Compositions and methods for hearing loss

Abstract

Methods and compositions for use in treating subjects with non-syndromic progressive hearing loss caused by mutations in a P2RX2 gene by editing of the mutant, and methods of use thereof, as well as genetically modified animals and cells.

Description

[0001] COMPOSITIONS AND METHODS FOR HEARING LOSS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 548,792, filed on February 1, 2024. The contents of the foregoing are incorporated herein by reference in their entirety.

[0004] FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under grant numbers TR002636, DC019404, and DC016875 awarded by The National Institutes of Health. The government has certain rights in the invention.

[0006] TECHNICAL FIELD

[0007] Described herein are compositions for use in treating subjects with autosomal dominant non-syndromic hearing loss caused by mutations of the Purinergic Receptor P2X 2 (P2RX2)' gene, and methods of use thereof, as well as genetically modified animals and cells.

[0008] BACKGROUND

[0009] Congenital hearing loss represents the most prevalent birth defect worldwide (1). In developed countries, genetic factors account for congenital sensorineural hearing loss (SNHL) in as many as 1 in 500 newborns (2). Despite the identification of over 150 deafness genes, effective biological treatments for preserving or reversing hereditary hearing loss remain elusive (3). The current clinical options for SNHL are limited to hearing aids and cochlear implants, which have significant limitations, including poor speech recognition in noisy environments (3, 4), and unsatisfactory music perception due to incomplete synchrony restoration and inconvenience (3, 5, 6).

[0010] Remarkable progress has been made in developing gene therapy strategies for genetic hearing loss over the past decades, encompassing gene replacement (7-10), gene augmentation (11-13), gene silencing (14-16), and genome editing (17-22). Although gene therapy, including clustered regularly interspaced short palindromic repeats (CRISPR)-mediated genome editing, has achieved remarkable significance in treating genetic hearing loss in mouse models, a majority of gene therapy studies have been conducted in the neonatal stage in mouse models (7, 20, 23-33). In neonatal mice, the inner ear still undergoes development (34, 35), and the treatment effect is likely to be similar to what can be achieved in human fetal inner ears. In humans, however, even newborn inner ears are fully mature (36, 37). The cochlea undergoes significant developmental changes from neonatal to adult stages including changes in size, structure, and function. As such, genome editing in mature inner ear cells is a challenge.

[0011] SUMMARY

[0012] The compositions and methods provided herein are based, at least in part, on the discovery that the genome editing systems disclosed herein can efficiently and specifically edit disease-associated P2RX2 mutations in inner and outer hair cells in mature mammalian cochlea. The compositions and methods disclosed herein provide for efficient delivery of a genome editing complex into hair cells of mature cochlea. Further, the compositions and methods disclosed herein can ameliorate hearing loss, promote survival of hair cells in mature mammalian cochlea, rescue vestibular function, and attenuate heightened sensitivity to noise-induced hearing loss in a subject.

[0013] Thus, herein we describe a composition comprising one or more nucleic acids comprising a sequence encoding an RNA-guided nuclease and a sequence encoding one or more single guide RNAs (sgRNAs), wherein a target sequence of the one or more sgRNAs comprises a c.178 G > T mutation in a human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2) gene (SEQ ID NO:75).

[0014] Also described herein is a composition comprising a ribonucleoprotein (RNP) complex comprising an RNA-guided nuclease and one or more sgRNAs, wherein a target sequence of the one or more sgRNAs comprises a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75).

[0015] In some embodiments the one or more gRNAs target a sequence selected from any one of SEQ ID NOs: 1 to 25.

[0016] In some embodiments, the RNA-guided nuclease is selected based on the corresponding one or more sgRNAs as shown in Table 1.

[0017] In some embodiments, the RNA-guided nuclease is a Staphylococcus aureus Cas9 (SaCas9) or a variant thereof, optionally SaCas9-KKH. In some embodiments, the RNA-guided nuclease comprises one or more nuclear localization signals.

[0018] In some embodiments, the one or more nuclear localization signals comprise a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal.

[0019] In some embodiments, the sequence encoding the RNA-guided nuclease comprises a polyadenylation signal.

[0020] In some embodiments, the one or more nucleic acids comprises a viral delivery vector.

[0021] In some embodiments, the viral delivery vector is an adenovirus vector, an adeno- associated virus (AAV) vector, or a lentivirus vector.

[0022] In some embodiments, the composition is for use in therapy.

[0023] In some embodiments, the composition is for use in preparation of a medicament.

[0024] In some embodiments, the composition is for use in a method of treating a subject who has non-syndromic progressive hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75).

[0025] In some embodiments, the composition, e.g., AAV vector, is delivered to or formulated for delivery to the inner ear of a subject by injection, optionally through the round window.

[0026] Also described herein is a method of editing an allele comprising a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) of a cell, comprising contacting the cell with a composition described herein.

[0027] In some embodiments, the editing of the allele comprising a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO: 75) is affected using a sgRNA targeting a sequence selected from any one of SEQ ID NOs: 1 to 25.

[0028] In some embodiments, the cell is in or from a subject who has non-syndromic progressive hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75).

[0029] In some embodiments, the cell is a cell of the inner ear of the subject.

[0030] In some embodiments, the cell is an inner hair cell.

[0031] Also described herein is a method of treating progressive non-syndromic hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient a composition described herein. Also described herein is a method of improving hair cell survival in a patient harboring a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient a composition described herein.

[0032] Also described herein is a method of improving vestibular function in a patient harboring a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient a composition described herein.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0034] Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

[0035] DESCRIPTION OF DRAWINGS

[0036] Figures 1A-J. Allele specific genome editing using SaCas9 / sgRNA-l in mouse P2rx2V6IL'+primary cells. (A) The DNA sequence of the P2rx26ILmutation locus and the sgRNAs designs for SpCas9 and SaCas9, respectively. (B) Schematic overview of plasmid constructions for different CRISPR systems used for in vitro study. (C) The experiment design for studying genome editing in the primary fibroblasts from P2rx2V6IL'+mice. (D) Quantification of the InDei frequency in P2rx2V61L / +and P2rx2+ / +primary fibroblast after genome editing using different Cas9 / sgRNA combinations. n=3. Error bar represents SD. (E and F) Representative next-next generation sequence (NGS) results from SaCas9 / sgRNA-l edited P2rx2V6IL / +(E) and P2rx2+ / +primary fibroblasts (F). (G) InDei profiles from SaCas9 / sgRNA-l edited P2rx2V61Lallele in primary fibroblasts. Negative numbers represent deletions, positive numbers represent insertions. (H) Pie chart showing the out-of-frame (3n ± 1) ratio in the InDei profile. (I) CIRCLEseq analysis of SaCas9-sgRNA-l in P2rx2V61L'+primary fibroblast genomic DNA. (J) Quantification of InDei frequency of potential off-target sites from the mouse genome. Figures 2A-G. Targeting P2rx2 V61L mutation with different CRISPR nuclease systems. (A and B) Representative NGS results from SpCas9 / sgRNA-2 edited 2 / -x2V61L / +(A) and wildtype (B) primary fibroblasts. (C) Schematic overview of P2rx2 V61L HEI-0C1 cell line establishment using the PiggyBac system and a genome editing procedure. (D) Quantification of the InDei frequency in P2rx2 V61L and wild-type HEI-0C1 cells after genome editing using SpCas9 / sgRNA-2 and SaCas9 / sgRNA-l. Error bar represents SD. (E and F) InDei profiles from SpCas9 / sgRNA-2 edited P2rx2 V61L HEI-OC1 cells. Negative numbers represent deletions, positive numbers represent insertions. (G) Representative NGS results from SaCas9 / sgRNA-l edited wild-type HEI-0C1 cells.

[0037] Figures 3A-M. AAV2 mediated genome editing at the P2rx2 V61L locus in the cochlea of adult P2rx2V61L,+mice. (A) Experimental overview for in vivo studies. AAV2 was injected in the inner ear of adult mice at 4 weeks of age, followed by NGS 8 weeks later. (B) In uninjected P2rx2V6IL / +mice, representative NGS showed the WT and P2rx2V6,Lmutant alleles without any InDeis. (C) In AAV2-SaCas9-sgRNA-l injected P2rx2V61L'+ears, representative NGS showed InDeis on the mutant locus that resulted in a decrease in the mutant allele frequency. (D) In injected P2rx2 mice, representative NGS showed only the WT alleles without any InDeis. (E) Quantification of InDei frequency in the NGS results from AAV2-SaCas9-sgRNA-l injected and uninjected P2rx2V6IL / +ears, and AAV2-SaCas9-sgRNA-l injected P2rx2+ / +ears (n=6 for each). Cochleae were collected 8 weeks after AAV injection. In uninjected mice, background InDei frequencies ranged between 0% and 0.05%. Each dot represents a unique sequencing reaction from 2 cochleas combination. Error bar represents SD. (F) qPCR analysis of SaCas9 mRNA level in the injected cochlea (n=6). Values and error bars reflect mean ± SD. (G) NGS reads showing the distribution of P2rx2+and mutant P2rx2V61Ltranscripts from uninjected P2rx2V61L,+mice. Alternative splicing products were identified. (H) NGS reads showed decreased P2rx2V6,Ltranscripts compared to WT P2rx2 transcripts from AAV2-SaCas9-sgRNA-l injected P2rx2V61L / +ears. InDeis were also identified in some P2rx2V61Ltranscripts but not in P2rx2+transcripts. (I) A normalized ratio of unmodified P2rx2v'61Ltranscripts relative to unmodified WT transcripts in uninjected and injected P2rx2V61L'+animals based on the NGS reads, n=3. (J) Schematic overview of the experimental protocol of hair cell isolation, cell lysis, and NGS. (K) Representative NGS result of isolated hair cell DNA from AAV2- SaCas9-sgRNA-l injected P2rx2V61L,+cochleas. (L) Quantification of P2rx2 allele-specific InDei frequency of the NGS results from AAV2-SaCas9-sgRNA-4 injected and uninjected P2rx2V61L / +hair cells lysis (n=3). Each dot represents a unique sequencing reaction from one cochlea. The error bar represents SD. (M) The distribution of P2rx2 wild-type allele reads, V61L reads, and InDel-containing reads of the NGS results from AAV2-SaCas9-sgRNA-l injected P2rx2V61L / +hair cells. A 14% InDei frequency represents an editing efficiency of 28% on the P2rx2‘'61Llocus.

[0038] Figures 4A-G. Safety assessment of AAV -mediated genome editing in adult mice. (A) Representative images of FM1-43FX labeled hair cells after digestion of cochlear tissues. (B) Schematic overview of the AAV vector integration at the double strand DNA break (DSB) site. The asterisk indicates P2rx2 V61L mutation site, and the arrawhead indicates the DSB site. (C) Schematic overview of the primers designed for the AAV vector integration assay. The arrows indicate the location of the primers. Pl-F and P2-R were used for amplifying P2rx2 V61L loci in mouse genome. P3-F and P4-R were used for detecting AAV vector. Pl-F and ITR-R were used for detecting AAV vector integration. (D) Quantification of InDei frequency based on the NGS results and AAV vector ITR integration ratio from AAV2-SaCas9-sgRNA-l edited cells. (E and F) Gel image (E) and quantification (F) of PCR from AAV2-SaCas9-sgRNA-l edited cochlea and cell line, showing P2rx2 -ITR integration only in the cell line, not in in vivo hair cells. The asterisk indicates the 2r 2-ITR integration band (E). (G) qPCR analysis of 2rx2-ITR RNA level in injected and uninjected cochlea to test if there were P2rx2-ITR transcripts in injected cochlea (n=3). The error bar represents SD.

[0039] Figures 5A-D. AAV2-GFP distribution in P2rx2V6IL / +mouse cochlea by RWM injection with canal fenestration. (A) Whole mount of AAV2-GFP distribution in the cochlear sensorineural epithelia. Scale bar: 200pm. (B) Representation distribution of AAV2-GFP in the cochlear apex (8kHz), middle (16kHz) and basal (32kHz) regions. Scale bar: 100pm. (C) Quantitation of transduction efficiency of inner hair cells (IHCs) and outer hair cells (OHCs) in the apex, middle, and basal turn (Apex: 99.57 ± 0.43%, n=3; Middle: 94.69 ± 2.82%, n=3; Base: 89.93 ± 3.96%, n=3). (D) Quantification of GFP fluorescence intensity in transduced hair cells along the cochlear turns. Cells measured were from the apical, middle, and basal turns of AAV2- GFP injected cochlea of P2rx2V61L / +mice in IHCs (Apex: 3380.72 ± 9.43, n=169; Middle: 3198.77 ± 35.58, n=101; Basal: 3074.85 ± 54.81, n=99) and OHCs (Apex: 1493.22 ± 39.92, n=325; Middle: 1299.48 ± 40.32, n=266; Basal: 748.06 ± 26.55, n=242). All data are presented as mean ± SEM. Significance was determined by two-way ANOVA test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0040] Figures 6A-6M. AAV2-SaCas9-sgRNA-l adult and juvenal injections preserve auditory function in P2rx2V61L / +mouse model of DFNA41. (A) Schematic diagram of SaCas9 and sgRNAl packaged into one AAV2 capsid and surgical intervention strategy. For one group, AAV2-SaCas9-sgRNA-l was injected into the inner ear at 4 weeks of age. For the other group, the injection was performed into the inner ears at 2 weeks of age. Hearing was tested at 1-, 3-, 6-, and 9-months post injection (mpi). (B) Representative ABR waveforms recorded at 6 months from an uninjected l>2rx2‘61L / +mouse , a 4-week injected P2rx2V61L;+mouse, a 2-week injected P2rx2V6IL / +mouse , and an uninjected P2rx2+ +mouse . Lighter traces indicate the threshold. The scale bar applies to all traces. (C to F) ABR thresholds of P2rx2V6IL / +mice injected at 4 weeks old and uninjected P2rx261L / +littermates. ABR thresholds for uninjected littermates P2rx2+ / +mice tested at the same time points at 2, 4, 7 and 10 months of age. One-month post-4-week- inj ection, treated ears showed lower ABR thresholds compared to uninjected ears at 8kHz (Treated: 47.67 ± 2.96 dB, n=15; Untreated: 53.33 ± 2.32 dB, n=15; WT: 35.00 ± 2.24 dB, n=16; p - 0.0178) (C). Three months post-4-week-inj ection, treated ears showed lower ABR thresholds compared to uninjected ears, particularly at low frequencies of 5.66kHz (Treated: 59.23 ± 2.11 dB, n=13; Untreated: 73.85 ± 2.41 dB, n=13; WT: 48.57 ± 2.06 dB, n=14; p < 0.000 J), 8kHz (Treated: 54.62 ± 1.83 dB, n=13; Untreated: 64.62 ± 1.44 dB, n=13; WT: 35.71 ± 1.37 dB, n=14; p = 0.006), and 11.32kHz (Treated: 49.23 ± 2.11 dB, n=13; Untreated: 61.54 ± 1.04 dB, n=13; WT: 31.07 ± 2.11 dB, n=14; p = 0.0002) (D). At six months post-4-week-inj ection, more significant hearing preservation was observed at low frequencies 5.66kHz (Treated: 75.83 ± 3.63 dB, n=12; Untreated: 95.83 ± 2.29 dB, n=12; WT: 41.00 ± 3.15 dB, n=10; p < 0.0001), 8kHz (Treated: 65.00 ± 4.48 dB, n=12; Untreated: 89.17 ± 4.52 dB, n=12; WT: 33.00 ± 4.23 dB, n=10; p < 0.0001), and 11.32kHz (Treated: 65.00 ± 3.99 dB, n=12; Untreated: 85.00 ± 4.85 dB, n=12; WT: 25.00 ± 3.07 dB, n=10; p < 0.0001) (E). At nine months post-4-week-inj ection, hearing preservation was still evident in treated P2rx2V6IL'+group, specifically at low frequencies: 5.66kHz (Treated: 85.00 ± 5.00 dB, n=5; Untreated: 100.00 ± 0.00 dB, n=5; WT: 44.00 ± 2.45 dB, n=5; p = 0.0298), 8kHz (Treated: 82.00 ± 6.44 dB, n=5; Untreated: 100.00 ± 0.00 dB, n=5; WT: 40.00 ± 0.00 dB, n=5; p = 0.0036), and 11.32kHz (Treated: 78.00 ± 8.00 dB, n=5; Untreated: 98.00 ± 2.00 dB, n=5; WT: 32.00 ± 2.00 dB, n=5; p = 0.0008) (F). (G to J) ABR thresholds of P2rx2V61L / +mice injected at 2 weeks of age and uninjected P2rx2V61L,+littermates, injected and uninjected WT (P2rx2 ) littermates (grey & black) tested 1-, 3-, 6- and 9-months post injection. One-month post injection, treated P2rx2V61L / +ears showed lower ABR thresholds compared to uninjected P2rx2V61L / +ears at 22.6kHz (Treated: 69.58 ± 2.17 dB, n=12; Untreated: 77.50 ± 4.29 dB, n=12,p = 0.0175; P2rx2+ / +untreated: 31.43 ± 1.77 dB, n=14; P2rx2+ +treated: 35.71 ± 1.37 dB, n=14) (G). At three months post injection, hearing preservation in the treated P2rx2V6IL / +ears extended to all frequencies except for 32 kHz, including 5.66kHz (Treated: 57.27 ± 1.41 dB, n=l l; Untreated: 73.64 ± 2.44 dB, n=l l, / i = 0.0001; P2rx2+ +treated: 45.00 ± 2.30 dB, n=12; P2rx2 untreated: 42.50 ± 1.31 dB, n=12), 8kHz (P2rx2V61L;+treated: 48.18 ±

[0041] I.69 dB, n=l l; P2rx2V61L / +untreated: 60.00 ± 2.70 dB, n=l l,p = 0.0131 and P2rx2 treated: 35.00 ± 1.95 dB, n=12; P2rx2+ / +untreated: 35.83 ± 2.29 dB, n=12), 11.32kHz (P2rx2V61L / +Treated: 40.46 ± 2.47 dB, n=l 1; P2rx2V61L / +untreated: 57.27 ± 3.04 dB, n=l \,p < 0.0001;

[0042] P2rx2+,+treated: 30.42 ± 2.64 dB, n=12; P2rx2+ +untreated: 30.83 ± 1.49 dB, n=12), 16kHz (P2rx2V61L,+treated: 65.91 ± 3.49 dB, n=l l; P2rx2V6IL,+untreated: 80.91 ± 3.68 dB, n=l l, / > = 0.0003; P2rx2+ / +treated: 28.33 ± 2.07 dB, n=12; untreated: 30.83 ± 2.29 dB, n=12) and 22.6kHz (P2rx2V6IL'+treated: 85.91 ± 2.32 dB, n=l l; P2rx2V6IL / +untreated: 97.27 ± 1.41 dB, n=l l,p = 0.0216; treated: 33.33 ± 1.88 dB, n=12; untreated: 36.67 ± 1.88 dB, n=12) (H). At six months post injection, significant hearing preservation was observed in injected compared to uninjected P2rx2V61L / +ears at four frequencies: 5.66kHz (P2rx2V61L / +treated: 74.50 ± 1.57 dB, n=10; P2rx2V61L / +untreated: 94.50 ± 2.41 dB, n=10, / ? < 0.0001;

[0043] P2rx2+ / +treated: 44.55 ± 2.82 dB, n=l 1; P2rx2+ +untreated: 42.73 ± 2.37 dB, n=l 1), 8kHz (P2rx2V61L / +treated: 63.50 ± 1.83 dB, n=10; P2rx2V6IL,+untreated: 88.00 ± 1.53 dB, n=10, / ? < 0.0001; P2rx2+ / +treated: 38.18 ± 3.25 dB, n=l 1; untreated: 35.46 ± 2.82 dB, n=l 1),

[0044] I I.32kHz (P2rx2V61L / +treated: 58.00 ± 1.11 dB, n=10; P2rx2V61L / +untreated: 82.00 ± 2.49 dB, n=10,j> < 0.0001; P2rx2+ / +treated: 30.91 ± 3.43 dB, n=l l; P2rx2+ / +untreated: 25.46 ± 1.58 dB, n=l 1) and 16kHz (P2rx2V61L / +treated: 80.50 ± 1.57 dB, n=10; P2rx2]'61L / +untreated: 94.00 ± 1.63 dB, n=10, / i = 0.0008; P2rx2+ / +treated: 32.73 ± 1.95 dB, n=l 1; P2rx2+ / +untreated: 30.00 ± 2.34 dB, n=l 1) (I). At nine months post injection, significant hearing preservation in treated P2rx2V61L / +ears persisted at 4 frequencies: 5.66kHz (P2rx2V61L / +treated: 86.00 ± 2.45 dB, n=5; P2rx2V6IL / +untreated: 100.00 ± 0.00 dB, n=5, / ? = 0.0006; P2rx2+ / +treated: 46.00 ± 2.45 dB, n=5; P2rx2+ / +untreated: 46.00 ± 2.45 dB, n=5), 8kHz (P2rx2l61L / +treated: 76.00 ± 3.67 dB, n=5; P2rx2V6JL;+untreated: 97.00 ± 2.00 dB, n=5, / > < 0.0001 ; P2rx2+ / +treated: 38.00 ± 2.00 dB, n=5; P2rx2+ / +untreated: 40.00 ± 0.00 dB, n=5), 11.32kHz (P2rx2V61L / +treated: 79.00 ± 1.87 dB, n=5; P2rx2V61L / +untreated: 97.00 ± 2.00 dB, n=5, / ? < 0.0001; P2rx2+ / +treated: 30.00 ± 3.16 dB, n=5; P2rx2+ / +untreated: 28.00 ± 2.00 dB, n=5), and 16kHz (P2rx2]'61L / +treated: 84.00 ± 1.87 dB, n=5; P2rx2V6IL / +untreated: 100.00 ± 0.00 dB, n=5,p < 0.0001; P2rx2+ +treated: 36.00 ± 2.45 dB, n=5; P2rx2+,+untreated: 36.00 ± 2.45 dB, n=5) (J). (K) Mean ABR waveforms in uninjected and injected P2rx2V61L / +9 months post 4-week injection at 90dB 11.32kHz (n=5). (L) Quantification of Pl amplitude delta at 11.32 kHz from 20 dB to 100 dB SPL for injected P2rx2V61L;+and uninjected P2rx2V6IL:+at 9 months post-injection at 4 weeks old, significant difference at 90 dB (Treated: 0.33 ± 0.07pV, n=5; Untreated: 0.08 ± 0.04pV, n=5; p < 0.0001), and 100 dB (Treated: 0.52 ± 0.07 pV, n=5; Untreated: 0.13=1= 0.04 pV, n=5; p < 0.0001). (M) Quantification of Pl latency at 11.32 kHz from 20 dB to 100 dB SPL for injected P2rx2V61L / +(n=5), uninjected P2rx2V6IL'+(n=5), and uninjected P2rx2+ / +(n=10) at 9 months post-injection at 4 weeks old. All data are presented as mean ± SEM. Two-way ANOVA determined significance with Bonferroni correction for multiple comparisons: * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0045] Figures 7A-D. 4-week AAV2-SaCas9-sgRNA-l injection preserves DPOAE in P2rx2V61L / +mouse model of DFNA41 long-term. (A) One month after injection at 4 weeks of age, the average DPOAE thresholds in injected and uninjected P2rx2mLmice were similar, and both were increased compared to age-matched WT mice. (B) Three months after injection at 4 weeks of age, the DPOAE threshold at 11.32 kHz in injected P2rx2V6lL +mice was significantly reduced compared to uninjected P2rx2V6IL'+mice (Treated: 54.74 ± 1.92 dB, n=13; Untreated: 65.69 ± 3.57 dB, n=13; WT: 47.64 ± 4.85 dB, n=14; p = 0.0236). (C) Six months after injection at 4 weeks of age, the DPOAE threshold at 11.32 kHz in injected P2rx2V6,L / +mice was significantly reduced compared to uninjected P2rx2V61L,+mice (Treated: 63.10 ± 3.52 dB, n=12; Untreated: 72.63 ± 2.92 dB, n=12; WT: 37.09 ± 1.19 dB, n=10; p = 0.0002). (D) Nine months after injection at 4 weeks of age, the DPOAE threshold at 11.32 kHz in injected P2rx2‘‘6Umice was significantly reduced compared to uninjected P2rx2V6IL / +mice (Treated: 63.00 ± 1.72 dB, n= 5; Untreated: 79.91 ± 0.09 dB, n=5; WT: 34.98 ± 1.67 dB, n=5; / > < 0.0001). All data are presented as mean ± SEM. Significance was determined by two-way ANOVA test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Figures 8A-D. 2-week AAV2-SaCas9-sgRNA-l injection preserves DPOAE in P2rx2V61L / +mouse model of DFNA41 long-term. (A) One month after injection at 2 weeks of age, the average DPOAE thresholds in injected and uninjected P2rx2V61L,+mice were similar, and both were increased compared to age-matched WT mice. The DPOAE thresholds in injected WT mice were the same as the uninjected WT. (B) Three months after injection at 2 weeks of age, the DPOAE thresholds in injected P2rx2V61L,+mice were significantly reduced compared to uninjected P2rx2V61L / +mice at 11.32kHz (P2rx2V61L / +Treated: 51.91 ± 2.18 dB, n=l l; P2rx2V6IL / +untreated: 68.37 ± 1.44 dB, n=l 1; P2rx2+ / +treated: 42.73 ± 3.65 dB, n=12; P2rx2 untreated: 41.55 ± 3.77 dB, n=12; p < 0.0001) and 16 kHz (P2rx2V61L / +Treated: 60.08 ± 2.47 dB, n=l 1; P2rx2V6IL'+untreated: 75.55 ± 1.26 dB, n=l l; treated: 43.00 ± 6.73 dB, n=12; P2rx2+'+untreated: 42.18 ± 5.47 dB, n=12; p < 0.0001). The DPOAE thresholds in injected WT mice were not significantly different from those in the uninjected WT. (C) Six months after injection at 2 weeks of age, the DPOAE thresholds in injected P2rx2V6iLmice were significantly reduced compared to uninjected P2rx2*6IL'+mice at 11.32 kHz (P2rx2V6IL,+treated: 57.35 ± 2.61 dB, n=8; P2rx2V6IL'+untreated: 73.45 ± 1.55 dB, n=8; P2rx2+ / +treated: 42.06 ± 2.12 dB, n=10; P2rx2+ +untreated: 41.59 ± 4.95 dB, n=10; p < 0.0001) and 16 kHz (P2rx2V61L / +treated: 71.49 ± 2.26 dB, n=8; P2rx2V61L / +untreated: 79.35 ± 0.56 dB, n=8; P2rx2+ / +treated: 34.06 ± 3.34 dB, n=10; P2rx2+ / +untreated: 30.60 ± 2.75 dB, n=10; p < 0.0001). The DPOAE thresholds in injected WT mice were not significantly different from those in the uninjected WT. (D) Nine months after injection at 2 weeks of age, the DPOAE thresholds in injected P2rx2V6IL / +was were significantly reduced compared to uninjected P2rx2V61L / +mice at 11.32 kHz (P2rx2V6IL / +treated: 71.51 ± 1.14 dB, n=5; P2rx2], 6IL / +untreated: 78.77 ± 1.07 dB, n=5; P2rx2+ / +treated: 39.55 ± 2.94 dB, n=5; P2rx2+ / +untreated: 36.35 ± 2.42 dB, n=5; p < 0.0001). The DPOAE thresholds in injected WT mice were not significantly different from those in the uninjected WT. All data are presented as mean ± SEM. Significance was determined by a two-way ANOVA test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0046] Figures 9A-B. Long-term hearing rescue of AAV2-SaCas9-sgRNA-l in P2rx2V6IL / +mouse model of DFNA41 by early intervention. (A) ABR at 12 months post-2-week injection (mpi): significant difference observed at 11.32kHz (P2rx2V6IL / +Treated: 85.00 ± 10.00 dB, n=4; P2rx2V6IL / +untreated: 100 ± 0.00 dB, n=l 1; P2rx2+ / +treated: 32.50 ± 5.00 dB, n=4; P2rx2+ / +untreated: 30.00 ± 0.00 dB, n=4; p < 0.0001) and 16kHz (P2rx2V61L;+treated: 93.75 ± 7.50 dB, n=4; P2rx2V6JL;+untreated: 100.00 ± 0.00 dB, n=4; P2rx2+,+treated: 35.00 ± 5.77 dB, n=4; untreated: 32.50 ± 5.00 dB, n=4; p = 0.0001). (B) The DPOAE thresholds at 12 months post-2 -week injection (mpi) in injected mice were not significantly different from those in the uninjected. All data are presented as mean ± SEM. Significance was determined by two-way ANOVA test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0047] Figure 10. Wave 1 amplitude comparison between P2rx2V6IL / +injected and uninfected mice. Mean ABR waveform in P2rx2V61L / +uninjected and injected group at nine months postinjection at 4 weeks old at lOOdB 11.32kHz (n=5).

[0048] Figure 11 A-F. AAV2-SaCas9-sgRNA-l adult injection rescues outer hair cells in P2rx2V6IL / +mouse model of DFNA41. (A to C) Representative confocal microscopy images of wholemount of an intact cochlea of WT (A), uninjected (B), and injected (C) P2rx2V61L,+mice, 9 months post 4-week injection labeled with MY07A. Scale bars, 200pm. IHC: inner hair cells; OHC: outer hair cells. (D) Representative confocal microscopy images of the surface views of a WT, uninjected, and injected P2rx2V6IL / +cochleae at the apex (Panels D, G, and J), middle (Panels E, H, and K) and base (Panels F, I, and L), respectively. The asterisks indicate OHC loss in the apical and the middle turns, and severe IHC loss was seen in the base turn of uninjected and injected P2rx2V6IL'+cochleae. Scale bars, 50pm. (E) Quantification of OHC at the apex, middle, and base turns of the cochlea from WT (Apex: 40.2 ± 0.66 cells / lOOpm, n=5; Middle: 41.6 ± 0.51 cells / 100 pm, n=5; Basal: 41.0 ± 0.71 cells / lOOpm, n=5), uninjected P2rx2V6IL / +ears (Apex: 29.60 ± 1.40 cells / lOOpm, n=5; Middle: 18.80 ± 1.74 cells / 100 pm, n=5; Basal: 0.80 ± 0.37 cells / lOOpm, n=5), injected P2rx2V61L / +ears (Apex: 36.40 ± 1.81 cells / lOOpm, n=5, » = 0.0018; Middle: 29.00 ± 1.52 cells / 100 pm, n=5, < 0.0001; Basal: 1.40 ± 0.51 cells / lOOpm, n=5). (F) Quantification of IHC at the apex, middle, and base turns of the cochlea among WT (Apex: 12.40 ± 0.51 cells / lOOpm, n=5; Middle: 12.20 ± 0.66 cells / 100 pm, n=5; Basal: 11.40 ± 0.51 cells / lOOpm, n=5), uninjected P2rx2V6IL,+ears (Apex: 12.20 ± 0.37 cells / lOOpm, n=5; Middle: 11.60 ± 0.51 cells / 100 pm, n=5; Basal: 1.00 ± 0.32 cells / lOOpm, n=5), and injected P2rx2V6IL / +ears (Apex: 11.60 ± 0.51 cells / lOOpm, n=5; Middle: 12.00 ± 0.32 cells / 100 pm, n=5; Basal: 0.80 ± 0.37 cells / lOOpm, n=5). Data are presented as means ± SEM. A two-way ANOVA test was used to compare the results. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. Figures 12A-C. AAV2-SaCas9-sgRNA-l rescues hair cell morphology in the P2rx2V61L +mouse model of DFNA41. (A and B) ABR (A) and DPOAE (B) thresholds of injected and uninjected contralateral ears of a P2rx2V61L / +mouse 9 months post injection. (C) Representative hair cell stereocilia morphology analyzed by scanning electron microscope (SEM) at the apical turn of P2rx2+ +cochlear OHC (Panels C and C’ -enlarged inset in C) and IHC (Panels D and D’- enlarged inset in D). Representative SEM images of the apical turn of uninjected P2rx2mLstereocilia of OHC (Panels E and E’-enlarged inset E) and IHC (Panels F and F’-enlarged inset F). Representative SEM images of apical turn of AAV2-SaCas9-sgRNA-l injected P2rx2V6IL / +stereocilia of OHC (Panels G and G’ -enlarged inset G) and IHC (Panels H and H’-enlarged inset H). Scale bars, 3 pm.

[0049] Figures 13A-D. AAV2-GFP distribution in the utricle of P2rx2V6IL / +mouse model. (A) Overviews of AAV2-GFP distribution in the vestibular utricle under low magnification labeled with GFP (Panel A), MY07A (Panel B), and Sox2 (Panel C). Higher magnification of represented images shows the distribution of AAV2-GFP in the utricle (Panels A’ - enlarged inset in A, B’- enlarged inset in B, and C’ - enlarged inset in C). (B) Overviews of AAV2-GFP distribution in the canal crista labeled with GFP (Panel D), Phalloidin (Panel E), and DAPI (Panel F) under low magnification. (C) Quantitation of transduction efficiency of GFP+ / MY07A+cell (31.77 ± 2.66%, n=3) and Sox2+ / MYO7A+cell (26.57± 2.43%, n=3). (D) Quantitation of transduction efficiency of Phalloidin+ / GFP+cell (70.30 ± 1.87%, n=3). Scale bar: 100pm.

[0050] Figures 14A-F. AAV2-SaCas9-sgRNA-l adult injection rescues vestibular function in the P2rx2V6IL'+mouse model of DFNA41. (A to C) Representative recording of open field test tracking the movements over 3 minutes for WT (A), uninjected (B) and injected (C) P2rx2V61L / +mice, 9 months post-injection. (D) The number of full-body rotation analysis showed P2rx2V61L / +uninjected: 8.93 ± 0.68 rotations / min, n=5; P2rx2V6,L / +injected: 1.80 ± 0.28 rotations / min, n=l 1, p = 0.0004; WT: 1.60 ± 0.30 rotations / min, n=10, / ? = 0.0028. (E) Distance covered per minute for mice from each group tested in the open field tests showed P2rx2V61L'+uninjected: 526.3 ± 33.48 cm / min, n=5; P2rx2V61L / +injected: 237.1 ± 12.12 cm / min, n=l l,p = 0.0037; P2rx2+ / +uninjected: 235.7 ± 12.7 cm / min, n=10, / ? = 0.0010. (F) The result of rotarod performance 9 months post-injection of WT, uninjected and injected P2rx2V6IL / +mice. All data are presented as mean ± SEM. A two-way ANOVA test determined significance. * p < 0.05, ** p < 0.01, *** p < 0.001, ****p < 0.0001.

[0051] Figures 15A-H. AAV2-SaCas9-sgRNA-l injection rescues increased sensitivity to noise- induced hearing loss (NIHL) in P2rx2l 61L / +mouse model of DFNA41. (A) Schematic representation of the experimental design. (B and C) Representative ABR waveforms at 8 kHz of the contralateral uninjected ear (B) and the injected ear (C) of a P2rx2V6IL / +mouse following noise exposure. The ABR threshold of 70 dB and 50 dB were detected in the uninjected and injected ears, respectively. (D) Mean ABR thresholds of different groups: injected and noise exposed P2rx2V6IL, uninjected and noise exposed P2rx2V61L / +, and uninjected P2rx2l 61L / +without noise exposure. P2rx2V6IL'+uninjected mice with noise exposure exhibited a significant threshold shift compared to P2rx2V6IL'+injected mice at 5.66 kHz (P2rx2V61L / +uninjected + NE: 73.75 ± 3.75 dB, n=4 ; P2rx2V61L / +injected + NE: 56.25 ± 2.39 dB, n=4, / ? < 0.0001; P2rx2V61L / +uninjected: 53.75 ± 1.83 dB, n=8), 8kHz (P2rx2V61L / +uninjected + NE: 65.00 ± 2.04 dB, n=4 ; P2rx2V61L'+injected + NE: 48.75 ± 3.16 dB, n=4,p < 0.0001; P2rx2V6IL / +uninjected: 46.25 ± 2.63 dB, n=8) and 11.32kHz (P2rx2V61L / +uninjected + NE: 50.00 ± 2.89 dB, n=4 ; P2rx2V61L / +injected + NE: 40.00 ± 3.54 dB, n=4, / > = 0.005; P2rx2V61L:+uninjected: 36.25 ± 2.63 dB, n=8). (E) Mean DPOAE thresholds of different groups: injected and noise exposed P2rx2V61L / +, uninjected and noise exposed P2rx2i 6iL\ and uninjected P2rx2V6lL / +without noise exposure. (F and G) Immunostaining of pre-ribbon synapse marker of CtBP2 of uninjected (F) and injected (G) P2rx2V61L / +mice followed by noise exposure. MY07A labels HC. Scale bars: 10pm. (H) Quantification and comparison of CtBP2 number showed a significant increase in the number of CtBP2+synapses in the injected (8.11 ± 0.90 per IHC, n=10) compared to uninjected ears after noise exposure (3.80 ± 0.47 per IHC, n=10). All data are presented as mean ± SEM. Significance was determined by two-way ANOVA test for ABR and DPOAE and by unpaired Student T-test for CtBP2. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0052] Figure 16A-E. Characteristics of P2rx2+ / +mice in response to noise-induced TTS. (A and B) Representative ABR waveforms at 8 kHz of a P2rx2+ / +mouse without NE (A) and a P2rx2+ / +mouse following noise exposure (NE) (B). The ABR threshold of 30 dB was detected in P2rx2+ / +mice without NE and with NE. (C and D) Immunostaining of pre-ribbon synapses marked by CtBP2 of without NE (C) and with NE (D) P2rx2+ / +mice followed by noise exposure. MY07A labels HC. Scale bars: 10pm. (E) Statistical analysis of Ctbp2 number per IHC showed a significant increase in the number of CtBP2+synapses in the without NE group (12.56 ± 0.50 per IHC, n=9) compared to with NE group (9.75 ± 0.53 per IHC, n=8). All data are presented as mean ± s.e.m. Significance was determined by two-way ANOVA test. * p < 0.05, ** / ? < 0.01, ***p < 0.001, 0.0001.

[0053] Figures 17A-F. P2RX2 V60L allele-specific genome editing in patient-derived hiPSCs using compact CRISPR systems. (A) Sequence of the human P2RX2 V60L mutation locus and the sgRNAs designs. The dotted box marks the mutant nucleotide and the underlined nucleotides mark the PAM motifs (B) Bar chart of the InDei frequency after genome editing using different CRISPR systems on human hiPSCs derived from a homozygous patient (P2RX21 60I V601) and a healthy control individual (P2RX2+ / +' n=3. Each dot represents a unique sequencing reaction. Values and error bars reflect mean ± SD. (C and D) Representative NGS results from SaCas9- KKH / sgRNA-1 edited P2RX2V6OL / V6OLand P2RX2+ / +hiPSCs. No InDeis were detected in the normal P2RX2 allele. Asterisks in the reference sequence indicate the V60L mutation nucleotide. (E) Pie chart showing the out-of-frame (3n ± 1) ratio in the InDei profile. (F) Quantification of InDei frequency of potential off-target sites from AAV2-SaCas9-KKH-sgRNA-l edited human cells.

[0054] Figures 18A-E. (A) Overview of HEK-P2RX2-V60L cell line generation. DNA fragment containing the P2RX2 V60L mutation was integrated into the genome of HEK-293T using PiggyBac transposons technology. (B) Bar chart showing the editing efficiency of P2RX2 V60L mutation locus and WT locus using different sgRNA spacer lengths of saCas9-KKH / sgRNA-l (n = 3). Values and error bars reflect mean ± SD. (C and D) Representative NGS results from saCas9-KKH / sgRNA-l edited P2RX2 V60L and WT allele. Reference sequence is the mutant allele. (E) Indel profiles from saCas9-KKH / sgRNA-l edited P2RX2 V60L HEK-293T cells. Negative numbers represent deletions and positive numbers represent insertions.

[0055] DETAILED DESCRIPTION

[0056] Dominant hearing loss due to gain of function or dominant negative mutations is, in some cases, amendable to editing interventions that abolish the mutations. In humans, dominant hearing loss is generally manifested by delayed onset progressive phenotypes that present the window of opportunity for intervention: interventions can be applied from early age with mild to moderate hearing loss to older patients with more severe hearing loss. Intervention at different stages will likely result in differential treatment outcomes and the duration of the rescue.

[0057] Here, we describe the successful rescue of delayed progressive dominant hearing loss and vestibular dysfunction in an autosomal dominant deafness-41 (DFNA41) mouse model through a one-time adult injection for precise genome editing. We used AAV-mediated delivery of editing complex by local injection via round window membrane injection with canal fenestration (RWM+CF) in adult DFNA41 mice, resulting in highly efficacious treatment effects in the sustained preservation of the auditory functions and the rescue of vestibular function. This was accompanied by robust safety data in off-target effects and the lack of AAV integration in the genomic DNA. Editing rescued DFNA41 mice from hypervulnerability to noise-induced hearing loss (NIHL). We performed a comparative delivery in juvenile DFNA41 mice with further improvement in hearing rescue, defining the treatment window and demonstrating the importance of early intervention in DFNA41 patients. Due to the reproducible P2rx2V61L / + mouse phenotypes of DFNA41 and the hearing rescue by AAV-mediated editing in the mature inner ear that is directly applicable to humans, this work forms the basis for a genetic approach to treating DFNA41 in humans.

[0058] P2RX2-associated hearing loss

[0059] DFNA41 is caused by mutations of the purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2) gene, which encodes an ATP-gated receptor consisting of an extracellular domain binding ATP, two a-helical transmembrane segments (TM1 and TM2), and one intracellular amino terminus and carboxyl terminus (62). ATP binding to the extracellular domain activates the P2X2 receptor leading to the opening of the transmembrane ion channel (63). Currently, four P2RX2 mutations have been reported to be linked to DFNA41: P2RX2 C.601G > A (p. D273Y) in a Japanese family (64), c. 1057 G > C (p. G353R) in an Italian family (65), c. lO48T>G (p.Term 350Glu) in an Iranian family (66) , c. 178 G > T (p.V60L) mutation found in two unrelated Chinese families (51, 67). These mutations, while occur in different domains, all lead to a similar phenotype: delayed onset progressive autosomal dominant hearing loss (68), based on the linkage analysis, segregation of the mutations in family pedigree, as well as the molecular analysis (65, 69). Increased vulnerability to NIHL has been reported in DFNA41 patients (51). In the inner ear, sound transduction is primarily driven by the endocochlear potential (EP, approximately +100 mV) and the negative membrane potential of the hair cells (70). A previous study has shown that elevated sound leads to ATP release into the cochlea, subsequently activating P2X2 receptors, leading to reductions in sound transduction and synaptic transmission by hair cells within the cochlear (56).

[0060] RNA-guided nucleases

[0061] Various RNA-guided nucleases can be used in the present methods and compositions, see, e.g., Walton et al., Science. 2020 Apr 17;368(6488):290-296; Kleinstiver et al., Nature. 2015 Jul 23; 523(7561): 481-485; WO 2021151085; WO 2016 / 141224; US 9,512,446; US-2014- 0295557; WO 2014 / 204578; and WO 2014 / 144761. This approach can use different CRISPR proteins and their corresponding gRNAs, including Streptococcus pyogenes Cas9 (SpCas9) and engineered SpCas9 variants (see, e.g., Tsai et al., Nat Biotechnol 33, 187-197 (2015); Fu et al., Nat Biotechnol 32, 279-284 (2014)); Mali et al., Nat Biotechnol 31, 833-838 (2013); Ran et al., Cell 154, 1380-1389 (2013)), Staphylococcus aureus Cas9 (SaCas9), KKH variant SaCas9 (see, e.g., Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33(12): 1293-1298; WO 2016 / 141224; WO 2017 / 040348), Cpfl (also known as Casl2a, such as AsCpfl, LPCpfl) (see e.g., WO2018195545A2 and WO2018022634A1, the contents of which are hereby incorporated by reference in their entireties), Casl2f (such as UnlCasl2fl, AsCasl2fl) etc. In some embodiments, the RNA-guided nuclease used in the present methods and compositions is a S. aureus Cas9 or a S. pyogenes Cas9, or variants thereof. In some embodiments of this disclosure a Cas9 sequence is modified to include two nuclear localization sequences (NLSs) (e.g., PKKKRKV (SEQ ID NO:71) at the C-terminus and / or N-terminus of the Cas9 protein, and a mini-polyadenylation signal (or Poly-A sequence). An exemplary NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO:72)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 73)). Other NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep. 2000 Nov 15; 1(5):411-415; Freitas and Cunha, Curr Genomics. 2009 Dec; 10(8): 550-557. Exemplary S. aureus Cas9 sequences (both nucleotide and peptide) are described in Table 4 of WO 2018 / 026976, e.g., SEQ ID NOs 10 and 11 therein. Cas9 nuclease sequences and structures are well known to those of skill in the art (see e.g., "Complete genome sequence of an Ml strain of Streptococcus pyogenes." Ferretti, J. J. et al., Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Deltcheva E. et al., Nature 471 :602-607(2011); and "Programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Jinek M. et al, Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference). Cas9 orthologs have been described in various species, including, but not limited to, S. pyogenes and S. thermophilus. Additional suitable Cas9 nucleases and sequences would be apparent to those of skill in the art based on this disclosure, and such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems" (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In some embodiments, a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain, that is, the Cas9 is a nickase.

[0062] In some embodiments, the compositions and methods disclosed herein use Staphylococcus aureus Cas9 (SaCas9), or variants thereof, and corresponding gRNAs. SaCas9 variants can include one of the following sets of mutations: E782K / N968K / R1015H (KKH variant); E782K / K929R / R1015H (KRH variant); or E782K / K929R / N968K / R1015H (KRKH variant). SaCas9 is one of several smaller Cas9 orthologues that are suited for viral delivery (Horvath et al., J Bacteriol 190, 1401-1412 (2008); Ran et al., Nature 520, 186-191 (2015); Zhang et al., Mol Cell 50, 488-503 (2013)). The wild type recognizes a longer NNGRRT PAM that is expected to occur once in every 32 bps of random DNA; or the alternative NNGRRA PAM.

[0063] In some embodiments, the compositions and methods disclosed herein use Streptococcus pyogenes Cas9 (SpCas9), or variants thereof, and corresponding gRNAs. SpCas9 variants can include one of the following sets of mutations:

[0064] R1335V / L1111R / D1135V / G1218R / E1219F / A1322R / T1337R (SpCas9-NG variant); DI 135V / R1335Q / T1337R (VQR variant); DI 135V / G1218R / R1335Q.T1337R (VRQR variant); DI 135E / R1335Q / T1337R (EQR variant); or DI 135V / G1218R / R1335E / T1337R (VRER variant). In some embodiments, the compositions and methods disclosed herein use Staphylococcus lugdunensis Cas9 (SlugCas9), or variants thereof, and corresponding gRNAs. SlugCas9 variants can include one of the following sets of mutations: R247A / N415A / T421A / R656A (SlugCas9-HF variant); or Q782R / S888R / L906R / N984S / E1012K / K1016I (SlugCas9-NNG variant) (Hu et al., Nucleic Acids Res 45, 4008-4019 (2021); Qi et al., Nat Chem Biol 20, 344-352 (2024)).

[0065] In some embodiments, the compositions and methods disclosed herein use Staphylococcus auricularis Cas9 (SauriCas9), or variants thereof, and corresponding gRNAs. SauriCas9 variants can include the following mutations or sets of mutations: Q788K / Y973K / R1020H (SauriCas9-KKH variant); N269D (SauriCas9-HFl); or D270N (SauriCas9-HF2) (Wei et al., FASEB J 37, e23060 (2023); Hu et al., PLOS Biol 18, e3000686 (2020)).

[0066] In some embodiments, the compositions and methods disclosed herein use a nuclease from Acidibacillus sulfuroxidans (AsCas), or variants thereof, including AsCasl2fl and AsCasl2a (Wu et al., Nat Chem Biol 17, 1132-1138 (2021); Hino et al., Cell 186, 4920-4935 (2023)).

[0067] Guide RNAs

[0068] The genome editing compositions disclosed herein include a guide polynucleotide. In some embodiments, the guide polynucleotide is a guide RNA that directs a RNA-guided nuclease (e.g., a Cas9 nuclease) to a target DNA (i.e., protospacer). RNA-guided nucleases, such as Cas9 nucleases, recognize a short motif (2-6 base pair sequence), called the PAM or protospacer adjacent motif. The PAM immediately follows the protospacer sequence and helps distinguish self versus non-self. The segment of DNA containing the protospacer and the PAM is sometimes referred to as the “target sequence”.

[0069] In some embodiments, the guide polynucleotide is at least one single guide RNA ("sgRNA" or "gRNA"). A guide polynucleotide can be DNA. A guide polynucleotide can be RNA. In some embodiments, the guide polynucleotide comprises natural nucleotides (e.g., adenosine). In some embodiments, the guide polynucleotide comprises non-natural (or unnatural) nucleotides (e.g., peptide nucleic acid or nucleotide analogs). In some embodiments, the guide nucleic acid sequence can be at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The guide nucleic acid can be between 10-30 nucleotides in length, or between 15-25 nucleotides in length, or between 15-20 nucleotides in length.

[0070] The guide RNAs, e.g., sgRNAs, used in the disclosed methods and compositions targets the P2RX2 locus. Exemplary human P2RX2 gene protospacer sequences that can serve as the target DNA for the sgRNA are shown in Table 1 at SEQ ID NOs: 1-25. Protospacer sequences useful in the guide RNA compositions and methods described herein are shown in Table 1 and throughout the application.

[0071] In some embodiments, the degree of complementarity between the gRNA sequence and the protospacer in the target gene e.g., the P2RX2 gene) can be at least about 95%, about 96%, about 97%, about 98%, about 99%, or 100%. Preferably, the complementarity between the gRNA sequence and the protospacer in the target gene is 100%.

[0072] In some embodiments, the gRNA (e.g., sgRNA) is from 15-100 nucleotides long (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long).

[0073] Any of the gRNAs disclosed herein, including any of the sgRNAs, can be modified or unmodified. In some embodiments, the gRNA can include one or more modified nucleotides and / or modified backbones. In some embodiments, a modified gRNA such as an sgRNA can comprise one or more 2'-O-methyl phosphorothioate nucleotides, which can be located at either the 5’ end, the 3’ end, or both.

[0074] Table 1 provides exemplary sequences for the protospacer sequence in the P2RX2 gene.

[0075] Table 1 - Exemplary protospacer and PAM sequences in the P2RX2 gene

[0076] AAV Delivery Systems

[0077] The methods include delivery of a CRISPR / Cas9 genome editing system, including a nucleic acid-guided nuclease and one or more guide RNAs, to a subject in need thereof. The delivery methods can include, e.g., viral delivery, preferably using an adeno-associated virus (AAV) vector that encodes the nucleic acid-guided nuclease and one or more guide RNA(s). AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review, see Muzyczka et al., Curr. Topics in Micro and Immunol.158:97-129 (1992)). AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo. AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther. 2009 Aug; 11(4): 442-447; Asokan et al., Mol Ther. 2012 April; 20(4): 699-708. AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression. For example, AAV2, AAV5, AAV2 / 5, AAV2 / 8 and AAV2 / 7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al., Vision Research 2008, 48(3):377-385; Khani et al., Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3954-61; Allocca et al., I. Virol. 2007 81(20): 11372-11380). In some embodiments, the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in PCT / US2014 / 060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT / US2014 / 060163, and a nucleic acid-guided nuclease sequence and guide RNA sequence as described herein. In some embodiments, the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc8OL33; Anc80L36; or Anc80L44. In some embodiments, the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018 / 026976. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting. Modifications of these sequences are known in the art, or will be evident to skilled artisans, and are thus included in the scope of this disclosure.

[0078] The approaches described herein include the use of retroviral vectors, adenovirus-derived vectors, and / or adeno-associated viral vectors as recombinant gene delivery systems for the transfer of exogenous genes in vivo, particularly into humans. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14, and other standard laboratory manuals.

[0079] In certain embodiments, an adenovirus can be used in accordance with the methods described herein. The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Ad2, Ad3, Ad7 etc.) are known to those skilled in the art. Recombinant adenoviruses can be advantageous in certain circumstances in that they are not capable of infecting nondividing cells and can be used to infect a wide variety of cell types, including epithelial cells Furthermore, the virus particle is relatively stable and amenable to purification and concentration, and as above, can be modified so as to affect the spectrum of infectivity. Additionally, introduced adenoviral DNA (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situ where introduced DNA becomes integrated into the host genome (c.g, retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors.

[0080] Adeno-associated virus is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. It is also one of the few viruses that may integrate its DNA into nondividing cells and exhibits a high frequency of stable integration.

[0081] Expression of the nucleic acid-guided nuclease, e.g., Cas9, spCas9, scCas9++, LZ3 Cas9, KKH-saCas9 or sauriCas9, can be driven by a promoter known in the art. In some embodiments, expression of the nuclease is driven by a cytomegalovirus (CMV) promoter. Modifications of the promoter sequence may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure.

[0082] Expression of the gRNAs in the AAV vector is driven by a promoter known in the art. In some embodiments, a polymerase III promoter, such as a human U6 promoter. An exemplary U6 promoter sequence is presented below: AAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGA TACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTA GTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAA TTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCT TGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 74).

[0083] In some embodiments, the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with one of the nucleic acids or AAV vectors recited above.

[0084] The AAV genomes described above can be packaged into AAV capsids (for example, AAV5 capsids), which capsids can be included in compositions (such as pharmaceutical compositions) and / or administered to subjects. An exemplary pharmaceutical composition comprising an AAV capsid according to this disclosure can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants (e.g., Tween 20) and / or a thermosensitive or reverse-thermosensitive polymer (e.g., pluronic). Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described here.

[0085] Compositions comprising AAV vectors according to this disclosure can be administered to subjects by any suitable means, including without limitation injection, for example, injection through the round window. The concentration of AAV vector within the composition is selected to ensure, among other things, that a sufficient AAV dose is administered to the inner ear of the subject, taking account of dead volume within the injection apparatus and the relatively limited volume that can be safely administered. Suitable doses may include, for example, IxlO11viral genomes (vg) / mL, 2xlOnviral genomes (vg) / mL, 3xl0nviral genomes (vg) / mL, 4xlOnviral genomes (vg) / mL, 5xl0nviral genomes (vg) / mL, 6xlOnviral genomes (vg) / mL, 7xlOnviral genomes (vg) / mL, 8xl0nviral genomes (vg) / mL, 9xlOnviral genomes (vg) / mL, IxlO12vg / mL, 2xl012viral genomes (vg) / mL, 3xl012viral genomes (vg) / mL, 4xl012viral genomes (vg) / mL, 5xl012viral genomes (vg) / mL, 6xl012viral genomes (vg) / mL, 7xl012viral genomes (vg) / mL, 8xl012viral genomes (vg) / mL, 9xl012viral genomes (vg) / mL, IxlO13vg / mL, 2xl013viral genomes (vg) / mL, 3xl013viral genomes (vg) / mL, 4xl013viral genomes (vg) / mL, 5xl013viral genomes (vg) / mL, 6xl013viral genomes (vg) / mL, 7xl013viral genomes (vg) / mL, 8xl013viral genomes (vg) / mL, or 9xl013viral genomes (vg) / mL. Any suitable volume of the composition may be delivered to the cochlear space. In some instances, the volume is selected to form a bleb in the cochlear space, for example 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, etc.

[0086] For delivery to the inner ear, injection to the cochlear duct, which is fdled with high potassium endolymph fluid, can provide direct access to hair cells. However, alterations to this delicate fluid environment may disrupt the endocochlear potential, heightening the risk for injection-related toxicity. The perilymph-fdled spaces surrounding the cochlear duct, scala tympani and scala vestibuli, can be accessed from the middle ear, either through the oval or round window membrane (RWM). The RWM, which is the only non-bony opening into the inner ear, is relatively easily accessible in many animal models and administration of viral vector using this route is well-tolerated. Administration through the oval window or across the tympanic membrane can also be used. See, e.g., W02017100791 and US7206639.

[0087] In certain embodiments, delivery of the compositions disclosed herein may occur by use of liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, optionally mixing with cell penetrating polypeptides, and the like, for the introduction of the compositions of the present invention into suitable host cells. In particular, the compositions of the present invention may be formulated for delivery either encapsulated in a lipid particle, a liposome, a vesicle, a nanosphere, a nanoparticle or the like. The formulation and use of such delivery vehicles can be carried out using known and conventional techniques.

[0088] For pre-clinical development purposes, systems, compositions, nucleotides and vectors according to this disclosure can be evaluated in vitro using a human or mouse engineered cell lines, ex vivo using a cochlear explant system, or in vivo using an animal model such as a mouse, rabbit, pig, nonhuman primate, etc. Cochlear explants are optionally maintained on a support matrix, and AAV vectors can be delivered by injection. Tissue for cochlear explanation can be obtained from human or animal subjects, for example mouse. Explants, or cells derived from inner organs of animal models, are particularly useful for studying the expression of gRNAs and / or Cas9 following viral transduction, and for studying genome editing over comparatively short intervals. These models also permit higher throughput than may be possible in animal models and can be predictive of expression and genome editing in animal models and subjects. Small (mouse, rat) and large animal models (such as rabbit, pig, nonhuman primate) can be used for pharmacological and / or toxicological studies and for testing the systems, nucleotides, vectors and compositions of this disclosure under conditions and at volumes that approximate those that will be used in clinic. Because model systems are selected to recapitulate relevant aspects of human anatomy and / or physiology, the data obtained in these systems will generally (though not necessarily) be predictive of the behavior of AAV vectors and compositions according to this disclosure in human and animal subjects.

[0089] Nanoparticles

[0090] In some embodiments, the prime editing polynucleotides as disclosed herein for delivery to a target tissue in vivo are encapsulated or associated with in a nanoparticle. Methods for nanoparticle packaging are well known in the art, and are described, for example, in Bose S, et al (Role of Nucleolin in Human Parainfluenza Virus Type 3 Infection of Human Lung Epithelial Cells. J. Virol. 78:8146. 2004); Dong Y et al. Poly(d,14actide-co-glycolide) / montmorillonite nanoparticles for oral delivery of anticancer drugs. Biomaterials 26:6068. 2005); Lobenberg R. et al (Improved body distribution of 14C-labelled AZT bound to nanoparticles in rats determined by radioluminography. J Drug Target 5: 171.1998); Sakuma S R et al (Mucoadhesion of polystyrene nanoparticles having surface hydrophilic polymeric chains in the gastrointestinal tract. Int J Pharm 177:161. 1999); Virovic L et al. Novel delivery methods for treatment of viral hepatitis: an update. Expert Opin Drug Deliv 2:707.2005); and Zimmermann E et al, Electrolyte- and pH-stabilities of aqueous solid lipid nanoparticle (SLN) dispersions in artificial gastrointestinal media. Eur J Pharm Biopharm 52:203. 2001). In some embodiments, one or more polynucleotides is delivered to a target tissue in vivo in a vesicle, e.g., a liposome (see Langer, Science 249: 1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid). In some embodiments, lipid-based nanoparticles (LNP) are used; see, e.g., Robinson et al., Mol Then 2018 Aug 1 ;26(8):2034-2046;

[0091] US9956271B2.

[0092] The present methods and compositions can include microvesicles or a preparation thereof that contains one or more therapeutic molecules, e.g., PE RNPs, or polynucleotides or RNA encoding a PE system, as described herein. “Microvesicles”, as the term is used herein, refers to membrane-derived microvesicles, which includes a range of extracellular vesicles, including exosomes, microparticles and shed microvesicles secreted by many cell types under both normal physiological and pathological conditions. See, e.g., EP2010663BE The methods and compositions described herein can be applied to microvesicles of all sizes. In some embodiments, the microvesicles are 30 to 200 nm, 30 to 800 nm, or up to 2 um. The methods and compositions described herein can also be more broadly applied to all extracellular vesicles, a term which encompasses exosomes, shed microvesicles, oncosomes, ectosomes, and retroviral- like particles. Such a microvesicle or preparation is produced by the herein described methods. As the term is used herein, a microvesicle preparation refers to a population of microvesicles obtained / prepared from the same cellular source. Such a preparation is generated, for example, in vitro, by culturing cells expressing the nucleic acid molecule of the instant invention and isolating microvesicles produced by the cells. Methods of isolating such microvesicles are known in the art (Thery et al., Isolation and characterization of exosomes from cell culture supernatants and biological fluids, in Current Protocols Cell Biology, Chapter 3, 322, (John Wiley, 2006); Palmisano et al., (Mol Cell Proteomics. 2012 August; 11 (8):230-43) and Waldenstrom et al., ((2012) PLoS ONE 7(4): e34653)).

[0093] Methods of Treatment

[0094] The methods described herein include methods for the treatment of disorders associated with mutations in the P2RX2 gene.

[0095] In some embodiments, the disorder is autosomal dominant progressive nonsyndromic allfrequency hearing loss, e.g., DFNA41. Subjects with DFNA41 typically have delayed-onset sensorineural progressive hearing loss of all frequencies, with progressive hearing loss and hypervulnerability to noise-induced hearing loss as the only clinical feature (i.e., nonsyndromic). Age of onset is typically around 12 years of age, with initial hearing loss being mild and progressing to severe or profound by the seventh decade of life. Generally, the methods of treatment disclosed herein include administering a therapeutically effective amount of a genome editing system as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment. The term "genome editing system" refers to any system having RNA-guided DNA editing activity. Genome editing systems of the present disclosure include at least two components adapted from naturally occurring CRISPR systems: a gRNA and an RNA- guided nuclease. These two components form a complex that is capable of associating with a specific nucleic acid sequence in a cell and editing the DNA in or around that nucleic acid sequence, for example by making one or more of a single-strand break (an SSB or nick), a double-strand break (a DSB) and / or a base substitution. See, e.g., WO2018 / 026976 for a description of exemplary genome editing systems.

[0096] As used in this context, to “treat” means to ameliorate at least one symptom of the disorder associated with a mutation of the P2RX2 gene. Often, these mutations result in progressive nonsyndromic hearing loss; thus, a treatment comprising administration of a therapeutic gene editing system as described herein can result in a reduction in hearing impairment; a reduction in the rate of progression of hearing loss; and / or a return or approach to normal hearing. A treatment comprising administration of a therapeutic gene editing system as described herein can also result in reduced sensitivity to noise-induced hearing loss and improved vestibular function. Hearing can be tested using known methods, e.g., audiology testing.

[0097] The methods can be used to treat any subject (e.g., a mammalian subject, preferably a human subject) who has a mutation of the P2RX2 gene. The therapeutic gene editing system as described herein can disrupt the mutant allele associated with the disease. As used herein, an “allele” is one of a pair or series of genetic variants of a polymorphism (also referred to as a mutation) at a specific genomic location. As used herein, “genotype” refers to the diploid combination of alleles for a given genetic polymorphism. A homozygous subject carries two copies of the same allele and a heterozygous subject carries two different alleles. Methods for identifying subjects with such mutations are known in the art; see, e.g., Yan et al., J Hum Genet. 2009 Dec; 54(12): 732-738; Leroy et al., Exp Eye Res. 2001 May;72(5):503-9; or Consugar et al., Genet Med. 2015 Apr;17(4):253-261. For example, gel electrophoresis, capillary electrophoresis, size exclusion chromatography, sequencing, and / or arrays can be used to detect the presence or absence of the allele or genotype. Amplification of nucleic acids, where desirable, can be accomplished using methods known in the art, e.g., PCR. Tn one example, a sample (e.g., a sample comprising genomic DNA), is obtained from a subject. The DNAin the sample is then examined to identify or detect the presence of an allele or genotype as described herein. The allele or genotype can be identified or determined by any method described herein, e.g., by Sanger sequencing or Next Generation Sequencing (NGS). Other methods can include hybridization of the gene in the genomic DNA, RNA, or cDNAto a nucleic acid probe, e.g., a DNA probe (which includes cDNA and oligonucleotide probes) or an RNA probe. The nucleic acid probe can be designed to specifically or preferentially hybridize with a particular mutation (also referred to as a polymorphic variant).

[0098] Other methods of nucleic acid analysis can include direct manual sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81 : 1991-1995 (1988); Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977); Beavis et al., U.S. Pat. No. 5,288,644); automated fluorescent sequencing; single-stranded conformation polymorphism assays (SSCP) (Schafer et al., Nat. Biotechnol. 15:33-39 (1995)); clamped denaturing gel electrophoresis (CDGE); two-dimensional gel electrophoresis (2DGE or TDGE); conformational sensitive gel electrophoresis (CSGE); denaturing gradient gel electrophoresis (DGGE) (Sheffield et al., Proc. Natl. Acad. Sci. USA 86:232-236 (1989)); denaturing high performance liquid chromatography (DHPLC, Underhill et al., Genome Res. 7:996-1005 (1997)); infrared matrix-assisted laser desorption / ionization (IR- MALDI) mass spectrometry (WO 99 / 57318); mobility shift analysis (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766-2770 (1989)); restriction enzyme analysis (Flavell et al., Cell 15:25 (1978); Geever et al., Proc. Natl. Acad. Sci. USA 78:5081 (1981)); quantitative real-time PCR (Raca et al., Genet Test 8(4):387-94 (2004)); heteroduplex analysis; chemical mismatch cleavage (CMC) (Cotton et al., Proc. Natl. Acad. Sci. USA 85:4397-4401 (1985)); RNase protection assays (Myers et al., Science 230: 1242 (1985)); use of polypeptides that recognize nucleotide mismatches, e.g., E. coli mutS protein; allele-specific PCR, and combinations of such methods. See, e.g., Gerber et al., U.S. Patent Publication No. 2004 / 0014095 which is incorporated herein by reference in its entirety.

[0099] In certain aspects, the present disclosure provides AAV vectors encoding CRISPR / Cas9 genome editing systems and provides the use of such vectors to treat P2RX2-associated disease. Exemplary AAV vector genomes are described in WO2019 / 183641, which illustrates certain fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or more gRNA sequences and promoter sequences to drive their expression, a nuclease coding sequence and another promoter to drive its expression (an exemplary construct for use in the methods described herein could include, for example 2 gRNA or only 1 gRNA and U6). Each of these elements is discussed in detail herein. A single vector can be used to deliver a Cas9 and one or more gRNAs, or a plurality of vectors can be used, e.g., wherein one vector is used to deliver Cas9, and another vector or vectors is used to deliver one or more gRNAs (e.g., one vector for one gRNA, one vector for two gRNAs, one vector for three gRNAs, or three vectors for each of three gRNAs). Other arrangements are also possible, including splitting the Cas9 across two AAV.

[0100] In some embodiments, the nucleic acid compositions described herein, that include a gRNA and a nucleic acid encoding an RNA-guided nuclease encoded on one or more vectors, are formulated in or administered via a lipid nanoparticle (LNP); see e g., WO2017173054A1 and WO2019067992A1, the contents of which are hereby incorporated by reference in their entireties. Any LNP known to those of skill in the art to be capable of delivering nucleotides to subjects may be utilized with the guide RNAs described herein and the nucleic acid encoding an RNA-guided nuclease.

[0101] In some embodiments, the guide RNA and the nucleic acid encoding an RNA-guided nuclease are administered in an LNP described herein, such as an LNP that includes a CCD lipid (e.g., an amine lipid, such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid, such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0102] Disclosed herein are various embodiments of LNP formulations for RNAs, including CRISPR / Cas cargoes. Such LNP formulations may include (i) a CCD lipid, such as an amine lipid, (ii) a neutral lipid, (iii) a helper lipid, and (iv) a stealth lipid, such as a PEG lipid. Some embodiments of the LNP formulations include an amine lipid, along with a helper lipid, a neutral lipid, and a stealth lipid such as a PEG lipid. In some embodiments, the LNP formulations include less than 1 percent neutral phospholipid. In some embodiments, the LNP formulations include less than 0.5 percent neutral phospholipid. A “lipid nanoparticle” could be a particle that comprises a plurality of (i.e. more than one) lipid molecules physically associated with each other by intermolecular forces. CCD Lipids, Amine Lipids, Neutral Lipids, and other lipids that can be used in the LNP formulations disclosed herein are described in W02020198697, WO2015006747, WO2016118724, and WO2021026358, each of which is incorporated herein in its entirety.

[0103] Further technologies that can be used for delivery of the compositions of this disclosure include those that utilize encapsulation by biodegradable polymers, liposomes, or nanoparticles. In some embodiments, the compositions of this disclosure are administered in any suitable delivery vehicle, including, but not limited to, polymers, engineered viral particles (e.g., adeno- associated virus), exosomes, liposomes, supercharged proteins, implantable devices, or red blood cells. Suitable delivery methods are described in US10851357, US10709797, and US20170349914, each of which is incorporated herein in its entirety.

[0104] EXAMPLES

[0105] The compositions and methods disclosed herein are further described in the following examples, which do not limit the scope of the claims.

[0106] Methods

[0107] The following materials and methods were used in the following examples.

[0108] Mice

[0109] P2rx2V61L / +mice were maintained on a CBA / J background. A female mouse carrying a P2rx2 c.179 G>C (p.F6 / / .) was used for colony expansion by mating with a wild-type P2rx2+ / +male mouse, as described elsewhere (50). The mice were housed in groups of five or two per cage on a 12:12 hour light-dark cycle. Mice were allowed free access to food and water. All the animals were maintained under standard conditions with room temperature range 22 ± 2°C and humidity range 55 ± 10%. All procedures were performed in accordance with NIH guidelines for use and care of laboratory animals and were approved by the Massachusetts Eye & Ear IACUC committee (protocol no. #2022N000065).

[0110] Plasmid construction

[0111] U6-sgRNA sequence and SaCas9 (Addgene 61591) (76) cDNA was acquired. Vectors for in vitro screening were constructed via Gibson assembly (NEB, E261 IS) based on pMax-SpCas9 (77, 78). AAV vectors were based on PX601 (Addgene 61591) (76). Plasmids encoding recombinant AAV (rAAV) genomes were cloned by Gibson assembly. All plasmids were purified using Plasmid Plus Miniprep or Maxiprep kits (Qiagen).

[0112] AA V production

[0113] AAV plasmids containing “CMV-SaCas9-PA” cassette, “U6-sgRNA-l”, or “U6-sgCtrl” cassette were sequenced before packaging into AAV2 / 2. AAV vectors were produced by Mass Eye and Ear Infirmary (MEEI) vector core (Boston, MA, USA). Vector titer was 4.46x 1012vg / ml for AAV2-SaCas9 / sgRNA-l as determined by qPCR specific for the inverted terminal repeat of the virus.

[0114] Isolation and culture of Primary Fibroblast from Mice

[0115] P2rx2V61L / +and wild type mice were euthanized and cleaned with 70% ethanol. The dorsal skin (~1 cm diameter) of the mice was collected and rinsed with DPBS and subcutaneous fat was removed by forceps. Subsequently, the samples were cut into small fragments and incubated with Dispase II (Sigma-Aldrich, USA) overnight at 4°C. The dermal layers of the skin were separated and further subjected to incubation with type I collagenase (1 mg / ml Gibco, USA) for 2 hours at 37°C. The resulting cell suspension was strained using a 40-micron strainer and centrifuged at 950 rpm to obtain the cell pellet. The cell pellet was seeded in T-75 flask containing DMEM high glucose media (Gibco, USA) containing 10 % FBS (Gibco, USA). Fibroblasts were cultured for about 2-3 days to reach -90% confluence and then passaged in T75 flasks with TrypLE Express and cultured in DMEM: F12 medium (ThermoFisher) with 10% fetal bovine serum (FBS) supplemented with GlutaMax (ThermoFisher).

[0116] Construction of P2rx2 V61L cell line using PiggyBac

[0117] Mouse P2rx2 V61L fragment harboring the +14C>A mutation was amplified by PCR from P2rx2V61L / V61Lmouse genomic DNA and cloned into the PiggyBac donor backbone (PB- CAG-mNeonGreen-P2A-BSD-polyA) using Gibson Assembly. The PB donor plasmid was cotransfected with PiggyBac transposon vector (PB210PA, System Biosciences) into HEI-OC1 cells. Cells were cultured and selected in the medium containing 10 pg / mL blasticidin for 2 weeks. Human P2rx2 V60L fragment mutation was cloned into the same PiggyBac donor backbone using Gibson Assembly. PCR and sequencing analysis confirmed successful insertion. Genome editing in vitro

[0118] For transfection of fibroblasts, neucleofection was performed using LONZA 4D- Nucleofector. Cells were digested by Trypsin-EDTA (0.05%) (Thermo Fisher) and further dispersed into single cells. 100,000 cells were resuspended in 20pl P3 reagent of the P3 Primary Cell 4D-Nucleofector® X Kit S (Lonza V4XP-3032) and nucleofected by program EH-100. Cells were treated with puromycin 24 hours later for 2 days. Four days after the nucleofection, genomic DNA was collected using QuickExtract™ DNA Extraction Solution (Lucigen). Genomic PCR was carried out using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S). Purified PCR products were used for next generation sequencing (NGS). Individual SEQ files were analyzed by CRISPResso2 (crispresso.pinellolab.org / submission) (79). The sgRNA and PAM sequences can be found in Table 2.

[0119] Table 2 - sgRNA Sequences

[0120] Hair cells isolation and NGS analysis

[0121] Cochlea were harvested with the sensory epithelia dissociated using needles under the microscope (Axiovert 200M, Carl Zeiss). Inner ear tissue was immersed in 1 pM FM 1-43FX (ThermoFisher, F35355) for 15 seconds at room temperature in the dark and then washed by DPBS. The sensory epithelia were treated with 100 pl 0.05% trypsin-EDTA (ThermoFisher, 25300054) for 20 minutes. During incubation, tissue was carefully dispersed into small or single cell clusters using a 200pl Eppendorf pipette tip. Cells were then transferred into a 10 mm culture dish and placed under a fluorescent microscope (ZEISS) equipped with a camera. Cells with FM 1-43FX dye were collected by a 1 Opl Eppendorf pipette tip. About 300 cells were collected from single cochlea. Hair cells were transferred into a PCR tube and lysed by 5 pl QuickExtract™ DNA Extraction Solution (Lucigen) to extract the genomic DNA. All 5pl of the cell lysis were used for each Genomic PCR amplification using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S). PCR program was 1 cycle: 98°C 5 minutes; 42 cycles: 98°C 15 seconds, 60°C 20 seconds, 72°C 10 seconds; 1 cycle: 72°C 4 minutes; 4°C. PCR product visualization, purification, and NGS analysis were the same as described above.

[0122] RNA isolation and qRT-PCR

[0123] Total RNA was extracted from inner ear tissue using the ReliaPrep RNA Tissue Miniprep System (Promega, z6111). Then first-strand cDNA was produced using ProtoScript® II First Strand cDNA Synthesis Kit (NEB, E6560s). Real time quantitative PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, 4368708) on the ABI QuantStudio 3 Flex Real-Time PCR System (Applied Biosystems).

[0124] A A E vector integration assay

[0125] HEK 293T-P2rx2-V61L cells were treated with AAV2-CMV-SaCas9-sgRNA-l of different dosages from 1 to 105genomic copies per cell. Cells were collected 7 days later, and genomic DNA was isolated. Primers Pl-F / ITR-R were used for detecting AAV vector integration. For in vivo integration detection, Primers P1-F / P2-R and primers Pl-F / ITR-R were used to amply genomic fragments from isolated hair cells and PCR products were merged for NGS analysis. Related primers are listed in Table 3.

[0126] Table 3 - Primers

[0127] Off-target analysis

[0128] To identify off-target sites, CIRCLE-seq was used. Briefly, 50 ig genomic DNA was purified from HEI-OC1 cells. Genomic DNA was sheared using Tn5 and circularized. In vitro cleavage reaction of circularized genomic DNA is performed with SaCas9 protein (Synthego)ZsgRNA-l. Sequencing libraries were prepared and sequenced on an Illumina Miseq. Off-target sites were identified with a standard pipeline. Negative control samples were treated with Cas9 alone to assess background.

[0129] All 7 potential off-target sites (Table 4) were identified by the cutting frequency determination (CFD) score (42). PCR primers were designed for the two flanks of each sgRNA target sequence for amplifying 250-280 bp DNA fragments. Amplified fragments were purified for NGS to identify whether there was any off-target mutation. Primers are listed in Table 5.

[0130] Table 4 - Potential Off-Target Sites

[0131] Table 5 - Potential Off-Target Site Primers

[0132] In vivo surgery

[0133] Round window membrane injection with canal fenestration (RWM+CF) was performed in mice at Pl 4 or P28. The mice were anesthetized using intraperitoneal injections of ketamine (100 mg / kg) and xylazine (10 mg / kg). The post-auricular area hair was shaved and disinfected with 10% povidone-iodine and 70% ethanol three times, respectively. The AAV2-SaCas9- sgRNA-1 was injected into the inner ears of P2rx2l 6i!- ' or P2rx2+ / +mice. The AAV2-GFP was injected into the inner ears of P2rx2V6,L / +mice. Each cochlea was injected with 1-1.2 pL virus in total.

[0134] Confocal immunofluorescence

[0135] Cochlea was extracted and perfused with 4% paraformaldehyde, post-fixed for 12 hours at 4°C, decalcified in 0.12M EDTA for 48 hours, dissected into two to three pieces spanning cochlear regions from apex to base, and stained with antibodies against C-terminal binding protein 2 (mouse anti-CtBP2, 1 :200, BD Biosciences) and myosin 7a (rabbit anti-myosin7a, 1 : 100, Proteus Biosciences) followed by appropriate secondary antibodies coupled to Alexa fluor (1: 1000). Confocal Z-stacks of selected regions from each sample were obtained using high-N.A. objectives and 2x digital zoom. Two adjacent z-stacks were obtained at each frequency location, spanning the IHC cuticular plate to the synaptic pole using a lOOx objective (N.A. 1.4) at 2x digital zoom with a z-step increment of 0.30 pm.

[0136] Scanning electron microscopy

[0137] Following euthanasia, the temporal bones of mice were carefully separated from the surrounding skull base. Small holes were created in the round window and oval window membranes to ensure optimal fixation, and a small apical piece of bone near the helicotrema was removed. The cochleae were then immersed in a solution of 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer supplemented with 20 mM CaC12 for 60 minutes at room temperature or overnight at 4°C. After fixation, the cochleae were washed with distilled water and subjected to decalcification for 24-48 hours using 120 mM EDTA at pH 7.4. Subsequently, the cochleae were rinsed again in distilled water, and sections of the organ of Corti were carefully microdissected from the surrounding supporting tissue and bone. To prepare the tissues for analysis, a gradual ethanol series from 50% to 100% was used for dehydration. The dehydrated tissues were placed in a critical point dryer (Tousimis 931) and mounted on double-sided conductive carbon tape. A thin layer of platinum (approximately 5 nm) was coated onto the tissues using a Leica ACE600 system. Samples were examined using a Hitachi S-4700 scanning electron microscope, utilizing a 5.0-kV accelerating voltage in the Harvard Medical School Imaging and Analysis Core to capture the images.

[0138] Auditory brainstem responses / DPOAE measurement

[0139] Auditory brainstem responses (ABRs) and distortion product optoacoustic emissions (DPOAEs) were recorded to test auditory ability. ABRs were recorded to tone pips from 5.66, 8.00, 11.32, 16.00, 22.60, 32.00, 45.24 kHz with 5 millisecond duration and 0.5 millisecond cos2rise-fall, presented with polarity alternating (512 sweeps each), followed by averaging. ABR threshold was defined by visual inspection of stacked waveforms under the test condition from 20 to 100 dB in 5-10dB steps. ABR wave 1 amplitudes were extracted and analyzed by a semiautomated algorithm. Subsets of cases were analyzed by a second investigator that was blind to experimental treatment. DPOAEs were recorded in response to fl and f2, which f2 equal to ABR test frequencies, and f2 / fl=l .2, Ll=L2+10dB, in steps of 5dB. The DPOAE at 2fl-f2 was extracted from the ear canal sound pressure and iso-response contours were constructed from response amplitude vs. sound level data. Threshold was computed by interpolation as the f2 producing a DPOAE of 5dB SPL.

[0140] Noise exposure

[0141] Awake mice were placed in a small wire mesh cage without restraints directly below the acoustic horn in a reverberant exposure chamber with a sound delivery loudspeaker. 97 dB SPL for 2 hours with 1-20 kHz noise band was delivered. The calibration was processed before each exposure session. The variation of sound level was within 1-1.5dB.

[0142] Vestibular test

[0143] For the open-field test, awake mice were placed in a square 38cm x 38cm arena, inside a sound chamber with overhead LED lighting, inside a dimmed room. The mice were tested one at each time inside the square open field and allowed to explore for 3 minutes. Behavior was recorded by Canon Camera (EOS R5) and tracking videos were analyzed by Ethovision XT to measure the traveled distance and velocity. Traveled distance was measured in centimeters. Videos were recorded at 08:00 - 17:00 to ensure mice adapted to their new environment. Open- field assessments were all conducted blind. The same tester conducted all the experiments during the day.

[0144] For the rotarod test, mice were placed on a rod that rotated at 5 rpm for 5 minutes to familiarize the mouse with the equipment. The next day, the animals were placed on the rods for a total of 5 trials. A 3 minute resting period was imposed between trials. The same tester conducted all the experiments during the day. The time length the animals could remain on the rod before dropping off was recorded for each ran.

[0145] Statistical analysis

[0146] Statistical analysis was performed by Prism 10 software (GraphPad, San Diego, CA). Data are presented as mean ± SEM / SD. P-values < 0.05 were considered statistically significant. All group sizes, statistical tests, and P values were reported in the figures or the Fig. legends. Asterisks were marked as, *p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.

[0147] EXAMPLE 1: Screening of genome editors for P2rx2V61Lallele-specific editing

[0148] In order to identify the most effective genome editor for targeting the P2rx2V61Lallele, sgRNAs were designed for use with Staphylococcus aureus Cas9 (SaCas9) (sgRNAl) and Streptococcus pyogenes Cas9 (SpCas9) (sgRNA2 - sgRNA5) nucleases (Fig. 1 A). All Cas9 / sgRNA combinations were incorporated into the same plasmid backbone containing three nuclear localization signals (NLSs) and optimized sgRNA scaffold (40) (Fig. IB). The Cas9 / sgRNA plasmids and a puromycin resistance plasmid were co-transfected into the primary fibroblasts derived from P2rx2l 61L / +mice by nucleofection. The puromycin resistant cells were collected for DNA extraction, amplicon amplification, and analysis by next-generation sequencing (NGS) for InDei identification (Fig. 1C).

[0149] In primary fibroblasts, efficient editing shown by InDei reads was detected in the P2rx2V6ILallele across all the gRNA designs of SpCas9 and SaCas9, ranging from 71.28% to 83.29% (Fig. ID). For SpCas9 sgRNAs (sgRNA-2, -3, -4 and -5), elevated levels of InDeis were detected in wildtype (WT) P2rx2+allele (8.73%-29.20%) (Figs. ID and 2A-2B) indicating the occurrence of undesired off-target editing on the WT allele. The findings suggested that SpCas9 / sgRNAs can tolerate one nucleotide mismatch between the P2rx2V61Lallele and the WT allele, making it unsuitable for allele-specific genome editing. In contrast, NGS analysis of SaCas9 / sgRNA-l revealed a high level of InDei formation in the P2rx2V61Lallele (75.01±4.55%) (Fig. 1D-1E), with negligible InDeis observed in the WT allele (0.45±0.39%) (Figs. ID and IF), indicating P2rx2V6ILallele-specific editing. For SaCas9 / sgRNA-l -mediated editing, the NGS showed different types of InDeis, with single nucleotide deletions being the most common type (Fig. 1G). 85.1% of the InDeis cause frameshift effect (Fig. 1H), suggesting efficient abolishment of P2rx2V61Lprotein by SaCas9 / sgRNA-l.

[0150] To assess the editing efficiency and specificity in the cochlear cells, a mouse organ of Corti cell line, HEI-OC-1, was used to generate HEI-OCl-P2rx2-V61L cells (0C1-V61L) that harbored the P2rx2V61LDNA fragment in the genome using the PiggyBAC system (Fig. 2C). NGS analysis of HEI-0C1-V61L cells following transfection with SaCas9 / sgRNA-l or SpCas9 / sgRNA-2 plasmids revealed similar robust InDei formations. In the HEI-0C1 cells with the WT P2rx2 allele, SpCas9 / sgRNA-2 mediated editing shown by InDeis was consistent with the findings from the primary fibroblasts (Figs. ID and 2D). In contrast, SaCas9 / sgRNA-l transfection produced negligible editing events in the HE1-0C1 cells with the WT P2rx2 allele (Figs. 2D and 2G). The InDei profile in SaCas9 / sgRNA-l edited HEI-0C1-V61L cells showed various types of InDeis (Figs. 2E-2F), with one nucleotide deletions being the most common type.

[0151] To comprehensively assess off-target editing, CIRCLEseq (41) was performed on HEI- 0C1-V61L cells edited by SaCas9 / sgRNA-l. No off-target sites were identified beyond the on- target locus (Fig. II). Furthermore, computational predictions were used to identify potential off- target loci (42, 43). Analysis of the seven most likely potential off-target hits identified by the cutting frequency determination (CFD) score (42) in SaCas9 / sgRNA-l edited HEI-0C1-V61L cells revealed no off-target editing events and the on-target editing efficiency exceeded 80% (Figs. ID and 2H). Collectively, these results demonstrate that SaCas9 / sgRNA-l specifically targets the P2rx2V61Lallele with minimal off-target effects in mouse primary fibroblasts or a cochlear cell line.

[0152] EXAMPLE 2: In vivo genome editing of the P2rx2V61Lallele in the cochlea of adult mice

[0153] To evaluate the therapeutic potential of SaCas9 / sgRNA-l, SaCas9 / sgRNA-l was packaged into AAV2 and administered to adult P2rx2V6IL / +mouse (4 weeks old) cochlea via the round window membrane with canal fenestration (RWM+CF) at a dose of 4* 109vg per ear. After 8 weeks, the cochleae were harvested and DNA and RNA was extracted for NGS and InDeis analysis (Fig. 3A). In uninjected mice, background InDei frequencies ranged between 0% and 0.05%. In vivo NGS of the cochlea showed the presence of InDeis at the P2rx2V61Llocus in the injected P2rx2V6IL,+ears after 8 weeks with an InDei rate of 2.62 ± 0.64% without editing on the WT allele (Figs. 3B and 3C). AAV2-SaCas9-sgRNA-l was injected to the WT adult mouse cochlea and NGS analysis was performed. No InDeis were detected in the injected WT cochlea (Figs. 3D and 3E). The expression of SaCas9 after cochlear injection was determined by qPCR. The SaCas9 mRNA level peaked around 4 weeks post-injection, followed by a subsequent decline over time (Fig. 3F). By the 12th week post-injection, the expression of SaCas9 was no longer detectable (Fig. 3F). This decrease in expression was potentially attributable to either CMV promoter silencing or an immune response triggered by SaCas9 in adult mice (40, 44-46).

[0154] Given that on-target editing efficiency will directly impact hearing rescue, editing efficiency was measured by changes in the P2rx2 transcripts in the injected P2rx2V6,L / +cochleae. P2rx2 is specifically expressed in the hair cells. NGS analysis was performed for injected and uninjected contralateral control cochlear cDNAs. Multiple InDel-containing P2rx2 transcripts were detected in the injected, but not in the uninjected, control cochleae (Figs. 3G and 3H). Additionally, exon 2 skipping P2rx2 transcripts were detected in the injected cochleae, accounting for 1.46% of the total reads and suggesting that genome editing at the P2rx2V61locus resulted in exon 2 skipping (Fig. 3H). This occurrence was likely due to the cutting site of SaCas9 / sgRNA-l, located at the exon 2 splicing acceptor, which was disabled by the InDeis. Rare alternative splicing transcripts were detected in both uninjected and injected samples, constituting less than 5% of all reads (Figs. 3G and 3H). This suggests that genome editing did not induce changes in the expression pattern of these rare alternative splicing transcripts.

[0155] In comparison to uninjected P2rx2V6IL / +cochleae, a significant decrease in the ratio between unedited P2rx2V6iLtranscripts and WT P2rx2 transcripts was detected in the injected ears (Fig. 31). Upon SaCas9 / sgRNA-l editing targeting the V61L allele, the ratio of unedited P2rx2V6ILtranscripts in the injected ears decreased by 28.2% to 71.2 ± 3.0% relative to the uninjected ears (Fig. 31). These findings support that approximately 28% of TUrx -expressing cells underwent disruption of the V61L mutant allele through genome editing.

[0156] To determine editing efficiency in hair cells, hair cells were isolated using the FM1-43 uptake assay (Fig. 4A). Eight weeks after injection of SaCas9 / sgRNA-l into adult P2rx2V61L / +ears, the cochleae were dissected. Cells were dissociated by Trypsin-EDTA (0.25%) and incubated with FM1-43FX to label hair cells through open mechanotransduction channels (47, 48). Subsequently, the labeled hair cells were collected and lysed to obtain genomic DNA. Genomic DNA was analyzed for InDei frequency by NGS (Fig. 3 J). In contrast to uninjected cochleae, a wider range of InDei types was observed in isolated hair cells (Fig. 3K) with an InDei frequency of 26.96 ± 4.2% in P2rx2V6ILallele (Fig. 31). The editing frequency based on the hair cell DNA InDeis matched that from the P2rx2V61Ltranscript analysis. Furthermore, the combined reads from edited and unedited P2rx2V61Llocus was equal to the P2rx2+reads in the injected ear (Fig. 3M). This finding indicates that no noticeable chromatin rearrangements (e.g., lesion, large deletions or insertions) were caused by genome editing, reinforcing the safety and accuracy of the approach in targeted hair cells.

[0157] AAV integration into the genome as a consequence of induced DNA breaks (45, 49) is a potential safety concern in editing therapy via AAV delivery (Fig. 4B). To study AAV integration at the target locus in inner ear, specific primers for PCR and NGS analysis were designed to detect the integration of P2rx2 and AAV inverted terminal repeats (ITR) (Fig. 4C). AAV integration in the HEK-293T-P2rx2-V61L cells was evaluated after AAV2- SaCas9 / sgRNA-l infection. A low level of P2rx2V6IL- T integration was observed, and the rate of integration was correlated with AAV2-SaCas9 / sgRNA-l dosage (Fig. 4D). At a dosage of 103vg / cell, the on-target editing was near its peak efficiency with virtually no detectable integration (Fig. 4D). At the AAV dosage exceeding 104vg / cell, a P2rx2‘'Z, / / -ITR integration rate of 5.0± 0.2% was detected (Fig. 4D). These findings strongly support that, by optimizing AAV dosage, maximum editing efficiency could be achieved while minimizing AAV integration. It was further confirmed that no integration reads were detected from isolated hair cells from in vivo samples after AAV2-SaCas9 / sgRNA-l injection (Figs. 4E and 4F). Furthermore, qPCR analysis examining P2rx2‘' / / -ITR transcripts revealed no significant change between uninjected and injected animals (Fig. 4G), indicating the absence of P2rx2V61L-ITR chimera transcripts caused by genome editing. Combined, these results demonstrate that AAV2-mediated genome editing at the P2rx2V6ILlocus exhibited negligible AAV integration in the injected mature cochlea and provide a crucial piece of evidence for the safety and specificity of the therapeutic approach.

[0158] EXAMPLE 3: AAV2 transduces cochlear hair cells in adult mice

[0159] AAV2 is a well-established synthetic AAV capsid known for its high transduction efficiency in inner hair cells (IHCs) and outer hair cells (OHCs) in the cochlea with a preferential distribution from apex turn to basal turn (39). Given its effective transduction capabilities, the AAV2 capsid was selected as a vector for genome editing therapy in P2rx2V6IL,+mice.

[0160] To assess the distribution and transduction efficiency, AAV2-GFP with 1x1013vg / ml was injected into the adult cochlea at 4 weeks of age via RWM+CF. The cochleae were harvested two weeks later and whole mount GFP expression in P2rx2V61L / +mice from apical-8kHz, middle- 16kHz, and basal turns-32kHZ was examined (Figs. 5 A and 5B). AAV2-GFP efficiently transduced all IHCs across all the cochlear turns (Fig. 5C) and transduced OHCs with varying efficiencies from the apex to the base (Fig. 5C). Intensity analysis on the GFP signals in the IHCs and OHCs was performed. Overall, a constant high intensity was detected in IHCs throughout the cochlea, whereas half the intensity was seen in the apical OHCs with the intensity decreased to -25% in the basal OHCs compared to IHCs (Fig. 5D). Thus, AAV2 transduces 100% IHCs with robust expression and is less efficient transducing OHCs with lower expression.

[0161] EXAMPLE 4: Adult genome editing therapy preserves auditory function in P2rx2V61L / +mice

[0162] The P2rx2V61L / +mouse model exhibits early-onset hearing loss at 21 -days-old and progresses to deafness over time (50). Intriguingly, this corresponds to the 2nddecade of life when hearing loss is first detected in DFNA41 patients (51) and suggests that P21 could be a good time point for intervention in the P2rx2V6n- mice.

[0163] To assess the therapeutic effect of AAV2-SaCas9-sgRNA-l on auditory function in P2rx2V61L / +mice, clinical treatment scenarios and intervention were modeled at two different time points: 1) intervention at 4 weeks old, a young adult age; 2) intervention at 2 weeks old, the earliest age when hearing loss was detected. 4x 109vg AAV2-SaCas9-sgRNA-l was injected per ear. Local injection was performed through the round window membrane with canal fenestration (RWM+CF) (Fig. 6A). Hearing tests by AB Rs and DPOAEs were measured across different frequencies (5.66, 8, 11.32, 16, 22.6, and 32 kHz) for the treated and untreated contralateral ears at 1-, 3-, 6-, and 9-months post-injection (Fig. 6A).

[0164] In the 4-week-inj ection group, one-month post-injection, a significant reduction in ABR threshold of 6 dB was detected at the frequency of 8 kHz in injected compared to uninjected control P2rx2V6,L / +ears (Fig. 6C). No significant difference in DPOAE thresholds was detected between injected and uninjected contralateral P2rx2V6IL / +inner ears (Fig. 7A).

[0165] At three months post-4-week injection, substantial hearing rescue was observed in treated P2rx2V6IL / +ears. In untreated ears, hearing loss was worsened across all frequencies. In contrast, the treated ears showed lower ABR thresholds at the frequencies of 5.66, 8, and 11.32 kHz (Fig. 6D), with an average of ABR threshold reduction of 13 dB. DPOAE threshold was reduced by 11 dB at 11.32 kHz (Fig. 7B).

[0166] Six months after injection, more significant hearing preservation was observed at the frequencies 5.66, 8, and 11.32 kHz (Fig. 6E). At this point, hearing in the P2rx2V61L / +ears had deteriorated to above 85 dB across all frequencies. In the injected ears, the average ABR threshold at 5.66, 8, and 11.32 kHz was 21 dB lower (Fig. 6E). DPOAE threshold was reduced by 10 dB at 11.32 kHz (Fig. 7C).

[0167] Nine months post injection, hearing preservation persisted in the treated P2rx2V61L / +group (Fig. 6F). In the untreated P2rx2V61L / +ears, the average ABR threshold was over 95 dB across all frequencies (Fig. 6F). In the injected ears, significant hearing preservation was detected at 5.66, 8, and 11.32 kHz with an average ABR threshold reduction of 17 dB (Fig. 6F). DPOAE thresholds showed a significant reduction at 11.32 kHz of 7 dB (Fig. 7D). Thus, injection by AAV2-SaCas9-sgRNA-l in P2rx2V61L +ears resulted in robust and long-term hearing rescue post injection. EXAMPLE 5: Early genome editing therapy further enhances auditory function preservation in P2rx2'61L / +mice

[0168] To evaluate whether an earlier intervention could result in more efficacious hearing rescue, additional injections were performed in P14 P2rx2V6!L +mice and hearing was subsequently assessed.

[0169] One month post injection, a significant reduction in ABR threshold of 8 dB was detected at the frequency of 22.6 kHz in injected compared to uninjected control P2rx2V61L / +ears (Fig. 6G). No significant difference in DPOAE thresholds was detected between injected and uninjected contralateral P2rx2V61L / +inner ears (Fig. 8A).

[0170] Three months post injection, the ABR thresholds in injected ears were significantly reduced at all frequencies except for 32 kHz compared to uninjected ears (Fig. 6D). The reductions ranged from 16 dB at 5.66 kHz to 11 dB at 22.6 kHz with an average reduction of 14 dB across the five frequencies. (Fig. 6H). DPOAE thresholds in injected ears were significantly reduced at 11.32 and 16 kHz by 17 and 14 dB, respectively (Fig. 8B).

[0171] Six months post injection, ABR thresholds were further elevated from 3 months in uninjected ears. The injected ears showed significant reductions in ABR thresholds at 5.66, 8, 11.32, and 16 kHz with an average reduction of 21 dB compared to uninjected ears (Fig. 61). DPOAE thresholds were significantly reduced at 11.32 and 16 kHz by 16 and 6 dB, respectively (Fig. 8C).

[0172] Nine months post injection, uninjected P2rx2V6!L / +ears showed profound hearing loss with ABR thresholds over 95 dB across all frequencies. In the injected ears, ABR thresholds were significantly reduced at the frequencies of 5.66, 8, 11.32, and 16 kHz by an average of 17 dB (Fig. 6J). DPOAE threshold was significantly reduced at 11.32 kHz by 7 dB in the injected ears (Fig. 8D).

[0173] Twelve months post injection, ABR thresholds over 100 dB across all the frequencies were observed in uninjected P2rx2V6IL +ears. In the injected ears, ABR thresholds were significantly reduced at 8 and 11.32kHz by an average 16 dB (Fig. 9A). DPOAE threshold showed no difference between injected and uninjected ears (Fig. 9B).

[0174] To evaluate how AAV2-SaCas9-sgRNA-l injection affects normal hearing, AAV2- SaCas9-sgRNA-l was injected into 2-week-old WT CBA mice and hearing was assessed. The ABR and DPOAE thresholds in the injected WT mice were indistinguishable from WT mice without injection (Figs. 6G-6J and Figs. 8A-8D) up to 9 months post injection. These results demonstrated that, consisted with mutation specific editing, AAV2-SaCas9-sgRNA-l injection does not affect normal hearing.

[0175] Consistent with the rescue in ABR and DPOAE thresholds, significantly greater wave I Pl amplitudes at 11.32kHz at 90- and 100-dB SPL were detected in 4-week-old injected P2rx2V6IL / +ears 9 months post injection compared to untreated ears in which Pl was negligible (Figs. 6K, 6L and 10A). Additionally, more normal wave I latency stimulated from 20 to 100 dB SPL at 11.32 kHz was observed at 9 months after 4-week-inj ection in P2rx2l 6i!' treated ears than in untreated ears, compared with the WT group (Fig. 6M).

[0176] Taken together, hearing tests demonstrated that injection of AAV2-SaCas9-sgRNA-l into adult P2rx2V6iL / +inner ear significantly rescued hearing by the preservation of auditory function long term. Earlier intervention in the P2rx2V61L / +inner ear further improved the treatment efficacy by broadening the frequencies rescued.

[0177] EXAMPLE 6: AAV2-SaCas9-sgRNA adult intervention promotes P2rx2V61L / +hair cell survival and preserves hair cell morphology

[0178] To assess the impact of the adult intervention with the CRISPR / Cas9 system via AAV2- SaCas9-sgRNAl on hair cell survival, hair cell numbers were examined at 9 months after 4- weeks-old injection. Compared to WT inner ears, there was a significant loss of IHC and OHC across the entire cochlear turn in the uninjected P2rx2V61L / +ears. There was a complete loss in the basal turn followed by a partial loss in the middle and apical turns shown by immunolabeling and quantification (Figs. 11 A, 1 IB, 1 ID, 1 IE, and 1 IF). In the injected P2rx2i 61L / +ears, a complete loss of basal HC was seen (Figs. 11C, 1 ID, 1 IE and 1 IF). In the middle and apical turns, significantly more HC survived, especially in OHC (Figs. 11C, 1 ID, and 4F), compared to the uninjected P2rx2V61L / +ears (Figs. 1 IB, 1 ID, 1 IE, and 1 IF). It was concluded that AAV2- SaCas9-sgRNA-l mediated editing in P2rx2V6IL / +ears significantly promotes HC survival especially in the middle and apical turns long term.

[0179] The structure of hair cell stereocilia is essential to hair cell function and hearing. The highest densities of P2X2 receptors, crucial for normal hearing function, are found on the stereocilia and cuticular plates facing the endolymph (52, 53). To evaluate the effect of AAV2- SaCas9-gRNA-l on the stereocilia structure, scanning electron microscopy (SEM) was performed to examine the apex-middle turn hair cell stereocilia of WT, treated and untreated P2rx2V61L'+ears at 9 months post-4-weeks-old injection. In the injected ears, hearing was rescued at 3 frequencies (Figs. 12A and 12B). In WT ears, the stereocilia of OHC and IHC were well organized with a uniform pattern (Fig. 12C). In contrast, in the uninjected P2rx2V6IL'+ears, stereocilia were either completely absent, partially missing, or disorganized in a majority of OHC (Fig. 12C). The stereocilia of IHCs were present (Fig. 12C). In the AAV2-SaCas9-gRNA-l injected P2rx2V61L;+cochlea, the overall V-shape pattern of OHC stereocilia, as well as the structure, were maintained (Fig. 12C). The stereocilia of IHC was present in the injected ears (Fig. 12C). The SEM data revealed that the hair cell stereocilia defects caused by the P2rx2V6IL / +mutation were ameliorated by injection of AAV2-SaCas9-sgRNA-l into the adult P2rx2V61L / +inner ear.

[0180] EXAMPLE 7: AAV2-SaCas9-gRNAl treatment rescue of vestibular behavior in P2rx2i 6Imice

[0181] P2rx2V61L / +mice exhibited vestibular dysfunction(50). AAV2-SaCas9-sgRNA-l inner ear delivery may target the vestibular HC to rescue the function. Injection of AAV2-GFP vector was performed into adult WT mouse cochlea via RWM+CF and the transduced vestibular HCs were studeid. Robust transduction in the vestibular HC was observed by GFP signals (Fig. 13). These results suggested that AAV2-SaCas9-sgRNA-l inner ear delivery can rescue the vestibular function in the P2rx2™ mice by targeting vestibular sensory organs (Figs. 13A-13D).

[0182] AAV2-SaCas9-sgRNA-l was injected into 4-week-old P2rx2‘761L,+mice. Vestibular function was studied by open field and rotarod test 9 months post-injection. In the open field test, untreated P2rx2V6,L / +mice exhibited more activities throughout the entire field with increased full-body rotations compared to untreated WT mice (Figs. 14A and 14B). In contrast, injected P2rx2V61L / +mice showed recovery in open field behavior by exploring along the border of the chamber and displayed minimal full-body rotations, similar to the behavior of WT mice (Fig. 14C). Compared to untreated P2rx2V6,mice, the treated P2rx2V6IL / +mice exhibited decreased velocity and the distance traveled, similar to WT mice (Figs. 14D and 14E).

[0183] In the rotarod test, uninjected P2rx2V61L +mice displayed significantly poor rotarod performance in maintaining their balance with the allocated time (Fig. 14F). In contrast, injected P2rx2V61Lj+mice performed the rotarod test significantly better than uninjected mice with results similar to the WT mice (Fig. 14F). Combining the open field and rotarod test results, it was concluded that AAV2-SaCas9-gRNA-l adult injection effectively rescues vestibular function in P2rx2V6iL / +mice long term.

[0184] EXAMPLE 8: AAV2-SaCas9-gRNAl treatment attenuates heightened sensitivity to noise- induced hearing loss in P2rx2l 6I / +mice

[0185] Previous studies have shown that P2X2 receptors protect against noise-induced hearing loss by releasing cation burden from high-intense noise stimulation (54, 55). E2 / x2-mutant mice were more susceptible to noise exposure (>95 dB), resulting in permanent threshold shift (PTS) due to the disruption of hair cell ribbon synapses compared to WT mice (56). In this study, it was observed that the P2rx2V61L / +mice model exhibited greater sensitivity to NIHL than P2rx2+'+mice (Figs. 15D and 16A-16E).

[0186] Given that AAV2-SaCas9-sgRNA-l mediated editing disrupts the V61L mutation that underlies the increased sensitivity to NIHL in P2rx2+ / +mice, it was hypothesized that the edited ears should be protected from the increased sensitivity to NIHL. To test the hypothesis, we AAV2-SaCas9-sgRNA-l was injected into 2 -weeks-old P2rx2l 61L / +mice. Four weeks later, mice were then exposed to the noise of 97dB SPL at the octave band of 1-20 kHz for 2 hours, followed by a hearing test 2 weeks post-noise exposure (Fig. 15 A). Controls were contralateral uninjected P2rx2V61L / +ears exposed to noise and P2rx2V61L +mice not exposed to noise. In the untreated P2rx2l 6iears, noise exposure induced hearing loss, as shown by elevated ABR thresholds at 5.66, 8, and 11.32 kHz compared to P2rx2l 6’:- mice without noise exposure of the same age (Figs. 15B and 15D). In contrast, in AAV2-SaCas9-sgRNA-l injected P2rx2V61L / +mice exposed to the noise, the NIHL was completely attenuated compared to noise-exposed uninjected P2rx2 '6Hears. The ABR thresholds in these mice were virtually identical to the P2rx26IL / +mice without noise exposure (Figs. 15C and 15D). There was no significant change in DPOAE thresholds before or after noise exposure (Fig. 15E), indicating that the noise did not affect the OHC function.

[0187] Ribbon synapses, which play an essential role in converting mechanic signals from hair cells to electric signals in the auditory neurons, are highly sensitive to noise exposure. CtBP2 is a presynaptic protein and has been used to study synaptic deficiency due to the loss of synapses(57, 58). In noise exposed injected P2rx2V61L / +ears, there was significantly more Ctbp2 per IHC in the apex turn than noise exposed uninjected P2rx2V6IL / +ears (Figs. 15F-15H). These results demonstrated that editing m P2rx2V61L,+protected against synapse loss. and that AAV2- SaCas9-sgRNA-l treatment effectively attenuated heightened sensitivity to NIHL in P2rx2V6,L / +mice. Together, these results strongly support a therapeutic approach to mitigate noise-induced hearing loss in individuals with P2RX2 mutation.

[0188] EXAMPLE 9: In vitro genome editing screening for human P2rx2 V60L mutation in patient-derived hiPSCs

[0189] An editing strategy to rescue hearing in P2RX2 patients was developed. To directly assess the approach of abolishing the P2RX2 V60L mutation in the human genome, gRNA designs for different editors in P2RX2 patient-derived hiPSCs (hiPSCsr60L / ra'L) harboring aP2RX2 C.178G > T mutation were tested (Table 1) (51). Different compact CRISPR systems that can be accommodated in a single AAV vector, including SaCas9-KKH (59), enosCasl2fl (60), Casl2j- 8 (61) were screened (Fig. 17A). Plasmids encoding CRISPR nucleases and sgRNAs were introduced into hiPSCs using nucleofection, and NGS analysis revealed robust InDei generation in cells edited with SaCas9-KKH / sgRNA-l with an InDei frequency of 37.9%±2.3% (Fig. 17B). InDei profiling further revealed that, in reads edited with SaCas9-KKH / sgRNA-l, a majority of InDeis were frame-shift mutations (Fig. 17C and 17E). An editing study was performed in hiPSCs derived from a normal healthy control. No InDeis were detected in the control hiPSCs (Fig. 17B and 17D), demonstrating the gRNA design is mutation specific and does not edit the normal allele lacking the mutation. In comparison, the other compact CRISPR systems exhibited substantially lower on-target genome editing efficiency. The enosCasl2fl / sgRNA-2 had an efficiency of 4.6%±2.2% and Casl2j-8 nuclease has an efficiency of less than 3% (Fig. 17B). Neither enosCasl2fl / sgRNA-2 nor Casl2j-8 induced editing on the allele lacking the mutation (Fig. 17B). The top 10 potential off-target locus in human genome (Table 6) were tested, and NGS revealed no InDeis (Fig. 17F and 17G). Collectively, these data demonstrate that a gRNA has been identified for SaCas9-KKH for efficient and specific editing targeting the human P2RX2 dominant mutation C.178G ''' T (V60L) with no off-target editing. Table 6 - Potential Off-Target Sites

[0190] EXAMPLE 10: Optimization of human P2rx2 V60L editing

[0191] Editing efficiency was further optimized using the saCas9-KKH / sgRNA-l (Figure 18).

[0192] The PIGGYBAC transposon system was used to generate a HEK-293T cell line that harbored the human P2RX-V60L mutant sequence, named HEK-P2RX2-V60L Different sgRNA spacer lengths were tested for sgRNA- 1, following transfection with SaCas9-KKH / sgRNA-l with space lengths from 17 bp to 23 bp (Figs. 18A and 18B). NGS analysis of edited HEK-P2RX2-V60L cells showed minimal editing for 17 and 18 bp, modest editing efficiency for 19, 20 and 23 bp, and robust InDei formations for 21 and 22 bp (Figs. 18C-E). At the same time, in the HEK-293T cells with the WT-P2RX2 allele, NGS found negligible InDeis (Figs. 18C-E). These results were consistent with the findings in hiPSCs. The InDei profile in edited HEK-P2RX2-V60L cells showed various types of InDeis with one nucleotide insertion being the most common type. REFERENCES

[0193] 1. Renauld JM, and Basch ML. Congenital Deafness and Recent Advances Towards Restoring Hearing Loss. Curr Protoc. 2021;l(3):e76.

[0194] 2. Korver AM, Smith RJ, Van Camp G, Schleiss MR, Bitner-Glindzicz MA, Lustig LR, et al. Congenital hearing loss. Nat Rev Dis Primers. 2017;3: 16094.

[0195] 3. Petit C, Bonnet C, and Safieddine S. Deafness: from genetic architecture to gene therapy. Nat Rev Genet. 2023.

[0196] 4. Nassiri AM, Marinelli JP, Sorkin DL, and Carlson ML. Barriers to Adult Cochlear Implant Care in the United States: An Analysis of Health Care Delivery. Semin Hear. 2021;42(4):311-20.

[0197] 5. Sininger YS, and Trautwein P. Electrical stimulation of the auditory nerve via cochlear implants in patients with auditory neuropathy. Ann Otol Rhinol Laryngol Suppl. 2002;189:29-31.

[0198] 6. Harrison RV, Gordon KA, Papsin BC, Negandhi J, and James AL. Auditory neuropathy spectrum disorder (ANSD) and cochlear implantation. Int J Pediatr Otorhinolaryngol. 2015;79(12): 1980-7.

[0199] 7. Akil O, Seal RP, Burke K, Wang C, Alemi A, During M, et al. Restoration of hearing in the VGLUT3 knockout mouse using virally mediated gene therapy. Neuron. 2012;75(2):283-93.

[0200] 8. Pan B, Askew C, Galvin A, Heman-Ackah S, Asai Y, Indzhykulian AA, et al. Gene therapy restores auditory and vestibular function in a mouse model of Usher syndrome type 1c. Nat Biotechnol. 2017;35(3):264-72.

[0201] 9. Isgrig K, Shteamer JW, Belyantseva IA, Drummond MC, Fitzgerald TS, Vijayakumar S, et al. Gene Therapy Restores Balance and Auditory Functions in a Mouse Model of Usher Syndrome. Mol Ther. 2017;25(3):780-91.

[0202] 10. Du W, Ergin V, Loeb C, Huang M, Silver S, Armstrong AM, et al. Rescue of auditory function by a single administration of AAV-TMPRSS3 gene therapy in aged mice of human recessive deafness DFNB8. Mol Ther. 2023.

[0203] 11. Takeda H, Miwa T, Kim MY, Choi BY, Orita Y, and Minoda R. Prenatal electroporation-mediated gene transfer restores Slc26a4 knock-out mouse hearing and vestibular function. Sci Rep. 2019;9(l): 17979. 12. Chien WW, Isgrig K, Roy S, Belyantseva IA, Drummond MC, May LA, et al. Gene Therapy Restores Hair Cell Stereocilia Morphology in Inner Ears of Deaf Whirl er Mice. Mol Ther. 2016;24(1): 17-25.

[0204] 13. Emptoz A, Michel V, Lelli A, Akil O, Boutet de Monvel J, Lahlou G, et al. Local gene therapy durably restores vestibular function in a mouse model of Usher syndrome type 1G. Proc Natl Acad Sci U S A. 2017;114(36):9695-700.

[0205] 14. Lentz JJ, Jodelka FM, Hinrich AJ, McCaffrey KE, Farris HE, Spalitta MJ, et al. Rescue of hearing and vestibular function by antisense oligonucleotides in a mouse model of human deafness. Nat Med. 2013; 19(3):345-50.

[0206] 15. Ahmed H, Shubina-Oleinik O, and Holt JR. Emerging Gene Therapies for Genetic Hearing Loss. J Assoc Res Otolaryngol. 2017;18(5):649-70.

[0207] 16. Lentz JJ, Pan B, Ponnath A, Tran CM, Nist-Lund C, Galvin A, et al. Direct Delivery of Antisense Oligonucleotides to the Middle and Inner Ear Improves Hearing and Balance in Usher Mice. Mol Ther. 2020;28(12):2662-76.

[0208] 17. Pascual-Garcia P, and Capelson M. Nuclear pores in genome architecture and enhancer function. Curr Opin Cell Biol. 2019;58: 126-33.

[0209] 18. Fierz B, and Poirier MG. Biophysics of Chromatin Dynamics. Annu Rev Biophys. 2019;48:321-45.

[0210] 19. Gy orgy B, Nist-Lund C, Pan B, Asai Y, Karavitaki KD, Kleinstiver BP, et al. Allele-specific gene editing prevents deafness in a model of dominant progressive hearing loss. Nat Med. 2019;25(7):l 123-30.

[0211] 20. Gao X, Tao Y, Lamas V, Huang M, Yeh WH, Pan B, et al. Treatment of autosomal dominant hearing loss by in vivo delivery of genome editing agents. Nature. 2018;553(7687):217-2L

[0212] 21. Yeh WH, Shubina-Oleinik O, Levy JM, Pan B, Newby GA, Womow M, et al. In vivo base editing restores sensory transduction and transiently improves auditory function in a mouse model of recessive deafness. Sci Transl Med. 2020; 12(546).

[0213] 22. Tao Y, Lamas V, Du W, Zhu W, Li Y, Whittaker MN, et al. Treatment of monogenic and digenic dominant genetic hearing loss by CRISPR-Cas9 ribonucleoprotein delivery in vivo. Nat Commun. 2023;14(l):4928. 23. Oestreicher D, Picher MM, Rankovic V, Moser T, and Pangrsic T. Cabp2-Gene Therapy Restores Inner Hair Cell Calcium Currents and Improves Hearing in a DFNB93 Mouse Model. Front Mol Neurosci. 2021 ; 14:689415.

[0214] 24. lizuka T, Kamiya K, Gotoh S, Sugitani Y, Suzuki M, Noda T, et al. Perinatal Gjb2 gene transfer rescues hearing in a mouse model of hereditary deafness. Hum Mol Genet. 2015;24(13):3651-61.

[0215] 25. Wu X, Zhang L, Li Y, Zhang W, Wang J, Cai C, and Lin X. Gene therapy via canalostomy approach preserves auditory and vestibular functions in a mouse model of Jervell and Lange-Nielsen syndrome type 2. Nat Commun. 2021 ; 12(1 ):697.

[0216] 26. Xue Y, Hu X, Wang D, Li D, Li Y, Wang F, et al. Gene editing in a Myo6 semidominant mouse model rescues auditory function. Mol Ther. 2022;30(l): 105- 18.

[0217] 27. Al-Moyed H, Cepeda AP, Jung S, Moser T, Kugler S, and Reisinger E. A dual- AAV approach restores fast exocytosis and partially rescues auditory function in deaf otoferlin knock-out mice. EMB O Mol Med. 2019; 11(1).

[0218] 28. Tang H, Wang H, Wang S, Hu SW, Lv J, Xun M, et al. Hearing of Otof-deficient mice restored by trans-splicing of N- and C-terminal otoferlin. Hum Genet. 2023;142(2):289- 304.

[0219] 29. Liu L, Zou L, Li K, Hou H, Hu Q, Liu S, et al. Template-independent genome editing in the Pcdhl5(av-3j) mouse, a model of human DFNB23 nonsyndromic deafness. Cell Rep. 2022;40(2):l 11061.

[0220] 30. Lu YC, Tsai YH, Chan YH, Hu CJ, Huang CY, Xiao R, et al. Gene therapy with a synthetic adeno-associated viral vector improves audiovestibular phenotypes in Pjvk-mutant mice. JCI Insight. 2022;7(20).

[0221] 31. Shubina-Oleinik O, Nist-Lund C, French C, Rockowitz S, Shearer AE, and Holt JR. Dual-vector gene therapy restores cochlear amplification and auditory sensitivity in a mouse model of DFNB16 hearing loss. Sci Adv. 2021;7(51):eabi7629.

[0222] 32. Taiber S, Cohen R, Yizhar-Barnea O, Sprinzak D, Holt JR, and Avraham KB. Neonatal AAV gene therapy rescues hearing in a mouse model of SYNE4 deafness. EMBO Mol Med. 2021;13(2):el3259. 33. Dulon D, Papal S, Patni P, Cortese M, Vincent PF, Tertrais M, et al. Clarin-1 gene transfer rescues auditory synaptopathy in model of Usher syndrome. J Clin Invest. 2018;128(8):3382-401.

[0223] 34. Lim DJ, and Anniko M. Developmental morphology of the mouse inner ear. A scanning electron microscopic observation. Acta Otolaryngol Suppl. 1985;422: 1-69.

[0224] 35. Liberman LD, and Liberman MC. Postnatal maturation of auditory-nerve heterogeneity, as seen in spatial gradients of synapse morphology in the inner hair cell area. Hear Res. 2016;339: 12-22.

[0225] 36. Chang M, and Kanold PO. Development of Auditory Cortex Circuits. J Assoc Res Otolaryngol. 2021;22(3):237-59.

[0226] 37. Meenderink SWF, Shera CA, Valero MD, Liberman MC, and Abdala C. Morphological Immaturity of the Neonatal Organ of Corti and Associated Structures in Humans. J Assoc Res Otolaryngol. 2019;20(5):461-74.

[0227] 38. Akil O, Dyka F, Calvet C, Emptoz A, Lahlou G, Nouaille S, et al. Dual AAV- mediated gene therapy restores hearing in a DFNB9 mouse model. Proc Natl Acad Sci U S A. 2019;116(10):4496-501.

[0228] 39. Du W, Ergin V, Loeb C, Huang M, Silver S, Armstrong AM, et al. Rescue of auditory function by a single administration of AAV-TMPRSS3 gene therapy in aged mice of human recessive deafness DFNB8. Mol Ther. 2023;31(9):2796-810.

[0229] 40. Wenliang Z, Wan D, Arun Prabhu R, Ariel Miura A, Stewart S, Yehree K, et al. Targeted genome editing restores auditory function in adult mice with progressive hearing loss caused by a human microRNA mutation. bioRxiv. 2023:2023.10.26.564008.

[0230] 41. Tsai SQ, Nguyen NT, Malagon-Lopez I, Topkar VV, Aryee MJ, and Joung JK. CIRCLE-seq: a highly sensitive in vitro screen for genome-wide CRISPR-Cas9 nuclease off- targets. Nat Methods. 2017;14(6):607-14.

[0231] 42. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol. 2016 ; 34(2) : 184-91.

[0232] 43. Tycko J, Barrera LA, Huston NC, Friedland AE, Wu X, Gootenberg JS, et al. Pairwise library screen systematically interrogates Staphylococcus aureus Cas9 specificity in human cells. Nat Commun. 2018;9(l):2962. 44. Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, et al. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Nat Commun. 2022; 13(l):5947.

[0233] 45. Nelson CE, Wu Y, Gemberling MP, Oliver ML, Waller MA, Bohning JD, et al. Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy. Nat Med. 2019;25(3):427-32.

[0234] 46. Turker MS. Gene silencing in mammalian cells and the spread of DNA methylation. Oncogene. 2002;21(35):5388-93.

[0235] 47. Meyers JR, MacDonald RB, Duggan A, Lenzi D, Standaert DG, Corwin JT, and Corey DP. Lighting up the senses: FM1-43 loading of sensory cells through nonselective ion channels. J Neurosci. 2003;23(10):4054-65.

[0236] 48. Shu Y, Li W, Huang M, Quan YZ, Scheffer D, Tian C, et al. Renewed proliferation in adult mouse cochlea and regeneration of hair cells. Nat Commun.

[0237] 2019; 1O(1):553O.

[0238] 49. Hanlon KS, Kleinstiver BP, Garcia SP, Zaborowski MP, Volak A, Spirig SE, et al. High levels of AAV vector integration into CRISPR-induced DNA breaks. Nat Commun. 2019; 10(l):4439.

[0239] 50. Chen X, Abad C, Chen ZY, Young JI, Gurumurthy CB, Walz K, and Liu XZ. Generation and characterization of a P2rx2 V60L mouse model for DFNA41. Hum Mol Genet. 2021;30(l l):985-95.

[0240] 51. Yan D, Zhu Y, Walsh T, Xie D, Yuan H, Sirmaci A, et al. Mutation of the ATP- gated P2X(2) receptor leads to progressive hearing loss and increased susceptibility to noise. Proc Natl Acad Sci U S A. 2013;l 10(6):2228-33.

[0241] 52. Housley GD, Greenwood D, and Ashmore JF. Localization of cholinergic and purinergic receptors on outer hair cells isolated from the guinea-pig cochlea. Proc Biol Sci. 1992;249(1326):265-73.

[0242] 53. Housley GD, Kanjhan R, Raybould NP, Greenwood D, Salih SG, Jarlebark L, et al. Expression of the P2X(2) receptor subunit of the ATP-gated ion channel in the cochlea: implications for sound transduction and auditory neurotransmission. J Neurosci.

[0243] 1999; 19(19):8377-88. 54. Lee JH, Chiba T, and Marcus DC. P2X2 receptor mediates stimulation of parasensory cation absorption by cochlear outer sulcus cells and vestibular transitional cells. J Neurosci. 2001;21(23):9168-74.

[0244] 55. Thorne PR, Munoz DJ, and Housley GD. Purinergic modulation of cochlear partition resistance and its effect on the endocochlear potential in the Guinea pig. J Assoc Res Otolaryngol. 2004;5(l):58-65.

[0245] 56. Housley GD, Morton-Jones R, Vlajkovic SM, Telang RS, Paramananthasivam V, Tadros SF, et al. ATP-gated ion channels mediate adaptation to elevated sound levels. Proc Natl Acad Sci U S A. 2013; 110(18)7494-9.

[0246] 57. Kujawa SG, and Liberman MC. Adding insult to injury: cochlear nerve degeneration after "temporary" noise-induced hearing loss. J Neurosci. 2009;29(45): 14077-85.

[0247] 58. Wei W, Shi X, Xiong W, He L, Du ZD, Qu T, et al. RNA-seq Profiling and Coexpression Network Analysis of Long Noncoding RNAs and mRNAs Reveal Novel Pathogenesis of Noise-induced Hidden Hearing Loss. Neuroscience. 2020;434: 120-35.

[0248] 59. Chen B, Hu J, Almeida R, Liu H, Balakrishnan S, Covill-Cooke C, et al. Expanding the CRISPR imaging toolset with Staphylococcus aureus Cas9 for simultaneous imaging of multiple genomic loci. Nucleic Acids Res. 2016;44(8):e75.

[0249] 60. Kong X, Zhang H, Li G, Wang Z, Kong X, Wang L, et al. Engineered CRISPR- OsCasl2fl and RhCasl2fl with robust activities and expanded target range for genome editing. Nat Commun. 2023; 14(l):2046.

[0250] 61. Wang Y, Qi T, Liu J, Yang Y, Wang Z, Wang Y, et al. A highly specific CRISPR-Casl2j nuclease enables allele-specific genome editing. Sci Adv. 2023;9(6):eabo6405.

[0251] 62. Mittal R, Chan B, Grati M, Mittal J, Patel K, Debs LH, et al. Molecular Structure and Regulation of P2X Receptors With a Special Emphasis on the Role of P2X2 in the Auditory System. J Cell Physiol. 2016;231(8): 1656-70.

[0252] 63. Stelmashenko O, Compan V, Browne LE, and North RA. Ectodomain movements of an ATP-gated ion channel (P2X2 receptor) probed by disulfide locking. J Biol Chem. 2014;289(14):9909-17.

[0253] 64. Moteki H, Azaiez H, Booth KT, Hattori M, Sato A, Sato Y, et al. Hearing loss caused by a P2RX2 mutation identified in a MELAS family with a coexisting mitochondrial 3243AG mutation. Ann Otol Rhinol Laryngol. 2015;124 Suppl 1(1 0): 177S-83S. 65. Faletra F, Girotto G, D' Adamo AP, Vozzi D, Morgan A, and Gasparini P. A novel P2RX2 mutation in an Italian family affected by autosomal dominant nonsyndromic hearing loss. Gene. 2014;534(2):236-9.

[0254] 66. Azizi Malamiri R, Mohammadi Asl J, and Ghanbari F. Identification of a Novel Stop Loss Mutation in P2RX2 Gene in an Iranian Family with Autosomal Nonsyndromic Hearing Loss. Iran Biomed J. 2021;25(5):368-73.

[0255] 67. Liu XZ, Yan D, Mittal R, Ballard ME, and Feng Y. Progressive Dominant Hearing Loss (Autosomal Dominant Deafness-41) and P2RX2 Gene Mutations: A Phenotype- Genotype Study. Laryngoscope. 2020;130(7): 1657-63.

[0256] 68. George B, Swartz KJ, and Li M. Hearing loss mutations alter the functional properties of human P2X2 receptor channels through distinct mechanisms. Proc Natl Acad Sci U S A. 2019;116(45):22862-71.

[0257] 69. Blanton SH, Liang CY, Cai MW, Pandya A, Du LL, Landa B, et al. A novel locus for autosomal dominant non-syndromic deafness (DFNA41) maps to chromosome 12q24-qter. J Med Genet. 2002;39(8):567-70.

[0258] 70. Nin F, Hibino H, Doi K, Suzuki T, Hisa Y, and Kurachi Y. The endocochlear potential depends on two K+ diffusion potentials and an electrical barrier in the stria vascularis of the inner ear. Proc Natl Acad Sci U S A. 2008;105(5):1751-6.

[0259] 71. Cui C, Wang D, Huang B, Wang F, Chen Y, Lv J, et al. Precise detection of CRISPR-Cas9 editing in hair cells in the treatment of autosomal dominant hearing loss. Mol Ther Nucleic Acids. 2022;29:400-12.

[0260] 72. Takimoto Y, Ishida Y, Kondo M, Imai T, Hanada Y, Ozono Y, et al. P2X(2) Receptor Deficiency in Mouse Vestibular End Organs Attenuates Vestibular Function. Neuroscience. 2018;386:41-50.

[0261] 73. Jeong J, Kim JY, Hong H, Wangemann P, Marcus DC, Jung J, et al. P2RX2 and P2RX4 receptors mediate cation absorption in transitional cells and supporting cells of the utricular macula. Hear Res. 2020;386: 107860.

[0262] 74. Jun Lv HWM, Xiaoting Cheng, Yuxin Chen, Daqi Wang, Longlong Zhang, Qi Cao, Honghai Tang, Shaowei Hu, Kaiyu Gao, Mengzhao Xun, Jinghan Wang, Zijing Wang, Biyun Zhu, Chong Cui, Ziwen Gao, Luo Guo, Sha Yu, Luoying Jiang, Yanbo Yin, Jiajia Zhang, Bing Chen, Wuqing, Wang, Renjie Chai, Zheng- Yi Chen, Yilai Shu. AAVl-hOTOF gene therapy for autosomal recessive deafness 9: a single-arm trial. Lacent. 2024.

[0263] 75. Zhang L, Wang H, Xun M, Tang H, Wang J, Lv J, et al. Preclinical evaluation of the efficacy and safety of AAVl-hOTOF in mice and nonhuman primates. Mol Ther Methods Clin Dev. 2023;31 : 101154.

[0264] 76. Ran FA, Cong L, Yan WX, Scott DA, Gootenberg JS, Kriz AJ, et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 2015;520(7546): 186-91.

[0265] 77. Zhu W, Zhang B, Li M, Mo F, Mi T, Wu Y, et al. Precisely controlling endogenous protein dosage in hPSCs and derivatives to model FOXG1 syndrome. Nat Commun 2019;10(l):928.

[0266] 78. Zhu W, Li M, Zou J, Zhang D, Fang M, Sun Y, et al. Induction of local immunosuppression in allogeneic cell transplantation by cell-type-specific expression of PD-L1 and CTLA4Ig. Stem Cell Reports. 2023.

[0267] 79. Clement K, Rees H, Canver MC, Gehrke JM, Farouni R, Hsu JY, et al. CRISPResso2 provides accurate and rapid genome editing sequence analysis. Nat Biotechnol. 2019;37(3):224-6.

[0268] SEQUENCES

[0269] Human P2RX2 (SEQ ID NO:75)

[0270] TTGCTTCAAAATAATGTGGGTGGGGTGGAGGTTCGAAAAGTTACCAAAAAAAAAAAAAAAGAAA GAAAGAAAGAAAGAAAACTCTGGCTTGCAAAGAAGAAAACGGATCGGCCGTGGATCCCTCTCCA GCTCGAGGGCTGGAGCTGCGGCGGAGGCAGGAGCTGGAAGCGAGGCGTCTGCTGGCAAAGGCGG GAGTGCAGGTTGCGCTCGAAGCCCCGGCAGCCGCGGCAGGAACCGGCCTGGACGGGGTGGGGGG CGCCGCGGAGGCCGGCGGGACTTCCCATGTCTTTCTCCTCGAGCTCGGAAAAAGTTCCCACCCG GGGAATCCCGACCCTCCAACTTCGAGACCGCCGGTTCCGCGCTCGGCCCCCACCTGGACCAAGA GCTGGGGCTGGGCTGCCGCGCCCCCGGCTCTGTCCCCGCGAGGCCCCGCTCCCAGCCCCACCTG GGACACCCGGGACTCCCGGGACACCTGCGGGGCGGGGCGGGGCCGGGGCGAGGCGGGGCGGGCT CGAGGCCGCACCCCGGAGGCGGAGCCGCGAGCTACCCGCCCGCCGCGCGCCCCCCGCTCTCGGT GCGCAGCGGGGCCGACCCTCAGCCCTGCAGCGCCTTCCTGGAGGTGGGGGCCGCCCGCGCCATG GCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGT CCGCCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCT GTACCGCGCCGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGTGCGCGGGGCGCGGGGTGCGG GGCGCGGGGTGCGGGGCGCAGGGGAGGGGCTGGGATTGGGGGCGCTGGGCTGGAGGCGCGGGGC TGGGGCTGGGGCTGGGACCGGGGGCGCGGGGCAGGGGCTGGGGCTGGGACCGGGGGCGCGGGGC AGGGGCTGGGATTGGGGGCGCGGGGCAGGGGCTGGGACTGGGGGCGTGGGGCAGGGGCTGGGAC TCGGGGTGCTGGGCTGGAGGCGCGGGGCTGGGGCTGGGACCAGGGGCGCGGGGCAGGGGCTGGG GCTGGGACCGGGGGCGCGGGGCAGGGGCTGGGGCTGGGACCGAGGGCGCGGGGCAGGCCCCAAG AGCCCCGCAGAGCGGACCCGGGTCGCGGGAGGGCCCCTGCCGTGCCTGCGGGCGGGACTCAGCC TTCCCAGGGTCGCCTCCGGAGCCGGCGCCGCCCCTGCCCGCAGGTACGTATTCATCGTGCAGAA AAGCTACCAGGAGAGCGAGACGGGCCCCGAGAGCTCCATCATCACCAAGGTCAAGGGGATCACC ACGTCCGAGCACAAAGTGTGGGACGTGGAGGAGTACGTGAAGCCCCCCGAGGTGCGGGCCGCCC CCTGCCCCCCGCCCCGCCGTGCACCCTACCCTAGTGGGCGGAGGGGGCAGCGGCTGCCGCCTGG CCGACCGCCCCCTCTTTCTGAGCCCAGGGGGGCAGCGTGTTCAGCATCATCACCAGGGTCGAGG CCACCCACTCCCAGACCCAGGGAACCTGCCCCGAGGTGAGGGGATCCCGCGGCGCTGGGGGACC CCGCCTCAGCTAGGCGGGCCAGCTGTCCCTTGCGGGGTCCCTGACTGGGCCGCCTCCACCCTAG AGCATAAGGGTCCACAACGCCACCTGCCTCTCCGACGCCGACTGCGTGGCTGGGGAGCTGGACA TGCTGGGAAACGGTCGGTGTGCGCCAGCTGGGGCTGGGCGGGTGGGGCAGGGCTGCGTCCCCGC TAATGCCTCAGTGACCTCTGCCTCCCAGGCCTGAGGACTGGGCGCTGTGTGCCCTATTACCAGG GGCCCTCCAAGACCTGCGAGGTGTTCGGCTGGTGCCCGGTGGAAGATGGGGCCTCTGTCAGGTG CACCTGCGCCCCGGCCTGGGGCCCAGCCTCCCCTCTGATCCTTTTCCCCTGACCAGAGGCCAAA CGGGCGGGGCAGGAGTGACAAGATCTGGGGAGGGGTGGGGGCCAATGCCAGGCGGGGGCTTTGC GGGAAGAGGGGACTAAACAACCCTTCTGTGCCTCCTCAGCCAATTTCTGGGTACGATGGCCCCA AAT T T C AC CAT C C T CAT C AAGAAC AG CATC C AC T AC C C C AAAT T C C AC T T C T C C AAG T AAGAG C CGCGGGGTGTGGTGACGGCCCAGCCTGAGGGCTGCCTTCTGGGAATGGGGTATTTGGGGTGCAG GTCTCGCCTCCTGCCGCCTCCTCAGGGGCAACATCGCCGACCGCACAGACGGGTACCTGAAGCG CTGCACGTTCCACGAGGCCTCCGACCTCTACTGCCCCATCTTCAAGCTGGGCTTTATCGTGGAG AAGGCTGGGGAGAGCTTCACAGAGCTCGCACACAAGGCAGGGCAAGCGCAGGCAGGGTGGGGCC AGGGTGGGCTCCCACCTGCACAGAGAGGGCCTGGGGTACAGGGGACCAGTCCCTCCTCCCTCCT GACCAGCTGGCCCCGCTCAGGCAGAGGAAAAGAAATGCGATCAGCGCAACCCATCCGGTGTGGC GCTTGCTGAATTATTGACACTGGCCATGGGGCTGGCTGCTGGCACCCCTTGTGCCTCAGACACT GGACGCCCACCAGTACCCCTGAGCTGCCCCATGGGCCCCTCAGTGCACACCTCACATGCAGCCT GGGACTGACCCGGGCTCTCGAGGGGCCTCTCGTGTGCCCTTGTGACCCCCTTCCCTGGCCTGGG ACTGACCCGGGCTCTCGAGGGGCCTCTCGTGTGCCCTCCTGACCCCCTTCTCTGGCTCCTTCTT GGCAGGGTGGTGTCATCGGGGTCATTATCAACTGGGACTGTGACCTGGACCTGCCTGCATCGGA GTGCAACCCCAAGTACTCCTTCCGGAGGCTTGACCCCAAGCACGTGCCTGCCTCGTCAGGCTAC AACTTCAGGTGCTGTACTTGGGACACCGCTGTCCACACTGGCATAGCTGTGGTGGGGTCCCGAG AGGCCCAATGCCTGTGGGGCAGCCCTGGAGTGCAGAGGACGAGTGGGCACTGGCGTTCCCATTG CAGGTTTGCCAAATACTACAAGATCAATGGCACCACCACCCGCACGCTCATCAAGGCCTACGGG ATCCGCATTGACGTCATTGTGCATGGACAGGTGCCTGCACCTGCTGGGGGTGGGTGGCCAGCCC TGCTAGCCTGGGTCTGAGCTCCTCACGCCCCACCCCTCCCTTAAGCCCCATCAGACGCCGTCAG ACATTCTGACCACGACCCCCATTCTCCCCAGGCCGGGAAGTTCAGCCTGATTCCCACCATTATT AATCTGGCCACAGCTCTGACTTCCGTCGGGGTGGTAAGGAACCCTCTCTGGGGTCCCAGCGGGT GCGGGGGGTCCACCAGGCCCTTACACACCGGTCTCTGCTGGCCCCAGGGCTCCTTCCTGTGCGA CTGGATCTTGC T AACAT T C AT GAAC AAAAAC AAG G T C TAG AG C C AT AAGAAAT T T GAG AAGG T G TGTACGCCGAGCCACCCCTCAGGTAGCTGGCCTGTGACCCTTGCCCGTGTATTGGGCCAGGCCC CTCCCGAACCCGGCCACCGCTCCGAGGACCAGCACCCCAGCCCTCCATCAGGCCAGGAGGGCCA ACAAGGGGCAGAGTGTGGCCCAGCCTTCCCGCCCCTGCGGCCTTGCCCCATCTCTGCCCCTTCT GAGCAGATGGTGGACACTCCTGCCTCCGAGCCTGCCCAAGCCTCCACACCCACAGACCCCAAAG GTTTGGCTCAACTCTGAGCTCCTTTCCATCTCACTGGACTGCAGACCCGGCCTGGTGGGGCCAG AGAGTCCCCAGCTAGGGACCTGCACGTGGACGTGGGCACCTCAGTAGCGGAGCATCTCCACGAA ACGGGGCACCACAGGATCCCTGTGCAAGGGCTGGGGGCACGCTCTGGCCCCAGGCTTGTGCCCC ACCCTGGCATACAGCCCCTGACACCTCCTCCCCAGCTGGTCCCTACAGGGCTGCTCACTTCCCA TCACCTCTCACAGCCACCTGGAACCCAAGCCAGCTGAGCTCTGAGGGGCTCTGCTCCCGGTCTT GGGCCCTGGGAACCCCACCCCACCCCACCCCACAGGCGTTGTAACCTTGAATCTGCCCAGACTC TTCCCTTAGAAGTCACAACATACTCAGTCCAATAAACCTGTGAGCAGAACCTTCTGGCCTCGTT CCTTGGGGAGGAGCATCGTGAGCCTGTCAATATGGGATGTCAGGCCCTGTCGGCCTGGAGCTGG GCTGCACGGTGACCTCTGTCTGGGTCATCTCCCCTCTAAGCAGCCTGCGAGGTGTGCAGGGCAC ATGTCTGCCTGCCCCATGACACATGGTCCCCACAGCCAGCCAGGCCACGGTCAGGTCTGCCCAG GCTGGGAGTGCACTGGGACCCAGGCCACCTCCTCAGTGCACTTGCTTCTGACAGGGCCACCCCA GACTCCAAACCAAAGCTGGCTCATCTCAAAATGTGGGAGGACAGCATGACTCAGGAAGAGAGAA ATAGGAGGGAGGCCGGGACAGCTGCACACAAGGAAAACGAAAGCTCAGACTACAGCAGTGCTCA GACCAGTGTTCATTCCTACTCCATGGGAGGGGGCAGGAATGCCGAGATGGGAAGTCAGGCCAGG CGGGGGTGGAAGGACACCAGCCCGGGAGCCAGCACTAACTGCATCAGGGCCTGGGGGTAATCTG GTTACTGCATCCTCAGATGCTGCAGTGGTTAGACTGGTGCCCACTGGGTGGGGGGAGGAGCCCA GAACAGC

[0271] Exemplary AAV Construct (SEQ ID NO: 76)

[0272] CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCGTCGGGCGACCTTTGGTC GCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTC CTGCGGCCTCTAGACTCGAGGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTA CGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTA ACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGG CAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCC CGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTA TTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGT TTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCA AAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGG CGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGCCACCATGGGCAAACGC CCAGCAGCTACAAAGAAGGCAGGTCAAGCCAAGAAAAAGAAAggaGCCCCAAAGAAGAAGCGGA AGGTCGGTtccAAGCGGAACTACATCCTGGGCCTGGACATCGGCATCACCAGCGTGGGCTACGG CATCATCGACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTTCAAAGAGGCCAAC GTGGAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGAGGCGGC ATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGCGAGCT GAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGCGAGGAAGAG TTCTCTGCCGCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTGAACGAGGTGGAAG AGGACACCGGCAACGAGCTGTCCACCAAAGAGCAGATCAGCCGGAACAGCAAGGCCCTGGAAGA GAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGACGGCGAAGTGCGGGGCAGCATC AACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAACAGCTGCTGAAGGTGCAGAAGGCCT ACCACCAGCTGGACCAGAGCTTCATCGACACCTACATCGACCTGCTGGAAACCCGGCGGACCTA CTATGAGGGACCTGGCGAGGGCAGCCCCTTCGGCTGGAAGGACATCAAAGAATGGTACGAGATG CTGATGGGCCACTGCACCTACTTCCCCGAGGAACTGCGGAGCGTGAAGTACGCCTACAACGCCG AC C T G T AC AAC G C C C T GAAC GAC C T GAAC AAT C T C G T GAT C AC C AG G GAC GAGAAC GAGAAG C T GGAATATTACGAGAAGTTCCAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAAGCCCACCCTG AAGCAGATCGCCAAAGAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCA CCGGCAAGCCCGAGTTCACCAACCTGAAGGTGTACCACGACATCAAGGACATTACCGCCCGGAA AGAGATTATTGAGAACGCCGAGCTGCTGGATCAGATTGCCAAGATCCTGACCATCTACCAGAGC AGCGAGGACATCCAGGAAGAACTGACCAATCTGAACTCCGAGCTGACCCAGGAAGAGATCGAGC AGATCTCTAATCTGAAGGGCTATACCGGCACCCACAACCTGAGCCTGAAGGCCATCAACCTGAT CCTGGACGAGCTGTGGCACACCAACGACAACCAGATCGCTATCTTCAACCGGCTGAAGCTGGTG CCCAAGAAGGTGGACCTGTCCCAGCAGAAAGAGATCCCCACCACCCTGGTGGACGACTTCATCC T GAGC C C C G T C G T GAAGAGAAG C T T CAT C C AGAG CAT C AAAG T GAT C AAC G C CAT CAT C AAGAA GTACGGCCTGCCCAACGACATCATTATCGAGCTGGCCCGCGAGAAGAACTCCAAGGACGCCCAG AAAAT GAT CAACGAGATGCAGAAGCGGAACCGGCAGACCAAC GAGC GGATCGAGGAAAT CAT CC GGACCACCGGCAAAGAGAACGCCAAGTACCTGATCGAGAAGATCAAGCTGCACGACATGCAGGA AGGCAAGTGCCTGTACAGCCTGGAAGCCATCCCTCTGGAAGATCTGCTGAACAACCCCTTCAAC TATGAGGTGGACCACATCATCCCCAGAAGCGTGTCCTTCGACAACAGCTTCAACAACAAGGTGC TCGTGAAGCAGGAAGAAAACAGCAAGAAGGGCAACCGGACCCCATTCCAGTACCTGAGCAGCAG CGACAGCAAGATCAGCTACGAAACCTTCAAGAAGCACATCCTGAATCTGGCCAAGGGCAAGGGC AGAATCAGCAAGACCAAGAAAGAGTATCTGCTGGAAGAACGGGACATCAACAGGTTCTCCGTGC AGAAAGACTTCATCAACCGGAACCTGGTGGATACCAGATACGCCACCAGAGGCCTGATGAACCT GCTGCGGAGCTACTTCAGAGTGAACAACCTGGACGTGAAAGTGAAGTCCATCAATGGCGGCTTC ACCAGCTTTCTGCGGCGGAAGTGGAAGTTTAAGAAAGAGCGGAACAAGGGGTACAAGCACCACG CCGAGGACGCCCTGATCATTGCCAACGCCGATTTCATCTTCAAAGAGTGGAAGAAACTGGACAA GGCCAAAAAAGTGATGGAAAACCAGATGTTCGAGGAAAAGCAGGCCGAGAGCATGCCCGAGATC GAAACCGAGCAGGAGTACAAAGAGATCTTCATCACCCCCCACCAGATCAAGCACATTAAGGACT TCAAGGACTACAAGTACAGCCACCGGGTGGACAAGAAGCCTAATAGAGAGCTGATTAACGACAC CCTGTACTCCACCCGGAAGGACGACAAGGGCAACACCCTGATCGTGAACAATCTGAACGGCCTG TAG GAC AAG GAC AAT GAC AAGC T GAAAAAG C T GAT C AAC AAGAGC C C C GAAAAG C T G C T GAT G T AC C AC C AC GAC C C C CAGAC C T AC C AGAAAC T GAAG C T GAT TAT GGAAC AG T AC G GC GAC GAGAA GAATCCCCTGTACAAGTACTACGAGGAAACCGGGAACTACCTGACCAAGTACTCCAAAAAGGAC AACGGCCCCGTGATCAAGAAGATTAAGTATTACGGCAACAAACTGAACGCCCATCTGGACATCA CCGACGACTACCCCAACAGCAGAAACAAGGTCGTGAAGCTGTCCCTGAAGCCCTACAGATTCGA CGTGTACCTGGACAATGGCGTGTACAAGTTCGTGACCGTGAAGAATCTGGATGTGATCAAAAAA GAAAAC TAG TACGAAGT GAATAGCAAGT GC TAT GAGGAAGC TAAGAAGCT GAAGAAGAT CAGCA ACCAGGCCGAGTTTATCGCCTCCTTCTACAACAACGATCTGATCAAGATCAACGGCGAGCTGTA TAGAGTGATCGGCGTGAACAACGACCTGCTGAACCGGATCGAAGTGAACATGATCGACATCACC TACCGCGAGTACCTGGAAAACATGAACGACAAGAGGCCCCCCAGGATCATTAAGACAATCGCCT CCAAGACCCAGAGCATTAAGAAGTACAGCACAGACATTCTGGGCAACCTGTATGAAGTGAAATC TAAGAAGCACCCTCAGATCATCAAAAAGGGCAAAAGGCCGGCGGCCACGAAAAAGGCCGGCCAG GCAAAAAAGAAAAAGGGATCCTACCCATACGATGTTCCAGATTACGCTTAAGAATTCGCTGATC AGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTG ACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTC TGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGA AGAGAATAGCAGGCATGCTGGGGAGGTACCGAGGGCCTATTTCCCATGATTCCTTCATATTTGC AT AT AC GAT AC AG G C T G T T AG GAGAT AT T G GAAT T AAT T T GAC T G T AAAC AC AAAGAT AT T AG T AC AAAAT AC G T GAC G T AGAAAG TAATAATTTCTTGGGTAGTTTG C AG T T T T AAAAT T AT G T T T T AAAAT G GAC T AT C AT AT GC T T AC C G T AAC T T GAAAG T AT T T C GAT T T C T T G GC T T T AT AT A TCTTGTGGAAAGGACGAAACACCGCACGATGAAGAGGTACCTGGTTATAGTACTCTGTAATGAA AATTACAGAATCTACTATAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT TTTTTTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGA GCGAGCGAGCGCGCAGCTGCCTGCAGG OTHER EMBODIMENTS

[0273] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:

1. A composition comprising one or more nucleic acids comprising a sequence encoding an RNA-guided nuclease and a sequence encoding one or more single guide RNAs (sgRNAs), wherein a target sequence of the one or more sgRNAs comprises a c.178 G > T mutation in a human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2) gene (SEQ ID NO:75).

2. A composition comprising a ribonucleoprotein (RNP) complex comprising an RNA- guided nuclease and one or more sgRNAs, wherein a target sequence of the one or more sgRNAs comprises a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75).

3. The composition of claim 1 or 2, wherein the one or more gRNAs target a sequence selected from any one of SEQ ID NOs: 1 to 25.

4. The composition of claim 3, wherein the RNA-guided nuclease is selected based on the corresponding one or more sgRNAs as shown in Table 1.

5. The composition of claim 4, wherein the RNA-guided nuclease is a Staphylococcus aureus Cas9 (SaCas9) or a variant thereof, optionally SaCas9-KKH.

6. The composition of any one of claims 1-5, wherein the RNA-guided nuclease comprises one or more nuclear localization signals.

7. The composition of claim 6, wherein the one or more nuclear localization signals comprise a C-terminal nuclear localization signal and / or an N-terminal nuclear localization signal.

8. The composition of any one of claims 1-7, wherein the sequence encoding the RNA- guided nuclease comprises a polyadenylation signal.

9. The composition of any one of claims 1-8, wherein the one or more nucleic acids comprises a viral delivery vector.

10. The composition of claim 9, wherein the viral delivery vector is an adenovirus vector, an adeno-associated virus (AAV) vector, or a lentivirus vector.

11. The composition of any of one of claims 1-10, for use in therapy.

12. The composition of any one of claims 1-10, for use in preparation of a medicament.

13. The composition of any one of claims 1-10, for use in a method of treating a subject who has non-syndromic progressive hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO: 75).

14. The composition for the use of claim 13, wherein the AAV vector is delivered to the inner ear of a subject by injection, optionally through the round window.

15. A method of editing an allele comprising a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) of a cell, comprising contacting the cell with the composition of any one of claims 1-14.

16. The method of claim 15, wherein editing the allele comprising a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) is affected using a sgRNA targeting a sequence selected from any one of SEQ ID NOs: 1 to 25.

17. The method of any one of claims 15-16, wherein the cell is in or from a subject who has non-syndromic progressive hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO: 75).

18. The method of any one of claims 15-17, wherein the cell is a cell of the inner ear of the subject.

19. The method of claim 18, wherein the cell is an inner hair cell.

20. A method of treating progressive non-syndromic hearing loss caused by a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient the composition of any one of claims 1-14.

21. A method of improving hair cell survival in a patient harboring a c. l78 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient the composition of any one of claims 1-14.

22. A method of improving vestibular function in a patient harboring a c.178 G > T mutation in a human P2RX2 gene (SEQ ID NO:75) in a patient in need thereof, the method comprising administering to the patient the composition of any one of claims 1-14.

Images