Therapy for dravet syndrome by targeting SCN1a antisense transcript

Abstract

The present invention relates to molecular complexes for targeting and modifying SCN1ANAT lncRNA, comprising: a SCN1ANAT sequence-specific RNA; a RNA-modifying effector protein; a RNA hairpin loop binding domain; and a ssRNA binding domain; optionally wherein these components are non-bacterial. Related compositions and methods are also disclosed. The molecular complexes and related compositions may be useful in the treatment of SCN1A genetic aberrations that result in Nav1.1 deficiencies, including Dravet Syndrome.

Description

[0001] Therapy for Dravet Syndrome

[0002] Technical field

[0003] Gene therapy to treat Dravet Syndrome by inhibiting long non-coding RNA (IncRNA).

[0004] Introduction

[0005] Dravet Syndrome (DS) is a form of epilepsy that affects 1 in 15,400-40,999 births worldwide. The typical age of seizure onset is between 5 and 18 months, with the majority happening before 12 months. The prognosis for patients having Dravet Syndrome can be highly variable, with 10-20% of individuals not surviving beyond the age of 10.

[0006] Dravet Syndrome is characterised by frequent, prolonged seizures often triggered by high body temperature (hyperthermia), developmental delay, speech impairment, ataxia, hypotonia, sleep disturbances, and other health problems. DS is thought to be at the severe end of a spectrum of disorders associated with changes (mutations) in genes for the sodium ion channel.

[0007] Over 80% of Dravet Syndrome contain a de novo loss of function mutation in the SCN1A (sodium channel alpha 1 subunit) gene. The SCN1A gene encodes the alpha subunit of the sodium ion channel Nav1.1. Nav1.1. is mostly found in the brain and facilitate nerve transmission between cells by controlling the flow of sodium ions. The flow of sodium ions is involved in determining when neurotransmitters are released. Mutations in SCN1A lead to decreased functioning of SCN1A. Many mutations in the SCN1A gene are responsible for diseases such as Dravet Syndrome, and specific mutations can have different effects on the severity of disease.

[0008] Gene editing is a technology which can insert or delete regions of DNA sequences in living cells by non-homologous end joining or homologous recombination. This is typically induced by a bacterial RNA guided endonuclease enzyme, Cas9. Gene editing has been used to cure many different diseases in mice, one example was a mouse model of haemophilia B which was cured after postnatal administration of AAV8 carrying a single guide RNA and Cas9. However, using bacterial proteins such as Cas9 in vivo can cause an immune response. Therefore, there is a need for new therapies for Dravet Syndrome that solve these problems.

[0009] Summary of the Invention

[0010] The invention relates to the use of CIRTS gene therapy to develop a treatment for Dravet Syndrome.

[0011] According to a first aspect the invention provides a molecular complex for targeting and modifying a SCN1ANAT (natural anti-sense transcript) long non-coding RNA (IncRNA), the molecular complex comprising: a. a guide RNA (gRNA) capable of sequence-specific binding to the SCN1ANA T IncRNA; and b. a molecular subcomplex comprising: i. an effector protein capable of modifying RNA; ii. a RNA hairpin loop binding domain or protein; and iii. a single-stranded RNA (ssRNA) binding domain or protein, wherein the gRNA, the effector protein, the RNA hairpin loop binding domain or protein, and the ssRNA binding domain or protein form a complex capable of binding to and modifying the SCN1ANAT IncRNA.

[0012] Advantageously, a complex of this aspect is associated with fewer adverse effects than a typical CRISPR complex would be because the components of the invention described herein are derived from humans, not from bacteria. Human proteins are less likely to elicit an immune response from a patient, in turn reducing the chances of adverse effects. Furthermore, Dravet Syndrome is caused by decreased expression of the SCN1A gene, SCN1ANAT is a long non-coding RNA that acts as an inhibitor to this gene, therefore preventing SCN1A inhibition by facilitating the inhibition or degradation of SCN1ANAT results in increased SCN1A activity and thus, a reduction in the symptoms of Dravet Syndrome.

[0013] CRISPR inspired RNA targeting system (CIRTS) is a new gene editing technology that has previously been developed to target RNA sequences. It is a method of gene therapy that is similar to CRISPR but instead of using bacterial components, it uses human components. Using human components is beneficial as human proteins are less immunogenic than bacterial ones. This new CIRTS technology can be used to successfully target the long non-coding RNA SCN1ANAT which naturally inhibits SCN1A mRNA, to increase endogenous SCN1A expression.

[0014] CIRTS uses programmable nucleic acid binding proteins to impact gene expression by regulating RNA. A typical CIRTS system will comprise (1) an RNA hairpin-binding protein specific to an RNA structure displayed on an engineered gRNA, (2) a gRNA that is capable of interacting with the engineered hairpin-binding protein and has a sequence complementary to the target RNA, (3) a charged protein that could bind to the displayed gRNA sequence non-specifically to stabilize and protect the gRNA prior to target engagement, and (4) an effector protein, such as a ribonuclease or epitranscriptomic regulator, that acts on the targeted RNA.

[0015] In a preferred embodiment, the SCN1ANAT long non-coding RNA (IncRNA) is human.

[0016] In embodiments, each domain or protein that is comprised by the molecular complex may consist of: part of a protein domain, an entire protein domain, more than one part of a protein (e.g. multiple entire protein domains, either from the same protein or from different proteins), or an entire protein. The person skilled in the art will be familiar with appropriate ways of joining multiple protein domains, if an embodiment so requires. Therefore, throughout this specification, specific references to “domain(s)” or “protein(s)” comprised by the molecular complex are to be understood as essentially mutually interchangeable embodiments, unless the context clearly requires otherwise.

[0017] The guide RNA The gRNA may be adapted with a hairpin loop. In one embodiment, the gRNA comprises or consists of a hairpin fused to a guide sequence, for example via a linker. The linker may be any suitable chemical linkage. The linker may comprise nucleic acid. The linker may comprise a linker nucleotide. In one embodiment, the gRNA comprises or consists of a hairpin fused to a nucleotide linker and a guide sequence. In particular, the gRNA may comprise three components: 1) a hairpin loop sequence, 2) a linker, and 3) a guide sequence for targeted binding to the target sequence.

[0018] The linker nucleotide may comprise about 1-10 nucleotides. In one embodiment, the linker nucleotide is about 5 nucleotides. The linker nucleotide may be a flexible linker. The linker nucleotide may be GC rich, for example comprising more than 60% of G and / or C nucleotides. In another embodiment, the linker nucleotide may comprise one or more uracil nucleotides. In one embodiment, the linker nucleotide comprises or consists of a sequence selected from U, UU, GUGCU and UUAUU. In a preferred embodiment, the linker nucleotide comprises or consists of the sequence: UUAUU.

[0019] In an embodiment which uses a CRISPR system, such as when using Cas 13 to provide an RNA hairpin loop binding domain and ssRNA binding domain in a single protein, an analogous gRNA may be provided. The skilled person will recognise that the guide RNA (gRNA) molecule may comprise a crispr RNA (crRNA) component, which is the part that is complementary to the target sequence for targeted binding to the target sequence, and a tracr RNA (tracrRNA) component that is a hairpin loop scaffold to bind to Cas nuclease (e.g. Cas 13). The hairpin loop structure may be known as a direct repeat (DR) or a stem loop, which is specific to the Cas13 orthologue. For example, the stem loop for LwCas13a may comprise or consist of the sequence GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC (SEQ ID NO: 234); the stem loop for PspCas13b may comprise or consist of the sequence

[0020] GTTGTGGAAGGTCCAGTTTTGAGGGGCTATTACACC (SEQ ID NO: 235); or the stem loop for RxCas13d may comprise or consist of the sequence

[0021] CCCCTACCAACTGGTCGGGGTTT (SEQ ID NO: 236). The Protospacer Flanking Site (PFS) of the gRNA may be optimised or selected for a given Cas13 orthologue. The skilled person will be familiar with suitable components of CRISPR systems, such as discussed in Kim et al, (2022 Efficient CRISPR Editing with hypercompact Casl2fl and engineered guide RNAs delivered by Adeno Associated virus. Nature biotechnology.), which is herein incorporated by reference.

[0022] The hairpin loop may be matched to be capable of binding to the RNA hairpin binding protein or domain. The hairpin loop may comprise a human histone mRNA hairpin. The hairpin loop may comprise a HIV TAR hairpin. Structural variations of the HIV TAR hairpin that have been elucidated, and may be used for the hairpin loop herein. The hairpin loop may comprise the sequence of SEQ ID NO: 182.

[0023] The gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 22 to 49. In another embodiment, the gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 22 to 42. In another embodiment, the gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 43 to 49. In a preferred embodiment, the gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of the sequence of SEQ ID NO: 46.

[0024] The gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 267 to 282 and 311 to 323. The gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 267 to 282. The gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 311 to 323. The gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of any one of the sequences of SEQ ID NO: 268 to 282. In a preferred embodiment, the gRNA may bind to a specific target region on the target SCN1ANAT comprising or consisting of the sequence of SEQ ID NO: 267.

[0025] Reference to binding to a specific target region on the target SCN1ANAT may be understood to be binding fully within the targeted region (i.e. not binding to any upstream or downstream flanking sequences).

[0026] In one embodiment, the guide sequence of the gRNA may be 100% complementary to any of SEQ ID NO: 22 to 49. However, the skilled person will recognise that binding of the guide sequence of the gRNA to a target sequence may occur when the guide sequence of the gRNA is not 100% complementary to the target sequences. Therefore, in another embodiment, the guide sequence of the gRNA may be at least 80% complementary to any of SEQ ID NO: 22 to 49. In another embodiment, the guide sequence of the gRNA may be at least 83% complementary to any of SEQ ID NO: 22 to 49. In another embodiment, the guide sequence of the gRNA may be at least 90% complementary to any of SEQ ID NO: 22 to 49. In another embodiment, the guide sequence of the gRNA may be at least 95% complementary to any of SEQ ID NO: 22 to 49. In another embodiment, the guide sequence of the gRNA may be at least 98% complementary to any of SEQ ID NO: 22 to 49. The guide sequence of the gRNA may be mismatched to the target IncRNA sequence by 1, 2, 3, 4, or 5 nucleotides, or more, whilst still capable of specific binding to the targeted IncRNA.

[0027] In another embodiment, the guide sequence of the gRNA may be 100% complementary to any of SEQ ID NO: 268 to 282. In another embodiment, the guide sequence of the gRNA may be 80% complementary to any of SEQ ID NO: 268 to 282. In another embodiment, the guide sequence of the gRNA may be 90% complementary to any of SEQ ID NO: 268 to 282. In another embodiment, the guide sequence of the gRNA may be 95% complementary to any of SEQ ID NO: 268 to 282. In another embodiment, the guide sequence of the gRNA may be 98% complementary to any of SEQ ID NO: 268 to 282.

[0028] In another embodiment, the guide sequence of the gRNA may be 100% complementary to any of SEQ ID NO: 311 to 323. In another embodiment, the guide sequence of the gRNA may be 80% complementary to any of SEQ ID NO: 311 to 323. In another embodiment, the guide sequence of the gRNA may be 90% complementary to any of SEQ ID NO: 311 to 323. In another embodiment, the guide sequence of the gRNA may be 95% complementary to any of SEQ ID NO: 311 to 323. In another embodiment, the guide sequence of the gRNA may be 98% complementary to any of SEQ ID NO: 311 to 323.

[0029] In another embodiment, the guide sequence of the gRNA may be 100% complementary to any of SEQ ID NO: 22 to 42. In another embodiment, the guide sequence of the gRNA may be 80% complementary to any of SEQ ID NO: 22 to 42. In another embodiment, the guide sequence of the gRNA may be 90% complementary to any of SEQ ID NO: 22 to 42. In another embodiment, the guide sequence of the gRNA may be 95% complementary to any of SEQ ID NO: 22 to 42. In another embodiment, the guide sequence of the gRNA may be 98% complementary to any of SEQ ID NO: 22 to 42.

[0030] In another embodiment, the guide sequence of the gRNA may be 100% complementary to SEQ ID NO: 46. In another embodiment, the guide sequence of the gRNA may be 80% complementary to SEQ ID NO: 46. In another embodiment, the guide sequence of the gRNA may be 90% complementary to SEQ ID NO: 46. In another embodiment, the guide sequence of the gRNA may be 95% complementary to SEQ ID NO: 46. In another embodiment, the guide sequence of the gRNA may be 98% complementary to SEQ ID NO: 46.

[0031] In another embodiment, the guide sequence of the gRNA may be 100% complementary to SEQ ID NO: 267. In another embodiment, the guide sequence of the gRNA may be 80% complementary to SEQ ID NO: 267. In another embodiment, the guide sequence of the gRNA may be 90% complementary to SEQ ID NO: 267. In another embodiment, the guide sequence of the gRNA may be 95% complementary to SEQ ID NO: 267. In another embodiment, the guide sequence of the gRNA may be 98% complementary to SEQ ID NO: 267.

[0032] Advantageously, the gRNA binding to the site of SEQ ID NO: 46 of the IncRNA showed improved inhibition of the murine IncRNA, and highlights an equivalent region of human IncRNA for targeting according to the invention.

[0033] The gRNA may comprise any one of the guide sequences according to SEQ ID NOs: 1 to 21. In one embodiment, the gRNA comprises any of SEQ ID NOs: 5-9. In another embodiment, the gRNA comprises any of SEQ ID NOs: 5-21. In another embodiment, the gRNA comprises SEQ ID NO: 9 or 21. Such sequences refer to the guide sequence (i.e. the target binding sequence), and do not include the hairpin or linker sequences. The gRNA may comprise any one of guides 1-21 described herein. In one embodiment, the gRNA comprises any of gRNAs 5-9 described herein. In another embodiment, the gRNA comprises any of gRNAs 5-21 described herein. In another embodiment, the gRNA comprises gRNA 9 or 21 described herein.The gRNA may comprise any one of the sequences according to SEQ ID NOs: 186 to 206. The gRNA may comprise or consist of the sequence according to SEQ ID NO: 194.

[0034] In another embodiment, the gRNA may comprise any one of the guide sequences according to SEQ ID NOs: 283 to 297 and 324 to 336. In one embodiment, the gRNA comprises any of SEQ ID NOs: 283-297. In another embodiment, the gRNA comprises any of SEQ ID NOs: 324-336. Such sequences refer to the guide sequence (i.e. the target binding sequence), and do not include the hairpin or linker sequences. The gRNA may comprise or consist of any one of the sequences according to SEQ ID NOs: 337-364. The gRNA may comprise or consist of any one of the sequences according to SEQ ID NOs: 337-351. The gRNA may comprise or consist of any one of the sequences according to SEQ ID NOs: 352-364. The gRNA may comprise or consist of the sequence of SEQ ID NO: 341.

[0035] The skilled person will recognise that the use of gRNAs 1-21 described herein allows for a significant inhibition of the IncRNA by the molecular complex of the invention. Some of the gRNAs 1-21 have a greater effect on the inhibition than others, with gRNA9 and gRNA21 being most effective. The skilled person may choose an appropriate gRNA to have the desired effect.

[0036] The guide sequence of the gRNA may be at least 10 nucleotides long, at least 12 nucleotides long, at least 15 nucleotides long, at least 16 nucleotides long, at least 17 nucleotides long, at least 18 nucleotides long, at least 19 nucleotides long, at least 20 nucleotides long, at least 21 nucleotides long, at least 22 nucleotides long, at least 23 nucleotides long, at least 24 nucleotides long, or at least 25 nucleotides long. The guide sequence of the gRNA may be no more than 50 nucleotides long. The guide sequence of the gRNA may be about 10 to 35 nucleotides in length. In another embodiment, the guide sequence of the gRNA may be about 10 to 30 nucleotides in length. In another embodiment, the guide sequence of the gRNA may be about 15 to 30 nucleotides in length. In another embodiment, the guide sequence of the gRNA may be about 20 to 30 nucleotides in length. In another embodiment, the guide sequence of the gRNA may be about 30 to 50 nucleotides in length. In another embodiment, the guide sequence of the gRNA may be about 40 to 50 nucleotides in length.

[0037] The gRNA may comprise chemical modifications that alter the physicochemical properties of the gRNA. The altered properties may be: increased binding affinity to RNA, decreased binding affinity to RNA, increased stability, decreased stability. The chemical modifications that may alter the physicochemical properties of the gRNA may comprise one or more of locked nucleic acid (LNA) modifications and phosphorothioate modifications. More generally, the gRNA may comprise one or more nucleotide analogues, such as for example: thymidine, peptide nucleic acid (PNA), LNA, morpholino (PMO), glycol nucleic acid (GNA), threose nucleic acid (TNA), hexitol nucleic acids (HNA), fluoroarabino nucleic acid (FANA), cyclohexene nucleic acid (CeNA), 1,5-anhydrohexitol nucleic acid (HNA), unlocked nucleic acid (UNA).

[0038] The gRNA may comprise 1, 2, 3, 4, 5, or more nucleotide analogues. The gRNA may comprise 1 nucleotide analogue. The gRNA may comprise about 3 nucleotide analogues. The gRNA may comprise about 10 nucleotide analogues.

[0039] The gRNA may further comprise a terminator sequence, such as a poly-T tail (e.g. TTTTTTT). The terminator sequence may be about 10 nucleotides long. The terminator sequence may be about 7 nucleotides long.

[0040] In embodiments where the gRNA comprises a hairpin loop sequence, a linker, a guide sequence, and a terminator sequence, the gRNA may be at least 50 nucleotides long, at least 60 nucleotides long, at least 70 nucleotides long, at least 80 nucleotides long, at least 90 nucleotides long, or at least 100 nucleotides long. The gRNA may be about 63 nucleotides long. In a preferred ambodiment, the gRNA may be about 73 nucleotides long.

[0041] More than one gRNA may be provided for forming the molecular complex, for example there may be multiple molecular complexes comprising different gRNAs, which may target different sequences. In embodiments wherein two or more different gRNAs are provided, each gRNA may be chosen independently from the sequences of SEQ ID NOs: 1-21 and 157-178. Alternatively, in embodiments wherein two or more different gRNAs are provided, each gRNA may be chosen independently from the sequences of SEQ ID NOs: 1-21. Alternatively, in embodiments wherein two or more different gRNAs are provided, each gRNA may be chosen independently from the sequences of SEQ ID NOs: 283-297 and 324-336. Alternatively, in embodiments wherein two or more different gRNAs are provided, each gRNA may be chosen independently from the sequences of SEQ ID NOs: 283-297.

[0042] The Effector Protein

[0043] The effector protein may be any protein capable of modifying RNA, such as the targeted IncRNA. The modification may be the degradation of the IncRNA or the marking of IncRNA for degradation. The modification activity may comprise deadenylation activity, nuclease activity, endonuclease activity, exonuclease activity, polymerase activity, helicase activity, splicing activity, or a combination thereof. The modification may be carried out by a molecular complex that comprises any one or more of the proteins DCP1A, DCP1B, DCP2, XRN1, XRN2, Rrp44, EXOSC1-10, CID, MPP6, POLS, PAPD5, ZCCHC3, SKIV2L, SKIV2L2, SUPV3L1, LOC91431, LSM1-7, hCCR4, CNOT1, CNOT7, CNOT8, and / or domains or polypeptides, and / or homologues, and / or variants, thereof with substantially similar, or substantially retained, function.

[0044] The effector protein may be a deadenylating protein or a nuclease. In one embodiment, the effector protein comprises a deadenylation domain or a domain capable of recruiting (e.g. by binding) an enzyme capable of deadenylation. In one embodiment, the effector protein may not have RNA-modifying function itself, but it may be capable of recruiting, such as binding, a protein that has RNA-modifying capability, such as deadenylation.

[0045] It is understood that YTHDF proteins can recognise and bind to TV6-Methyladenosine (m6A) containing RNA sequences and have an effect on the RNA's stability. For example, YTHDF2 binds to RNA via m6A motifs, then recruits deadenylation machinery to induce RNA degradation.

[0046] The effector protein may be a ribonuclease or epitranscriptomic regulator, for example that acts on the targeted IncRNA in a proximity-dependent manner.

[0047] In one embodiment, the effector protein comprises or consists of a YTH 7V6- methyladenosine RNA binding protein (YTHDF), or a fragment thereof comprising the m6A binding domain of YTHDF. In a preferred embodiment, the effector protein comprises or consist of YTHDF2, or a fragment thereof comprising the m6A binding domain of YTHDF2.

[0048] In one embodiment, the effector protein comprises or consists of a Pin nuclease domain, for example of a human nonsense-mediated mRNA decay factor SMG6, which is a nonspecific proximity-dependent RNA endonuclease.

[0049] In one embodiment, the effector protein comprises or consists of an ADAR protein, for example a human ADAR protein, or a polypeptide thereof.

[0050] The effector protein may comprise or consist of the sequence of SEQ ID NO: 179. The effector protein may be encoded by a nucleotide sequence selected from any of SEQ ID NOs: 224-229.

[0051] The effector protein as described herein may be a mammalian protein. In a preferred embodiment, the effector protein is a human protein.

[0052] The effector protein may be up to 600 amino acids in length. In one embodiment, the effector protein is up to 200 amino acids in length. In one embodiment, the effector protein is 191 amino acids in length, or less. The effector protein may be up to 20 kDa in size. In another embodiment, the effector protein may be up to 70 kDa in size. In another embodiment, the effector protein may be 62 kDa in size, or less.

[0053] The ssRNA binding domain

[0054] The ssRNA binding domain may be a domain of a protein that also comprises the RNA hairpin loop binding domain. Such a protein is herein termed a guided nucleic acid binding protein. In particular, a single nucleic acid binding protein may comprise both an ssRNA binding domain and an RNA hairpin loop binding domain. One example of a single guided nucleic acid binding protein comprising both domains (i.e. ssRNA binding domain and RNA hairpin loop binding domain) is Cas13. Such a system may be also known as an RNA-guided RNAse. Therefore, in one embodiment, the guided nucleic acid binding protein may comprise or consist of an RNA-guided RNAse, such as Cas13.

[0055] Suitable Cas13 based CRISPR systems may be further described in Abudayyeh et al. (2016, Science.C2C2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector), Abudayyeh et al. (2017. Nature. RNA targeting with CRISPR-Cas13), Konermann et al. (2018. Cell. Transcriptome engineering with RNA-targeting Type VI- D CRISPR effectors), and Gupta et al. (2022. Cas13d: A new Molecular Scissor for Transcriptome Engineering. Frontiers in cell and Developmental Biology.); all of which are incorporated herein by reference.

[0056] The ssRNA binding domain may be an RNA Recognition Motif (RRM), K homology (KH), PUF, or PPR, domain, or homologue thereof. The ssRNA binding domain may be a domain from the proteins PAPB, sex-lethal, HuD, hnRNP Al, nucl eolin, RNA stemloops U1A, U2B”, CCCH-type zinc fingers, CNBP, RBM7, U2AF2, CBX4, PNPT1, MBNL1, SUPV3L1, EIF4B, DHX8, FUS, PCBP1, SRP19, or homologues thereof. The ssRNA binding domain and RNA hairpin loop binding domain may be part of the same fusion protein. For example, the ssRNA binding domain and RNA hairpin loop binding domain may be fused together (i.e. translated and expressed as a single polypeptide product). In an alternative embodiment, the ssRNA binding domain may be a domain of a separate (i.e. distinct) protein relative to the protein comprising the RNA hairpin loop binding domain.

[0057] In one embodiment, the ssRNA binding domain is an ssRNA binding protein. The skilled person will recognise that an ssRNA binding protein is a protein comprising a domain that is capable of binding ssRNA. In embodiments where the ssRNA binding protein natively comprises an RNAse domain, the RNAse activity may advantageously be diminished, or altogether prevented, artificially, for example by way of mutation or deletion.

[0058] The ssRNA binding domain may comprise the ssRNA binding domain of β-defensin 3. The ssRNA binding protein or domain of the complex described herein may comprise or consist of β-defensin 3, for example comprising or consisting of the sequence of SEQ ID NO: 181. Alternatively, the ssRNA binding protein may comprise HBEGF (heparin binding EGF like growth factor), for example comprising or consisting of the sequence of SEQ ID NO: 246. The ssRNA binding protein or domain may be translated from nucleotide sequences comprising any of SEQ ID NOs: 212-217.

[0059] The ssRNA binding protein as described herein may be a mammalian protein. The ssRNA binding protein as described herein may be a human protein.

[0060] The ssRNA binding protein may be 46 amino acids in length, or less. The ssRNA binding protein may be 5 kDa in size, or less.

[0061] The ssRNA binding protein or domain as described herein may be a mammalian protein. The ssRNA binding protein or domain as described herein may be a human protein. In one embodiment, the ssRNA binding domain or protein may be humanised.

[0062] The RNA hairpin loop binding domain

[0063] In one embodiment, the RNA hairpin loop binding domain is an RNA hairpin loop binding protein. The skilled person will recognise that an RNA hairpin loop binding protein is a protein comprising a domain that is capable of binding to an RNA hairpin loop. The RNA hairpin loop binding protein may be matched to the gRNA, such that it is capable of binding to the hairpin loop of the gRNA, for example as described herein.

[0064] The RNA hairpin loop binding protein may comprise human hairpin-binding protein U1 A (TBP 6.7), or the RNA hairpin loop binding domain thereof. In an embodiment wherein TBP 6.7 is the RNA hairpin binding protein, the gRNA may comprise the HIV transactivation response (TAR) hairpin.

[0065] The RNA hairpin loop binding protein, or domain thereof, as described herein may be mammalian. The RNA hairpin loop binding protein, or domain thereof, as described herein may be human, or humanised. The RNA hairpin loop binding protein or domain may be about 102 amino acids in length, or less. In another embodiment, the RNA hairpin loop binding protein or domain may be about 12 kDa in size, or less.

[0066] The RNA hairpin loop binding protein or domain may comprise or consist of the sequence of SEQ ID NO: 180. The RNA hairpin loop binding protein or domain may be translated from nucleotide sequences comprising any of SEQ ID NOs: 218-223.

[0067] Linkers

[0068] A first linker may be provided between the single-stranded RNA (ssRNA) binding protein or domain, and the RNA hairpin loop binding protein or domain.

[0069] A second linker may be provided between the effector protein and the RNA hairpin loop binding protein or domain. In an embodiment wherein the ssRNA binding domain and RNA hairpin loop binding domain are part of the same guided nucleic acid binding protein, a second linker may be provided between the effector protein and the guided nucleic acid binding protein.

[0070] Preferably the first and / or second linkers are peptides.

[0071] The first and / or second linkers may comprise the sequence (GGS)e (SEQ ID NO: 237). The first and / or second linkers may comprise the sequence SGSETPGTSESATPES (SEQ ID NO: 238). The first and / or second linkers may comprise a helical amino acid sequence. The first and / or second linkers may comprise the sequence EEEEKKKQQEEEAERLRRIQEEMEKERKRREEDEKRRRKEEEERRMKLEMEAK RKQEEEERKKREDDEKRKKK (SEQ ID NO: 239).

[0072] The first and / or second linkers may comprise a nuclear export sequence (NES), or more than one NES. The first and / or second linkers may comprise an HIV-derived NES. The first and / or second linkers may comprise a NES of general sequence LxxxLxxLxL (SEQ ID NO: 240), wherein “L” is a hydrophobic residue (to be chosen from the list consisting of Leu, He, Vai, Met, and Phe) and “x” is any other residue. The first and or / second linkers may comprise the sequence LPPLERLTLD (SEQ ID NO: 241). In a preferred embodiment, the first and / or second linkers comprise the sequence LQLPPLERLTL (SEQ ID NO: 242). In one embodiment, the second linker comprises the NES. Preferably, the second linker comprises a NES and GGS repeats, such as (GGS)e. In one embodiment, the first linker comprises or consists of the sequence (GGS)e and / or the second linker comprises or consist of the sequence GSLQLPPLERLTLGGSGGSGGSGGSGGSGGS (SEQ ID NO: 243).

[0073] The first and / or second linkers may comprise a nuclear localisation sequence (NLS), or more than one NLS. The first and / or second linkers may comprise an NLS of general sequence KyxK (SEQ ID NO: 244), wherein “K” is Lys, “y” is either Lys or Arg, and “x” is any other residue. The first and / or second linkers may comprise the sequence KRPAATKKAGQAKKKK (SEQ ID NO: 245). The first and / or second linkers may be sufficiently long to avoid steric inhibition between the molecules of the molecular complex. The first and / or second linkers may be from 18 to 100 amino acids in length. The first and / or second linkers may be from 50 to 100 amino acids in length. In an alternative embodiment, the first and / or second linkers may be from 18 to 32 amino acids in length. In one embodiment, the first linker may be about 54 amino acids in length and the second linker may be about 93 amino acids in length.

[0074] The molecular complex

[0075] The molecular complex may comprise a fusion protein comprising the following components in the N- to C-terminal direction: the single-stranded RNA (ssRNA) binding protein; the RNA hairpin binding protein; and the effector protein capable of modifying RNA.

[0076] In another embodiment, the molecular complex may comprise a fusion protein comprising the following components in the N- to C-terminal direction: the guided nucleic acid binding protein, comprising the single-stranded RNA

[0077] (ssRNA) binding domain and the RNA hairpin binding domain; and the effector protein capable of modifying RNA.

[0078] The molecular complex may comprise a fusion protein comprising the following components in the N- to C-terminal direction: the single-stranded RNA (ssRNA) binding protein; a first linker; the RNA hairpin binding protein; a second linker; and the effector protein capable of modifying RNA.

[0079] In another embodiment, the molecular complex may comprise a fusion protein comprising the following components in the N- to C-terminal direction:

[0080] The guided nucleic acid binding protein, comprising the single-stranded RNA (ssRNA) binding domain and the RNA hairpin binding domain; a linker; and the effector protein capable of modifying RNA.

[0081] The linker may be in accordance with the second linker herein described.

[0082] The fusion protein of the molecular complex may have the sequence of SEQ ID NO: 183. The fusion protein of the molecular complex may be translated from nucleotide sequences comprising any of SEQ ID NOs: 207-211 and 230.

[0083] In one embodiment, the molecular complex may be between about 30 and 60 kDa in size. In one embodiment, the molecular complex is about 41 kDa in size. The molecular complex may be less than 185 kDa in size. In another embodiment, the molecular complex may be about 370 kDa in size. In one embodiment, the molecular complex comprises the CIRTS complex described in Rauch et al., (Cell, Volume 178, Issue 1, 2019, Pages 122-134.el2, ISSN 0092-8674, https: / / doi.Org / 10.1016 / i.cell.2019.05.049) or W02020142676 Al, which are herein incorporated by reference. In one embodiment, the molecular complex comprises an effector protein; a RNA hairpin binding protein; a single-stranded RNA (ssRNA) binding protein; and linkers as described in Rauch et al., (Cell, Volume 178, Issue 1, 2019, Pages 122-134.el2, ISSN 0092-8674, https: / / doi.Org / 10.1016 / i.cell.2019.05.049) or

[0084] W02020142676 Al. The gRNA may be provided for use with such CIRTS components in accordance with the invention herein.

[0085] Other Aspects

[0086] According to another aspect of the invention, there is provided a composition of molecular complexes according to the invention herein, wherein two or more molecular complexes may comprise different gRNAs (i.e. each targeting different sequences described herein).

[0087] According to another aspect, the invention provides a nucleic acid encoding the molecular complex of the invention.

[0088] According to another aspect, the invention provides a nucleic acid encoding the fusion protein described herein, and optionally the gRNA described herein. The nucleic acid according to the invention may comprise or consist of a sequence of SEQ ID NO: 184.

[0089] The nucleic acid according to the invention may be a vector, such as a viral vector. The nucleic acid according to the invention may comprise or consist of a sequence of SEQ ID NO: 185.

[0090] The nucleic acid according to the invention may comprise or consist of a sequence of SEQ ID NO: 368. The nucleic acid according to the invention may comprise or consist of a sequence of any of SEQ ID NOs: 365-368. The the skilled person will recognise that these sequences have been optimised for expression efficiency, such as being GA- optimised. The nucleic acid according to the invention may comprise or consist of a sequence of any of SEQ ID NOs: 185 and 365-368.

[0091] The nucleic acid or vector described herein may further comprise one or more promoters. The promoter may comprise a human polymerase III promoter, such as U6, 7SK, Hl, or U3. The promoter may comprise a CMV, 7SK, Hl, U3, or a U6 promoter. The promoter may comprise a T7 or Sp6 promoter, for example for in vitro transcription. In one embodiment, the promoter comprises U6. The promoter may be a universal promoter (e.g. not tissue or cell specific). In another embodiment, the promoter may be tissue or cell specific, such as a neuronal specific promoter. In one embodiment, the promoter may comprise a pan-neuronal promoter such as human synapsin promoter.

[0092] The vector described herein may be any suitable viral vector, such as a lentiviral vector or AAV vector. In a preferred embodiment, the vector described herein is an AAV vector. The AAV may be any one of the serotypes 1 to 9. In one embodiment, the AAV is serotype 2 (AAV2). In another embodiment, the AAV is serotype 9 (AAV9). According to another aspect, the nucleic acid or vector described herein may comprise a number of gRNAs. The gRNAs may have identical sequences. Alternatively, the gRNAs may have different sequences. For example, one of the gRNAs of the nucleic acid or vector may be designed to target a different transcript to, or a different variant of a transcript from, that which is targeted by another gRNA of the nucleic acid or vector. Only one of these gRNAs may be preceded by a promoter. Alternatively, each of these gRNAs may be immediately preceded by a promoter. In embodiments where each gRNA is immediately preceded by a promoter, all these promoters may have identical sequences. Alternatively, each of these gRNAs may be immediately preceded by different promoter sequences.

[0093] The person skilled in the art will understand that the nucleic acid or vector described herein may encode all components of the molecular complex, or may alternatively encode only some components of the molecular complex. In embodiments wherein not all components of the molecular complex are encoded by the nucleic acid or vector described herein, the other components of the molecular complex (that is, the components of the molecular complex that are not encoded by the nucleic acid or vector) are supplied separately, either beforehand, concurrently, or afterwards. In another embodiment, the components of the molecular complex that are not encoded by the nucleic acid or vector are supplied in their protein form. By way of non-limiting example, in one embodiment, the gRNA is encoded by the nucleic acid or vector described herein, whereas the effector protein, the RNA hairpin binding domain and the ssRNA binding are concurrently delivered in their protein form.

[0094] Vectors

[0095] The viral vector for nucleic acid expression of the gRNA may be any suitable viral vector that can be used to deliver genetic material to the cells of interest. In one embodiment, the viral vector is adeno-associated virus (AAV) vector. The AAV may be a self- complementary AAV (scAAV) or single-stranded (ssAAV).

[0096] Advantageously, AAV is a virus that is not known to result in human disease and it cannot replicate in the body without further assistance. This allows safe and precise control of dosing. scAAV allows more efficient infection and can increase and prolong transgene expression, as well as providing a higher in vivo DNA stability and more effective circularization. The skilled person will be familiar with studies of such vectors, such as Rahim, Ahad A., et al. (The FASEB Journal 25.10 (2011): 3505-3518), which is herein incorporated by reference.

[0097] The viral vector for expression of gRNA may comprise or consist of the sequence of SEQ ID NO: 185. The AAV vector of SEQ ID NO: 185 may be modified with the insertion of alternative or additional gene sequences for the gRNA, and optionally a suitable number of alternative promoter sequences, such as a muscle specific sequence. The viral vector of SEQ ID NO: 185 may be modified to replace the antibiotic resistance gene sequence with an alternative marker, such as a kanamycin resistance gene coding sequence. The viral vector may be packaged into a viral particle. The AAV plasmids may be packaged into AAV, such as AAV serotype 8. Other serotypes such as AAV9, AAV1, AAV2, rAAVrhS, AAV-PhPb or AAV-PhPeb or rAAVrh?4, or AAV-F may be used as an alternative. Additionally, other serotypes may be selected from AAV5, 6, 7, AAVancSO, AAVrh.10, AAV8, AAV-DJ, AAV-BI30, AAV- BI-hTFRl.

[0098] The the viral vector may comprise AAV9. Alternatively, the the viral vector may comprise AAV-F. In one embodiment, the viral vector may comprise AAV9 used in combination with gRNA9. In another embodiment, the viral vector may comprise AAV9 used in combination with gRNA21. In another embodiment, the viral vector may comprise AAV-F used in combination with gRNA9. In another embodiment, the viral vector may comprise AAV-F used in combination with gRNA21.

[0099] Compositions

[0100] According to another aspect of the present invention, there is provided a composition comprising the molecular complex, nucleic acid, or viral vector according to the invention, and a carrier.

[0101] The carrier may be a pharmaceutically acceptable carrier. The carrier may comprise one or more pharmaceutically acceptable excipients. The carrier may comprise or consist of saline.

[0102] Treating Dravet Syndrome

[0103] According to another aspect of the present invention, there is provided the molecular complex according to the invention for use as a medicament.

[0104] According to another aspect, the invention provides the molecular complex described herein for use in treating Dravet Syndrome in a subject.

[0105] According to another aspect, the invention provides a method of treatment for Dravet Syndrome in a subject wherein the method comprises the administration of the molecular complex of the invention, the nucleic acid of the invention, the composition of the invention, the viral particle of the invention, or the composition of the invention.

[0106] Preferably, the subject is human. The complex for use described herein may be given to a subject wherein the subject is male or female. In one embodiment, the subject to be treated may be a child diagnosed with Dravet Syndrome, for example a child from 0.6 to 5 years of age. In another embodiment, the subject to be treated may be a child diagnosed with Dravet Syndrome in their first year of life.

[0107] The treatment may be a single dose treatment.

[0108] The treatment may be delivered by intravenous infusion. The treatment may be delivered by neurosurgical stereotactic intracerebroventricular delivery or intrathecal delivery. The subject be a child aged at least, 6 months, 9 months, 12 months, 18 months, 24 months, 3 years, 4 years, 5 years, of age.

[0109] The complex described herein could typically be administered intravenously, and / or via the intracerebroventricular route.

[0110] The methods of this invention may be practiced using any mode of administration that is medically acceptable, and produces effective levels of the active compounds without causing clinically unacceptable adverse effects. Such modes of administration include, but are not limited to, oral, buccal, sublingual, inhalation, mucosal, rectal, intranasal, topical, ocular, periocular, intraocular, transdermal, subcutaneous, intra-arterial, intravenous, intracerebroventricular, intramuscular, parenteral, or infusion methodologies. In another embodiment, such modes of administration include, but are not limited to, oral, buccal, sublingual, inhalation, mucosal, rectal, intranasal, topical, ocular, periocular, intraocular, transdermal, subcutaneous, intra-arterial, intrathecal, intrathalamic, intravenous, intracerebroventricular, intramuscular, parenteral, or infusion methodologies. In a specific embodiment, it may be desirable to administer the pharmaceutical complexes of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion, by injection, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibres.

[0111] Other diseases

[0112] According to another aspect, the invention provides the molecular complex or composition described herein for use in treating a subject that would benefit from an increase in SCN1A levels and / or an increase in Navi .1 levels, such as subjects with known genetic-driven reduction in SCN1A levels and / or Nav1.1. levels.

[0113] According to another aspect, the invention provides a method of treatment of a subject that would benefit from an increase in SCN1A levels and / or an increase in Nav1.1. levels, wherein the method comprises the administration of the molecular complex of the invention, the nucleic acid of the invention, the composition of the invention, the viral particle of the invention, or the composition of the invention.

[0114] The molecular complex described herein may be used in treating genetic epilepsy with febrile seizures plus (GEFS+), Doose Syndrome, epilepsy of infancy with migrating focal seizures (EIMFS), West Syndrome, Lennox-Gastaut Syndrome (LGS), Rett Syndrome, and nonsyndromic epileptic encephalopathy (NEE), hemiplegia migraine, autism spectrum disorder (ASD), sudden death, sudden unexpected death in epilepsy (SUDEP), nonepileptic SCN1A -related sudden death, or arthrogryposis multiplex congenita (AMC).

[0115] The invention herein may be used in the preparation of a medicament for the treatments described herein.

[0116] The skilled person will recognise that the molecular complex of the invention, the nucleic acid of the invention, the composition of the invention, the viral particle of the invention, or the composition of the invention may be provided in a therapeutically effective amount. For example, the skilled person is capable of adapting the concentration and total amount of the molecular complex of the invention, the nucleic acid of the invention, the composition of the invention, the viral particle of the invention, or the composition of the invention for an appropriate dosage to therapeutically improve the subject’s condition. Such concentrations and / or dosage may as used in the mouse model examples herein, which may be translated to human as appropriate. Such concentrations and / or dosage may be more or less than as used in the mouse model examples herein, which may be translated to human as appropriate.

[0117] Definitions

[0118] As used herein, the term gRNA refers to a section of RNA that comprises a stretch of nucleotides that is complementary to a target region and is capable of annealing to that target region.

[0119] As used herein, the term IncRNA refers to a section of RNA that is over 200 nucleotides in length that is non-coding but has a role in modulating gene transcription, post transcriptional regulation and in epigenetic regulation.

[0120] As used herein, the term effector protein refers to a protein that forms a CIRTS complex and acts on the target, SCN1ANAT, or recruits enzymes capable of acting on the target, in order to inhibit its activity or facilitate its degradation. For example, an effector protein may recruit (e.g. bind to) an enzyme having deadenylation or nuclease activity on the target RNA.

[0121] The term “modifying” herein may refer to editing, including nucleotide additions, deletions or substitutions, and molecular modifications such as methylation. Modification may include direct or indirect (e.g. via a recruited effector enzyme) degradation of a nucleotide sequence.

[0122] As used herein, the term ssRNA binding protein refers to a single-stranded RNA binding protein that facilitates the binding between the gRNA and the target sequence.

[0123] As used herein, the term vector refers to a nucleic acid that encodes at least i) one of the components of the the complex required for CIRTS RNA editing, and ii) a promoter.

[0124] Variants of the described amino acid sequences / proteins or nuceleic acids may be contemplated. The skilled person will understand that one or more amino acid residue or nucleotide substitutions, deletions or additions, may be tolerated, optionally two substitutions may be tolerated in a sequence, such that it maintains its function. The skilled person will appreciate that 1, 2, 3, 4, 5 or more amino acid residues or nucleotides may be substituted, added or removed without affecting function. References to sequence identity may be determined by BLAST sequence alignment (www.ncbi.nlm.nih.gov / BLAST / ) using standard / default parameters. For example, the sequence may have 99% identity and still function according to the invention. In other embodiments, the sequence may have 98% identity and still function according to the invention. In another embodiment, the sequence may have 95% identity and still function according to the invention. In another embodiment, the sequence may have 90%, 85%, or 80% identity and still function according to the invention. In one embodiment, the variation and sequence identity may be according the full length sequence. In other embodiments, the variation may be limited to non-conserved sequences and / or sequences outside of active sites, such as binding domains. Therefore, an antibody site or binding site of a protein may be 100% identical, whereas the flanking sequences may comprise the stated variations in identity. Such variants may be termed “conserved active site variants”.

[0125] Amino acid substitutions may be conservative substitutions. For example, a modified residue may comprise substantially similar properties as the wild-type substituted residue. For example, a substituted residue may comprise substantially similar or equal charge or hydrophobicity as the wild-type substituted residue. For example, a substituted residue may comprise substantially similar molecular weight or steric bulk as the wild-type substituted residue. With reference to “variant” nucleic acid sequences, the skilled person will appreciate that 1, 2, 3, 4, 5 or more codons may be substituted, added or removed without affecting function. For example, conservative substitutions may be considered. Variant nucleic acid sequences may also be varied by codon degeneracy, whilst still encoding the same amino acid residue.

[0126] The skilled person will recognise that features of one aspect or embodiment described herein may be used with any other aspect or embodiment described herein.

[0127] Embodiments of the invention will now be described in more detail, by way of example only, with reference to the accompanying drawings.

[0128] Brief description of the Figures

[0129] Figure 1. A diagram from Rauch et al., (Cell, Volume 178, Issue 1, 2019, Pages 122-134.el2, ISSN 0092-8674, https: / / doi.Org / 10.1016 / i.cell.2019.05.049) showing the key components of a CIRTS system, the effector protein, the gRNA, the ssRNA binding protein, and the RNA hairpin binding protein. The diagram also shows how these components interact with the target RNA.

[0130] Figure 2. A schematic showing the hybridisation of Senia IncRNA to Senia mRNA, which results in reduction of translation and expression of the latter.

[0131] Figure 3. A diagram showing the structure of the Senia IncRNA, with the binding sites of gRNAs 1-21 highlighted.

[0132] Figure 4. A diagram showing a typical plasmid encoding CIRTS machinery and gRNA (contains gRNA 9 for reference). The CIRTS machinery comprises 0- defensin 3, TBP6.7 and YTHDF2, and expression is controlled by a CMV promoter. While the hairpin binding protein (TAR), linker and Scnlanat specific gRNA are controlled by a U6 promoter.

[0133] Figure 5. A - Shows in vitro validation of the CIRTS machinery in a proof-of- concept study demonstrating that a 39% reduction in luciferase expression was observed following RNA editing in the luciferase reporter gene when HEK293T cells were co-transfected with a luciferase-encoding plasmid and a CIRTS plasmid with luciferase targeting gRNA (SEQ ID NO: 372). Statistical significance was calculated using a one-way ANOVA. B - The same study showing individual data points and statistical significance calculated using an unpaired, two-tailed t-test

[0134] Figure 6. A - This figure shows in vitro validation of all 21 gRNA designs where plasmids were transiently transfected onto differentiated populations of mouse Neuro2a neuronal cells. gRNA constructs 8, 9, 11, 15 and 21 showed a significant fold increase in Senia mRNA expression. 3 replications of 6 wells for gRNAs 1- 13, 15, 18 and 21, remaining gRNAs one replication of 6 wells. The gRNA have been placed in order of homology to human SCN1ANAT. The percentage homology for gRNA constructs 8, 9, 11, 15 and 21 are included in the figure. Data were analysed using one-way ANOVA with multiple comparisons. B - This figure shows the same data as 6 A, with additional replicates. gRNA constructs 9, 11, 15 and 21 showed a significant fold increase in Senia mRNA expression. The gRNA have been placed in order of homology to human SCN1ANAT. The percentage homology for gRNA constructs 9, 11, 15 and 21 are included in the figure. Data were analysed using one-way ANOVA with multiple comparisons.

[0135] Figure 7: Data showing in vivo longitudinal dosage study where AAV9- and AAV-F-CIRTS-Scn1anat-9 or -21 were injected to new-born heterozygous Dravet Syndrome mice via ICV & IV delivery. This study is still in life and (A) so far there is 77% survival of AAV-F-CIRTS-Scn1anat-9 (2el2 vg / ml) treatment group over 100 days of development and 50% of AAV-F- Scnlanat -9 (5e11 vg / ml) over 65 days. AAV-F-CIRTS-Scn1anat-9 (2el l vg / ml) treatment group showed a survival of 100% up to 20 days of development, after which these mice were subjected to thermal induced seizures and culled after. Whereas, AAV9- CIRTSScn1anat -21(lel4 vg / ml) has 100% survival up to 98 days of development and AAV9-CIRTS- Scn1anat -21 (2e13 vg / ml) has 50% survival up to 100 days. AAV9-CIRTS-Scnlanat-9 (2e13 vg / ml) has shown 0% survival over 100 days. 36% survival of PBS treated heterozygous mice over 100 days. Kaplan- Meier test was used. (B) Clinically relevant thermal induced seizure readout showed that the treatments groups had a reduced sensitivity to thermal induced seizures when compared to untreated heterozygous mice. Kaplan-Meier test was used. (C) The durations of seizures showed a trend towards wild-type mice in the treatment groups. One-way ANOVA, multicomparison was used. (D) ddPCR was conducted on AAV-F-CIRTS-Scn1anat-9 (2el2 vg / ml) and AAV-F-CIRTS- Scnlanat-9 (2el l vg / ml) treatment groups and the results showed a significant increase in endogenous Senia compared to untreated heterozygous mice. Oneway ANOVA, multicomparison was used.

[0136] Figure 8- Data showing the same in vivo longitudinal dosage study as Figure 7, but with additional data points in a longer follow up. (A) AAV9-CIRTS- Scnlanat-21 (le14vg / ml) had a 100% survival at PlOO (P=0.09), AAV9-CIRTS- Scnlanat-21 (2e13vg / ml) had a 50% survival at P100 (P=0.29) and AAV9- CIRTS-Scn1anat-9 (2e13vg / ml) showed an overall survival of 26.5% (P=0.82). 36.4% survival of PBS treated heterozygous mice at 100 days of age. Kaplan- Meier test was used with Log-rank Mantel-Cox statistical analysis. Only one dose of AAV9-CIRTS-Scn1anat -9 was tested and resulted in the lowest survival. Future studies, would require further doses to be tested with a larger n number. (B) AAVF-CIRTS-Scn1anat -9 (2el2vg / ml) showed an overall survival of 71.4% (P=0.07), AAVF-CIRTS-Scn1anat -21 (2el2vg / ml) had a 12.5% survival at P100 (P=0.05). Further doses of AAVF-CIRTS-Scn1anat-9 at 2el lvg / ml, 5el lvg / ml and 5el2vg / ml revealed 44% (P=0.58), 44% (P=0.86) and 65.5% (P=0.07) survival at 100 days of age, respectively. 36.4% ofPBS treated heterozygous mice survived to 100 days of age. Only one dose of AAVF-CIRTSScn1anat -21 was tested and resulted in the lowest survival. Future studies, would require further doses to be tested with a larger n number. Kaplan-Meier test was used with Logrank Mantel-Cox statistical analysis. (C) Open field analyses did not reveal any hyperactivity in any tested dose of AAVF-CIRTS-Scn1anat-9 . Data were analysed using one-way ANOVA with multiple comparisons.

[0137] Figure 9.A-D. An enlarged view of Figure 3.

[0138] Figure 10. Clinically relevant febrile seizure readout showed that (A) AAV9- treated mice, showed reduced sensitivity to febrile seizures. Although AAV9- CIRTS-Scn1anat-9 demonstrated the lowest survival, the febrile seizures were reduced in this group compared to PBS heterozygous controls. (B) AAVF-treated mice had a reduced sensitivity to thermal induced seizures when compared to PBS treated heterozygous mice. (C and D) Electroencephalogram (EEG) data showing a reduction in spontaneous seizures in the AAVF-CIRTS-Scn1anat-9 treatment group compared to mice treated with a non-targeting AAVF-CIRTS-luciferase vector. Statistical significance was calculated using an unpaired, two-tailed t-test.

[0139] Examples

[0140] Example 1

[0141] Design of ssRNA gRNAs

[0142] The Scnlanat target sequence was inputted into sOligo software (https: / / sfold.wadsworth.org / cgi-bin / soligo.pl), varying the parameter for gRNA length. Folding temperature was set to 37°C and ionic conditions set to IM NaCl with no divalent ions. Resulting outputs were screened forthose with less than -8.0 Gibbs free energy with positional clusters identified. Potential gRNA sequences were manually mapped to RNA secondary structures produced using mFold software (http: / / www.unafold.org / mfold / applications / rna-folding-form.php) to determine qualities of each gRNA such as the number of termini and percentage of gRNA sequence in open conformation.

[0143] Validation of gRNAs gRNA sequences were cloned into the plasmid of SEQ ID NO: 231. This plasmid was transiently transfected into differentiated Neuro2a cells (7DIV; DMEM, 2% FBS, 1% pen / strep, 0.5mM Cyclic AMP, 20pM Retinoic acid) using Lipofectamine 2000 (DNAdipofectamine ratio = 0.8pg:2pl per replicate). 5 days post-transfection cells were harvested, RNA extracted and cDNA synthesised. Endogenous Senia was analysed by RT-qPCR and normalised to endogenous Gapdh. The AACt method was used to determine Senia fold change to GFP-transfected controls.

[0144] Vector design

[0145] The AAV-CIRTS plasmid was obtained from Bryan Dickinson’s team (University of Chicago). We then inserted the gRNA to this plasmid by routine cloning methods.

[0146] Longitudinal survival study

[0147] CIRTS-Scn1anat-9 and -21 was packaged into Adeno-associated viral vectors with the traditional serotype 9 and a recently discovered capsid, AAV-F, that transduces the CNS with higher efficiency than AAV9, used in this study. This study is still in life and so far there is 77% survival of AAV-F-CIRTS-Scn1anat-9 (2e12 vg / ml) treatment group over 100 days of development and 44% of AAV-F-CIRTS-Scn1anat-9 (5e11 vg / ml) over 97 days. AAV-F-CIRTS-Scn1anat-9 (2el l vg / ml) treatment group showed a survival of 100% up to 20 days of development, after which these mice were subjected to thermal induced seizures and culled after. Whereas, AAV9-CIRTSScn1anat -21 (1e14 vg / ml) has 100% survival up to 98 days of development and AAV9-CIRTSScn1anat -21 (2e13 vg / ml) has 50% survival up to 100 days. AAV9-CIRTS-Scn1anat-9 (2e13 vg / ml) has shown 0% survival over 100 days. 36% survival of PBS treated heterozygous mice over 100 days. Kaplan-Meier test was used.

[0148] Target Treatment Profile Product Properties Acceptable Results Desirable Results

[0149] Primary Product Patients clinically Patients clinically diagnosed Indication diagnosed with Dravet with Dravet Syndrome. Cure Syndrome. Improved in patients treated with gene quality of life in Dravet therapy soon after diagnosis. patients treated with gene therapy soon after diagnosis.

[0150] Patient population Children diagnosed with Children diagnosed with Dravet Syndrome (0.6-5 Dravet Syndrome in the first years of age). year of life.

[0151] Treatment Duration Single dose treatment, long-lasting. Delivery Mode Neurosurgical stereotactic Intracerebroventricular and intravenous infusion.

[0152] Dosage Form AAV Viral vector suspension. Patients will receive a AAV dose determined by this pre-clinical efficacy study.

[0153] Regimen Neurosurgical delivery by intracerebroventricular and intravenous infusion. Efficacy The acceptable endpoint The ideal efficacy for will be safety of AAV via patients to be treated as early intracerebroventricular as possible soon after and intravenous delivery, diagnosis to prevent with ! symptoms. Gene therapy to reduction in seizure demonstrate efficacy on frequencies, disease progression, result in improvement in freedom from seizures, development and quality improvement in of life, compared to development and quality of natural history studies. life, compared to natural history studies. No need for anti-epileptic drugs.

[0154] Risks / Side Effects This AAV mediated RNA editing therapy is expected to increase the human Nav1.1. expression. Acceptable sideeffect profile that results in overall improvement in quality of life.

[0155] Therapeutic modality Dravet RNA editing treatment is a medicinal product which expresses an gRNA sequence to increase and restore the expression of Nav1.1.. It is incorporated into an Adeno-associated virus (AAV).

[0156] Example 2

[0157] Design of ssRNA gRNAs

[0158] As per Example 1.

[0159] Validation of gRNAs

[0160] As per Example 1.

[0161] Vector design

[0162] As per Example 1.

[0163] Longitudinal survival study

[0164] With reference to Figure 8, this longitudinal survival study is a continuation of the Example 1 study with further data points and insight. CIRTS-Scn1anat-9 and -21 were packaged into AAV9 and a recently discovered capsid, AAV-F, that transduces the CNS with higher efficiency than AAV9, used in this study. AAV9-CIRTSScn1anat -21 (lel4vg / ml) had a 100% survival at P100 (P=0.09), AAV9-CIRTS- Scnlanat-21 (2e13vg / ml) had a 50% survival at P100 (P=0.29) and AAV9-CIRTS-Scn1anat-9 (2e13vg / ml) showed an overall survival of 26.5% (P=0.82). AAVF-CIRTS-Scn1anat-9 (2el2vg / ml) showed an overall survival of 71.4% (P=0.07), AAVF-CIRTS- Scnlanat-21 (2el2vg / ml) had a 12.5% survival at P100 (P=0.05). Further doses of AAVF-CIRTS- Scnlanat-9 at 2el lvg / ml, 5el lvg / ml and 5el2vg / ml revealed 44% (P=0.58), 44% (P=0.86) and 65.5% (P=0.07) survival at 100 days of age, respectively. 36.4% survival of PBS treated heterozygous mice at 100 days of age.

[0165] Target Treatment Profile

[0166] As per Example 1.

[0167] All-in-one Cas13d plasmid production:

[0168] To examine CRISPR / Cas ribonucleases, as a benchmark for RNA targeting applications in comparison to the CRISPR-Cas Inspired RNA Targeting System (CIRTs) technology. An all-in-one Cas13d construct was sub-cloned, this molecular complex requires: a) A SgRNA comprising a 30nt 5’ Direct Repeat (DR) and a Spacer of between 14- 30 nucleotides of length. The spacer being complementary to a ssRNA target of interest. b) A catalytically active Cas13d Effector, comprising two higher eukaryotes and prokaryotes nucleotide (HEPN) binding domains, which when bound to complementary ssRNA targets confer RNAse activity.

[0169] To achieve this “pXR003” (Addgene: #109053) and “pXROOl” (Addgene: #109049), were procured (Konermann et al, 2017).

[0170] From the pXR003 plasmid, a U6 promoter, a 5’ RfxCas13d 30 nucleotide direct repeat (3 Ont DR) and a poly ‘T’ terminator sequence were liberated. Importantly, two type IIS BbsI endonuclease restriction sites flank the 5’ 30nt DR and 3’ poly ‘T’ terminator sequence, enabling a spacer sequence to be sub-cloned contiguous to these two components.

[0171] From the pXROOl plasmid, an EFla promoter, RfxCas13d effector, SV40 Nuclear Localisation Signal, HA tag, T2A Linker, eGFP and Woodchuck Heptatitis Virus (HPV) Posttranscriptional Regulatory Element (WPRE) sequence were liberated. Notably, a single nucleotide point mutation was introduced into the WPRE to remove an endogenous BbsI endonuclease restriction site, which otherwise would have proven inhibitory to Cas13d SgRNA sub-cloning.

[0172] The ‘pCI’ plasmid backbone, had a multiple cloning site engineered to facilitate the directional sub-cloning of the two sequences described above. This enabled the production of the plasmid “pCI-U6-30ntDR-5’BbsI-3’BbsI-Poly ‘T’-Ef1α-RfxCas13d- Sv40NLS-HA-T2A-eGFP-WPRE” referred to as pCI-U6-sgRNA-EFla-Cas13d-eGFP or Cas13d all-in-one construct for simplicity. The SNP introduced to the WPRE sequence, meant the two type IIS BbsI restriction endonuclease sites could be utilised without compromising the plasmid construction. This enabled spacer sequences to be ordered as two complementary single stranded oligonucleotides, hybridised in a high salt buffer, and introduced between the 3 Ont DR and Poly ‘T’ terminator sequence. Thus the sequence driven by the human U6 promoter is a continuous single guide RNA sequence. Cas13d SgRNA designs:

[0173] Design of Cas13d SgRNAs was undertaken using “Cas13 Design: A flexible tool to design Cas13d guide RNAs” [Online Resource: https: / / casl3design.nygenome.Org / # last accessed 01.01.2024],

[0174] To identify suitable Cas13d spacers, the firefly luciferase reporter and mouse Scnlanat sequences were divided into sequential 500 nucleotide fragments (e.g. 0-500bps, 500- 1000bps), a requirement due to the maximal sequence input of the guide design tool.

[0175] The Cas13d sgRNAs ranked highest for each 500bp fragment were ordered as oligonucleotides with overhangs defined by the BbsI sites, to facilitate the sub-cloning into the pCI-U6-sgRNA-EFla-Cas13d-eGFP generated.

[0176] This tool predicts Cas13d guides based upon numerous parameters from the following publications:

[0177] Massively parallel Cas13 screens reveal principles for guide RNA design Hans-Hermann Wessels*, Alejandro Mendez-Mancilla*, Xinyi Guo, Mateusz Legut, Zharko Daniloski, Neville E. Sanjana

[0178] Transcriptome-wide Cas13 guide RNA design for model organisms and viral RNA pathogens

[0179] Xinyi Guo, Jahan Rahman, Hans-Hermann Wessels, Alejandro Mendez-Mancilla, Daniel Haro, Xinru Chen, Neville E. Sanjana

[0180] The predicted optimal Cas13d sgRNAs and CIRTs SgRNAs were sub-cloned into the Cas13d All-in-one construct, to examine the efficacy of these two RNA targeting systems in parallel.

[0181] References:

[0182] Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD. (2018) Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors Cell. pii: S0092-8674(18)30207-1. doi: 10.1016 / j.cell.2018.02.033.

[0183] 10.1016 / j.cell.2018.02.033 PubMed 29551272

[0184] Hans-Hermann Wessels*, Alejandro Mendez-Mancilla*, Xinyi Guo, Mateusz Legut, Zharko Daniloski, Neville E. Sanjana (2020) Massively parallel Cas13 screens reveal principles for guide RNA design, Nature Biotechnology. Xinyi Guo, Jahan Rahman, Hans-Hermann Wessels, Alejandro Mendez-Mancilla, Daniel Haro, Xinru Chen, Neville E. Sanjana (2021) Transcriptome- wide Cas13 guide RNA design for model organisms and viral RNA pathogens, Cell Genomics.

[0185] SEQUENCES Targeted IncRNA sequences

[0186] Targeted Scnlanat RNA sequence regions

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194] Whole gRNA molecule sequences

[0195]

[0196] In the ensuing vector sequences (SEQ ID NOs: 185 and 231), the marker gene is an ampicillin (Amp) resistance gene, and is in underlined typeface. In alternative embodiments, the Amp resistance gene may be replaced with at least one alternative marker gene, such as a kanamycin (Kan) resistance gene.

[0197] Backbone sequence (ie ITR to ITR; SEQ ID NO: 185 minus SEQ ID NO: 184) (begins immediately after polyT terminator at 3’ of gRNA, ends immediately before the CMV promoter) (SEQ ID NO: 231)

[0198] Full CIRTS vector sequence with gRNA9 and GA-optimised β-defensin 3 (SEQ ID NO: 365):

[0199]

[0200] Full CIRTS vector sequence with gRNA9 and GA-optimised TBP 6.7 (SEQ ID NO: 366):

[0201]

[0202] Full CIRTS vector sequence with gRNA9 and GA-optimised YTHDF2 (SEQ ID NO: 367): Full CIRTS vector sequence with gRNA9 and GA-optimised molecular subcomplex (SEQ ID NO: 368):

[0203] Full CIRTS vector sequence with luciferase-gRNA and GA-optimised β-defensin 3 (SEQ ID NO: 369):

[0204]

[0205] Full CIRTS vector sequence with luciferase-gRNA and GA-optimised YTHDF2 (SEQ ID NO: 371):

[0206] Full CIRTS vector sequence with luciferase-gRNA and GA-optimised molecular subcomplex (SEQ ID NO: 372):

[0207] Mouse Scn1anat full sequence

[0208] Human SCN1ANAT full sequence

[0209] This is 1123 nucleotides in length, in comparison to mouse Scnlanat which is 607 nucleotides in length.

[0210] Region of Human SCN1ANAT sequence that is equivalent to region spanning mouse guides 14 - 21

Claims

CLAIMS1. A molecular complex for targeting and modifying a Scn1anat long non-coding RNA (IncRNA), the molecular complex comprising: a. a guide RNA (gRNA) capable of sequence-specific binding to the Scn1anat ncRNA; and b. a molecular subcomplex comprising: i. an effector protein capable of modifying RNA; ii. a RNA hairpin loop binding domain or protein; and iii. a single-stranded RNA (ssRNA) binding domain or protein, wherein the gRNA, the effector protein, the RNA hairpin loop binding domain or protein, and the ssRNA binding domain or protein form a complex capable of binding to and modifying the SCN1ANAT IncRNA.

2. The molecular complex of claim 1, wherein the gRNA, the effector protein, the RNA hairpin loop binding domain or protein, and the ssRNA binding domain or protein are human.

3. The molecular complex of any previous claim, wherein the gRNA comprises a hairpin loop capable of binding to the RNA hairpin loop binding protein or domain.

4. The molecular complex of claim 3, wherein the gRNA further comprises a guide sequence fused to the hairpin loop, optionally via a linker.

5. The molecular complex of claims 3 or 4, wherein the hairpin loop comprises a human histone mRNA hairpin or a HIV TAR hairpin, or a variant thereof.

6. The molecular complex of any previous claim, wherein the gRNA binds to a target region on the target SCN1ANAT IncRNA comprising any one of the sequences of SEQ ID NO: 267-282 and 311-323, or a sequence having at least 80% identity thereto.

7. The molecular complex of any one of claims 4-6, wherein the gRNA comprises any one of the sequences according to SEQ ID NOs: 283-297 and 324-336.

8. The molecular complex of any previous claim, wherein the gRNA comprises a terminator sequence.

9. The molecular complex of any previous claim, wherein the effector protein comprises a deadenylation domain or a domain capable of recruiting a protein that has RNA- modifying capability.

10. The molecular complex of any previous claim, wherein the effector protein comprises the m6A binding domain of YTHDF or of YTHDF2, or a Pin nuclease domain, or a human nonsense-mediated mRNA decay factor SMG6 domain, or an ADAR protein or a poplypeptide thereof11. The molecular complex of any previous claim, wherein the ssRNA binding domain or protein and the RNA hairpin loop binding domain or protein comprise an RNA-guided RNAse.

12. The molecular complex of any previous claim, wherein the ssRNA binding domain or protein is an RNA Recognition Motif (RRM), a K homology (KH), a PUF, or a PPR, domain, or a homologue thereof.

13. The molecular complex of any previous claim, wherein the ssRNA binding domain or protein is a domain from the proteins PAPB, sex-lethal, HuD, hnRNP Al, nucl eolin, RNA stem-loops U1 A, U2B”, CCCH-type zinc fingers, CNBP, RBM7, U2AF2, CBX4, PNPT1, MBNL1, SUPV3L1, EIF4B, DHX8, FUS, PCBP1, SRP19, or homologues thereof14. The molecular complex of any previous claim, wherein the ssRNA binding domain or protein and the RNA hairpin loop binding domain or protein are fused together.

15. The molecular complex of any previous claim, wherein the ssRNA binding domain or protein comprises either the ssRNA binding domain of β-defensin 3, or heparin binding EGF like growth factor (HBEGF).

16. The molecular complex of any previous claim, wherein the RNA hairpin loop binding domain or protein comprises the RNA hairpin loop binding domain of human hairpinbinding protein U1 A (TBP 6.7), optionally wherein the gRNA comprises the HIV transactivation response (TAR) hairpin.

17. The molecular complex of any previous claim, wherein a first linker is provided between the ssRNA binding protein or domain, and the RNA hairpin loop binding protein or domain, optionally wherein a second linker is provided between the effector protein and the RNA hairpin loop binding protein or domain.

18. The molecular complex of claim 17, wherein the first and / or second linker comprise a nuclear export sequence (NES), or wherein the first and / or second linker comprise a nuclear localisation sequence (NLS).

19. The molecular complex of any preceding claim, wherein the molecular complex comprises a fusion protein comprising the following components in the N- to C-terminal direction: the ssRNA binding domain or protein; the RNA hairpin loop binding domain or protein; and the effector protein.

20. The molecular complex of any preceding claim, wherein the molecular complex comprises a fusion protein comprising the following components in the N- to C-terminal direction: the ssRNA binding domain or protein; a first linker; the RNA hairpin loop binding domain or protein;a second linker; and the effector protein.

21. A nucleic acid encoding the molecular complex of any previous claim, optionally wherein the nucleci acid is a viral vector.

22. The nucleic acid of claim 21, wherein the nucleic acid encodes more than one species of gRNA.

23. A composition of nucleic acids that encodes the molecular subcomplex of any previous claim, wherein the composition optionally also encodes the gRNA and / or one or more promoters.

24. The composition of claim 23, wherein the composition encodes more than one gRNA species.

25. A viral particle comprising the nucleic acid of claim 21 or 22.

26. A composition comprising the molecular complex of claims 1-20, the nucleic acid of claim 21 or 22, the composition of claims 23-24, or the viral particle of claim 25, and a carrier.

27. The molecular complex of claims 1-20, the nucleic acid of claim 21 or 22, the composition of claims 23-24, the viral particle of claim 25, or the composition of claim 26, for use as a medicament.

28. The molecular complex of claims 1-20, the nucleic acid of claim 21 or 22, the composition of claims 23-24, the viral particle of claim 25, or the composition of claim 26, for use in treating Dravet Syndrome in a subject.

29. The molecular complex of claims 1-20, the nucleic acid of claim 21 or 22, the composition of claims 23-24, the viral particle of claim 25, or the composition of claim 26, for use use in treating a subject that would benefit from an increase in SCN1A levels and / or an increase in Nav1.

1. levels.

30. A method of treatment for Dravet Syndrome in a subject, or treatment of a subject that would benefit from an increase in SCN1A levels and / or an increase in Nav1.

1. levels, wherein the method comprises the administration of the molecular complex of claims 1- 20, the nucleic acid of claim 21 or 22, the composition of claims 23-24, the viral particle of claim 25, or the composition of claim 26.

Images