in G2); G4) A recombinant microorganism containing the nucleic acid molecule described in G1), or a recombinant microorganism containing the expression cassette described in G2), or a recombinant microorganism containing the recombinant vector described in G3); G5) A transgenic plant cell line containing the nucleic acid molecule described in G1), or a transgenic plant cell line containing the expression cassette described in G2), or a transgenic plant or animal cell line containing the recombinant vector described in G3); G6) A transgenic animal cell line containing the nucleic acid molecule described in G1), or a transgenic animal cell line containing the expression cassette described in G2), or a transgenic animal cell line containing the recombinant vector described in G3).

12. The biomaterial according to claim 11, characterized in that, The nucleic acid molecule encoding the effector protein according to claim 9 or 10 is any one of the following: g9) A DNA molecule whose coding gene is positions 40 - 1047 of SEQ ID No. 9 (encoding Cas7L1); g10) A DNA molecule whose coding gene is positions 1132 - 1725 of SEQ ID No. 9 (encoding Cas6); g11) A DNA molecule whose coding gene is positions 2404 - 3501 of SEQ ID No. 9 (encoding Cas5).

13. Application, characterized in that, The application is the application of the protein composition according to claim 9 and / or the protein nucleic acid composition according to claim 10 and / or the biological material according to claim 11 or 12 in any one of the following: H1), Application in gene base editing, H2), Application in preparing products for gene base editing, H3), Application in regulating gene transcription level, H4), Application in preparing products for regulating gene transcription level, H5), Application in gene epigenetic modification, H6), Application in preparing products for gene epigenetic modification; H7), Application in gene cleavage (or cutting) and / or ligation, H8), Application in preparing products for gene cleavage (or cutting) and / or ligation.

14. A gene transcription regulation composition, characterized in that, The gene transcription regulatory composition includes a protein composition and crRNA. The protein composition includes a Cas7 fusion protein, the Cas6, and the Cas5; the Cas7 fusion protein is obtained by linking a transcription regulatory factor and the Cas7.

15. The gene transcription regulation composition according to claim 14, wherein The transcription regulatory factor is a transcription activator, and the transcription activator is selected from any one of the following: H1), A protein with an amino acid sequence at positions 368 - 878 of SEQ ID No. 4; H2), A protein that has more than 80% identity with the protein shown in H1) and is related to a transcription activator, obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in H1); H3), A fusion protein obtained by linking a tag to the N - terminus and / or C - terminus of H1) or H2).

16. The gene transcription regulatory composition according to claim 14 or 15, wherein: The Cas7 fusion protein is any one of the following: I1), A protein with an amino acid sequence of SEQ ID No. 4; I2), A protein that has more than 80% identity with the protein shown in I1) and is related to a Cas7 fusion protein, obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in I1); I3), A fusion protein obtained by linking a tag to the N - terminus and / or C - terminus of I1) or I2).

17. A biological material related to the gene transcription regulation composition according to any one of claims 14-16, characterized in that, The biological material is any one of the following: J1), A nucleic acid molecule encoding the protein composition according to any one of claims 14 - 16 and / or a nucleic acid molecule encoding the crRNA according to claim 14; J2), An expression cassette containing the nucleic acid molecule described in J1); J3), A recombinant vector containing the nucleic acid molecule described in J1), or a recombinant vector containing the expression cassette described in J2); J4), A recombinant microorganism containing the nucleic acid molecule described in J1), or a recombinant microorganism containing the expression cassette described in J2), or a recombinant microorganism containing the recombinant vector described in J3); J5), A transgenic plant cell line containing the nucleic acid molecule described in J1), or a transgenic plant cell line containing the expression cassette described in J2), or a transgenic plant or animal cell line containing the recombinant vector described in J3); J6), A transgenic animal cell line containing the nucleic acid molecule described in J1), or a transgenic animal cell line containing the expression cassette described in J2), or a transgenic animal cell line containing the recombinant vector described in J3).

18. The biomaterial according to claim 17, wherein: The nucleic acid molecule encoding the protein composition according to any one of claims 14 - 16 described in J1) is any one of the following: g12), the coding gene is a DNA molecule at positions 40 - 2640 of SEQ ID No. 18 (encoding Cas7 L175F VPR); g13), the coding gene is a DNA molecule of SEQ ID No. 18 (encoding Cas7 L175F VPR - CAS6 - cas5); g14), the coding gene is a DNA molecule at positions 40 - 2640 of SEQ ID No. 3 (encoding Cas7 VPR); g15), the coding gene is a DNA molecule of SEQ ID No. 3 (encoding Cas7 VPR - CAS6 - cas5).

19. Use of the gene transcriptional regulation composition according to any one of claims 14 - 16 and / or the biological material according to claim 17 or 18, said use comprising: K1), use in gene transcriptional regulation; K2), use in the preparation of products for gene transcriptional regulation.

20. A product for regulating gene transcription, said product containing the gene transcriptional regulation composition according to any one of claims 14 - 16 and / or the biological material according to claim 9 or 10.

21. A method for gene transcriptional regulation, said method comprising introducing into a recipient cell the gene transcriptional regulation composition according to any one of claims 14 - 16 and / or the biological material according to claim 17 or 18 or the product according to claim 20 to achieve transcriptional activation of a specific gene in the cell.

22. A protein, characterized in that, The protein is Cas7L175F, and the Cas7L175F is selected from any one of the following: B1), a protein with an amino acid sequence of SEQ ID No. 11 (Cas7L175F); B2), a protein that has more than 80% identity with the protein shown in B1) and is related to Cas7, obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in B1); B3), a fusion protein obtained by connecting a tag to the N - terminal and / or C - terminal of B1) or B2).

23. A biomaterial, characterized in that, The biological material is any one of the following: M1), a nucleic acid molecule encoding the protein according to claim 22; M2), an expression cassette containing the nucleic acid molecule described in M1); M3), a recombinant vector containing the nucleic acid molecule described in M1), or a recombinant vector containing the expression cassette described in M2); M4), a recombinant microorganism containing the nucleic acid molecule described in M1), or a recombinant microorganism containing the expression cassette described in M2), or a recombinant microorganism containing the recombinant vector described in M3); M5), a transgenic plant cell line containing the nucleic acid molecule described in M1), or a transgenic plant cell line containing the expression cassette described in M2), or a transgenic plant or animal cell line containing the recombinant vector described in M3); M6), a transgenic animal cell line containing the nucleic acid molecule described in M1), or a transgenic animal cell line containing the expression cassette described in M2), or a transgenic animal cell line containing the recombinant vector described in M3).

24. The biomaterial according to claim 23, wherein The nucleic acid molecule described in M1) is selected from any one of the following: g12), the coding gene is a DNA molecule at positions 40-2640 of SEQ ID No. 18 (encoding Cas7 L175F VPR); g13), a nucleic acid molecule having 80% or more identity with g12) and encoding the protein described in claim 22.

Citation Information

Patent Citations

  • Modified cascade ribonucleoproteins and uses thereof

    CN104321429A

  • Novel CRISPR-Cas12i system

    CN114015674A

  • I-F2 type CRISPR-Cas system for regulating eukaryotic cell gene transcription and application of I-F2 type CRISPR-Cas system

    CN118272344A

  • Gene modulation with crispr system type i

    WO2020092725A1

  • Type i-f2 crispr-cas system for regulating and controlling eukaryotic cell gene transcription, and use thereof

    WO2024138481A1