Methods for the treatment of breast cancer using a JNK-1 inhibitor

By targeting the JNK/c-Jun pathway with a JNK-1 inhibitor, the mitogenic activity of OCDO in TNBC is inhibited, providing a novel treatment approach to reduce proliferation and improve outcomes for triple-negative breast cancer.

WO2025162980A1PCT designated stage Publication Date: 2025-08-07INST NAT DE LA SANTE & DE LA RECHERCHE MEDICALE (INSERM) +2
View PDF 18 Cites 0 Cited by

Patent Information

Application Number
PCT/EP2025/052230
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-01-30
Filing Date
2025-01-29
Publication Date
2025-08-07

AI Technical Summary

Technical Problem

Current treatments for triple-negative breast cancer (TNBC) are limited, and the molecular mechanisms underlying its progression are not well understood, leading to aggressive and poorly prognostic outcomes.

Method used

Targeting the JNK/c-Jun pathway by administering a therapeutically effective amount of a JNK-1 inhibitor to inhibit the mitogenic activity of OCDO, which is involved in TNBC progression.

Benefits of technology

Inhibiting JNK-1 activity effectively reduces the proliferation and progression of TNBC cells by blocking the OCDO/GR complex, offering a novel therapeutic strategy for this aggressive form of breast cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000005_0001
    Figure IMGF000005_0001
  • Figure IMGF000006_0001
    Figure IMGF000006_0001
  • Figure IMGF000007_0001
    Figure IMGF000007_0001
Patent Text Reader

Abstract

Breast cancer (BC) affects more than 2 million women and is the leading cause of cancer death in women worldwide. The aim of the present study was to determine whether the JNK / c-Jun pathway was involved in GR-mediated OCDO mitogenic activity and to explore the therapeutic targeting of this pathway in TNBC. The Inventors showed that the targeting of JNK1 in TNBC is essential to inhibit the mitogenic activity of OCDO. Accordingly, the present invention relates to a method of treating a subject suffering from breast cancer comprising administering to said subject a therapeutically effective amount of a JNK-1 inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] METHODS FOR THE TREATMENT OF BREAST CANCER USING A JNK-1 INHIBITOR

[0002] FIELD OF THE INVENTION:

[0003] The present invention is in the field of medicine, in particular oncology.

[0004] BACKGROUND OF THE INVENTION:

[0005] Breast cancer (BC) affects more than 2 million women and is the leading cause of cancer death in women worldwide. Great strides have been made in BC treatment using targeted therapies such as hormonotherapy for BC expressing estrogen and progesterone receptors (ER, PR) or with agents targeting BC overexpressing Her2 (Her2+). For so-called triple negative BC which express neither ER, PR nor HER2 (TN), chemotherapies are the reference treatments and few targeted therapies, such as immune checkpoint or PARP inhibitors, are offered to a minority of patients (1). Moreover, TNBC are more aggressive and associated with a poor prognosis and they often affect younger subjects. After chemotherapy these cancers are responsible for many early and late relapses. It is therefore essential to better understand the molecular mechanisms involved in the progression of TNBC with a view to developing novel precision therapeutic strategies to improve the prognosis of these patients.

[0006] Our previous data indicate that 5,6-epoxides of cholesterol (5,6-EC) metabolism is deregulated in BC and promotes ER + and TN BC development (2). In normal breast tissues, we showed that 5,6a-EC and 5,6 P-EC are transformed by the cholesterol epoxide hydrolase (ChEH) into cholestane-3p,5a,6P-triol (CT) (2). In BC, CT is further transformed into 6-oxo- cholestan-3p,5a-diol (OCDO, named oncosterone) by the l ip-hydroxy steroid dehydrogenasetype 2 enzyme (11PHSD2). 11PHSD2 is known to regulate glucocorticoid metabolism by converting active cortisol into inactive cortisone (2). We have established that OCDO promotes cell proliferation and cell cycle progression in ER+ and TN BC cells by binding to the glucocorticoid receptor (GR) (2). BC patient samples show significant increased OCDO levels and greater ChEH and 11PHSD2 protein expression compared with normal adjacent breast tissues. Moreover, ChEH and 11PHSD2 overexpression correlate with a higher risk of patient death and GR overexpression is correlated with poor progression-free and overall survival in patients with TN and ER-negative BC (12-14), highlighting that OCDO biosynthetic pathway is of major importance to BC pathology.

[0007] In tumor cells, the OCDO / GR complex activates GR translocation to the nucleus and GR target gene transcription via the activation of the transcription factor activator protein 1 (AP-1) (2), as exemplified with the MMP1 gene (collagenase), (6). In contrast, cortisol and dexamethasone, the canonic GR ligands, repressed MMP1 expression (2), consistent with the fact glucocorticoids repress AP-1 (6,7). AP-1 is a dimeric complex typically formed by the members of the c-Jun and c-Fos protein families. c-Jun is a positive regulator of cell proliferation and is required for Gl-to-S-phase progression (8). The oncogene c-Jun is phosphorylated by the c-Jun N-terminal kinases (JNKs) at residues serine 63 and 73 , resulting in increased AP-1 transcriptional activity (9,10). The JNK family is composed of three members JNK1, JNK2 and JNK3, which have two different splicing forms (JNK-46 and JNK- 54). JNK1 and JNK2 are ubiquitous while JNK3 is a tissue-specific isoform in brain, testis and heart. JNK1 appears to be the main isoform involved in c-Jun phosphorylation and cell proliferation, while JNK2 appears to be a negative regulator of c-Jun expression and phosphorylation as well as cell proliferation (11). Human GR has been shown to be directly phosphorylated by JNKs at Ser 226 (12) and by MAPK 38 and Erk at Ser 211 (13,14), following glucocorticoids stimulation. Phosphorylation at these sites were reported to regulate GR transcriptional activity (14,15). The JNKs were reported to be downstream effectors of Src kinases activity (16,17). These kinases activate different signaling pathways downstream of integrins and tyrosine kinase and nuclear receptors, leading to tumor growth and metastasis of several cancer types, including BC (18-20).

[0008] SUMMARY OF THE INVENTION:

[0009] The invention is defined by the claims. In particular, the present invention relates to a method of treating a subject suffering from breast cancer comprising administering to said subject a therapeutically effective amount of a JNK-1 inhibitor.

[0010] DETAILED DESCRIPTION OF THE INVENTION:

[0011] The aim of the present study was to determine whether the JNK / c-Jun pathway was involved in GR-mediated OCDO mitogenic activity and to explore the therapeutic targeting of this pathway in TNBC. The Inventors showed that the targeting of JNK1 in TNBC is essential to inhibit the mitogenic activity of OCDO.

[0012] Accordingly, the present invention relates to a method of treating breast cancer in a subject in need thereof comprising administering to the subject a therapeutically effective amount of a JNK-1 inhibitor. As used herein, the term “breast cancer” refers to a disease characterized by the uncontrolled growth of abnormal breast cells leading to tumor formation. Several subtypes of breast cancer exist, including: ER-positive (ER+), PR-positive (PR+), HER2-positive (HER2+) or Triple Negative (TN). As used herein, the term “ER-positive” or “ER+” refers to a breast cancer wherein tumors overexpress Estrogen Receptors (ER). In some embodiments, the breast cancer is an ER-positive breast cancer. As used herein, the term “PR-positive” or “PR+” refers to a breast cancer wherein tumors overexpress Progesterone Receptors (PR). In some embodiments, the breast cancer is an PR-positive breast cancer. As used herein, the term “HER2-positive” or “HER2+” refers to a breast cancer wherein tumors overexpress Human Epidermal growth factor Receptor 2 (HER2+). In some embodiments, the breast cancer is an HER2-positive breast cancer. As used herein, the term “Triple Negative Breast Cancer” or “TNBC” refers to a breast cancer wherein tumors do not express any of the ER, PR and HER2 receptor (ER- / PR- / HER2-). In some embodiments, the breast cancer is triple negative breast cancer.

[0013] In some embodiments, the present invention also relates to a method of treating a cancer associated to cholestane-6-oxo-3p,5a-diol (OCDO) production in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a JNK-1 inhibitor. In some embodiments, the cancer associated to cholestan-6-oxo-3p,5a-diol (OCDO) production is a breast cancer, in particular a TNBC. In some embodiments, the breast cancer or TNBC is associated to cholestan-6-oxo-3p,5a-diol (OCDO) production. As used herein, the term “associated to cholestan-6-oxo-3p,5a-diol production” refers to tumors producing cholestan- 6-oxo-3p,5a-diol, also known as “OCDO” or “oncosterone” (Voisin, Maud et al. “Identification of a tumor-promoter cholesterol metabolite in human breast cancers acting through the glucocorticoid receptor.” Proceedings of the National Academy of Sciences of the United States of America vol. 114,44 (2017): E9346-E9355). Indeed, it was previously demonstrated that cholesterol epoxide hydrolase (ChEH) metabolizes cholesterol-5,6-epoxide (5,6-EC) into cholestane-3p,5a,6P-triol, which is transformed into the oncometabolite 6-oxo-cholestan- 3p,5a-diol (OCDO) by l ip-hydroxy steroid-dehydrogenase-type-2 (11PHSD2). OCDO stimulates breast cancer cell growth by binding to the glucocorticoid receptor (GR), the nuclear receptor of endogenous cortisol. Typically and in order to determinate if a subject suffers from a cancer or a breast cancer associated to cholestan-6-oxo-3p,5a-diol production, a tumoral sample of the subject can be collected (e.g. a breast tumoral sample for breast cancer). As non- invasive methods, EP 23 305 003 describes radiotracers and associated methods to identify a cancer associated to cholestan-6-oxo-3p,5a-diol (OCDO) production. An exemplary representation of the chemical structure of oncosterone is shown below:

[0014] As used herein, the term “subject” or “patient” denotes a mammal, preferably female. Typically, a subject according to the invention refers to any subject (preferably human) afflicted with or susceptible to be afflicted with cancer, in particular breast cancer. In some embodiments, the subject suffers from cancer or breast cancer relapse. In some embodiments, the subject suffers from TNBC.

[0015] As used herein, the terms “treating”, “treatment” or “therapy” refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of subject at risk of contracting the disease or suspected to have contracted the disease as well as subject who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. In some embodiments, the term “treatment” also refers to the preventive treatment of cancer, in particular breast cancer. The treatment may be administered to a subject having a medical disorder or a subject likely to suffer from the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a subject during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a subject during treatment of an illness, e.g., to keep the subject in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., pain, disease manifestation, etc.]).

[0016] JNK-1 inhibitor

[0017] As used herein, the term “JNK-1” has its general meaning in the art and refers to the JNK-1 protein, also named as “c-Jun N-terminal Kinase 1”. JNK-1 is encoded by MAPK8 gene (NCBI Gene: 5599; Ensembl: ENSG00000107643). An exemplary amino acid sequence for JNK-1 is represented in SEQ ID NO:1. MSRSKRDNNF YSVE I GDSTF TVLKRYQNLK PI GSGAQGIV CAAYDAI LER NVAIKKLSRP FQNQTHAKRA YRELVLMKCV NHKNI I GLLN VFTPQKSLEE FQDVYIVMEL MDANLCQVIQ MELDHERMSY LLYQMLCGIK HLHSAGI IHR DLKPSNIVVK SDCTLKI LDF GLARTAGTS F MMTPYVVTRY YRAPEVI LGM GYKENVDLWS VGCIMGEMVC HKI LFPGRDY IDQWNKVIEQ LGTPCPE FMK KLQPTVRTYV ENRPKYAGYS FEKLFPDVLF PADSEHNKLK ASQARDLLSK MLVIDASKRI SVDEALQHPY INVWYDPSEA EAPPPKI PDK QLDEREHTIE EWKELIYKEV MDLEERTKNG VIRGQPS PLG AAVINGSQHP SSSSSVNDVS SMSTDPTLAS DTDSSLEAAA

[0018] GPLGCCR

[0019] As used herein, the term “ JNK-1 inhibitor” refers to a molecule that partially or fully blocks, inhibits, or neutralizes the biological activity or expression of JNK-1. In some embodiments, the JNK-1 inhibitor interacts directly with JNK-1. In some embodiments, the JNK-1 inhibitor interacts specifically with JNK-1. A JNK-1 inhibitor can be a molecule of any type that interferes with the signalling associated with JNK-1 in a cell, for example, either by decreasing transcription or translation of JNK-1 -encoding nucleic acid, or by inhibiting or blocking JNK-1 polypeptide activity, or both. Examples of JNK-1 inhibitors include, but are not limited to, antisense polynucleotides, interfering RNAs, catalytic RNAs, RNA-DNA chimeras, JNK-1 -specific aptamers, anti-JNK-1 antibodies, JNK-1 -binding fragments of anti- JNK-1 antibodies, JNK-1 -binding small molecules, JNK-1 -binding peptides, and other polypeptides that specifically bind JNK-1 (including, but not limited to, JNK-1 -binding fragments of one or more JNK-1 ligands, optionally fused to one or more additional domains), such that the interaction between the JNK-1 inhibitor and JNK-1 results in a reduction or cessation of JNK-1 activity or expression. In some embodiments, the JNK-1 inhibitor according to the invention may be a low molecular weight compound, e. g. a small organic molecule (natural or not). The term "small organic molecule" refers to a molecule (natural or not) of a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e. g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about

[0020] 10000 Da, more preferably up to 5000 Da, more preferably up to 2000 Da and most preferably up to about 1000 Da.

[0021] In some embodiments, the JNK-1 inhibitor is AS-602801 (Bentamapimod; CAS: 848344-36- 5). An exemplary representation of the chemical structure of AS-602801 is shown below:

[0022] In some embodiments, the JNK-1 inhibitor is CC-90001 (BMS-986360; CAS: 1403859-14-2).

[0023] An exemplary representation of the chemical structure of CC-90001 is shown below:

[0024] In some embodiments, the JNK-1 inhibitor is SP-600125 (Signal Research; CAS: 129-56-6).

[0025] An exemplary representation of the chemical structure of SP-600125 is shown below: In one embodiment, the inhibitor according to the invention (i.e. JNK-1 inhibitor) is an antibody. Antibodies directed against JNK-1 can be raised according to known methods by administering the appropriate antigen or epitope to a host animal selected, e.g., from pigs, cows, horses, rabbits, goats, sheep, and mice, among others. Various adjuvants known in the art can be used to enhance antibody production. Although antibodies useful in practicing the invention can be polyclonal, monoclonal antibodies are preferred. Monoclonal antibodies against JNK-1 can be prepared and isolated using any technique that provides for the production of antibody molecules by continuous cell lines in culture. Techniques for production and isolation include but are not limited to the hybridoma technique originally described by Kohler and Milstein (1975); the human B-cell hybridoma technique (Cote et al., 1983); and the EBV-hybridoma technique (Cole et al. 1985). Alternatively, techniques described for the production of single chain antibodies (see e.g., U.S. Pat. No. 4,946,778) can be adapted to produce anti-JNK-1 single chain antibodies. Compounds useful in practicing the present invention also include anti-JNK- 1 antibody fragments including but not limited to F(ab')2 fragments, which can be generated by pepsin digestion of an intact antibody molecule, and Fab fragments, which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab and / or scFv expression libraries can be constructed to allow rapid identification of fragments having the desired specificity to JNK-1. Humanized anti-JNK-1 antibodies and antibody fragments therefrom can also be prepared according to known techniques. "Humanized antibodies" are forms of non-human (e.g., rodent) chimeric antibodies that contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (CDRs) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity and capacity. In some instances, framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Methods for making humanized antibodies are described, for example, by Winter (U.S. Pat. No. 5,225,539) and Boss (Celltech, U.S. Pat. No. 4,816,397).

[0026] In another embodiment, the antibody according to the invention is a single domain antibody directed against JNK-1. The term “single domain antibody” (sdAb) or "VHH" refers to the single heavy chain variable domain of antibodies of the type that can be found in Camelid mammals which are naturally devoid of light chains. Such VHH are also called “nanobody®”. According to the invention, sdAb can particularly be llama sdAb. The term “VHH” refers to the single heavy chain having 3 complementarity determining regions (CDRs): CDR1, CDR2 and CDR3. The term “complementarity determining region” or “CDR” refers to the hypervariable amino acid sequences which define the binding affinity and specificity of the VHH. The VHH according to the invention can readily be prepared by an ordinarily skilled artisan using routine experimentation. The VHH variants and modified form thereof may be produced under any known technique in the art such as in-vitro maturation. VHHs or sdAbs are usually generated by PCR cloning of the V-domain repertoire from blood, lymph node, or spleen cDNA obtained from immunized animals into a phage display vector, such as pHEN2. Antigen-specific VHHs are commonly selected by panning phage libraries on immobilized antigen, e.g., antigen coated onto the plastic surface of a test tube, biotinylated antigens immobilized on streptavidin beads, or membrane proteins expressed on the surface of cells. However, such VHHs often show lower affinities for their antigen than VHHs derived from animals that have received several immunizations. The high affinity of VHHs from immune libraries is attributed to the natural selection of variant VHHs during clonal expansion of B- cells in the lymphoid organs of immunized animals. The affinity of VHHs from non-immune libraries can often be improved by mimicking this strategy in vitro, i.e., by site directed mutagenesis of the CDR regions and further rounds of panning on immobilized antigen under conditions of increased stringency (higher temperature, high or low salt concentration, high or low pH, and low antigen concentrations). VHHs derived from camelid are readily expressed in and purified from the E. coli periplasm at much higher levels than the corresponding domains of conventional antibodies. VHHs generally display high solubility and stability and can also be readily produced in yeast, plant, and mammalian cells. For example, the “Hamers patents” describe methods and techniques for generating VHH against any desired target (see for example US 5,800,988; US 5,874, 541 and US 6,015,695). The “Hamers patents” more particularly describe production of VHHs in bacterial hosts such as E. coli (see for example US 6,765,087) and in lower eukaryotic hosts such as moulds (for example Aspergillus or Trichoderma) or in yeast (for example Saccharomyces, Kluyveromyces, Hansenula or Pichia) (see for example US 6,838,254).

[0027] In one embodiment, the compound according to the invention is an aptamer. Aptamers are a class of molecule that represents an alternative to antibodies in term of molecular recognition. Aptamers are oligonucleotide or oligopeptide sequences with the capacity to recognize virtually any class of target molecules with high affinity and specificity. Such ligands may be isolated through Systematic Evolution of Ligands by Exponential enrichment (SELEX) of a random sequence library, as described in Tuerk C. and Gold L., 1990. The random sequence library is obtainable by combinatorial chemical synthesis of DNA. In this library, each member is a linear oligomer, eventually chemically modified, of a unique sequence. Possible modifications, uses and advantages of this class of molecules have been reviewed in Jayasena S.D., 1999. Peptide aptamers consists of a conformationally constrained antibody variable region displayed by a platform protein, such as E. coli Thioredoxin A that are selected from combinatorial libraries by two hybrid methods (Colas et al., 1996). Then, for this invention, neutralizing aptamers of JNK-1 are selected.

[0028] In one embodiment, the compound according to the invention is a polypeptide. In a particular embodiment the polypeptide is an inhibitor of JNK-1 and is capable to prevent the function of JNK-1. Particularly, the polypeptide can be a mutated ligand of JNK-1, a mutated JNK-1 protein, a truncated JNK-1 protein or a similar protein without the function of JNK-1. In some embodiments, the JNK-1 inhibitor is a fusion protein. As example, the fusion protein may comprise a JNK-1 polypeptide (e.g. JNK-1 binding site) linked to a second non JNK-1 polypeptide. In one embodiment, the polypeptide of the invention may be linked to a cellpenetrating peptide to allow the penetration of the polypeptide in the cell. The term “cellpenetrating peptides” are well known in the art and refers to cell permeable sequence or membranous penetrating sequence such as penetratin, TAT mitochondrial penetrating sequence and compounds (Bechara and Sagan, 2013; Jones and Sayers, 2012; Khafagy el and Morishita, 2012; Malhi and Murthy, 2012). The polypeptides of the invention may be produced by any suitable means, as will be apparent to those of skill in the art. In order to produce sufficient amounts of polypeptide or functional equivalents thereof for use in accordance with the present invention, expression may conveniently be achieved by culturing under appropriate conditions recombinant host cells containing the polypeptide of the invention. Preferably, the polypeptide is produced by recombinant means, by expression from an encoding nucleic acid molecule. Systems for cloning and expression of a polypeptide in a variety of different host cells are well known. When expressed in recombinant form, the polypeptide is preferably generated by expression from an encoding nucleic acid in a host cell. Any host cell may be used, depending upon the individual requirements of a particular system. Suitable host cells include bacteria mammalian cells, plant cells, yeast and baculovirus systems. Mammalian cell lines available in the art for expression of a heterologous polypeptide include Chinese hamster ovary cells. HeLa cells, baby hamster kidney cells and many others. Bacteria are also preferred hosts for the production of recombinant protein, due to the ease with which bacteria may be manipulated and grown. A common, preferred bacterial host is E coli. In specific embodiments, it is contemplated that polypeptides used in the therapeutic methods of the present invention may be modified in order to improve their therapeutic efficacy. Such modification of therapeutic compounds may be used to decrease toxicity, increase circulatory time, or modify biodistribution. For example, the toxicity of potentially important therapeutic compounds can be decreased significantly by combination with a variety of drug carrier vehicles that modify biodistribution. In example adding dipeptides can improve the penetration of a circulating agent in the eye through the blood retinal barrier by using endogenous transporters. A strategy for improving drug viability is the utilization of water-soluble polymers. Various water-soluble polymers have been shown to modify biodistribution, improve the mode of cellular uptake, change the permeability through physiological barriers; and modify the rate of clearance from the body. To achieve either a targeting or sustained-release effect, water-soluble polymers have been synthesized that contain drug moieties as terminal groups, as part of the backbone, or as pendent groups on the polymer chain. Polyethylene glycol (PEG) has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. Attachment to various drugs, proteins, and liposomes has been shown to improve residence time and decrease toxicity. PEG can be coupled to active agents through the hydroxyl groups at the ends of the chain and via other chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids were explored as novel biomaterials which would retain the biocompatibility properties of PEG, but which would have the added advantage of numerous attachment points per molecule (providing greater drug loading), and which could be synthetically designed to suit a variety of applications. Those of skill in the art are aware of PEGylation techniques for the effective modification of drugs. For example, drug delivery polymers that consist of alternating polymers of PEG and tri -functional monomers such as lysine have been used by VectraMed (Plainsboro, N. J.). The PEG chains (typically 2000 daltons or less) are linked to the a- and e-amino groups of lysine through stable urethane linkages. Such copolymers retain the desirable properties of PEG, while providing reactive pendent groups (the carboxylic acid groups of lysine) at strictly controlled and predetermined intervals along the polymer chain. The reactive pendent groups can be used for derivatization, cross-linking, or conjugation with other molecules. These polymers are useful in producing stable, long-circulating pro-drugs by varying the molecular weight of the polymer, the molecular weight of the PEG segments, and the cleavable linkage between the drug and the polymer. The molecular weight of the PEG segments affects the spacing of the drug / linking group complex and the amount of drug per molecular weight of conjugate (smaller PEG segments provides greater drug loading). In general, increasing the overall molecular weight of the block co-polymer conjugate will increase the circulatory halflife of the conjugate. Nevertheless, the conjugate must either be readily degradable or have a molecular weight below the threshold-limiting glomular filtration (e.g., less than 60 kDa). In addition, to the polymer backbone being important in maintaining circulatory half-life, and biodistribution, linkers may be used to maintain the therapeutic agent in a pro-drug form until released from the backbone polymer by a specific trigger, typically enzyme activity in the targeted tissue. For example, this type of tissue activated drug delivery is particularly useful where delivery to a specific site of biodistribution is required and the therapeutic agent is released at or near the site of pathology. Linking group libraries for use in activated drug delivery are known to those of skill in the art and may be based on enzyme kinetics, prevalence of active enzyme, and cleavage specificity of the selected disease-specific enzymes. Such linkers may be used in modifying the protein or fragment of the protein described herein for therapeutic delivery.

[0029] In another embodiment, the JNK-1 inhibitor according to the invention inhibits JNK-1 gene expression.

[0030] Small inhibitory RNAs (siRNAs) can also function as inhibitors of JNK-1 expression for use in the present invention. JNK-1 gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that JNK-1 gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known (e.g. see for example Tuschl, T. et al. (1999); Elbashir, S. M. et al. (2001); Hannon, GJ. (2002); McManus, MT. et al. (2002); Brummelkamp, TR. et al. (2002); U.S. Pat. Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos. WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836).

[0031] Ribozymes can also function as inhibitors of JNK-1 gene expression for use in the present invention. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Engineered hairpin or hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of JNK-1 mRNA sequences are thereby useful within the scope of the present invention. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites, which typically include the following sequences, GUA, GUU, and GUC. Once identified, short RNA sequences of between about 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site can be evaluated for predicted structural features, such as secondary structure, that can render the oligonucleotide sequence unsuitable. The suitability of candidate targets can also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using, e.g., ribonuclease protection assays. Both antisense oligonucleotides and ribozymes useful as inhibitors of JNK-1 gene expression can be prepared by known methods. These include techniques for chemical synthesis such as, e.g., by solid phase phosphoramadite chemical synthesis. Alternatively, anti-sense RNA molecules can be generated by in vitro or in vivo transcription of DNA sequences encoding the RNA molecule. Such DNA sequences can be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters. Various modifications to the oligonucleotides of the invention can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and / or 3' ends of the molecule, or the use of phosphorothioate or 2'-O-methyl rather than phosphodiesterase linkages within the oligonucleotide backbone.

[0032] Antisense oligonucleotides, siRNAs and ribozymes of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense oligonucleotide siRNA or ribozyme nucleic acid to the cells and preferably cells expressing JNK-1. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense oligonucleotide siRNA or ribozyme nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: retrovirus, such as moloney murine leukemia virus, harvey murine sarcoma virus, murine mammary tumor virus, and rouse sarcoma virus; adenovirus, adeno-associated virus; SV40- type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known to the art. Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non- cytopathic viruses include retroviruses (e.g., lentivirus), the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles are provided in Kriegler, 1990 and in Murry, 1991. Preferred viruses for certain applications are the adenoviruses and adeno-associated viruses, which are double-stranded DNA viruses that have already been approved for human use in gene therapy. The adeno- associated virus can be engineered to be replication deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion. In some embodiments, an endonuclease can be used to abolish the expression of JNK- 1. As an alternative to, as example, cDNA overexpression or downregulation by RNA interference, more recent technologies provide means to manipulate the genome. The mechanism behind endonuclease-based genome inactivating generally requires a first step of DNA single or double strand break, which can then trigger two distinct cellular mechanisms for DNA repair, which can be exploited for DNA inactivating: the error prone non homologous end-joining (NHEJ) and the high-fidelity homology-directed repair (HDR). In a particular embodiment, the endonuclease is CRISPR-cas. As used herein, the term “CRISPR-cas” has its general meaning in the art and refers to clustered regularly interspaced short palindromic repeats associated which are the segments of prokaryotic DNA containing short repetitions of base sequences. In some embodiment, the endonuclease is CRISPR-cas9 which is from Streptococcus pyogenes. The CRISPR / Cas9 system has been described in US 8697359 Bl and US 2014 / 0068797. Originally an adaptive immune system in prokaryotes (Barrangou and Marraffini, 2014), CRISPR has been engineered into a new powerful tool for genome editing. It has already been successfully used to target important genes in many cell lines and organisms, including human (Mali et al., 2013, Science, Vol. 339 : 823-826), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), zebrafish (Hwang et al., 2013, PLoS One, Vol. 8:e68708.), C. elegans (Hai et al., 2014 Cell Res. doi: 10.1038 / cr.2014.11.), bacteria (Fabre et al., 2014, PLoS Negl. Trop. Dis., Vol. 8:e2671.), plants (Mali et al., 2013, Science, Vol. 339 : 823-826), Xenopus tropicalis (Guo et al., 2014, Development, Vol. 141 : 707-714.), yeast (DiCarlo et al., 2013, Nucleic Acids Res., Vol. 41 : 4336-4343.), Drosophila (Gratz et al., 2014 Genetics, doi: 10.1534 / genetics. H3.160713), monkeys (Niu et al., 2014, Cell, Vol. 156 : 836- 843.), rabbits (Yang et al., 2014, J. Mol. Cell Biol., Vol. 6 : 97-99.), pigs (Hai et al., 2014, Cell Res. doi: 10.1038 / cr.2014.11.), rats (Ma et al., 2014, Cell Res., Vol. 24 : 122-125.) and mice (Mashiko et al., 2014, Dev. Growth Differ. Vol. 56 : 122-129.). Several groups have now taken advantage of this method to introduce single point mutations (deletions or insertions) in a particular target gene, via a single gRNA. Using a pair of gRNA-directed Cas9 nucleases instead, it is also possible to induce large deletions or genomic rearrangements, such as inversions or translocations. A recent development is the use of the dCas9 version of the CRISPR / Cas9 system to target protein domains for transcriptional regulation, epigenetic modification, and microscopic visualization of specific genome loci. In some embodiment, the endonuclease is CRISPR-Cpfl which is CRISPR from Provotella and Francisella 1 (Cpfl) in Zetsche et al. (“Cpfl is a Single RNA-guided Endonuclease of a Class 2 CRISPR-Cas System (2015); Cell; 163, 1-13).

[0033] Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those of skill in the art. See e.g. Sambrook et al., 1989. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigenencoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC / CMV, SV40, and pBlueScript. Other plasmids are well known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intramuscular, eye, intradermal, subcutaneous, or other routes. It may also be administered by intranasal sprays or drops, rectal suppository and orally. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and microencap sul ati on .

[0034] In a particular embodiment, the antisense oligonucleotide, siRNA, shRNA or ribozyme nucleic acid sequence is under the control of a heterologous regulatory region, e.g., a heterologous promoter. The promoter can also be, e.g., a viral promoter, such as CMV promoter or any synthetic promoters.

[0035] JNK-1 inhibitor in combination with at least one further therapeutic agent

[0036] In another aspect of the invention, the JNK-1 inhibitor is administered in combination with at least one further therapeutic agent.

[0037] In some embodiments, the at least one further therapeutic agent is a hormone therapy, in particular a ligand of the microsomal anti-estrogen binding site (AEBS). In some embodiments, the hormone therapy is Tamoxifen, Tesmilifene or l-[2-[4- (phenylmethyl)phenoxy]ethyl]-pyrrolidine (PBPE). In some embodiments, the at least one further therapeutic agent is a glucocorticoid (GR) antagonist. In some embodiments, the GR antagonist is Mifepristone. In some embodiments, the at least one further therapeutic agent is a CDK4 / 6 inhibitor (i.e. Cyclin-dependent kinase 4 and 6 inhibitor). In some embodiments, the CDK4 / 6 inhibitor is Palbociclib, Abemaciclib or Ribociclib. In some embodiments, the at least one further therapeutic agent is a Src inhibitor. In some embodiments, the Src inhibitor is Dasatinib. In some embodiments, the at least one further therapeutic agent is a chemotherapeutic agent selected from the group comprising alkylating agents, antimetabolites, topoisomerase inhibitors, antibiotics, mitotic inhibitors or protein kinase inhibitors. In some embodiments, the chemotherapeutic agent is selected from the group consisting in Carboplatin, Paclitaxel, Doxorubicin, Methotrexate, Pemetrexed, Cytarabine, 5-Fluorouracil, Capecitabine, Gemcitabine, 6-Mercaptopurine, Azathioprine, Fludarabine, Cladribine, Hydroxyurea, Cyclophosphamide, Ifosfamide, Chlorambucil, Melphalan, Temozolomide, Carmustine, Lomustine, Streptozocin, Busulfan, Procarbazine, Cisplatin, Carboplatin, Oxaliplatin, Irinotecan, Topotecan, Etoposide, Vincristine, Vinblastine, Vinorelbine, Docetaxel, Paclitaxel, Eribulin, Ixabepilone, Epothilone, Bleomycin, Actinomycin D, Daunorubicin, Idarubicin, Mitomycin, Imatinib, Nilotinib, Erlotinib, Gefitinib, Afatinib, Osimertinib, Cabozantinib, Pazopanib, Sunitinib, Sorafenib, Tivozanib, Axitinib, Lenvatinib, Regorafenib, Vandetanib, Alectinib, Crizotinib, Dabrafenib, Encorafenib, Vemurafenib, Trametinib, Ibrutinib, Ruxolitinib, L-Asparaginase, Bortezomib, Carfilzomib, Ixazomib or Olaparib. In some embodiments, at least one further therapeutic agent is an agent targeting oncosterone biosynthesis or biogenesis, in particular selected from the group comprising a ligand of the microsomal anti-estrogen binding site (AEBS), a Selective Estrogen Receptor Modulator (SERM), an EBP (Emopamil Binding site Protein) inhibitor, a 7-dehydrocholesterol reductase (DHCR7) inhibitor, a cholesterol epoxide hydrolase (ChEH) inhibitor, a sigma- 1 receptor ligand or a sigma-2 receptor ligand. In some embodiments, the agent targeting oncosterone biosynthesis or biogenesis is selected from the group comprising or consisting in tamoxifen, tesmilifene, raloxifene, terbinafine, haloperidol, trifluoroperazine, clomiphene, toremifene DSP-0390, TASIN (Truncated APC-Selective Inhibitors) compounds, dendrogenin A (DDA), perospirone, nefazodone, aripiprazole, trazodone buspirone, fluoxetine, risperidone, AY9944, BM15766 and cariprazine.

[0038] In some embodiments, the at least one further therapeutic agent is selected from the group consisting in Tamoxifen (CAS: 10540-29-1), PBPE (CAS: 262425-59-2), Tesmilifene (CAS: 98774-23-3), Dendrogenin A (CAS: 1191043-85-2), Mifepristone (CAS: 84371-65-3), Palbociclib (CAS: 571190-30-2), Carboplatin (CAS: 41575-94-4), Paclitaxel (CAS: 33069-62- 4), Dasatinib (CAS: 302962-49-8) or Doxorubicin (CAS: 23214-92-8). In some embodiments, the at least one further therapeutic agent is selected from the group consisting in Tamoxifen (CAS: 10540-29-1), Dendrogenin A (CAS: 1191043-85-2), Mifepristone (CAS: 84371-65-3), Palbociclib (CAS: 571190-30-2), Carboplatin (CAS: 41575-94-4) or Paclitaxel (CAS: 33069- 62-4).

[0039] In some embodiments, the JNK-1 inhibitor is AS-602801 and the at least one further therapeutic agent is selected from the group consisting in Tamoxifen (CAS: 10540-29-1), PBPE (CAS: 262425-59-2), Tesmilifene (CAS: 98774-23-3), Dendrogenin A (CAS: 1191043-85-2), Mifepristone (CAS: 84371-65-3), Palbociclib (CAS: 571190-30-2), Carboplatin (CAS: 41575- 94-4), Paclitaxel (CAS: 33069-62-4), Dasatinib (CAS: 302962-49-8) or Doxorubicin (CAS: 23214-92-8).

[0040] In some embodiments, the JNK-1 inhibitor is CC-90001 and the at least one further therapeutic agent is selected from the group consisting in Tamoxifen (CAS: 10540-29-1), Dendrogenin A (CAS: 1191043-85-2), Mifepristone (CAS: 84371-65-3), Palbociclib (CAS: 571190-30-2), Carboplatin (CAS: 41575-94-4), Paclitaxel (CAS: 33069-62-4), Dasatinib (CAS: 302962-49-8) or Doxorubicin (CAS: 23214-92-8).

[0041] In some embodiments, the JNK-1 inhibitor is SP600125 and the at least one further therapeutic agent is selected from the group consisting in Tamoxifen (CAS: 10540-29-1), Dendrogenin A (CAS: 1191043-85-2), Mifepristone (CAS: 84371-65-3), Palbociclib (CAS: 571190-30-2), Carboplatin (CAS: 41575-94-4), Paclitaxel (CAS: 33069-62-4), Dasatinib (CAS: 302962-49-8) or Doxorubicin (CAS: 23214-92-8).

[0042] In some embodiments, the cancer is a cancer producing oncosterone and the at least one further therapeutic agent is an agent targeting oncosterone biosynthesis or biogenesis. In some embodiments, the cancer is a breast cancer producing oncosterone and the at least one further therapeutic agent is an agent targeting oncosterone biosynthesis or biogenesis. In some embodiments, the cancer is a triple negative breast cancer producing oncosterone and the at least one further therapeutic agent is an agent targeting oncosterone biosynthesis or biogenesis. In some embodiments, the administration of the combination (i.e. JNK-1 and at least one further therapeutic agent) results in enhanced therapeutic efficacy relative to the administration of the JNK-1 inhibitor alone. As used herein, the expression "enhanced therapeutic efficacy," relative to cancer, in particular breast cancer, refers to a slowing or diminution of the growth of cancer cells or solid tumor, or a reduction in the total number of cancer cells or total tumor burden. An "improved therapeutic outcome" or "enhanced therapeutic efficacy" therefore means there is an improvement in the condition of the subject according to any clinically acceptable criteria, including, for example, decreased tumor size, an increase in time to tumor progression, increased progression-free survival, increased overall survival time, an increase in life expectancy, or an improvement in quality of life. In particular, "improved" or "enhanced" refers to an improvement or enhancement of 1%, 5%, 10%, 25% 50%, 75%, 100%, or greater than 100% of any clinically acceptable indicator of therapeutic outcome or efficacy. As used herein, the expression "relative to" when used in the context of comparing the activity and / or efficacy of a combination composition comprising the JNK-1 inhibitor with the additional compound as compared to the activity and / or efficacy of the JNK- 1 alone, refers to a comparison using amounts known to be comparable according to one of skill in the art.

[0043] By a "therapeutically effective amount" of the inhibitor as above described is meant a sufficient amount to provide a therapeutic effect. It will be understood, however, that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated and the severity of the disorder; activity of the specific compound employed; the specific composition employed, the age, body weight, general health and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific polypeptide employed; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Typically, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg / kg to about 20 mg / kg of body weight per day, especially from about 0.001 mg / kg to 7 mg / kg of body weight per day. Typically, the inhibitor of the present invention is combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions. "Pharmaceutically" or "pharmaceutically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Typically, the pharmaceutical compositions contain vehicles, which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. Sterile injectable solutions are prepared by incorporating the inhibitor at the required amount in the appropriate solvent with several of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuumdrying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. Any mode of administration that produces desired therapeutic effect without unacceptable adverse effects is relevant in practicing the invention. Such modes of administration may include oral, rectal, topical, transdermal, sublingual, intramuscular, parenteral, intravenous, intracavity and adhesive matrix to be used during surgery. Certain carriers that may contain the JNK-1 inhibitor or the pharmaceutical composition comprising the JNK-1 inhibitor should be considered such as pill, patch, injection or implant.

[0044] Any therapeutic agent of the invention may be combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form therapeutic compositions. "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The form of the pharmaceutical compositions, the route of administration, the dosage and the regimen naturally depend upon the condition to be treated, the severity of the illness, the age, weight, and sex of the patient, etc. The pharmaceutical compositions of the invention can be formulated for a topical, parenteral, intranasal, intraocular, intravenous, intramuscular or subcutaneous administration and the like. Preferably, the pharmaceutical compositions contain vehicles which are pharmaceutically acceptable for a formulation capable of being injected. These may be in particular isotonic, sterile, saline solutions (monosodium or disodium phosphate, sodium, potassium, calcium or magnesium chloride and the like or mixtures of such salts), or dry, especially freeze-dried compositions which upon addition, depending on the case, of sterilized water or physiological saline, permit the constitution of injectable solutions. The doses used for the administration can be adapted as a function of various parameters, and in particular as a function of the mode of administration used, of the relevant pathology, or alternatively of the desired duration of treatment. In addition, other pharmaceutically acceptable forms include, e.g. tablets or other solids for oral administration; time release capsules; and any other form currently can be used.

[0045] The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

[0046] FIGURES:

[0047] Figure 1: OCDO activates JNKs / AP-1 pathway in MDA-MB231 TN BC cells, a) Tumor cells, transfected with a plasmid encoding luciferase under the control of a promoter containing the TRE element, were stimulated either with the positive control PMA (10 nM) or OCDO (1 pM) for 24 h. Data, expressed as relative luminescence units (RLU) per pg of proteins, are the means ± SEM of 3 independent experiments performed in triplicate (*P < 0.05, ***P < 0.001, one-way ANOVA). b) Representative immunoblots analysis of cyclin DI expression in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM SP or 30 pM SP, n = 3. c) Representative immunoblots analysis of c-Jun phosphorylation (Ser 63) expression in tumor cells treated as in (b), n = 3. d) Representative immunoblots analysis of c-Jun phosphorylation (Ser63) in MDA-MB231 tumor cells proficient (shC) or deficient (shGR) for the expression of the GR treated as in (b), n = 3. e) Representative immunoblots analysis of RB phosphorylation (Ser 807 / 811) in tumor cells treated as in (b), n = 3. f) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in tumor cells treated as in (b), n = 3. g) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS n = 3. b-g) Densitometry values show changes in expression or phosphorylation of the protein of interest relative to Control and normalized to actin, GAPDH, or HSP90 as indicated and to the unphosphorylated protein of interest.

[0048] Figure 2: OCDO activates JNKs which phosphorylates GR at Ser 226 and dissociates the GR from Src kinases which induces JNK phosphorylation in MDA-MB231 TN BC cells, a) Representative immunoblots analysis of GR phosphorylation (Ser226) in tumor cells treated for 8 h with the solvent vehicle (Control), 0.5 pM cortisol or 1 pM OCDO, n = 3. b) Representative immunoblots analysis of GR phosphorylation (Ser211) in tumor cells treated for 8 h with the solvent vehicle (Control), 0.5 pM cortisol or 1 pM OCDO, n = 3. c) Representative immunoblots analysis of GR phosphorylation (Ser226) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM SP or 30 pM SP, n = 3. a-c) Densitometry values show changes in phosphorylation of the protein of interest relative to Control and normalized to actin and to the unphosphorylated GR. d-e) Proximity ligation assay (PLA) was conducted in cells to analyze the interaction of endogenous Src and GR. d) MDA-MB-231 cells were treated either with 0.1 pM dexamethanone (Dex), 1 pM OCDO or with the solvent vehicle (Control) for 8 h. After cell fixation, PLA with specific antibodies against Src or GR was performed. The detected interactions are indicated by red dots. The nuclei were counterstained with DAPI (blue). The number of interactions detected by ImageJ analysis is shown as the mean ± SEM of 3 independent experiments. P-value was determined using a paired t-test. *P < 0.05, **P < 0.01. e) PLA was conducted as in (d) after transfection of MDA-MD-231 with siRNA for GR (siGR) of non-specific siRNA (siNS). Detected interactions are shown as the mean ± SEM of 3 independent experiments. P-value was determined using a paired t-test, *P < 0.05. f) Representative immunoblots analysis of Src phosphorylation (Tyr 416) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 nM dasa or 10 nM dasa, n = 3. g) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in tumor cells treated as in (f), n = 3. h) Representative immunoblots analysis of c-Jun phosphorylation (Ser 63) in tumor cells treated as in (f), n = 3. f-h) Densitometry values show changes in phosphorylation of the protein of interest relative to Control and normalized to GAPDH or HSP90 as indicated and to the unphosphorylated protein of interest.

[0049] Figure 3: The Src / JNKl / c-Jun pathway mediates OCDO-induced cell cycle progression and proliferation in MDA-MB231 cells, a) Representative cell cycle analysis by flow cytometry of 3 independent experiments. Tumor cells cultured for 24 h in serum-free medium were treated with the solvent vehicle (control) or 1 pM OCDO or 1 pM OCDO + 10 nM dasa or 10 nM dasa for 7 h. b) Representative cell cycle analysis by flow cytometry of 3 independent experiments. Tumor cells cultured for 24 h in serum-free medium were treated with the solvent vehicle (control) or 1 pM OCDO or 1 pM OCDO + 30 pM SP or 30 pM SP for 7 h. a-b) Cells were stained with BrdU and propidium iodide. The percentages of cells within the G0 / G1, S, and G2 / M phases of the cycle were calculated using Flow Jo software. Numbers in the panels indicate the percentages of cells within G0 / G1, S, and G2 / M phases of the cell cycle, c) Effect of the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 nM dasa or 10 nM dasa on tumor cell proliferation, n = 3. d) Effect of the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM SP or 30 pM SP on tumor cell proliferation, n = 3. e) Effect of the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS on tumor cell proliferation, n = 3. f) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in MDA-MB231 tumor cells proficient (Mock) or deficient (JNK1-KO) for the expression of JNK1 treated for 8 h with the solvent vehicle (Control) or 1 pM OCDO, n = 3. g) Representative immunoblots analysis of c-Jun phosphorylation (Ser63) in MDA-MB231 tumor cells proficient (Mock) or deficient (JNK1-KO) for the expression of JNK1 treated for 8 h with the solvent vehicle (Control) or 1 pM OCDO, n = 3. f-g) Densitometry values show changes in phosphorylation of JNKs relative to Control and normalized to HSP90 and to JNK1. h) Effect of the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS on MDA-MB231 (Mock) or (JNK1-KO) cell proliferation, n = 3. c-d and h) The number of viable cells were determined using a trypan blue exclusion assay. Data are the means (+SEM) of 3 separate experiments, (n = 6), **P < 0.01, ***p < 0.001, ****p < 0.0001, ns: not significant, one-way ANOVA, Tukey’s posttest.

[0050] Figure 4: OCDO activates the Src / JNKl / c-Jun pathway which drives its mitogenic activity in MDA-MB468 cells, a) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS n = 3. b) Representative immunoblots analysis of c-Jun phosphorylation (Ser63) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM SP or 30 pM SP, n = 3. c) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) in MDA- MB231 tumor cells, proficient (Mock) or deficient (JNK1-KO) for the expression of JNK1, treated for 8 h with the solvent vehicle (Control) or 1 pM OCDO, n = 3. d) Representative immunoblots analysis of c-Jun phosphorylation (Ser63) in MDA-MB468 tumor cells proficient (Mock) or deficient (JNK1-KO) for the expression of JNK1 treated for 8 h with the solvent vehicle (Control) or 1 pM OCDO, n = 3. e) Representative immunoblots analysis of Src phosphorylation (Tyr 416) in tumor cells treated for 8 h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 nM dasa or 10 nM dasa, n = 3. f) Representative immunoblots analysis of JNKs phosphorylation (Thrl83 / Tyrl85) and c-Jun phosphorylation (Ser 63) in tumor cells treated as in (e), n = 3. g) MDA-MB-468 cells were treated either with the solvent vehicle (Control) or 1 pM OCDO for 8 h. After cell fixation, PLA with specific antibodies against Src or GR was performed and analyzed as described in Fig 2d. Data are the mean + SEM of 3 independent experiments. P-value was determined using a paired t-test. *P < 0.05. a- f) Densitometry values show changes in expression or phosphorylation of the protein of interest relative to Control and normalized to GAPDH or HSP90 as indicated and to the unphosphorylated protein of interest, h) Effect of a 24 h treatment with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 nM dasa, 10 nM dasa 1 pM OCDO + 30 pM SP or 30 pM SP on tumor cell proliferation, n = 3. i) Effect of the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS on tumor cell proliferation, n = 3. j) Effect of a 24 h treatment with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS or 30 pM AS on MDA-MB468 (Mock) or (JNK1-KO X9) tumor cell proliferation, n = 3. h-j) The number of viable cells were determined using a trypan blue exclusion assay. Data are the means (+SEM) of 3 separate experiments, (n = 6), *P < 0.05, **P < 0.01, ***p < 0.001, ****p < 0.0001, ns: not significant, one-way ANOVA, Tukey’s posttest. Figure 5: Genetic inactivation of JNK1 expression and pharmacological targeting of JNKs inhibit OCDO-induced MDA-MB231 and MDA-MB468 tumor proliferation in mice, a-f) Immunodeficient mice (10 per group) grafted with the indicated cell lines (MDA- MB231-Mock and MDA-MB468-Mock expressing JNK1 / JNK2 / JNK3 and MDA-MB231- JNK1-KO and MDA-MB468-JNK1-KO deficient for JNK1 expression) were treated once a day, 5 days / week and monitored for tumor growth over time, a-d) Mice were treated with the Control (solvent vehicle) or OCDO (16 pg / kg). e-f) Mice were treated with Control (solvent vehicle), OCDO (16 pg / kg), OCDO (16 pg / kg) + AS (30 mg / kg) or AS (30mg / kg). Mean tumor volumes (±SEM) are shown, two-way ANOVA, Tukey’s posttest, *P <0.05, **P < 0.01, ***p < 0.001 and ****p < 0.0001. g) Scheme indicating the molecules that were tested in combination with AS and the target of each of these molecules.

[0051] Figure 6: Effect of the combination of AS602801 with a GR antagonist, a Src inhibitor, a CDK4 / 6 inhibitor and with chemotherapies on OCDO-induced and basal MDA-MB231 cell proliferation. MDA-MB231 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS, 30 pM AS, IpM OCDO + the molecule of interest, the molecule of interest, 1 pM OCDO + the molecule of interest + 30 pM AS or the molecule of interest + 30 pM AS. The concentration used for the molecules of interest was: a) 1 pM for mifepristone (Mif), b) 10 nM for dasatinib (dasa), c) 100 nM for palbociclib (Palbo), d) 10 nM for doxorubicin (Doxo), e) 1 pM for carboplatin (Carbo) and f) 10 nM for paclitaxel (Pacli). The number of viable cells were determined using a trypan blue exclusion assay. Data are the means (+SEM) of 3 separate experiments, (n = 6), *P < 0.05, **P < 0.01, ***P < 0.001, ****p < 0.0001, ns: not significant, one-way ANOVA, Tukey’s posttest.

[0052] Figure 7: Effect of the combination of AS602801 with ChEH inhibitors, a-d) MDA-MB231 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM AS, 30 pM AS, IpM OCDO + the molecule of interest, the molecule of interest, 1 pM OCDO + the molecule of interest + 30 pM AS or the molecule of interest + 30 pM AS. The concentration used for the molecules of interest was: a) 5 pM for tamoxifen (Tam), b) 5 pM for dendrogenin A (DDA). c) 20 pM for PBPE, d) 20 pM for tesmilifen e) MDA-MB4231 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 30 pM CC, 30 pM CC, IpM OCDO + Tam 5 pM, Tam 5 pM, 1 pM OCDO + 5 pM Tam + 30 pM CC or Tam 5 pM + 30 pM CC. The number of viable cells were analyzed as described in Figure 6. f) Mice were treated with Control (solvent vehicle), OCDO (16 pg / kg), OCDO (16 pg / kg) + AS (30 mg / kg), AS (30mg / kg), OCDO (16 pg / kg) + Tam (28pg / kg), Tam (28pg / kg), OCDO (16pg / kg) + AS (30 mg / kg) + Tam (28pg / kg) or Tam (28pg / kg) + AS (30 mg / kg). Mean tumor volumes (±SEM) are shown, two-way ANOVA, Turkey’s posttest, *P <0.05, **P < 0.01, ***p < 0.001 and ****P < 0.0001

[0053] Figure 8: Effect of the combination of AS602801 with a GR antagonist, a Src inhibitor, and with chemotherapies on OCDO-induced and basal MDA-MB468 cell proliferation. MDA-MB468 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 pM AS, 10 pM AS, IpM OCDO + the molecule of interest, the molecule of interest, 1 pM OCDO + the molecule of interest + 10 pM AS or the molecule of interest + 10 pM AS. The concentration used for the molecules of interest was: a) 1 pM for mifepristone (Mif), b) 5 pM for dasatinib (dasa), c) 50 nM for doxorubicin (Doxo), d) 100 nM for carboplatin (Carbo) and e) 10 nM for paclitaxel (Pacli). The number of viable cells were analyzed as described in Figure 6.

[0054] Figure 9: Effect of the combination of AS602801 with ChEH inhibitors, a-b) MDA- MB468 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 10 pM AS, 10 pM AS, IpM OCDO + the molecule of interest, the molecule of interest, 1 pM OCDO + the molecule of interest + 10 pM AS or the molecule of interest + 10 pM AS. The concentration used for the molecules of interest was: a) 5 pM for dendrogenin A (DDA), b) 5 pM for tamoxifen (Tam), c) 20 pM PBPE, d) 20 pM tesmilifene e) MDA-MB468 cells were treated for 48h with the solvent vehicle (Control), 1 pM OCDO, 1 pM OCDO + 20 pM CC, 20 pM CC, IpM OCDO + Tam 5 pM, Tam 5 pM, 1 pM OCDO + 5 pM Tam + 20 pM CC or Tam 5 pM + 20 pM CC. The number of viable cells were analyzed as described in Figure 6.

[0055] EXAMPLE:

[0056] Material & Methods

[0057] Materials. OCDO (oncosterone or cholestan-3p, 5a-diol-6-one, C4000-000), was from Steraloids. Tamoxifen (T9262), dasatinib (CDS023389), mifepristone (M8046), cortisol (H4001), SP600125 (S5567), paclitaxel (T7191), carboplatin (C 2538), doxorubicin (44583) were from Sigma-Aldrich. AS602801 (bentamapimod, HY-14761) and CC-90001 (HY- 138304) are from MedChemTronica. MCF-7, MDA-MB-231, MDA-MB-468, cells were from LGC Standards. Penicillin and streptomycin (50 U / ml) was from Sigma- Aldrich (P0781) and L-Glutamine from Invitrogen (25030024). The antibodies anti -phospho-c- Jun (Ser63) II (9261S), anti-c-Jun (60A8) (9165S), anti-phospho-Src Family (Tyr416) (6943S), ant-sSrc (36D10) (2109S), anti-phospho-SAPK / JNK (Thrl83 / Tyrl85) (81E11) (4668), anti-SAPK / JNK (9252s), anti-GAPDH (D16H11) XP (5174S), anti -glucocorticoid Receptor (D6H2L) (12041S), Phospho- SEK1 / MKK4 (Ser257 / Thr261) (915613) were from Cell Signaling. The antibody anti -actin clone C4, (mabl501) was from Merck millipore. The antibodies anti-HSP90 alpha / beta (F-8) (5174S), anti -glucocorticoid receptor (G5) (sc-393232) and anti-JNKl (37) (sc- 136205) were from Santa-Cruz. The antibody FITC-conjugated BrdU clone 3D4 (364104) was from BioLegend.

[0058] Synthesis of PBPE and tesnulifene. PBPE and tesmilifene were synthetized as described in (Poirot M et al, Bioorg Med Chem, 2000 PMID: 11003145)

[0059] Cell culture. Cells were grown at 37°C in a humidified atmosphere with 5% CO2. All cell lines were tested once a month for mycoplasma contamination using Mycoalert Detection kit (Lonza, France) and cultured until passage 20. MCF-7 cells were grown in RPMI 1640 medium (Invitogen 21875091) supplemented with 5% fetal bovine serum (FBS), MDA-MB- 468 cells in RPMI 1640 medium (Invitogen 21875091) with 10% FBS and MDA-MB-231 in DMEM (Invitogen 41966029) with 10% FBS. All the cells lines were cultured in 1% penicillin and streptomycin (50 U / ml) (SIGMA-ALDRICH P0781).

[0060] MAPK8 / JNK1 CRISPR / CAS9 knockout cell lines. MDA-MB231 and MDA-MB468 cell lines knocked out (KO) in the MAPK8 gene encoding TNK1 were purchased (Synthego Redwood, CA, USA) and seeded into 96 wells plates for single colonies. Gene deletion was generated by using CRISPR-Cas9 and the following guide RNA sequence: CCUUGAGCUCCUGAGCCUAU (SEQ ID NO: 2) (Transcript ID: ENST00000395611). The control cells (Mock) were treated in the same way as the inactivated cells except that they were not transfected with the guide RNA. Cells were then seeded at a density of one cell per well in 96-well plates and grown until colonies were established. Colonies were tested by western blot for knockout of TNK1 proteins and by qPCR with the following primers (F: TCATGATCTAGCAGTCTHTGTTACT (SEQ ID NO: 3);

[0061] (R: ACCATTGATCCTGAAGCAAACA (SEQ ID NO:4).

[0062] Cell Proliferation assays. MCF7 (0.12 millions), MDA-MB231 (0.10 millions) and MDA-MB468 (0.15 millions) cells were seeded in 6-well plates and in the appropriate complete medium for 24 h. Then, cells were treated for the indicated time and in the appropriate medium supplemented with 5% FBS, with either OCDO (1 pM), or in combination with the treatment of interest at the indicated concentrations, added 30 minutes before OCDO. After the indicated time, cells were trypsinized, washed and resuspended in PBS containing 0.4% trypan blue. Live cells were counted using a Malassez counting chamber.

[0063] Gene reporter assays. The MDA-MB-231 cells were transfected with 1 pg plasmid encoding the luciferase enzyme under the control of a promoter having a TPA response element (TRE) recognized by the AP-1 complex, using the NEON transfection system (Thermofisher Scientific) according to the manufacturer's recommendations and then cultured for 24 h. The cells were treated with the molecules of interest for 24 h. Then, luciferase expression in cells was analyzed using the Luciferase Reporter Assay kit (PROMEG A, El 94 A) according to the manufacturer's recommendations. Briefly, cells were washed with PBS, incubated for 15 min in passive lysis buffer and placed at -80°C for 1 h. After thawing, the supernatant is transferred to 96-well plates and the enzyme substrate is added. The plate is read using the CLARIOstar® luminometer from Bmg Labtech.

[0064] Western blot. MCF7 (0.7 millions), MDA-MB231 (0.5 millions) and MDA-MB468 (0.7 millions) cells were seeded in 100 mm diameter dishes and cultured for 48 h in the appropriate complete medium. Then, cells (60% confluence) were treated for 8 h with the solvent vehicle, OCDO or the indicated treatments (compounds used in combination with OCDO were added 30 minutes before OCDO) in the appropriate medium without serum, DMEM (Invitogen 31053028) orRPMI (Invitogen 11835063), and with 1% penicillin and streptomycin (50 U / ml) and L-Glutamine at 2 mM. At the end of the treatment, a gentle cell scraping on ice were performed twice. After centrifugation at 1200 rpm for 5 minutes at 4°C, the cells were lysed in 100 pl to 500 pl of RIP A buffer (Sigma R0278) supplemented with a cocktail of protease (Sigma P2850) and phosphatase inhibitors (Sigma P5726 and P0044). Cell lysates were centrifuged at 12000 rpm for 10 minutes at 4°C and protein dosage was performed with a Pierce BCA dosage Kit (ThermoFisher Scientific, 23225). Proteins were separated on 10% (life Technologies, NP0315) or 4-12% (Life Technologies, NPO335) Bis-Tris polyacrylamide gel, electrotransferred onto polyvinylidene difluoride membranes (GE Healthcare, 10600023) activated in methanol. Membranes were incubated over-night at 4°C with the adequate primary antibodies as indicated diluted in TBS-Tween 5% BSA or Milk solution, washed and incubated with the secondary antibody for 1 h at 25°c. Visualization was achieved with an Enhanced Chemiluminescence Plus kit (BIO-RAD, 1705061) and chemiluminescence was revealed with Pixi (Genesys) or Chemidoc (BIORAD) imaging systems. Quantification was performed with Image J software.

[0065] Cell cycle analysis. Cell Cycle analysis was performed by flow cytometry using MACSQuant VYB analyser (Miltenyi Biotec). MDA-MB231 (0.75 millions) and MDA- MB468 (0.9 millions) cells were seeded in 100 mm diameter dishes and cultured in the appropriate complete medium for 24. Then, the medium was changed for FBS-free medium to synchronise cells for 24 h. Cells were incubated with 10 pM BrdU and treated for 6 h, as indicated, in the appropriate complete medium. After scraping, cells and supernatant were centrifuged, washed, fixed in 70% ethanol / PBS and stored at -20°C for subsequent cell cycle analysis. Cells were incubated with 2N HC1 for 30 min and then with 0.1 M Na2B4O7, pH 8.5, for 5 min. Cells were then stained with FITC-conjugated BrdU antibody (BioLegend, 364104, clone 3D4) at 1 / 40 dilution in PBS 1% BSA for 30 min in the dark at 25°c. Finally, cells were incubated for 30 min at 37°C in the dark with a solution of propidium iodide (50 pg / ml), EDTA (2mM) and RNase (DNAse-free) (100 pg / ml) in PBS / 1% BSA (Sigma-Aldrich). Approximately 10 000 events were analyzed from each samples. The percentages of cells within the GO / G1, S and G2 / M phases of the cell cycle were calculated using FlowJo software.

[0066] Proximity ligation assays. The experiments were performed using reagents following the manufacturer’s instructions from the Duolink kit (Sigma) as previously described (Soderberg Nat Methods 2006, PMID: 17072308, Poulard 2020 methods, PMID: 31499160). Cells were seeded onto coverslips in 12-well plates, fixed in methanol for 2 min, and then washed twice in 1X-PBS. Fixed cells were saturated with the blocking solution for 1 h at 37°C. Cells were then incubated with primary antibodies Src (36D10) (Cell Signaling,2109), and GR (G-5) (Santa Cruz, sc-393232) for 1 h at 37°C. After washes, the PLA probes minus and plus were added and incubated 1 h at 37°C. Again, cells were washed and incubated with ligation reaction during 30 min at 37°. Then, during 100 min at 37°C, the addition of nucleotides, DNA polymerase and fluorescently labeled oligonucleotides allows a rolling-circle amplification reaction if the two proteins were in close proximity and its subsequently labeled. Finally, cells were washed and samples mounted with Duolink Mounting Medium containing DAPI. The edges of the coverslips were sealed using nail polish. Slides were then being stored in the dark at 4°C for a short-term or visualized under a Zeiss Fluorescence Microscope, and interactions were counted using ImageJ software. For each sample, interactions were counted for at least 300 cells using ImageJ (Poulard Methods 2020).

[0067] In vivo studies. Six weeks old NMRI-Foxnl nu / nu female mice (Janvier, France) were maintained in specific pathogen-free conditions and were included in protocols only following 2 weeks’ quarantine. All of the animal procedures for the care and use of laboratory animals were conducted according to the ethical guidelines of our institution and followed the general regulations governing animal experimentation. Exponentially growing MDA-MB231, MDA- MB468 cells were collected, washed twice in PBS and resuspended in PBS. Tumor cells (3 to 5 x 106 in 200 pl PBS / matrigel, 1 / 1 volume) were injected subcutaneously into the flank of mice. Mice were treated as indicated. Mice were examined daily, and body weights were measured twice per week. In all the experiments, the tumor volume was determined by direct measurement with a caliper and was calculated using the formula (width2* length) / 2.

[0068] Statistical Analyses. Tumor growth curves in animals were analyzed for significance by two-way ANOVA followed by a Tukey’s post-test. Cell proliferation assays and gene reporter assays were analyzed for significance by one-way ANOVA followed by a Tukey’s post-test. Proximity ligation assays were analyzed for significance using a paired t-test. Prism software was used for all the analyses.

[0069] Results

[0070] OCDO activates the AP-1 pathway in TN BC cells. The protein AP-1 binds to specific sequences in DNA named TRE (phorbol 12-0 tetra decanoate- 13 -acetate- response element) (21). To confirm that OCDO activates AP-1, we measured the transcriptional activation of an AP-1 -dependent reporter gene. MDA-MB231 cells, transfected with a plasmid encoding luciferase under the control of a promoter containing the TRE element, were stimulated either with the positive control PMA or OCDO. PMA and OCDO significantly induced the transcription of the reporter gene luciferase by activating AP-1 (Figure 1A). We then explored whether OCDO increased cyclin DI expression that is regulated by AP-1 and is involved in cell cycle progression. As shown in Figure IB, OCDO increased cyclin DI expression by 1.8-fold compared to control and the INK inhibitor, SP600125 (SP) (22) completely inhibited this effect. We next evaluated the activation by OCDO of c-Jun, that formed the AP-1 complex. As shown in Figure 1C, OCDO increased c-Jun phosphorylation by about 3-fold in MDA-MB231 cells compared to control and SP completely inhibited OCDO-induced c-Jun phosphorylation as well as basal c-Jun phosphorylation. Similar experiments performed in MDA-MB231 cells expressing the GR (shC) or knocked-down for GR expression (shGR) (2) (Figure ID), indicate that the OCDO / GR complex activated c-Jun phosphorylation via JNK activation. We previously showed that OCDO induces cell cycle progression from G1 phase to S phase in TN BC cells (2). This passage is controlled by the interaction of cyclin DI with CDK4 and CDK6 which phosphorylate the tumor suppressor retinoblastoma (Rb), resulting in its inactivation and cell cycle progression. We showed here that OCDO increased Rb protein phosphorylation by about 2-fold and the combination of OCDO with SP inhibited this effect (Figure IE). We then studied the impact of OCDO on JNKs phosphorylation. OCDO increased by about 2-fold JNKs phosphorylation that was inhibited by the JNKs inhibitors SP and AS602801 (AS), also known as bentamapimod (23) (Figure 1F-G). Together these data indicate that OCDO activates the JNK / c-Jun pathway which activates cyclin DI expression and Rb phosphorylation in MDA- MB231 cells.

[0071] OCDO activates JNKs which phosphorylates GR at Ser 226 in TN BC cells. We then studied the impact of OCDO on GR phosphorylation. Chip assays indicate that GR phosphorylated at Ser 211 by glucocorticoids is the form that is recruited at several GRE sequences in gene promotors to activate their transcription (24). In contrast, the phosphorylation of GR at Ser 226 by glucocorticoids has a repressive transcriptional activity (15,24). We showed here that cortisol increased by 2-fold and OCDO by 4-fold GR phosphorylation at Ser 226 compared to control (Figure 2A). In contrast, cortisol increased by 9-fold and OCDO by 1.7- fold GR phosphorylation at Ser 211 compared to control (Figure 2B). Inhibition of JNK by SP decreased OCDO-induced GR phosphorylation at Ser 226 (Figure 2C). These data are consistent with the fact that OCDO activates JNK which phosphorylate human GR at Ser 226 (12). It is interesting to note that OCDO is much less efficient than cortisol to activate GR phosphorylation at Ser 211 but is more efficient than cortisol to activate GR phosphorylation at Ser 226, consistent with our previous data indicating that OCDO does not activate gene under the control of GRE, but activates gene under the control of AP-1 (2). Interestingly, GR expression level was similar in control and OCDO treatments while it was decreased by about 75 % with cortisol treatment relative to control or OCDO (Figure 2A,B), suggesting that OCDO either increases GR stability and / or inhibits its degradation through GR phosphorylation at Ser 226 and Ser 211, while cortisol has an opposite effect and decreases GR expression level as reported (25). The phosphorylation of the GR affects the stability and half-life of the protein by altering nuclear / cytoplasmic shuttling and targeting the receptor to ubiquitin-mediated proteasome degradation. Therefore, phosphorylation status of the GR significantly impacts the cellular response to GC hormones (25). Degradation of the GR protein is enhanced by glucocorticoid-dependent phosphorylation of the receptor, as phosphorylation deficient mutants are stabilized in the presence of glucocorticoids (26).

[0072] OCDO dissociates the GR from Src kinases which induce JNK phosphorylation. The GR has been shown associated to Src kinases in its inactive state in different normal or tumor cells and glucocorticoid binding to GR stimulate their dissociation which allows their activation by autophosphorylation (27-29). In addition, the activation of the oncogene Src kinases may lead to the phosphorylation and activation of JNK (30,31). We analyzed endogenous GR / Src interaction in MDA-MB-231 cells using proximity ligation assay technology (PLA). This technique allows the visualization by immunofluorescence of proteinprotein interaction. Each red dot represents a single molecular complex (32). As shown in Figure 2D, in the control assay, in absence of ligand, GR interacted mainly with Src in the cytoplasm of MDA-MB-231. In contrast, GR dissociated from Src after either dexamethasone (DEX) or OCDO treatment. Depletion of GR protein expression with specific siRNA (siRNA GR) eliminated most of the signal compared to siRNA control, validating the interaction and the antibodies used to detect it (Figure 2E). In order to determine whether OCDO activated Src kinases, we studied the impact of OCDO on Src kinase phosphorylation at residue Tyr 416, an auto-phosphorylation site that stimulates Src kinase activity (33). As shown in Figure 2F, OCDO increased Src phosphorylation by approximately 1.6-fold and this effect was inhibited in combination with danatinib (dasa), an inhibitor of Src family kinases (34). The induction of JNKs phosphorylation (Figure 2G) and c-Jun phosphorylation (Figure 2H) by OCDO was inhibited in the presence of dasa. Together these results indicate that OCDO binds to GR and activates its dissociation from Src kinases, allowing the auto-phosphorylation of Src kinases and the activation of JNKs.

[0073] The Src / JNKl / c-Jun pathway mediates OCDO-induced cell cycle progression and proliferation in MDA-MB231 cells. Wethen determined whether the Src / JNKs / c-Jun pathway was involved in the mitogenic activity of OCDO in MDA-MB231 cells. OCDO increased the transition from G1 phase of the cell cycle to S phase (Figure 3A-B) and a co-treatment of OCDO with dasa (Figure 3A) or SP (Figure 3B) inhibited S phase entry. Moreover, OCDO increased tumor cell proliferation, which was inhibited by a co-treatment with dasa (Figure 3C) and with SP (Figure 3D) or AS (Figure 3E). To confirm the role of JNKs in OCDO mitogenicity, we knocked out the expression of JNK1 in MDA-MB231 cells (JNK-KO cells) in comparison to control cells (Mock cells), which express JNK1 and JNK2 isoforms. OCDO increases JNKs phosphorylation in mock cells compared to control but not in JNK1-K0 cells (Figure 3F). Similarly, OCDO increased c-Jun phosphorylation compared to control in mock cells but not in JNK1-K0 cells (Figure 3G). As shown in Figure 3H, OCDO stimulated proliferation in Mock cells compared to control that was inhibited when OCDO was combined with AS. In contrast, OCDO did not induce cell proliferation compared to control in JNK1-K0 cells. Together these data show that OCDO mitogenicity is mediated by JNK1 in MDA-MB231 cells. OCDO activates the Src / JNKl / c-Jun pathway which drives its mitogenic activity in MDA-MB468 cells. We then studied another TN BC cell line, MDA-MB468, that are mutated on the RB gene and do not express the protein Rb (35) and determined whether OCDO activated the Src / JNKl / c-Jun pathway in this cell line. As shown in Figure 4A-B, OCDO increased JNKs and c-Jun phosphorylation by around 1.6 to 2.5-fold respectively compared to control and the combination of a INK inhibitor with OCDO inhibited JNKs and c-Jun phosphorylation. To determine whether OCDO activated JNK1, we knocked out the expression of JNK1 in MDA-MB468 cells (JNK1-K0 cells) in comparison to control cells (Mock cells). As shown in Figure 4C-D, OCDO increased JNKs and c-Jun phosphorylation compared to control in Mock cells proficient for JNK1 expression but not in JNK1-K0 cells deficient for JNK1 expression. In addition, OCDO activated Src phosphorylation that was inhibited when cells were treated with OCDO plus dasa (Figure 4E). The induction of JNK phosphorylation by OCDO was inhibited in the presence of dasa (Figure 4F), indicating that OCDO activates Src kinases which activate JNK phosphorylation. PLA technology showed that in absence of ligand (Control), GR was associated with Src kinases in MDA-MB468 cells. In contrast, OCDO treatment induced the dissociation of the GR / Src complex (Figure 4G). These results indicate that OCDO binds to GR and activates its dissociation from Src kinases, allowing the activation by auto phosphorylation of Src kinases and JNKs phosphorylation. We then studied the implication of the Src / JNK / c-Jun pathway in OCDO-mediated mitogenicity. As shown in Figure 4H, OCDO stimulated MDA-MB468 cell proliferation compared to control that was inhibited when OCDO was combined with dasa or with SP. Similarly, AS inhibited MDA- MB468 cell proliferation induced by OCDO (Figure 41). Moreover, OCDO increased MDA- MB468 mock cell proliferation compared to control but not that of MDA-MB468 JNK1-K0 X9 cells (Figure 4J), indicating that OCDO mitogenicity is also mediated by JNK1 in MDA- MB468 cells.

[0074] Genetic inactivation of JNK1 expression and pharmacological targeting of JNKs inhibit OCDO-induced MDA-MB231 and MDA-MB468 tumor proliferation in mice. We then studied the implication of JNK1 in OCDO-induced progression of tumors grafted onto nude mice. OCDO significantly promoted the growth of both MDA-MB231 mock-tumors and MDA-MB468 mock-tumors (Figure 5A-B). In contrast, no such effect was observed in JNK1- KO-MDA-MB231 and JNK1-KO-MDA-MB468 tumors (Figure 5C-D), indicating that JNK1 drives the proliferative activity of OCDO in MDA-MB231 and MDA-MB468 cells in vivo. We then determined whether an inhibitor of JNKs could inhibit OCDO-induced tumor proliferation. As shown in Figure 5E-F, OCDO significantly stimulated the proliferation of MDA-MB231 and MDA-MB468 tumors grafted onto mice compared to control while the combination of OCDO with AS significantly inhibited this effect, confirming that the pharmacological targeting of JNKs blocks the mitogenic activity of OCDO. Furthermore, it should be noted that the proliferation of MDA-MB231 tumors treated with OCDO + AS was similar to that of control tumors, however the proliferation of MDA-MB468 tumors treated with OCDO + AS was significantly decreased compared to control tumors.

[0075] Combination of AS602801 with either chemotherapies, dasatinib, tamoxifen or dendrogenin A, enhances inhibition of OCDO-induced and basal MDA-MB231 cell proliferation. To determine whether it is possible to increase AS response to inhibit OCDO- induced and basal TN cell proliferation, we tested several treatments (Figure 5G) that target the OCDO / GR signaling pathway such as a GR antagonist (Mifepristone or RU486 (36)), a Src inhibitor (dasatinib or Sprycel (37)), a CDK4 / 6 inhibitor (palbociclib (38)), different chemotherapies used in the clinic to treat BC (doxorubicin, carboplatin and paclitaxel, (39,40)), inhibitors of the cholesterol epoxide hydrolase involved in the OCDO biosynthesis pathway such as tamoxifen (2,41) or dendrogenin A (2). As shown in Figure 6, mifepristone (Figure 6A) and palbociclib (Figure 6C) did not increase the inhibitory activity of AS on OCDO- induced tumor cell proliferation or basal proliferation. In contrast, dasa (Figure 6B), doxorubicin (Figure 6D), carboplatin (Figure 6E) and paclitaxel (Figure 6F) significantly increased the effect of AS on both OCDO-induced cell proliferation and basal proliferation. Moreover, ChEH inhibitors such as Tam (Figure 7A), DDA (Figure 7B), PBPE (Figure 7C) and tesmilifen (Figure 7D) (2,41) (de Medina P. et al, PNAS 2010 and Voisin M. et al PNAS 2017) which inhibit OCDO production, (2,41) were very efficient to significantly enhance the effect of AS to inhibit OCDO-induced MDA-MB231 cell proliferation as well as basal proliferation. The in vitro inhibition effect of Tam on OCDO-induced and basal proliferation was confirmed in vivo on MDA-MB231 tumor growth. Mice (10 per group) were implanted with MDA-MB231 cells and were treated once a day (5 days / week) with PBS (control), or OCDO, or OCDO + AS, or AS, or Tam + OCDO, or Tam, or Tam + OCDO + AS, or Tam + AS. As shown in Figure 7F, OCDO significantly promoted the growth of MDA-MB231 tumor grafted onto mice compared to control as reported in (2) and its association with AS significantly reversed its effect to a level similar to that of control tumors. Interestingly, when Tam was associated with OCDO + AS or with AS, it significantly enhanced the effect of AS to inhibit OCDO-induced MDA-MB231 cell proliferation as well as basal proliferation of tumors. Combination of AS602801 with chemotherapies, tamoxifen and dendrogenin A enhances inhibition of OCDO-induced and basal MDA-MB468 cell proliferation. Similar experiments were performed in MDA-MB468 cell proliferation (Figure 8). Due to the absence of Rb protein, MDA-MB468 cells do not respond to CDK4 / 6 inhibitors, such as palbociclib, which has therefore not been tested in combination with AS. Mifepristone (Figure 8A) and dasa (Figure 8B) did not increase the inhibitory activity of AS on OCDO-induced tumor cell proliferation and basal proliferation. In contrast, doxorubicin (Figure 8C), carboplatin (Figure 8D) and paclitaxel (Figure 8E) significantly increased the effect of AS on OCDO-induced cell proliferation and doxorubicin and carboplatin increased the effect of AS on basal proliferation. Moreover, DDA (Figure 9A), Tam (Figure 9B), PBPE (Figure 9C) and tesmilifen (Figure 9D) were very efficient to significantly enhance the effect of AS to inhibit OCDO-induced MDA-MB231 cell proliferation as well as basal proliferation. We evaluated another INK inhibitor, CC90001 (CC), described to be 10-fold more potent to inhibit JNK1 activation than JNK2 (42). As shown in Figure 9E, CC significantly inhibited OCDO-induced cell proliferation but not basal proliferation and Tam significantly increased the inhibitory activity of CC on OCDO-induced tumor cell proliferation and basal proliferation.

[0076] REFERENCES:

[0077] Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

[0078] 1. Leon-Ferre, R. A., and Goetz, M. P. (2023) Advances in systemic therapies for triple negative breast cancer. BMJ 381, e071674

[0079] 2. Voisin, M., de Medina, P., Mallinger, A., Dalenc, F., Huc-Claustre, E., Leignadier, J., Serhan, N., Soules, R., Segala, G., Mougel, A., Noguer, E., Mhamdi, L., Bacquie, E., luliano, L., Zerbinati, C., Lacroix-Triki, M., Chaltiel, L., Filleron, T., Cavailles, V., Al Saati, T., Rochaix, P., Duprez-Paumier, R., Franchet, C., Ligat, L., Lopez, F., Record, M., Poirot, M., and Silvente-Poirot, S. (2017) Identification of a tumor-promoter cholesterol metabolite in human breast cancers acting through the glucocorticoid receptor. Proc Natl Acad Sci U S A 114, E9346-E9355

[0080] 3. Pan, D., Kocherginsky, M., and Conzen, S. D. (2011) Activation of the glucocorticoid receptor is associated with poor prognosis in estrogen receptor-negative breast cancer. Cancer Res 71, 6360-6370 4. Abduljabbar, R., Negm, O. H., Lai, C. F., Jerjees, D. A., Al-Kaabi, M., Hamed, M. R., Tighe, P. J., Buluwela, L., Mukheijee, A., Green, A. R., Ali, S., Rakha, E. A., and Ellis, I. O. (2015) Clinical and biological significance of glucocorticoid receptor (GR) expression in breast cancer. Breast Cancer Res Treat 150, 335-346

[0081] 5. Noureddine, L. M., Tredan, O., Hussein, N., Badran, B., Le Romancer, M., and Poulard, C. (2021) Glucocorticoid Receptor: A Multifaceted Actor in Breast Cancer. Int J Mol Sci 22

[0082] 6. Jonat, C., Rahmsdorf, H. J., Park, K. K., Cato, A. C., Gebel, S., Ponta, H., and Herrlich, P. (1990) Antitumor promotion and antiinflammation: down-modulation of AP-1 (Fos / Jun) activity by glucocorticoid hormone. Cell 62, 1189-1204

[0083] 7. Caelles, C., Gonzalez- Sancho, J. M., and Munoz, A. (1997) Nuclear hormone receptor antagonism with AP-1 by inhibition of the JNK pathway. Genes Dev 11, 3351-3364

[0084] 8. Schreiber, M., Kolbus, A., Piu, F., Szabowski, A., Mohle-Steinlein, U., Tian, J., Karin, M., Angel, P., and Wagner, E. F. (1999) Control of cell cycle progression by c-Jun is p53 dependent. Genes Dev 13, 607-619

[0085] 9. Minden, A., Lin, A., Smeal, T., Derijard, B., Cobb, M., Davis, R., and Karin, M. (1994) c-Jun N-terminal phosphorylation correlates with activation of the INK subgroup but not the ERK subgroup of mitogen-activated protein kinases. Mol Cell Biol 14, 6683-6688

[0086] 10. Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Identification of an oncoprotein- and UV-responsive protein kinase that binds and potentiates the c-Jun activation domain. Genes Dev 7, 2135-2148

[0087] 11. Sabapathy, K., Hochedlinger, K., Nam, S. Y., Bauer, A., Karin, M., and Wagner, E. F. (2004) Distinct roles for JNK1 and JNK2 in regulating JNK activity and c- Jun-dependent cell proliferation. Mol Cell 15, 713-725

[0088] 12. Rogatsky, I., Logan, S. K., and Garabedian, M. J. (1998) Antagonism of glucocorticoid receptor transcriptional activation by the c-Jun N-terminal kinase. Proc Natl Acad Sci U S A 95, 2050-2055

[0089] 13. Miller, A. L., Webb, M. S., Copik, A. J., Wang, Y., Johnson, B. H., Kumar, R., and Thompson, E. B. (2005) p38 Mitogen-activated protein kinase (MAPK) is a key mediator in glucocorticoid-induced apoptosis of lymphoid cells: correlation between p38 MAPK activation and site-specific phosphorylation of the human glucocorticoid receptor at serine 211. Mol Endocrinol 19, 1569-1583 14. Krstic, M. D., Rogatsky, I., Yamamoto, K. R., and Garabedian, M. J. (1997) Mitogen-activated and cyclin-dependent protein kinases selectively and differentially modulate transcriptional enhancement by the glucocorticoid receptor. Mol Cell Biol 17, 3947-3954

[0090] 15. Chen, W., Dang, T., Blind, R. D., Wang, Z., Cavasotto, C. N., Hittelman, A. B., Rogatsky, I., Logan, S. K., and Garabedian, M. J. (2008) Glucocorticoid receptor phosphorylation differentially affects target gene expression. Mol Endocrinol 22, 1754-1766

[0091] 16. Timokhina, I., Kissel, H., Stella, G., and Besmer, P. (1998) Kit signaling through PI 3 -kinase and Src kinase pathways: an essential role for Rael and JNK activation in mast cell proliferation. EMBO J 17, 6250-6262

[0092] 17. Yoshizumi, M., Abe, J., Haendeler, J., Huang, Q., and Berk, B. C. (2000) Src and Cas mediate INK activation but not ERK1 / 2 and p38 kinases by reactive oxygen species. J Biol Chem 275, 11706-11712

[0093] 18. Li, P., Silvis, M. R., Honaker, Y., Lien, W. H., Arron, S. T., and Vasioukhin, V. (2016) alphaE-catenin inhibits a Src-YAPl oncogenic module that couples tyrosine kinases and the effector of Hippo signaling pathway. Genes Dev 30, 798-811

[0094] 19. Lamar, J. M., Xiao, Y., Norton, E., Jiang, Z. G., Gerhard, G. M., Kooner, S., Warren, J. S. A., and Hynes, R. O. (2019) SRC tyrosine kinase activates the YAP / TAZ axis and thereby drives tumor growth and metastasis. J Biol Chem 294, 2302-2317

[0095] 20. Nandi, I., Smith, H. W., Sanguin-Gendreau, V., Ji, L., Pacis, A., Papavasiliou,

[0096] V., Zuo, D., Nam, S., Attalla, S. S., Kim, S. H., Lusson, S., Kuasne, H., Fortier, A. M., Savage, P., Martinez Ramirez, C., Park, M., Katzenellenbogen, J. A., Katzenellenbogen, B. S., and Muller, W. J. (2023) Coordinated activation of c-Src and FOXM1 drives tumor cell proliferation and breast cancer progression. J Clin Invest 133

[0097] 21. Lee, W., Mitchell, P., and Tjian, R. (1987) Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements. Cell 49, 741-752

[0098] 22. Bennett, B. L., Sasaki, D. T., Murray, B. W., O'Leary, E. C., Sakata, S. T., Xu,

[0099] W., Leisten, J. C., Motiwala, A., Pierce, S., Satoh, Y., Bhagwat, S. S., Manning, A. M., and Anderson, D. W. (2001) SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U S A 98, 13681-13686

[0100] 23. Gaillard, P., Jeanclaude-Etter, I., Ardissone, V., Arkinstall, S., Cambet, Y., Camps, M., Chabert, C., Church, D., Cirillo, R., Gretener, D., Halazy, S., Nichols, A., Szyndralewiez, C., Vitte, P. A., and Gotteland, J. P. (2005) Design and synthesis of the first generation of novel potent, selective, and in vivo active (benzothiazol-2-yl)acetonitrile inhibitors of the c-Jun N-terminal kinase. J Med Chem 48, 4596-4607 24. Blind, R. D., and Garabedian, M. J. (2008) Differential recruitment of glucocorticoid receptor phospho-isoforms to glucocorticoid-induced genes. J Steroid Biochem Mol Biol 109, 150-157

[0101] 25. Galliher-Beckley, A. J., and Cidlowski, J. A. (2009) Emerging roles of glucocorticoid receptor phosphorylation in modulating glucocorticoid hormone action in health and disease. IUBMB Life 61, 979-986

[0102] 26. Webster, J. C., Jewell, C. M., Bodwell, J. E., Munck, A., Sar, M., and Cidlowski, J. A. (1997) Mouse glucocorticoid receptor phosphorylation status influences multiple functions of the receptor protein. J Biol Chem 272, 9287-9293

[0103] 27. Marchetti, M. C., Di Marco, B., Cifone, G., Migliorati, G., and Riccardi, C. (2003) Dexamethasone-induced apoptosis of thymocytes: role of glucocorticoid receptor- associated Src kinase and caspase-8 activation. Blood 101, 585-593

[0104] 28. Lowenberg, M., Verhaar, A. P., Bilderbeek, J., Marie, J., Buttgereit, F., Peppelenbosch, M. P., van Deventer, S. J., and Hommes, D. W. (2006) Glucocorticoids cause rapid dissociation of a T-cell-receptor-associated protein complex containing LCK and FYN. EMBO Rep 7, 1023-1029

[0105] 29. Croxtall, J. D., Choudhury, Q., and Flower, R. J. (2000) Glucocorticoids act within minutes to inhibit recruitment of signalling factors to activated EGF receptors through a receptor-dependent, transcription-independent mechanism. Br J Pharmacol 130, 289-298

[0106] 30. Holzer, R. G., Park, E. J., Li, N., Tran, H., Chen, M., Choi, C., Solinas, G., and Karin, M. (2011) Saturated fatty acids induce c-Src clustering within membrane subdomains, leading to JNK activation. Cell 147, 173-184

[0107] 31. Kant, S., Standen, C. L., Morel, C., Jung, D. Y., Kim, J. K., Swat, W., Flavell, R. A., and Davis, R. J. (2017) A Protein Scaffold Coordinates SRC -Mediated JNK Activation in Response to Metabolic Stress. Cell Rep 20, 2775-2783

[0108] 32. Soderberg, O., Gullberg, M., Jarvius, M., Ridderstrale, K., Leuchowius, K. J., Jarvius, J., Wester, K., Hydbring, P., Bahram, F., Larsson, L. G., and Landegren, U. (2006) Direct observation of individual endogenous protein complexes in situ by proximity ligation. Nat Methods 3, 995-1000

[0109] 33. Roskoski, R., Jr. (2005) Src kinase regulation by phosphorylation and dephosphorylation. Biochem Biophys Res Commun 331, 1-14

[0110] 34. Lombardo, L. J., Lee, F. Y., Chen, P., Norris, D., Barrish, J. C., Behnia, K., Castaneda, S., Cornelius, L. A., Das, J., Doweyko, A. M., Fairchild, C., Hunt, J. T., Inigo, I., Johnston, K., Kamath, A., Kan, D., Klei, H., Marathe, P., Pang, S., Peterson, R., Pitt, S., Schieven, G. L., Schmidt, R. J., Tokarski, J., Wen, M. L., Wityak, J., and Borzilleri, R. M. (2004) Discovery of N-(2-chloro-6-m ethyl- phenyl)-2-(6-(4-(2-hydroxy ethyl)- piperazin- 1-yl)- 2-methylpyrimidin-4- ylamino)thiazole-5-carboxamide (BMS-354825), a dual Src / Abl kinase inhibitor with potent antitumor activity in preclinical assays. J Med Chem 47, 6658-6661

[0111] 35. Lehmann, B. D., Bauer, J. A., Chen, X., Sanders, M. E., Chakravarthy, A. B., Shyr, Y., and Pietenpol, J. A. (2011) Identification of human triple-negative breast cancer subtypes and preclinical models for selection of targeted therapies. J Clin Invest 121, 2750- 2767

[0112] 36. Heikinheimo, O. (1997) Clinical pharmacokinetics of mifepristone. Clin Pharmacokinet 33, 7-17

[0113] 37. Conchon, M., Freitas, C. M., Rego, M. A., and Braga Junior, J. W. (2011) Dasatinib - clinical trials and management of adverse events in imatinib resistant / intolerant chronic myeloid leukemia. Rev Bras Hematol Hemoter 33, 131-139

[0114] 38. Finn, R. S., Crown, J. P., Lang, I., Boer, K., Bondarenko, I. M., Kulyk, S. O., Ettl, J., Patel, R., Pinter, T., Schmidt, M., Shparyk, Y., Thummala, A. R., Voytko, N. L., Fowst, C., Huang, X., Kim, S. T., Randolph, S., and Slamon, D. J. (2015) The cyclin-dependent kinase 4 / 6 inhibitor palbociclib in combination with letrozole versus letrozole alone as first-line treatment of oestrogen receptor-positive, HER2-negative, advanced breast cancer (PALOMA- l / TRIO-18): a randomised phase 2 study. Lancet Oncol 16, 25-35

[0115] 39. von Minckwitz, G., and Martin, M. (2012) Neoadjuvant treatments for triplenegative breast cancer (TNBC). Ann Oncol 23 Suppl 6, vi35-39

[0116] 40. Petrelli, F., Coinu, A., Borgonovo, K., Cabiddu, M., Ghilardi, M., Lonati, V., and Bami, S. (2014) The value of platinum agents as neoadjuvant chemotherapy in triplenegative breast cancers: a systematic review and meta-analysis. Breast Cancer Res Treat 144, 223-232

[0117] 41. de Medina, P., Paillasse, M. R., Segala, G., Poirot, M., and Silvente-Poirot, S. (2010) Identification and pharmacological characterization of cholesterol-5,6-epoxide hydrolase as a target for tamoxifen and AEBS ligands. Proc Natl Acad Sci U S A 107, 13520- 13525

[0118] 42. Nagy, M. A., Hilgraf, R., Mortensen, D. S., Elsner, J., Norris, S., Tikhe, J., Yoon, W., Paisner, D., Delgado, M., Erdman, P., Haelewyn, J., Khambatta, G., Xu, L., Romanow, W. J., Condroski, K., Bahmanyar, S., McCarrick, M., Benish, B., Blease, K., LeBrun, L., Moghaddam, M. F., Apuy, J., Canan, S. S., Bennett, B. L., and Satoh, Y. (2021) Discovery of the c-Jun N-Terminal Kinase Inhibitor CC-90001. J Med Chem 64, 18193-18208

Claims

CLAIMS:

1. A method of treating a subject suffering from breast cancer comprising administering to said subject a therapeutically effective amount of a JNK-1 inhibitor.

2. The method according to claim 1, wherein the JNK-1 inhibitor is administered in combination with at least one further therapeutic agent selected from the list consisting in Tamoxifen, PBPE, Tesmilifene, Dendrogenin A, Mifepristone, Palbociclib, Carboplatin, Paclitaxel.

3. The method according to any of claim 1 or 2, wherein the JNK-1 inhibitor is AS-602801.

4. The method according to claim 1, wherein the JNK-1 inhibitor is AS-602801 and is administered in combination with at least one further therapeutic agent selected from the group consisting in Tamoxifen, Tesmilifene, PBPE, Dendrogenin A, Mifepristone, Palbociclib, Carboplatin, Paclitaxel, Dasatinib or Doxorubicin.

5. The method according to claim 1, wherein the JNK-1 inhibitor is CC-90001 and is administered in combination with at least one further therapeutic agent selected from the group consisting in Tamoxifen, Dendrogenin A, Mifepristone, Palbociclib, Carboplatin, Paclitaxel, Dasatinib or Doxorubicin.

6. The method according to claim 1 or 2, wherein the JNK-1 inhibitor is an inhibitor of JNK-1 gene expression selected from the list consisting of antisense oligonucleotide, nuclease, siRNA, shRNA or ribozyme.

7. The method according to claim 2, 4, 5 or 6, wherein administration of the combination results in enhanced therapeutic efficacy relative to the administration of the JNK-1 inhibitor alone.

8. The method according to any of claims 1 to 7, wherein the breast cancer is a triple negative breast cancer.

9. The method according to any of claim 1 to 8, wherein the breast cancer is associated to cholestan-6-oxo-3p,5a-diol (OCDO) production.

Citation Information

Patent Citations

  • Methods and compositions for RNA-directed target DNA modification and for RNA-directed modulation of transcription

    US20140068797A1

  • Multichain polypeptides or proteins and processes for their production

    US4816397A

  • Single polypeptide chain binding molecules

    US4946778A

  • Recombinant altered antibodies and methods of making altered antibodies

    US5225539A

  • Daniel desmond

    US541A